Struktur und Funktion neuartiger RNA-Thermometer = STructure and ...

Fakultät für Biologie und Biotechnologie

Lehrstuhl für Biologie der Mikroorganismen

Struktur und Funktion neuartiger RNA-Thermometer

Dissertation zur Erlangung des Gradeseines Doktors der Naturwissenschaften

der Fakultät für Biologie und Biotechnologieder Ruhr-Universität Bochum

angefertigt amLehrstuhl für Biologie der Mikroorganismen

vorgelegt vonJens Frank Kortmann

ausHagen

Referent: Prof. Dr. Franz NarberhausKorreferent: Prof. Dr. Ulrich Kück

Bochum 2010

Structure and function of novel RNA thermometers

Dissertation

Jens Frank Kortmann

Bochum 2010

Fakultät für Biologie und Biotechnologie

Lehrstuhl für Biologie der Mikroorganismen

Structure and function of novel RNA thermometers

Dissertation zur Erlangung des Gradeseines Doktors der Naturwissenschaften

der Fakultät für Biologie und Biotechnologieder Ruhr-Universität Bochum

angefertigt amLehrstuhl für Biologie der Mikroorganismen

vorgelegt vonJens Frank Kortmann

ausHagen

Referent: Prof. Dr. Franz NarberhausKorreferent: Prof. Dr. Ulrich Kück

Bochum 2010

Danksagung

Ich möchte meinem Doktorvater Herrn Prof. Dr. Franz Narberhaus für den großen inhaltlichen Freiraum danken, der mir bei der Wahl meiner Forschungsthemen gelassen wurde. Vielen Dank für die fortwährende Unterstützung, die Ermutigungen und das Vertrauen in den schwierigen Phasen meiner Arbeit. Eigeninitiative wurde immer gefördert und, wo notwendig, in die richtigen Bahnen gelenkt. Vielen Dank für die zahlreichen guten Ideen, die Hinweise zu deren pragmatischer Umsetzung und vor allem für die schöne Promotionszeit.

Herrn Prof. Dr. Ulrich Kück danke ich für die freundliche Übernahme des Zweitgutachtens und das fortwährend aufrichtige Interesse an meiner Arbeit.

Ich möchte mich bei Herrn Dr. Bernd Masepohl für seine wissenschaftliche Neugierde und für viele gute Hinweise und spannende Anekdoten aus der Experimentatoren-Welt bedanken. Bernds Tür steht jedem offen.

Frau Prof. Dr. Nicole Frankenberg-Dinkel danke ich für die vielen guten Anregungen und Vorschläge und die tolle wissenschaftliche Unterstützung während meiner Arbeit.

Ich danke Herrn Prof. Dr. Karl E. Klose für seinen Besuch in Deutschland, die unzähligen hilfreichen Mails und für eine rundum tolle Kooperation.

Frau Prof. Dr. Petra Dersch und Frau Katja Böhme danke ich für zahlreiche inspirierende Diskussionen an diversen Posterwänden und für die hervorragende Zusammenarbeit.

Ich danke der Studienstiftung des Deutschen Volkes für die finanzielle, vor allem aber für die exzellente ideelle Unterstützung während meiner Doktorarbeit. Dieser Dank gilt auch der Ruhr-University Research School, die ich ein Jahr lang aktiv mitgestalten durfte.

Ich möchte meinen Mitarbeitern aus der RNA-Subgruppe danken. Vor allem Frau Ulla Aschke für ihre tatkräftige Unterstützung im Labor und für ihre beinahe unheimliche Fähigkeit, wirklich „alles überall rein“ zu klonieren. Meinen Diplomanden Simon Sczodrok und Annika Cimdins danke ich für eine spannende Betreuungszeit, in der auch ich viel gelernt habe. Frau Dr. Birgit Klinkert danke ich für die Unterstützung und stete Hilfe bei allen Problemen. Ich danke den „kleinen RNAs“ für nützliche Tipps und prompte Unterstützung. Vielen Dank an Frau Rosemarie Gurski für die gemeinsame Bewältigung der Übungen in Prokaryontengenetik und die gute Hilfe beim Strahlenschutz. Danke für die gute Zeit, danke an sämtliche RNA-Mitstreiter für die Hilfe bei der Fertigstellung dieser Arbeit und das Aufrechterhalten meiner Vitalfunktionen in der Endphase dieser Arbeit.

Vielen Dank an Frau Petra Krämer für die schnelle Hilfe bei allen verwaltungstechnischen Problemen und die ununterbrochene Versorgung mit Koffein und kurzkettigen Kohlenhydraten.

Vielen Dank an den Lehrstuhl für Biochemie der Pflanzen für das Bereitstellen von Laborraum und die experimentellen Hilfestellungen.

Ich möchte sämtlichen Arbeitsgruppen am Lehrstuhl für Biologie der Mikroorganismen für die Hilfsbereitschaft in allen Forschungs-Situationen danken. Danke für das gute Arbeitsklima und die angenehme Zusammenarbeit.

Ich danke all meinen Freunden für Ihr Verständnis und die riesige moralische Unterstützung in den letzten Jahren. Bei Herrn Dr. Matthias Heyden möchte ich mich für die gemeinsame Zeit, die fortwährende Unterstützung und Freundschaft seit Wohnheimstagen bedanken. Herrn Dr. Sebastian Rasche danke ich für seine wissenschaftliche Hilfe und den Rock N‘ Roll. Bei Herrn Dr. Mathias Hentrich und Herrn Björn Moll möchte ich mich für viel Inspiration und eine wirklich gute Zeit bedanken.

Herrn Ernst Skerra danke ich für das vermittelte Wissen und seine jahrelange Freundschaft.

Bei Jaclyn Dalisay möchte ich mich für die unentwegte Unterstützung in den letzten Jahren bedanken. Dieser Dank gilt auch ihrer Familie.

Ich danke meiner Familie, vor allem meinen Eltern und meinem kleinen Bruder für die Unterstützung in der langen Promotionszeit. Ihr habt sehr viel zum guten Gelingen dieser Arbeit beigetragen. Danke.

- It ain‘t over till it‘s over. -- Never give up. And never stop believing. -

Robert „Rocky“ Balboa

I. Table of contents

I Table of contents I

II Abbreviations II

A Introduction 1 1. Micros for microbes - small RNAs regulate bacterial gene expression 1 2. The cis-active case - riboswitches and RNA thermometers 2 3. The E. coli rpoH thermometer 4 4. ROSE - Repression Of heat Shock gene Expression 5 5. Cold shock thermosensors 7 6. RNA thermometers in bacterial pathogens 7

B Objectives 12

C Generation of synthetic RNA-based thermosensors 13

D Translation on demand by a simple RNA-based thermosensor 14

E Temperature-mediated translational regulation by the Vibrio cholerae toxT 5‘ mRNA leader is based on nucleotide slippage and pseudoknot formation 15

F Discussion 16 1. Synthetic biology - molecular tailoring of biological systems at the nanoscale 16 2. RNA synthetic biology inspired by microbes: construction of translation initiators under temperature control 16 3. Potential applications of the synthetic RNA thermometer module 19 4. What it takes to be an RNA thermometer - the consensus algorithm 21 5. Destabilization of a bipartite stem - a novel principle among cyanobacterial RNA thermometers? 23 6. Cyotherm - a novel family of „green“ RNA thermometers 24 7. High light-sensing by a heat shock RNA thermometer? How co-translational protein insertion might contribute to it 26 8. RNA elements as antibacterial drug targets? 28 9. Anti-thermometer drugs - a promising attempt? 31

G Summary 33


H Zusammenfassung 35

I References 37

J Conference contributions 45 1. Posters 45 2. Talks 46

K Appendix 47 1. Curriculum vitae 47 2. Erklärung 48

L Eigenanteil an den Manuskripten 49


II. Abbreviations

AUG translational start site (methionine codon)

CD circular dichroism

dNTP desoxynucleotide triphosphate

Fig. figure

mRNA messenger RNA

MU Miller Units

kDa kilodalton

NTP nucleoside triphosphate

ORF open reading frame

RBS ribosome binding site

RNAP RNA polymerase

ROSE Repression Of heat Shock gene Expression

rRNA ribosomal RNA

SD Shine Dalgarno

UTR untranslated region

II. Abbreviations

A. Introduction

In order to survive in an often harsh environment, a microbe has to constantly monitor changes in

environmental conditions and adjust its metabolism appropriately. Such fine-tuning of gene-

expression is especially important for pathogenic bacteria, which need to employ several protective

measures during host-infection. For many years, these mechanisms were thought to be regulated

exclusively by proteins at the transcriptional level. Today there is an extensive body of literature

that describes the importance of post-transcriptional regulation in both eukaryotic and prokaryotic

microorganisms. It has become clear that mRNA is not a passive carrier of genetic information.

