Cheminformatics – Computergestützte Anwendungen in der Chemie

of 42 /42
BIOCHEMINFORMATICS Frank Oellien, 10.11.04 Intervet Innovation GmbH Schwabenheim Cheminformatics – Computergestützte Anwendungen in der Chemie Cheminformatics – Computergestützte Anwendungen in der Chemie

Embed Size (px)

Transcript of Cheminformatics – Computergestützte Anwendungen in der Chemie

  • BIOCHEMINFORMATICS

    Frank Oellien, 10.11.04Intervet Innovation GmbH

    Schwabenheim

    Cheminformatics ComputergesttzteAnwendungen in der Chemie

    Cheminformatics ComputergesttzteAnwendungen in der Chemie

  • BIOCHEMINFORMATICS

    Intervet Innovation GmbH bersicht Computergesttzte Wirkstoffforschung

    Computeranwendungen in der Chemie Die Natur der Molekle

    2D Strukturen 3D Strukturen Oberflchen und Eigenschaften Flexibilitt

    Online-Demos

    bersichtbersicht

  • BIOCHEMINFORMATICS

  • BIOCHEMINFORMATICS

    Akzo Nobels GeschftsbereicheAkzo Nobels Geschftsbereiche

    28%

    39%

    33%

    Pharma Coatings Chemicals

    Umsatz 2002 ca. 14.0 Milliarden Euro ()Ca. 68 000 Beschftigte in 80 Lndern

  • BIOCHEMINFORMATICS

    Forschung Produktion Forschung und Produktion

    16 Forschung

    19 Produktion

    58 Filialen

    5000 Beschftigte

    Intervets StandorteIntervets Standorte

  • BIOCHEMINFORMATICS

    2002 in m $ In % In mio $1 Pfizer (+ Pharmacia)* 1625 9.1 1352 Merial 1505 3.8 553 Intervet 1019 3.9 384 Bayer 736 4.3 305 Elanco 693 1.0 76 Schering-Plough 677 -2.4 -177 Fort Dodge 653 -15.8 -1238 Novartis 521 12.1 569 Virbac 333 11.3 34

    10 Alpharma 320 -4.0 -13

    * Proforma Ergebnis, unter der Annahme, da keine Produkte eingestellt werden

    Rang Firma Umsatz Zuwachs Per. 01/02

    Intervets WeltmarktplatzierungIntervets Weltmarktplatzierung

  • BIOCHEMINFORMATICS

    14%

    12%

    53%

    21%

    Europe USA and Canada Latin America Rest of World

    Ca. 1,081 Milliarden Euro ()

    Europa USA und Canada Lateinamerika brige Welt

    Intervets Verkauf 2002Intervets Verkauf 2002

  • BIOCHEMINFORMATICS

    49%

    13%

    12%

    17%

    9%

    Biologicals AntiparasiticsAntiinfectives Other PharmaceuticalsFeed Additives

    BiologikaAntiinfektivaFutter-Zusatzstoffe

    AntiparasitikaWeitere Pharmazeutika

    Produkt SegmenteProdukt Segmente

  • BIOCHEMINFORMATICS

    PanacurBreitband Anthelmintikum mit einem herausragenden Sicherheitsprofil fr die Verwendung in allen Tieren.

    PanacurBreitband Anthelmintikum mit einem herausragenden Sicherheitsprofil fr die Verwendung in allen Tieren.

    CobactanEine Reihe von Antiinfektiva-

    Formulierungen auf Basis des proprietren Molekls

    Cefquinome

    CobactanEine Reihe von Antiinfektiva-

    Formulierungen auf Basis des proprietren Molekls

    Cefquinome

    MKS-Impfstoffe und MKS-Marker TestsImpfstoff und Test ermglichen die Unterscheidung geimpfter und infizierter Tiere

    MKS-Impfstoffe und MKS-Marker TestsImpfstoff und Test ermglichen die Unterscheidung geimpfter und infizierter Tiere

    Nobivac E. coli inacInaktivierter Impfstoff, der 93%

    aller aus Hhnchen isoliertenE. coli Stmme abdeckt.

    Nobivac E. coli inacInaktivierter Impfstoff, der 93%

    aller aus Hhnchen isoliertenE. coli Stmme abdeckt.

    Produkt HighlightsProdukt Highlights

  • BIOCHEMINFORMATICS

    1

    2

    3

    4

    5

    6

    7

    8

    9

    10

    11

    12

    Finden

    Entwickeln

    Einfhren

    Arzneimittelforschung

    20 SubstanzenVorklinische Entwicklung

    ca. 10 Prparate

    ca. 5Prparate

    2 Prparate

    1 Prparat

    KlinischePhase I

    KlinischePhase II

    KlinischePhase III

    KlinischePhase IV

    J

    a

    h

    r

    e

    2

    0

    0

    -

    2

    5

    0

    M

    i

    o

    .