Instead it can form three-dimensional structures and thereby control its ability to initiate translation

or being degraded. Recent data reveals RNA as an ubiquitous mediator of gene expression.

1. Micros for microbes - small RNAs regulate bacterial gene expression

Regulatory RNAs can roughly be separated into two groups. The trans-acting small RNAs (sRNAs)

function by base-pairing with their target mRNA encoded elsewhere on the chromosome, and

thereby control its fate (1). A noteworthy subclass are antisense sRNAs (asRNAs) that are

encoded on the DNA strand opposite to its target mRNA and share perfect complementarity with

their target (2,3). In contrast, other transcripts contain cis-active built-in elements that directly affect

expression of the downstream coding sequence. The majority of the regulation by sRNA is

negative as base pairing between the sRNA and its target mostly results in translational inhibition,

mRNA degradation or both (4-6). Many sRNAs occlude the SD-harbouring ribosome binding site

(RBS), although some sRNAs like GcvB and RyhB, regulate their targets by base pairing far

upstream of the RBS (7,8). Having an average size around 100 nucleotides (although longer

variants over 500 nucleotides are known, (9)) bacterial sRNAs are larger than their eukaryotic

counterparts (around 25 nucleotides longer). As bacterial sRNAs provide different regions of

complementarity, one sRNA is often capable to control several mRNA targets in a synchronized

manner. The above-mentioned Escherichia coli sRNA RyhB binds many of the iron-storage

encoding mRNAs and thereby initiates their decay (7). RyhB is absent under high iron

concentrations which allows expression of iron-storage proteins.

A. Introduction

1

In many cases, the hexameric RNA chaperone Hfq is necessary for sRNA-mediated

regulation, presumably by facilitating RNA-RNA interactions despite limited complementarity

between the sRNA and the respective target mRNA (10,11).

2. The cis-active case - riboswitches and RNA thermometers

The first described class of cis-regulatory elements were classic attenuators that reside in the 5‘-

end of bacterial mRNAs. During transcription, stalled ribosomes lead to changes in the mRNA

structure, affecting transcription elongation through the formation of terminator or anti-terminator

structures in the mRNA (12, 13). A related mechanism is widely used in gram-positive bacteria

where sequences found in transcripts encoding aminoacyl-tRNA-synthetases, termed „T-boxes“,

bind the corresponding uncharged tRNA. This stabilizes the anti-terminator structure in preference

to the terminator structure, thereby preventing transcription termination (14, 15).

More recently, it was found that structured 5‘-untranslated regions (UTRs) of certain

bacterial mRNAs, riboswitches, bind specific metabolites and adopt different conformations in the

presence or absence of these small molecules (16-18). As the genes regulated by a riboswitch are

usually involved in the synthesis or transport of its specific metabolite, riboswitches are direct

modulators of cellular metabolite concentrations (19). If the cognate metabolite is not available

during transcription of the 5‘-UTR („GENE ON“, Fig.1a, b), the riboswitch in most cases folds into a

structure that does not interfere with the expression of the adjacent open reading frame (ORF). If

the concentration rises to a sufficiently high level, the metabolite binds to the riboswitch receptor

domain, which initiates formation of a structure in the nascent transcript that prevents the

expression of the ORF. This structure can either be a terminator, which stops RNA synthesis

prematurely („GENE OFF“, Fig. 1a) or a hairpin that masks the SD site and prevents the ribosome

from binding to the mRNA and translating the ORF („GENE OFF“, Fig. 1b).

A. Introduction

2

At least 20 different classes of riboswitches specific to different metabolites are known (20).

This suggests that the diversity of riboswitch function and/or control mechanisms could be greater

than envisioned originally. In 2009, Shoshy Altuvia (Jerusalem, Israel) presented the first example

of a pH-responsive riboswitch introducing a novel concept that involves folding dynamics driven by

pH (21). The pH-responsive RNA element resides upstream of E. coli alx, a gene encoding an

A

B

C

RNAP

ORF

ORF

ORF

ORF

ORF

- Ligand + Ligand

mRNA 5‘

5ʻ

mRNA 5‘

5‘ 5‘

5‘

5‘

GENE ON GENE OFF

Anti-Terminator

Terminator

UUUUUU

No ORF made

No ORF translated

Shine-Dalgarno-Sequestor

SD

SD

Anti-Sequestor

GENE ON GENE OFF

GENE ON GENE OFF

SDSDΔT No ORF

translatedOpen Thermometer

Closed Thermometer

Figure 1. Schematic model of gene regulation by riboswitches and RNA thermometers. See text for further information. (A) Transcription termination mechanism used by some riboswitches to

regulate gene expression. If the ligand (red circle) is not present during the transcription of the 5‘-UTR (GENE ON), an anti-terminator hairpin forms which does not interfere with expression of the open reading

frame (ORF). When present at elevated concentrations (GENE OFF), the ligand binds to the riboswitch which results in formation of a terminator hairpin. (B) A translation-inhibition mechanism of riboswitch gene

regulation. If the ligand is not present (GENE ON), an anti-sequestor stemloop forms which does not interfere with translation of the ORF. At elevated concentrations, the ligand binds to the riboswitch and allows

formation of a stemloop structure that sequesters the SD sequence and prevents the ribosome from binding to the mRNA. (C) Mode of action of RNA thermometers that control translation during a temperature shift. At

elevated temperature (GENE ON), the structure around the translation initiation region melts open and allows the ribosome to translate the ORF. At low temperature (GENE OFF), the SD site is base paired and

prevents the ribosome from translating the ORF. RNAP, RNA polymerase; SD, Shine Dalgarno; Δ T, temperature shift (Blount and Breaker 2006, revised)

A. Introduction

3

inner membrane protein synthesized under extreme alcaline stress (22). It is known that sequence-

specific pausing and the elongation speed of RNA polymerase during de novo synthesis influences

the dynamics of RNA folding (23). In vitro transcription assays demonstrated that the RNA

polymerase pauses at two distinct sites during alx transcript elongation under alcaline conditions

(21). The prolonged transcription pausing allowed subsequent formation of translatable messenger

intermediates. This was not the case under neutral pH conditions, when the riboswitch folded into

a translationally inactive conformation.

Already 20 years earlier, Shoshy Altuvia showed that translation efficiency of an RNA

segment can be dependent on temperature (24). Since then, it has become evident that both, non-

pathogenic and pathogenic microorganisms are able to regulate gene expression via RNA

thermosensors, or „RNA thermometers“ (25). These leader sequences fold in a manner that is

sensitive towards temperature alterations. With increased temperature, certain occluded regions,

i.e. the SD sequences, are liberated and translation can initiate (Fig. 1c). Usually, RNA

thermometers are found upstream of genes that are more or less directly related to temperature,

encoding either heat shock proteins or virulence regulators (26-29). However, the first described

temperature-responsive RNA element regulates viral lysis-lysogeny decision. The cIII RNA

segment in the bacteriophage λ was present in two mutually RNA secondary structures, A

(TRANSLATION OFF) and B (TRANSLATION ON), at equilibrium (24; Fig. 2a). At temperatures

below 37°C, the equilibrium shifted to structure B, causing accessibility of the SD site due to an

interaction between the anti-SD site and the anti-anti-SD site. The unpaired SD site facilitated

binding of the 30S subunit and translation of the cIII mRNA which in turn positively regulated the

lysogenic pathway. With an increase in temperature to 45°C, the structure was rearranged and the

equilibrium shifted to structure A. The SD site in structure A was sequestered by base pairing with

the anti-SD site, which prevented synthesis of the cIII protein and drove the bacteriophage λ into

the lytic cycle. It is noteworthy, that the cIII thermosensor deviates from other RNA thermometers in

that translation of cIII transcript is reduced with increasing temperature.

3. The E. coli rpoH thermometer

A sudden increase in temperature results in misfolding and accumulation of denatured proteins,

culminating in a global cellular response and stimulation of the multilayered heat shock regulon

A. Introduction

4

(30). This process was shown to be controlled mainly on transcriptional level by repressor proteins

and alternative sigma factors (31). The concerted expression of genes that maintain E. coli growth

under high temperature stress requires the expression of sigma factor σ32, encoded by the rpoH

gene. Interestingly, expression of σ32 itself is, to a great extent, governed on posttranscriptional and

translational level (32). Through various experiments, it was shown that two separated segments of

the rpoH transcript coding region (nucleotides 1 to 27 and 112 to 208) fold into a complex structure

that prevented translation initiation at low temperatures (32, 33; Fig. 2b). The rpoH thermometer is

the most complex heat shock sensor described to date, not only due to its structure but also

because of a sophisticated melting mechanism. An increase in temperature results in weakening of

the structure and concomitant liberation of a sequence downstream of the AUG start codon that

showed complementarity to a part of the 16S rRNA . This is the primary ribosome docking site

which facilitates subsequent binding of the 30S subunit to the SD sequence and translation

initiation. In fact, there is evidence that transient binding to non-SD sites („ribosome standby sites“)

is crucial to recruit ribosomes from the cytoplasm (34). Synthesis of the RpoH sigma factor then

induces transcription of a large heat shock regulon.

4. ROSE - Repression Of heat Shock gene Expression

The by far most common class of RNA thermometers are the ROSE (Repression Of heat Shock

gene Expression) elements. Shortly after its discovery in rhizobia (26, 35) it has been identified as

a conserved regulatory element in α and γ-proteobacteria (36). With a length from 60 to more than

100 nucleotides, the ROSE thermometers are comprised of two, three or four different hairpins.

While the 5‘ hairpin(s) remain(s) stable under heat shock conditions (37), the SD-sequestering 3‘

proximal hairpin is only stable at low temperatures (38). Temperature induced local melting in the 3‘

proximal hairpin exposes the SD site, facilitating ribosome binding (Fig. 2c). The other hairpins

probably ensure proper folding during de novo synthesis or alternative, to fold into a tertiary

structure supporting translation initiation at elevated temperatures (26, 38). Common to all ROSE

thermometers is the presence of a nucleotide stretch in close vicinity to the SD sequence. All

ROSE elements share a U-U/C-G-C-U motif. The centrally preserved G was first believed to be

unable to base pair and therefore cause a bulge opposite the SD sequence (38). However, recent

A. Introduction

5

NMR studies have shown that the G is not exposed as predicted but paired in a syn-anti

conformation with a second G residue of the SD region (39). A 29 nucleotide fragment carrying the

conserved ROSE sequences was used for three-dimensional structure determination and melting

studies. NMR studies showed that local melting of the RNA structure initiates from an internal loop

harbouring a U-U pair and proceeds into the SD sequence. Deletion of the G residue in the ROSE1

thermometer of Bradyrhizobium japonicum or the ibpA thermometer of E. coli completely abolished

Figure 2. Schematic model of temperature-dependent sequestration of the ribosome binding site in different RNA thermometers. See text for further information. (A) Structure A: Docking of the ribosome (grey circles) to the SD sequence (red box) of the bacteriophage λ cIII messenger is hindered by a secondary structure at high temperature

(45°C). Structure B: At lower temperature (<37°C), a conformational change in the RNA structure facilitates binding of the ribosome to the SD sequence and translation initiation at the AUG start codon (black box). (B) Translation initiation of the E. coli rpoH mRNA depends on an interaction between the 16S rRNA and an element (grey box) in the rpoH coding region. At low temperatures (<30°C) the downstream element is not

accessible, preventing binding of the ribosome. With an increase in temperature (42°C) the RNA conformation is altered, facilitating ribosome binding to the downstream element, interaction of the ribosome

with the SD site and concomitant translation initiation. (C) The translation of many small heat shock gene mRNAs is prohibited at low temperatures (30°C) due to a stable interaction between the SD and the anti-SD

sequence, preventing ribosome binding. The SD sequence is released at elevated temperature (42°C), allowing binding of the ribosome and translation initiation. ΔT, temperature shift

5‘

5‘

5‘ 5‘

5‘

A λ cIII

B rpoH

C ROSE

ΔT

ΔT

ΔT

5‘

G G

A B

A. Introduction

6

translation induction at higher temperatures, suggesting that the non-canonically paired G residue

is crucial for melting of the SD sequence (26, 36). As it was the case for the rpoH thermometer, the

E. coli ibpA ROSE element is embedded within a multifactorial regulatory network, including

RNaseE-mediated processing events and translational regulation of the gene products by the Lon

protease (29, 40).

5. Cold shock thermosensors

Deletion analysis in the 5‘-UTR of cspA, the paradigm E. coli cold shock gene, indicated that cold

induction is mainly regulated on the posttranscriptional level by cis-acting elements of its transcript

(41). Recently, it was shown that at low temperatures, the „cold shock“ structure was more

efficiently translated and somewhat less susceptible to degradation than the 37°C structure (42). In

contrast to other thermosensors, the underlying conformational rearrangements did not result from

melting of hairpin structures. The low temperature conformation of cspA mRNA imposes structural

constraints that expose the SD sequence and place the start codon in an unstable helix.

Conversely, at 37°C these translation initiation elements are buried within a double-stranded

structure, a condition expected to limit translational efficiency. It was demonstrated by various

structure probing experiments that temperature alterations were sensed by the whole cspA mRNA

and that the cold shock response is dependent on the mRNA folding process.

6. RNA thermometers in bacterial pathogens

An increase in temperature to 37°C is a highly significant signal for a pathogenic microbe that it

has successfully invaded a warm-blooded mammalian host (43). To avoid the innate immune

response and to safe energy, pathogens express virulence genes shortly before starting host

invasion (44). Expression of the Yersinia pestis adhesion protein YadA requires the virulence factor

LcrF, which is present only at 37°C but not at 26°C (45). Already in 1993, Hoe and Goguen

predicted that the 5‘-UTR of lcrF might confer translational control to the virulence regulator gene

(46). Unfortunately, no further experiments were performed to validate this model. Yersinia

pseudotuberculosis contains a similar potential RNA thermometer upstream of its lcrF gene. In a

side project of this PhD thesis in collaboration with Katja Böhme and Petra Dersch (HZI,

A. Introduction

7

Braunschweig), we provided evidence that it controls ribosome access and permits virulence gene

induction at 37°C (data not shown).

A typical RNA thermometer controls expression of the Salmonella enterica serovar

Typhimurium gene agsA (27; Fig.3a). The agsA gene does not encode a virulence factor but a

molecular chaperone. It is known that the expression, proper folding and secretion of virulence

factors require the presence of certain chaperones that are upregulated due to severe stresses

during host invasion (47). RNA secondary structure prediction programs and RNA-probing

experiments revealed that the agsA 5‘-UTR formed two distinct hairpins, with the second hairpin

having the SD site sequestered by binding to a consecutive stretch of four uridines (27).

Toeprinting assays confirmed that formation of the ternary translation initiation complex (mRNA,

30S ribosomal subunit and tRNAfmet) occurs only at 45°C but not at 30°C. Certain hairpin-

A agsA

B prfA

5‘ΔT

ΔT

5‘4U 4U

5‘ 5‘

Figure 3. Schematic model of RNA thermometers in pathogenic bacteria. See text for further information. (A) Translation of the S. typhimurium agsA mRNA at low temperatures

(30°C) is inhibited by a SD site (red box) interaction with four uridines (4U), that hampers the binding of the ribosome (grey circles). At higher temperatures (42°C), the SD site is released, facilitating binding of the

ribosome and translation initiation. (B) Translation initiation of the L. monocyogenes transcriptional activator prfA at low temperatures (<30°C) is hindered by a secondary structure that masks the SD site. At elevated

temperatures (37°C), the secondary structure is partially disrupted, enabling docking of the ribosome and translation initiation. While translation of agsA contributes to proper functionality of expressed virulence

factors, translation of the prfA mRNA directly activates virulence genes. ΔT, temperature shift

A. Introduction

8

stabilizing nucleotide substitutions located at the base of the anti-SD site were shown to close the

hairpin, thereby completely abolishing the heat induction of the agsA gene. Conversely,

destabilizing point mutations in the four uridine stretch prevented repression at 30°C. As the four

uridine anti-SD residues are also present in Y. pestis lcrF, Staphylococcus aureus groES and

Brucella melitensis dnaJ, there is strong evidence that „FourU“ elements are widely used for

control of bacterial heat shock and virulence genes (25). Due to its compact size of 58 nucleotides,

the agsA 5‘-UTR is perfect for NMR studies of the entire thermometer. Recent NMR data provided

insights into melting of the agsA FourU thermometer at nucleotide resolution (48). Intriguingly, the

agsA 4U motif is not only relevant for imperfect pairing of the SD sequence, but also comprises an

experimentally verified Mg2+-binding site (Fig.4; Rinnenthal et al. 2010 in preparation).