    E

    u

    r

    o

    Werdegang eines MedikamentsWerdegang eines Medikaments

  • BIOCHEMINFORMATICS

  • BIOCHEMINFORMATICSB

    i

    o

    C

    h

    e

    m

    I

    n

    f

    o

    r

    m

    a

    t

    i

    c

    s

    T

    a

    r

    g

    e

    t

    I

    d

    e

    n

    t

    i

    f

    i

    z

    i

    e

    r

    u

    n

    g

    &

    W

    i

    r

    k

    s

    t

    o

    f

    f

    D

    e

    s

    i

    g

    n Target DiscoveryMolekularbiologie

    Lead DiscoveryAssay Development & HTS

    Lead OptimizationKombinatorische und Medizinische Chemie

    ProfilingBiologische und in vitro-vivo Profilierung

    Product DevelopmentPrklinik / Klinik

    Von der Idee zum ProduktVon der Idee zum Produkt

  • BIOCHEMINFORMATICS

  • BIOCHEMINFORMATICS

    actttgataatagacttgtagatttttgcgtt

    BioInformatikBioInformatik

  • BIOCHEMINFORMATICS

    Rationales WirkstoffdesignRationales Wirkstoffdesign

    Aktivittsprfung (HTS)Leitstrukturoptimierung

    Chemoinformatik

  • BIOCHEMINFORMATICS

    ChemoInformatik und MM 1ChemoInformatik und MM 1

    Docking undin silco Screening

    Homology Modelling

    PharmakophorModelling

  • BIOCHEMINFORMATICS

    ChemoInformatik und MM 2ChemoInformatik und MM 2

    Berechnung phys.-chem.Eigenschaften

    Substruktur- und hnlichkeitssuchen

    Struktur-Aktivitts-BeziehungenVorhersagemodelle

    O

    O

    N

    OClN

    S

    ON

    -1

    0

    1

    2

    3

    4

    5

    6

    7

    -1 0 1 2 3 4 5 6 7

    COSMO-KOC

    e

    x

    p

    .

    l

    o

    g

    K

    o

    c

    Training Set rms=0.63

    Test Set rms=0.72

  • BIOCHEMINFORMATICS

    Who we are ...Who we are ...

    Paul Selzer

    Carsten Beyer

    Richard MarhferJrg Schrder

    Andreas Krasky

    Jrg Cramer

    Anette Klinger

    Andreas Rohwer

    Frank Oellien

    Kristin Engels Hon Tran

  • BIOCHEMINFORMATICS

    Gebiete BioInformatik ChemoInformatik Molecular Modelling Theoretische Chemie Material Science

    Verbreitung und Bedeutung Im akademischen Umfeld In der Industrie

    Computer und ChemieComputer und Chemie

    Allgemeine Betrachtungen

  • BIOCHEMINFORMATICS

    Die Natur der chem. VerbindungenDie Natur der chem. Verbindungen

    TestosteronName

    2D Struktur

    3D Strukturen und Konformere Oberflchen und Eigenschaften

  • BIOCHEMINFORMATICS

    SubstanznamenSubstanznamen

    Substanznamen sind ungeignet

    unterschiedliche Schreibweisen (IUPAC, etc) Trivialnamen (z.B. Salzsure, Natronlauge, Zyankali) Synonyme und ID (z.B. AHNO 5555, CAS 100-52-7) Nomenklatur komplexer Strukturen problematisch

    ACD/IUPAC Name ACD/Name-to-Structure BioRad IUPAC NameIt und DrawIt

    Datenbankrecherchen fehleranfllig Zu umstndlich

  • BIOCHEMINFORMATICS

    2D Strukturen 12D Strukturen 1

    Die Konnektivittsinformation ist der zentrale Schlssel

    O

    Cl

    O

    Line Notations (Strings)SMARTS: OC(=O)C1=CC=CC=C1Cl

    OC(=O)c1ccccc1ClSLN: C(C[2]:C(:CH:CH:CH:CH:@2)Cl)(=O)OH

    Strukturaustauschformate

  • BIOCHEMINFORMATICS

    2D Strukturen 22D Strukturen 2

    Struktur-Zeichenprogramme MDL ISIS Draw ACD ChemSketch CACTVS ChemDraw ACD Drawing Applet JChemPaint Marvin JME C-Design BioRad KnowItAll