In most cases, virulence genes are organized in a cascade-like fashion with a

transcriptional master activator on top of it (49). Upstream of the Listeria monocytogenes PrfA

virulence regulator encoding mRNA lies a 127 nucleotide-long 5‘-leader, which forms a complex

secondary structure (28). Despite the SD sequence and AUG start triplett being in exposed loops,

Figure 4. The Salmonella agsA FourU motif comprises a Mg2+ binding site.NMR spectroscopic analysis revealed that agsA thermometer-melting at elevated temperatures (42°C) is

based on Mg2+-binding to the U-G ensembles of the SD site (encircled). Presence of the cation resulted in enhanced stability of the structure. (Rinnenthal et al. in preparation, revised)

A. Introduction

9

the overall structure is sufficient to inhibit formation of the translation initiation complex at low

temperatures. The structure is destabilized at human body temperature (37°C) allowing translation

of the prfA messenger (Fig.3b). The presence of PrfA protein activates the expression of several

virulence genes, encoding not only adhesins, but also phagosome-escape factors and several

immune-modulating factors which repress the host innate response (50, 51). Base substitution

mutations that stabilized or destabilized the prfA-UTR structure, displayed a repressed expression

at 37°C and a derepressed expression at low temperatures, repsectively, both in E. coli and L.

monocytogenes (28). The complexity of prfA-regulation was further increased by recent findings of

the Johansson and Cossart labs, that a S-adenosylmethionine (SAM) riboswitch can function both

as a classical cis-acting riboswitch as well as a trans-acting sRNA by targeting the prfA

Figure 5. The truncated riboswitch element, SreA, interacts with the prfA-UTR at 37°C.See text for further information. The SAM riboswitch element A (SreA) can function in trans, by binding to the

prfA thermometer. The SreA:prfA-UTR interaction leads to a diminished expression of PrfA. The exact mechanism by which this interaction hamperes ribsome-binding remains to be elucidated. (Loh et al. 2009,

revised)

SreA:prfA-UTR

SreA prfA

5‘ 5‘

5‘

5‘

37°C

?

A. Introduction

10

thermometer (52). Transcription of the riboswitch is terminated by elevated levels of SAM. The

truncated element, SreA (SAM riboswitch element A, 227 nucleotides), directly interacts with the

distal part (80 bases upstream of the SD site) of the prfA thermosensor, thereby blocking

translation of prfA mRNA (Fig. 5). This interaction region is unusually distant from the SD site and

the precise mechanism of SreA-mediated translational inhibition remains unclear. The interaction

only occurs at elevated temperatures (37°C), when the prfA thermometer is in a more open

conformation. SreA expression itself is controlled by PrfA, forming a regulatory feedback loop.

Deletion of SreA resulted in upregulation of PrfA at 37°C, suggesting that SreA antagonizes Listeria

virulence. This „double“ regulation is an intelligent way for a pathogen to ensure translation of an

important protein under two different conditions (47). In theory, all transcriptionally controlled

riboswitch elements may function as sRNAs and regulate certain target mRNAs, which

dramatically increases the number of putative trans-acting sRNAs.

A. Introduction

11

B. Objectives

There is evidence that both pathogenic and non-pathogenic bacteria use RNA thermometers to

govern heat shock and virulence gene expression. Although the regulatory principle of translational

control by opening and closing of the thermometer appears very simple, we are still far from

understanding the molecular details of this reversible melting process. Internal loops and bulges

and non-canonical base pairs contribute to melting in the physiological range. Most RNA

thermometers are able to operate without additional cellular factors. However, in some cases

trans-active factors are involved in RNA thermometer function.

Intensive bioinformatic studies on RNA thermometers suggest that these regulatory

elements are widespread among prokaryotes. Hence, it is important to elucidate the true

physiological relevance of selected RNA thermometer candidates within complex stress and

virulence control networks. In the course of this thesis, we plan to address the following

fundamental questions:

- Is it possible to design a synthetic RNA thermosensor by the help of computer-based rational

design and in vivo selection?

- What is the physiological relevance of a simple RNA thermometer upstream of the

Synechocystis sp. PCC6803 small heat shock protein gene hsp17?

- How does a putative FourU thermometer control virulence gene expression in the human

pathogen Vibrio cholerae?

To address these issues, we will use both available molecular biological techniques and establish

novel methods to characterize the candidate RNA thermometers, e.g. chemical structure probing

(lead) along a temperature gradient, a gfp-reporter system to examine thermometer function, and

chromosomal insertion of repressed and derepressed thermometer variants to detect phenotypic

variations. Biophysical analyses and in vivo animal models will be conducted in close collaboration

with other laboratories.

B. Objectives

12

C. Generation of synthetic RNA-based thermosensors

Torsten Waldminghaus, Jens Kortmann, Stefan Gesing

and Franz Narberhaus

C. Generation of synthetic RNA-based thermosensors

13

Biol. Chem., Vol. 389, pp. 1319–1326, October 2008 • Copyright � by Walter de Gruyter • Berlin • New York. DOI 10.1515/BC.2008.150

2008/166

Article in press - uncorrected proof

Generation of synthetic RNA-based thermosensors

Torsten Waldminghaus, Jens Kortmann,Stefan Gesing and Franz Narberhaus*

Lehrstuhl fur Biologie der Mikroorganismen, Ruhr-Universitat Bochum, D-44780 Bochum, Germany

* Corresponding authore-mail: [email protected]

Abstract

Structured RNAs with fundamental sensory and regula-tory potential have been discovered in all kingdoms oflife. Bacterial RNA thermometers are located in the 59-untranslated region of certain heat shock and virulencegenes. They regulate translation by masking the Shine-Dalgarno sequence in a temperature-dependent manner.To engineer RNA-based thermosensors, we used a com-bination of computer-based rational design and in vivoscreening. After only two rounds of selection, severalRNA thermometers that are at least as efficient as naturalthermometers were obtained. Structure probing experi-ments revealed temperature-dependent conformationalchanges in these translational control elements. Ourstudy demonstrates that temperature-controlled RNAelements can be designed by a simple combined com-putational and experimental approach.

Keywords: regulatory RNA; riboswitch; RNAthermometer; synthetic biology; translational control.

Introduction

Examples of naturally occurring RNA sensors are accu-mulating in the last years (Winkler and Breaker, 2005;Narberhaus et al., 2006). Usually, they are located in the59-untranslated region (59-UTR) of mRNAs, fold into com-plex structures and control the expression of down-stream genes by signal-induced conformational changes.While RNA thermometers sense temperature as a phys-ical stimulus, riboswitches recognize chemical signals.Target molecules are bound by riboswitches with highspecificity and affinity. Gene expression is regulatedeither at the level of translation initiation, transcription ter-mination or RNA processing (Mandal and Breaker, 2004;Nudler and Mironov, 2004).

RNA sensors are comparatively simple regulatorydevices, as they do not require accessory proteins. It hasbeen speculated that they represent an ancient mode ofgene regulation (Vitreschak et al., 2004). Great effort hasbeen made to engineer different types of riboregulators,which may act as antisense RNAs, ribozymes or smallmolecule-binding aptamers (Isaacs et al., 2006; Gallivan,2007; Suess and Weigand, 2008). Incorporation of a the-ophylline aptamer into a designed helix in the 59-UTR of

a reporter gene by Suess and colleagues produced asynthetic riboswitch (Suess et al., 2004). Addition of the-ophylline caused a dose-dependent increase in geneexpression when this riboswitch was assayed in theGram-positive bacterium Bacillus subtilis. Theophyllinealso serves as inductor of a synthetic riboswitch thatactivates translation in Escherichia coli (Desai and Galli-van, 2004).

Construction of riboswitches includes several steps.The first step often is an in vitro selection procedure tosearch for binding of a desired ligand. In a second step,the regulatory potential of ligand binding is then analyzedin an in vitro activity assay or an in vivo system. In mostcases, time-consuming optimization steps are needed toyield the desired regulatory effect. The function of RNA-based regulators is to a great extent dependent on theirstructure. Computer-based prediction of RNA structuresfrom the primary sequence usually is quite reliable. Thismotivated studies using computer predictions to engi-neer riboswitches. Penchovsky and Breaker used aseries of programs to design RNA switches with differentBoolean logical functions (Penchovsky and Breaker,2005). Their system is based on allosteric ribozymeswhose activity is triggered by oligonucleotide binding.The binding region is located in a loop whose ligand-dependent conformation modulates the catalytic core ofa minimal hammerhead ribozyme.

Recently, RNA thermometers have been recognized asan attractive subject for engineering (Lee and Kotov,2007; Wieland and Hartig, 2007). Naturally occurringRNA thermometers undergo temperature-induced struc-tural changes (Narberhaus et al., 2006). All presentlyknown RNA thermometers control translation initiation. Inmost cases, entry to the ribosome binding site is blockedby complementary base pairs at low temperatures. Atincreasing temperatures, melting of the structure permitsribosome access. This simple regulatory principle can berealized by quite different RNA structures. Only a few dis-tinct families of RNA thermometers have been discov-ered so far. ROSE (rIepression oI f heat sIhock geneeIxpression)-like thermometers consist of several stem-loop structures and control expression of small heatshock genes in many a- and g-proteobacteria (Nocker etal., 2001; Waldminghaus et al., 2005). Thermal control isachieved by temperature-labile, non-canonical base-pairs in the SD region (Chowdhury et al., 2006). ThefourU thermometer has a simpler architecture (Wald-minghaus et al., 2007b). It regulates expression of theSalmonella heat shock gene agsA and is composed ofonly two hairpins spanning 57 nucleotides. While the 59-proximal hairpin remains stable up to 508C, the secondhairpin melts with increasing temperature in the physio-logical temperature range. The temperature responsiveelement harbors the SD sequence base-paired with astretch of fourU residues.

1320 T. Waldminghaus et al.


Figure 1 Bioinformatic prediction of temperature-controlled riboswitches.(A) Schematic representation of the two alternative structures that the approach was based on. The dot-bracket annotations belowthe corresponding structures were used as input for the switch program. SD sequence (GGAGG) and the translation start sites (AUG)are framed or underlined, respectively. (B) Flow scheme of the individual steps used for in silico prediction. Computer programs areprinted in bold font.

As the underlying mechanism of temperature sensingis a gradual melting of a weak stem-loop structure ratherthan a switch between two mutually exclusive confor-mations, RNA thermometers are often considered asmolecular dimmers rather than ON/OFF switches. AnRNA element regulating phage l development is the onlynotable exception (Altuvia et al., 1989, 1991). The 59-UTRof the gene coding for cIII appears to be in equilibriumbetween two alternative conformations. Variations intemperature or Mg2q concentration shift the equilibriumbetween both structures and thereby alter accessibilityof the SD region.

To generate a temperature-responsive regulatory RNAelement de novo, we set out to combine simple archi-tectural characteristics of the fourU thermometer with aswitch-like mechanism as described for the cIII ther-mometer. By computational design and in vivo screening,we were able to construct an RNA element capable oftemperature-dependent induction of gene expression.The structural basis underlying this regulation was ana-lyzed on the molecular level and revealed insights intothermosensing by a synthetic RNA thermometer.

Results

Architecture and design of RNA-basedthermoswitches

The common principle of RNA-based thermosensors isthe temperature-controlled access of the ribosome to theSD sequence (Narberhaus et al., 2006). On the basis ofthis principle, we simulated two temperature-dependentalternative structures (Figure 1A). Both structures containthe sequence of an optimal SD sequence (Curry andTomich, 1988) and an AUG start codon in the appropriate

distance of 9 nucleotides. In the assumed OFF structure,both of these sequences are involved in base-pairing inan extended hairpin (Figure 1A). The predicted ON struc-ture is composed of two smaller hairpins. The SDsequence is positioned in an exposed loop and the AUGstart codon is single-stranded. To arrive at sequencespotentially capable of folding into these two structures inresponse to temperature, we made use of softwaredeveloped by Flamm and colleagues. The so-calledswitch program computes bistable RNA molecules witha predicted ability to switch between two given struc-tures (Flamm et al., 2001).

Both alternative structures were converted into thedot-bracket annotation (Figure 1A) before being fed intothe switch program. Temperatures of 308C and 428Cwere assigned as temperatures to the OFF and ONstates, respectively. The expected output was a list ofsequences that predominantly fold into the correspond-ing structures at the indicated temperature. As outlinedin Figure 1B, candidate sequences retrieved by theswitch program were processed through several in silicoselection steps by making use of programs provided bythe Vienna RNA folding package (Hofacker, 2003).

The switch program returned numerous sequences asbasis for further analysis. A selection of candidates outof approximately 300 predicted sequences is shown inFigure 2A. Sequence 1 (Seq1) passed all of the followingselection criteria (Figure 1B). First, the score was below1.0 (Figure 2A). The score is an estimation of the switchpotential. It summarizes multiple parameters. Lower val-ues indicate better switch potential as sequences withhigher values (Christoph Flamm, personal communica-tion). Second, the calculated melting curve for thesequence shows a sharp peak in the temperature rangebetween 308C and 428C (Figure 2A). Third, the RNAfold

Synthetic RNA-based thermosensors 1321


Figure 2 Output of the in silico prediction.(A) Assorted sequences derived from the switch predictions are based on the secondary structures shown in Figure 1A. SD sequencesand translation start sites are underlined. Sequence 1 (Seq1) and sequence 2 (Seq2) were selected for further analysis. The meltingcurve of Seq1, calculated with the RNAheat program of the Vienna RNA Package, is depicted to the right. According to this calculation,the OFF and ON states are separated by a narrow energy-maximum and both conformations are predicted to switch at around 358C.(B) Energy dot plot of Seq1 calculated with RNAfold. The black squares describe the equilibrium base pairing probabilities. Thesequence has two dominating conformations with energies of -11.7 (ON, left) and -12.2 kcal/mol (OFF, right). The SD sequence inthe dot plot is shaded in gray.

Figure 3 Expression of translational bgaB fusions to predictedRNA thermometers.(A) Schematic representation of the reporter gene fusion on plas-mid pBAD-bgaB and (B) expression analysis of bgaB fusions.The Salmonella fourU-bgaB fusion served as positive control.Cells were grown in LB medium to exponential phase at 308C.Immediately after addition of 0.01% (w/v) arabinose, the cultureswere heat-shocked to 428C for 30 min. The relative b-galacto-sidase activity is shown as average of three parallel measure-ments with the indicated standard deviations.

program predicted a similar probability of both alternativestructures. This is visualized by the comparable squaresizes in the energy dot plot (Figure 2B). Finally, RNA sec-ondary structure predictions at different temperaturessupported a conformational switch between 378C and428C (data not shown). Most predicted sequences failedto pass the first selection criterion and had a score above1.0. Apart from Seq1, only Seq2 conformed to all criteria.The ability of both sequences to function as translationalregulatory control elements was assessed in E. coli.

In vivo characterization of thermoswitch candidates

Translational reporter gene fusions to Seq1 and Seq 2were placed downstream of the arabinose-induciblepBAD promoter (Guzman et al., 1995), which allows fortemperature-independent control of transcription (Figure3A). Upon annealing of appropriate oligonucleotides(Table 1), the AUG start codons of Seq1 and Seq2 wereligated to the bgaB sequence. bgaB codes for a heatstable b-galactosidase (Hirata et al., 1984). As positivecontrol, we used the recently described Salmonella fourUthermometer (Waldminghaus et al., 2007b). In the pres-ence of 0.01% (w/v) of the inductor L-arabinose, theexpression in E. coli of both putative thermoswitchfusions was very low. This basal expression is clearlyabove background, which is zero since E. coli has nochromosomally encoded thermostable b-galactosidase.Repression was not relieved when cells were grown at428C (Figure 3B). In contrast, the positive control (fourU)

showed approximately three-fold induction at the elevat-ed temperature.

Thermosensor engineering

Since Seq1 was incapable of conferring temperaturecontrol to a reporter gene fusion, we established an in



Table 1 Strains, plasmids and oligonucleotides used in this study.

Strain, plasmid or Relevant characteristic(s) or sequencea Source oroligonucleotide reference

StrainsEscherichia coli DH5a F-F80dlacZDM15D(lacZYAargF) U169deoRrecA1endA1hsdR17 (Hanahan, 1983)

(rK-mK

q)sup44thi-1 gyrA69

PlasmidspBAD-bgaB Translational bgaB fusion vector, bgaB: heat-stable b-galactosidase, AmpR (Waldminghaus et al.,

2007a)pBO681 Seq1 fusion in pBAD-bgaB This studypBO684b Seq1-C37U fusion in pBAD-bgaB This studypBO685 Seq1-C10U fusion in pBAD-bgaB This studypBO686 Seq1-C26G fusion in pBAD-bgaB This studypBO690 Seq1-C38U fusion in pBAD-bgaB This studypBO692 Seq1-C26U-UG39/40AA fusion in pBAD-bgaB This studypBO693 Seq1-C10U-G36A fusion in pBAD-bgaB This studypBO694 Seq1-C26U-U39A fusion in pBAD-bgaB This studypBO695 Seq1-C10U-C26U fusion in pBAD-bgaB This studypBO696 Seq1-G24A-G36U fusion in pBAD-bgaB This studypBO699 Seq2 fusion in pBAD-bgaB This studypBO472 FourU fusion in pBAD-bgaB (Waldminghaus et al.,

2007b)

OligonucleotidesRBS1_fw TTTCTCGTGCTTAACGATTTCTAGGCGTGGAGGTTGCCTGGTATGGICTAGC

(construction of pBO681)RBS1_rv CATACCAGGCAACCTCCACGCCTAGAAATCGTTAAGCACGAGAAAGIAATTC

(construction of pBO681)RBS3_fw TTTCGCATGTTGAGTGCTTTTCCCCTGGGGAGGGCAGGGGATATGGICTAGC

(construction of pBO699)RBS3_rv CATATCCCCTGCCCTCCCCAGGGGAAAAGCACTCAACATGCGAAAGIAATTC

(construction of pBO699)mutbgaBfw GTCTATAATCACGG (error-prone PCR)mutbgaBrv TCTTGCTCCAACTG (error-prone PCR)Fw-bgab-probe AGAGCAATGGCCAGAGGAAA (generation of Northern blot probe)Rv-bgab-probe TAATACGACTCACTATAGATCGGCAAAGAATCTGGAT

(generation of Northern probe)aIntroduced restriction sites are underlined.bThe RNA sequence (U instead of T) is given.