    GIF/PNG-Creator for 2D Plots of Chemical Structures: http://cactus.nci.nih.gov/services/gifcreator/

  • BIOCHEMINFORMATICS

    3D versus 2D3D versus 2D

    Strukturen sind keine 2D-Objekte

    aus: Molecules are like Humans, Johann Gasteiger, Erlangen

  • BIOCHEMINFORMATICS

    3D Strukturen 13D Strukturen 13D Struktur-Generatoren CORINA, http://www2.chemie.uni-erlangen.de/software/corina/free_struct.htm3D Struktur-Generatoren/Betrachter VRML File Creator for Chemical Structures,

    http://www2.chemie.uni-erlangen.de/services/vrmlcreator Online Smiles Translator BioRad KnowItAll ACD/Labs ChemSketch / 3D Viewer ChemDraw

    3D Struktur-Betrachter JMOL JSV Rasmol und Chime und viele andere mehr

  • BIOCHEMINFORMATICS

    3D Strukturen 23D Strukturen 2VRML Structure Generator

    Demo 1 Demo 2

  • BIOCHEMINFORMATICS

    3D Strukturen 23D Strukturen 2VRML Structure Generator

    Demo 1 Demo 2

  • BIOCHEMINFORMATICS

    Struktur vs. OberflchenStruktur vs. Oberflchen

    Molekle haben Oberflchen und Eigenschaften!

    aus: Molecules are like Humans, Johann Gasteiger, Erlangen

  • BIOCHEMINFORMATICS

    Oberflchen und EigenschaftenOberflchen und Eigenschaften

    MOLSURF, http://www2.chemie.uni-erlangen.de/services/molsurf/

    Demo

  • BIOCHEMINFORMATICS

    Oberflchen und EigenschaftenOberflchen und Eigenschaften

    MOLSURF, http://www2.chemie.uni-erlangen.de/services/molsurf/

    Demo

  • BIOCHEMINFORMATICS

    Atom-OrbitaleAtom-Orbitale

    Orbital Viewer, http://www.orbitals.com/orb/ov.htm Atomorbitale Hybridorbitale

  • BIOCHEMINFORMATICS

    Molekl-OrbitaleMolekl-Orbitale

    OrbVis, http://www2.chemie.uni-erlangen.de/services/orbvis/

  • BIOCHEMINFORMATICS

    Molekl-OrbitaleMolekl-Orbitale

    OrbVis, http://www2.chemie.uni-erlangen.de/services/orbvis/

  • BIOCHEMINFORMATICS

    Molekl-OrbitaleMolekl-Orbitale

    OrbVis, http://www2.chemie.uni-erlangen.de/services/orbvis/

  • BIOCHEMINFORMATICS

    FlexibilittFlexibilitt

    Molekle sind flexibel und nicht starr!

    aus: Molecules are like Humans, Johann Gasteiger, Erlangen

  • BIOCHEMINFORMATICS

    Spektren und NormalmodenSpektren und Normalmoden

    ComSpec3D, http://www2.chemie.uni-erlangen.de/services/vrmlvib/

    Demo

  • BIOCHEMINFORMATICS

    Spektren und NormalmodenSpektren und Normalmoden

    ComSpec3D, http://www2.chemie.uni-erlangen.de/services/vrmlvib/

    Demo

  • BIOCHEMINFORMATICS

    Spektren und NormalmodenSpektren und Normalmoden

    ComSpec3D, http://www2.chemie.uni-erlangen.de/services/vrmlvib/

    Demo

  • BIOCHEMINFORMATICS

    ReaktionsanimierungReaktionsanimierung

    VRML Animation Generator, http://www2.chemie.uni-erlangen.de/services/vrmlanim/

    Demo

  • BIOCHEMINFORMATICS

    ReaktionsanimierungReaktionsanimierung

    VRML Animation Generator, http://www2.chemie.uni-erlangen.de/services/vrmlanim/

    Demo

  • BIOCHEMINFORMATICS

    [email protected]

    Vielen Dank fr Ihr InteresseVielen Dank fr Ihr Interesse

  • BIOCHEMINFORMATICS

    JMolhttp://jmol.sourceforge.net/preview/

    MolSurfhttp://www2.chemie.uni-erlangen.de/services/molsurf/

    ComSpec3Dhttp://www2.chemie.uni-erlangen.de/services/vrmlvib/

    Datenbankenhttp://cactus.nci.nih.gov/ncidb2/http://www.chemfinder.com

    Online-DemosOnline-Demos