Table 2 Single and multiple nucleotide exchanges in Seq1obtained by error-prone PCR mutagenesis.

Mutation in Seq1 PCR conditions

C10Ua Seq1 as template; selected twice;(a) four-fold dGTP and(b) four-fold dATP (0.8 mM)

C37U Seq1 as template; selected twice;(a) four-fold dGTP and(b) four-fold dCTP (0.8 mM)

C26G Seq1 as template; four-fold dTTP(0.8 mM)

C38U Seq1 as template; eight-fold dTTP(1.6 mM)

C10U-C26U C10U as template; standard dNTPs(0.2 mM), MnCl2

C10U-G36A (HIM) C10U as template; eight-fold dATP(1.6 mM)

C26U-U39A Seq1 as template; standard dNTPs(0.2 mM), addition of 0.2 mM MnCl2

C26U-UG39/40AA See aboveG24A-G36U See aboveaThe RNA sequence (U instead of T) is given.

vivo screening system to convert it into a functional ther-mosensor. For this, we amplified the Seq1 fragment byerror-prone PCR. Different conditions, in which each oneof the four nucleotides dGTP, dATP, dCTP and dTTP wereused in four- or eight-fold excess, were used (see exper-imental procedures). The resulting PCR fragments werecloned into the pBAD-bgaB vector and transformed intoE. coli. Transformants were plated on Luria-Bertani agarplates containing L-arabinose as inductor and X-gal tomonitor b-galactosidase activity. Following overnightincubation at 308C, plates were transferred to 428C andthe color of the colonies was visually inspected for sev-eral hours. Colonies that turned blue were selected, andthe corresponding plasmids were isolated andsequenced. Four different single point mutations wereobtained (Table 2). Strikingly, the C10U mutation andC37U mutation were both selected twice from differentmutagenic conditions. This strongly suggests that thenumber of possible point mutations facilitating temper-ature-dependent regulation is limited.

Despite the clearly visible phenotype on plates, a qual-itative b-galactosidase assay of the four point-mutatedSeq1 variants showed only a minor increase of expres-sion at 428C as compared to 308C (Figure 4A). The factthat we were able to select for such subtle changes intemperature-dependent expression demonstrates the

high sensitivity of the X-gal based selection procedureand its suitability for an in vivo screening approach.

To further optimize thermal induction, we carried out asecond round of error-prone mutagenesis. Conditions of



Figure 4 Effect of selected single (A) and multiple (B) mutationsin Seq1 on temperature-dependent expression.The experimental procedures are as described in Figure 3.Arrows indicate the template sequence from which the muta-tions in (B) originate. (C) Schematic representation of single andmultiple mutations in the proposed ON structure. Point-mutatedpositions are encircled. SD sequence (GGAGG) and translationstart site (AUG) are framed.

Figure 5 Translational control by selected RNA elements oftemperature-dependent expression of bgaB fusions to Seq1, theC10U and HIM (C10U, G36A) RNAs.(A) Temperature-dependent expression was monitored in E. coliDH5a. Cells were grown in LB medium at 308C and heat-shocked to 428C for 30 min before b-galactosidase activity wasmeasured. The results are the average of three independentmeasurements with the indicated standard deviations. (B) In par-allel, total RNA was extracted from the same E. coli cultures.Equal amounts were separated on a 1.2% denaturing agarosegel, transferred to a positively charged nylon membrane andimmobilized for subsequent hybridization. Northern blot experi-ments were carried out using digoxigenin-labeled RNA probesto detect bgaB transcripts.

higher mutagenic strength were used, namely an eight-fold excess of one nucleotide and the addition of MnCl2(see the materials and methods section for details). Seq1and the mutated variant C10U served as PCR templates.Cloning and selection were performed as above. Fivenew variants, four with two-point mutations and one withthree mutations, were obtained (Table 2). b-Galactosi-dase expression of the new constructs was slightly high-er at 308C compared to Seq1 or C10U (Figure 4B). Ineach case, the performance as thermosensor wasimproved, since expression increased approximatelytwo-fold (C10U-C26U and G24A-G36U) or approximatelythree-fold (C10U-G36A, C26U-U39A and C26U-UG39/40AA) at 428C.

Except for C10U, all selected mutations are located inthe second stem region of the ON structure (Figure 4C).Furthermore, all these mutations would destabilize thestem structure by either introducing a mismatch (G24A,C26G, G36U, G36A and U39A) or by changing a stable

GC base pair to a weaker GU pair (C26U, C37U, C38U).Taken together, these findings point to a critical role ofhairpin stability in thermosensing.

Temperature-dependent regulation is due totranslational control

Our experimental setup was designed to select for ther-mosensors that act as translational control elements.However, in principle the selected mutations might alsoaffect the mRNA level by altering RNA stability. To rulethis out, we repeated the b-galactosidase assay for Seq1and the two variants C10U and C10U-G36A (henceforthcalled HIM for High Induction Mutant). In parallel, we tooksamples for RNA isolation and subsequent Northern blotanalysis. RNA levels were monitored using a probedirected against the coding region of the bgaB reportergene (Figure 5). Ribosomal RNAs served as internal load-ing control. Although the recorded mRNA levels wereequivalent at 308C and 428C for all three constructs, b-galactosidase activity was slightly induced in the C10Umutant and highly induced in the HIM strain. Translationalrepression at 308C is illustrated by the finding that dif-ferent C10U and HIM mRNA levels resulted in essentiallythe same basal b-galactosidase activity (Figure 5). Tem-perature-induced expression despite constant mRNAlevels clearly supports a translational control mechanism.

Enzymatic probing experiments reveal structuralbasis for thermosensing

To address the structural requirements for thermosen-sing, we performed enzymatic probing experiments using



Figure 6 Structure probing of synthetic Seq1 (A) and HIM (B)RNAs.RNase T1 (0.01 U) cleavage of 59-end-labeled RNAs was carriedout from 208C to 508C in intervals of 58C. RNA fragments wereseparated on 8% polyacrylamide gels. Lane C: incubation con-trols with water were taken at 208C, 358C and 508C. Lane L:alkaline ladder. Relevant G-residues are marked with arrow-heads to the right. The SD and stem sequences are labeled tothe left. Selected parts of SD and stem region are highlightedwith boxes. (C) Secondary structure model of Seq1 RNA con-sisting of hairpin I and II. RNase T1 cleavage sites are shownby arrows. Circled nucleotides mark exchanges that result in thethermoresponsive HIM RNA. SD sequence (GGAGG) and trans-lation start site (AUG) are framed.

RNase T1 which cuts selectively 39 of single-strandedguanine residues. We probed the structures of syntheticSeq1 and HIM RNAs at temperatures ranging from 208Cto 508C in intervals of 58C (Figure 6). The overall cleavagepattern of Seq1 at 208C is in good agreement with thecalculated ON structure (Figure 6C). G-residues in theterminal loop of hairpin II at positions 28–34, which con-tains the SD sequence, were cut by RNase T1. Con-versely, protection of regions 23–26 and 34–40 againstcleavage confirmed the predicted stem regions in hairpinII. Consistent with the low reporter gene activity, the RNAstructure was not temperature-responsive, as it remainedresistant against cleavage by RNases T1 at 408C andwas only moderately cleaved at 458C and 508C in thestem region at positions 24 and 25 (see box in Figure6A). The structure probing results clearly show that thecomputer-predicted switch between alternative struc-tures does not occur. Under our experimental conditions,the sequence does not fold into the OFF structure at all.

Also, the HIM structure does not seem to fold into thepredicted OFF structure. There are essentially no differ-ences between the structures of hairpin I in Seq1 andHIM (Figure 6). The predicted hairpin II of the HIM struc-ture, however, is less stable as in Seq1. The G36Aexchange results in an extended loop that is readilyaccessible to RNase T1, even at low temperature (Figure6B). The flanking regions are more resistant to thisenzyme at 208C, indicating a double-stranded RNA atlow temperature. Residual cleavage by T1 suggests thata minor population might be in an open conformation. Inaccordance with induced expression (Figures 4 and 5),the fraction of single-stranded residues substantiallyincreased with increasing temperature as illustrated bythe accumulation of T1-derived products at nucleotides24 and 25 (see box in Figure 6B and arrows in Figure6C).

Discussion

Heat-inducible systems have been shown to be suitablefor controlled expression of recombinant genes and var-ious industrial applications (Heitzer et al., 1992). Engineer-ing of RNA-based modules to achieve temperature-regulated gene expression is attractive for several reasons.First, cis-active RNA thermometers are independent ofadditional (protein) factors and therefore transferable tovarious biological systems. Second, there is no need forchemical inducers as in the case of riboswitches. Suchinducers often face technical drawbacks, such as poormembrane permeability or high costs in large scale appli-cations. Third, various computational tools have recentlybeen developed to support rational design of RNA ele-ments. Using a two-step approach composed of com-putational design and in vivo screening, we successfullyengineered RNA-based thermosensors.

Prediction of temperature-dependent RNA switches

RNA secondary structures are to a great extent com-posed of complementary base pairs. Algorithms to pre-dict the structure of a given RNA molecule based on themaximal number of base pairs possible have been devel-oped 30 years ago (Nussinov and Jacobson, 1980). Lat-er, experimental data were included to further optimizeprediction quality (Mathews et al., 1999). Matters arecomplicated by the fact that one RNA molecule can oftenfold into two or more different but energetically similarstructures. On the other hand, a given structure might beformed by RNAs with various sequences. Flamm andcolleagues developed a program to calculate sequencesable to fold into two given structures (Flamm et al., 2001).Since RNA folding is strongly temperature-dependent,this parameter was implemented in the program. Ourexperimental study, however, revealed that such theoret-ical assumptions might not necessarily be transferable toan in vitro or in vivo situation. The computer-derivedsequences Seq1 and Seq2 should have resulted in highreporter gene activities at elevated temperatures, whichwas not the case. Furthermore, determination of the RNAstructure of Seq1 in vitro (Figure 6) shows that it falls intothe predicted ON structure, regardless of the tempera-ture. Although the G-residues in the SD sequence in loop



II were accessible to RNAse T1, the small loop was notsufficient to allow entry of the 30S ribosomal subunit,since translation was inefficient. Apparently, it remains achallenge to reliably predict RNA sequences that switchbetween two alternative structures.

A promising approach for RNA regulatorengineering

The power of in vivo screening systems has been widelyused to improve enzyme function and to develop geneticcontrol systems and RNA-based regulators (Buskirk etal., 2003; Haseltine and Arnold, 2007; Yuen and Liu,2007). Also, our study demonstrates that a functionalRNA regulator can be developed successfully by appli-cation of a suitable selection approach. Two findings areespecially remarkable. First, two out of four selected sin-gle-point mutations were selected independently, despitedifferent experimental conditions (Table 2). This mightreflect the limited possibilities to evolve a functional reg-ulator from the given input structures. Such a narrow win-dow for de novo design of a functional RNA thermometeris conceivable, since most RNA structures would beeither too tight or too loose to allow temperature controlin the physiological temperature range.

The second interesting finding is that the combinationof only two-point mutations turned the translation-incom-petent structure Seq1 into a synthetic thermosensor thatis as efficient as natural thermometers. Only minorchanges in the nucleotide composition can have drasticeffects on natural RNA thermometers. Deletion of a singleG-residue that introduces a labile structure in ROSE ele-ments results in a SD sequence that remains base-pairedeven at high temperatures (Chowdhury et al., 2003,2006). On the other hand, single-point mutations canlead to derepression at low temperatures as describednot only for the ROSE thermometer but also for the prfAthermometer of Listeria monocytogenes and the rpoHthermometer of E. coli (Morita et al., 1999; Johansson etal., 2002).

It remains a matter of speculation whether the shortpath to generate an RNA sensor in our study means thatthe starting structure was already close to being an RNAthermosensor or whether many different structures mightbe transformed into an RNA thermosensor by only a fewscreening steps. It is noteworthy that RNA thermometerswith different architectures and riboswitches, whichsense the same metabolite by different structures, havebeen described (Corbino et al., 2005; Narberhaus et al.,2006). Nevertheless, there might be a limitation in thenumber of possible RNA structures with the same func-tionality. In vivo screening approaches starting from ran-dom sequences could help to address how many optionsthere might be in nature.

Materials and methods

Plasmid construction and in vivo screening

To generate plasmids pBO681 and pBO699, oligonucleotidescorresponding to the predicted sequences were ordered (MWG-Biotech, Ebersberg, Germany) and cloned into the NheI andEcoRI restriction sites upstream of bgaB in pBAD-bgaB (Table

1). Plasmid pBO681 served as template for random mutagenesisby error-prone PCR using primers mutbgaBfw and mutbgaBrvto generate pBO684, 685, 686, 690, 692, 694 and 696 (Table 1).Plasmids pBO693 and 695 were generated with the same prim-ers and pBO685 as template. The error-prone PCR was per-formed by using Taq DNA polymerase in PCR buffer w20 mM TrisHCl (pH 8), 10 mM KCl, 6 mM (NH4)2SO4, 2 mM MgSO4=6H2O,0.1% Triton X-100x, 25 pmol of each primer, 3 mM MgCl2 and anucleotide concentration of 0.2 mM each in a total volume of50 ml. To favor misincorporation of nucleotides, the followingmodifications to the standard protocol were used. One of thefour nucleotides dGTP, dATP, dCTP and dTTP were used in four-(0.8 mM) or eight-fold (1.6 mM) excess. In some cases, 0.2 mM

MnCl2 were added in the presence of standard nucleotide con-centration. The PCR program was as follows: initial DNA dena-turation at 948C for 2 min was followed by 35 cycles at 948C for30 s, primer annealing at 408C for 30 s and elongation at 728Cfor 30 s.

PCR products were digested with EcoRI and NheI, cloned intothe corresponding sites upstream of bgaB in pBAD-bgaB andtransformed into E. coli DH5a. Cells were grown on LB agarplates containing X-gal (40 mg/ml) in the presence of 0.01%(w/v) L-arabinose overnight at 308C. Following a temperatureshift to 428C, candidates that turned blue earlier than otherswere collected and the assay was repeated before the b-galac-tosidase activity was measured at 308C and 428C. Plasmidsfrom clones with elevated bgaB expression at 428C were isolat-ed and sequenced.

b-Galactosidase assay

E. coli cells carrying bgaB fusions were grown to exponentialgrowth phase at 308C. Samples of 10 ml were transferred to428C for 30–60 min, before b-galactosidase activity was meas-ured as described previously (Miller, 1972), except that enzymeactivity was measured at 558C. The b-galactosidase activity inFigures 3B and 4A is denoted relative to the activity of Seq1-bgaB at 308C and in Figure 4B relative to the parental construct(Seq1-bgaB for the first three and C10U-bgaB for the last two)at 308C.

Isolation of RNA and Northern blot analysis

Total RNA was extracted from E. coli cells using the hot phenolmethod (Aiba et al., 1981). Equal amounts of total RNA samples(5 mg) were separated on a 1.2% formaldehyde-agarose gel,transferred to a positively charged nylon membrane (Hybond N1;Amersham Biosciences, Buckinghamshire, UK), and hybridizedat 688C using a DIG-HIGH prime labeling and detection kit asper the manufacturer’s protocol (Roche Applied Science, Mann-heim, Germany). The probe used was a 240-bp RNA fragmentcorresponding to the bgaB ORF. Detection was carried out byexposing the blot to a luminescence detector using chemilu-minescence substrate (CSP-D-Star, Roche Molecular Bioche-micals, Mannheim, Germany).

Structure probing experiments

RNA oligomers for structure probing experiments were pur-chased from Vbc biotech (Vbc-biotech GmbH, Vienna, Austria).Partial digestions of 59-end-labeled RNAs with ribonuclease T1were conducted as follows. 30 000 cpm of labeled RNA weremixed with 1 ml 5= TMN buffer (100 mM Tris acetate, pH 7.5,10 mM MgCl2, 500 mM NaCl) and 0.4 mg tRNA, and distilledwater was added to a volume of 4 ml. Samples were pre-incu-bated for 5 min at the indicated temperature, before 1 ml of T1RNase (0.01 U) was added. After 5 min of cleavage, 5 ml for-mamide loading dye was added and the samples were heatedat 958C for 5 min prior to separation on denaturing 8% poly-



acrylamide gels. Alkaline ladders were generated as describedpreviously (Brantl and Wagner, 1994).

Acknowledgments

We thank Christoph Flamm (University of Vienna, Austria) forproviding us with the switch program and for help with com-puting. The work was funded by grants from the GermanResearch Foundation (NA 240 and SPP 1258) to F.N. and a fel-lowship from the Studienstiftung des Deutschen Volkes to J.K.

References

Aiba, H., Adhya, S., and de Crombrugghe, B. (1981). Evidencefor two functional gal promoters in intact Escherichia colicells. J. Biol. Chem. 256, 11905–11910.

Altuvia, S., Kornitzer, D., Teff, D., and Oppenheim, A.B. (1989).Alternative mRNA structures of the cIII gene of bacterio-phage l determine the rate of its translation initiation. J. Mol.Biol. 210, 265–280.

Altuvia, S., Kornitzer, D., Kobi, S., and Oppenheim, A.B. (1991).Functional and structural elements of the mRNA of the cIIIgene of bacteriophage l. J. Mol. Biol. 218, 723–733.

Brantl, S. and Wagner, E.G. (1994). Antisense RNA-mediatedtranscriptional attenuation occurs faster than stable anti-sense/target RNA pairing: an in vitro study of plasmidpIP501. EMBO J. 13, 3599–3607.

Buskirk, A.R., Kehayova, P.D., Landrigan, A., and Liu, D.R.(2003). In vivo evolution of an RNA-based transcriptional acti-vator. Chem. Biol. 10, 533–540.

Chowdhury, S., Ragaz, C., Kreuger, E., and Narberhaus, F.(2003). Temperature-controlled structural alterations of anRNA thermometer. J. Biol. Chem. 278, 47915–47921.

Chowdhury, S., Maris, C., Allain, F.H., and Narberhaus, F. (2006).Molecular basis for temperature sensing by an RNA ther-mometer. EMBO J. 25, 2487–2497.

Corbino, K.A., Barrick, J.E., Lim, J., Welz, R., Tucker, B.J., Pus-karz, I., Mandal, M., Rudnick, N.D., and Breaker, R.R. (2005).Evidence for a second class of S-adenosylmethionine ribo-switches and other regulatory RNA motifs in a-proteobac-teria. Genome Biol. 6, R70.

Curry, K.A. and Tomich, C.S. (1988). Effect of ribosome bindingsite on gene expression in Escherichia coli. DNA 7, 173–179.

Desai, S.K. and Gallivan, J.P. (2004). Genetic screens and selec-tions for small molecules based on a synthetic riboswitchthat activates protein translation. J. Am. Chem. Soc. 126,13247–13254.

Flamm, C., Hofacker, I.L., Maurer-Stroh, S., Stadler, P.F., andZehl, M. (2001). Design of multistable RNA molecules. RNA7, 254–265.

Gallivan, J.P. (2007). Toward reprogramming bacteria with smallmolecules and RNA. Curr. Opin. Chem. Biol. 11, 612–619.

Guzman, L.M., Belin, D., Carson, M.J., and Beckwith, J. (1995).Tight regulation, modulation, and high-level expression byvectors containing the arabinose pBAD promoter. J. Bacte-riol. 177, 4121–4130.

Hanahan, D. (1983). Studies on transformation of Escherichiacoli with plasmids. J. Mol. Biol. 166, 557–580.

Haseltine, E.L. and Arnold, F.H. (2007). Synthetic gene circuits:design with directed evolution. Annu. Rev. Biophys. Biomol.Struct. 36, 1–19.

Heitzer, A., Mason, C.A., and Hamer, G. (1992). Heat shock geneexpression in continuous cultures of Escherichia coli. J. Bio-technol. 22, 153–169.

Hirata, H., Negoro, S., and Okada, H. (1984). Molecular basis ofisozyme formation of b-galactosidases in Bacillus stearo-thermophilus: isolation of two b-galactosidase genes, bgaAand bgaB. J. Bacteriol. 160, 9–14.

Hofacker, I.L. (2003). Vienna RNA secondary structure server.Nucleic Acids Res. 31, 3429–3431.

Isaacs, F.J., Dwyer, D.J., and Collins, J.J. (2006). RNA syntheticbiology. Nat. Biotechnol. 24, 545–554.

Johansson, J., Mandin, P., Renzoni, A., Chiaruttini, C., Springer,M., and Cossart, P. (2002). An RNA thermosensor controlsexpression of virulence genes in Listeria monocytogenes.Cell 110, 551–561.

Lee, J. and Kotov, N. (2007). Thermometer design at the nano-scale. Nano Today 2, 48–51.

Mandal, M. and Breaker, R.R. (2004). Gene regulation by ribo-switches. Nat. Rev. Mol. Cell Biol. 5, 451–463.

Mathews, D.H., Sabina, J., Zuker, M., and Turner, D.H. (1999).Expanded sequence dependence of thermodynamic para-meters improves prediction of RNA secondary structure. J.Mol. Biol. 288, 911–940.

Miller, J.H. (1972). Experiments in Molecular Genetics (ColdSpring Harbor, New York: Cold Spring Harbor LaboratoryPress).

Morita, M.T., Tanaka, Y., Kodama, T.S., Kyogoku, Y., Yanagi, H.,and Yura, T. (1999). Translational induction of heat shocktranscription factor s32: evidence for a built-in RNA thermo-sensor. Genes Dev. 13, 655–665.

Narberhaus, F., Waldminghaus, T., and Chowdhury, S. (2006).RNA thermometers. FEMS Microbiol. Rev. 30, 3–16.

Nocker, A., Hausherr, T., Balsiger, S., Krstulovic, N.P., Hennecke,H., and Narberhaus, F. (2001). A mRNA-based thermosensorcontrols expression of rhizobial heat shock genes. NucleicAcids Res. 29, 4800–4807.

Nudler, E. and Mironov, A.S. (2004). The riboswitch control ofbacterial metabolism. Trends Biochem. Sci. 29, 11–17.

Nussinov, R. and Jacobson, A.B. (1980). Fast algorithm for pre-dicting the secondary structure of single-stranded RNA.Proc. Natl. Acad. Sci. USA 77, 6309–6313.

Penchovsky, R. and Breaker, R.R. (2005). Computational designand experimental validation of oligonucleotide-sensing allo-steric ribozymes. Nat. Biotechnol. 23, 1424–1433.

Suess, B. and Weigand, J.E. (2008). Engineered riboswitches –overview, problems and trends. RNA Biol. 5, 1–6.

Suess, B., Fink, B., Berens, C., Stentz, R., and Hillen, W. (2004).A theophylline responsive riboswitch based on helix slippingcontrols gene expression in vivo. Nucleic Acids Res. 32,1610–1614.

Vitreschak, A.G., Rodionov, D.A., Mironov, A.A., and Gelfand,M.S. (2004). Riboswitches: the oldest mechanism for the reg-ulation of gene expression? Trends Genet. 20, 44–50.

Waldminghaus, T., Fippinger, A., Alfsmann, J., and Narberhaus,F. (2005). RNA thermometers are common in a- and g-pro-teobacteria. Biol. Chem. 386, 1279–1286.

Waldminghaus, T., Gaubig, L.C., and Narberhaus, F. (2007a).Genome-wide bioinformatic prediction and experimentalevaluation of potential RNA thermometers. Mol. Genet.Genomics 278, 555–564.

Waldminghaus, T., Heidrich, N., Brantl, S., and Narberhaus, F.(2007b). FourU: a novel type of RNA thermometer in Sal-monella. Mol. Microbiol. 65, 413–424.

Wieland, M. and Hartig, J.S. (2007). RNA quadruplex-basedmodulation of gene expression. Chem. Biol. 14, 757–763.

Winkler, W.C. and Breaker, R.R. (2005). Regulation of bacterialgene expression by riboswitches. Annu. Rev. Microbiol. 59,487–517.

Yuen, C.M. and Liu, D.R. (2007). Dissecting protein structure andfunction using directed evolution. Nat. Methods 4, 995–997.

Received April 30, 2008; accepted June 25, 2008

D. Translation on demand by a simple RNA-based thermosensor

Jens Kortmann, Simon Sczodrok, Jörg Rinnenthal, Harald Schwalbe


submitted


14

1

Translation on demand by a simple

RNA-based thermosensor

Jens Kortmann, Simon Sczodrok, Jörg Rinnenthal†, Harald Schwalbe† and Franz

Narberhaus1

Lehrstuhl für Biologie der Mikroorganismen, Ruhr-Universität Bochum, 44780 Bochum,

Germany

†Institute for Organic Chemistry and Chemical Biology, Center for Biomolecular Magnetic

Resonance, Johann Wolfgang Goethe-University, 60438 Frankfurt/Main, Germany

Running title: Cyanobacterial RNA thermometer

Keywords: riboregulator; RNA thermometer; post-transcriptional control; heat shock;

photosynthesis; Hsp17

1Corresponding author: Franz Narberhaus, Lehrstuhl für Biologie der Mikroorganismen,

Ruhr-Universität Bochum, Universitätsstrasse 150, NDEF 06/783, 44780 Bochum, Germany.

Tel: +49 (0)234 322 3100; Fax: +49 (0)234 321 4620; E-mail: [email protected]


1

mailto:[email protected]


2

Structured RNA regions are important gene control elements in pro- and eukaryotes.

Here, we show that the mRNA of a cyanobacterial heat shock gene contains a built-in

thermosensor critical for photosynthetic activity under stress conditions. The

exceptionally short 5’-untranslated region is comprised of a single hairpin with an

internal asymmetric loop. It inhibits translation of the Synechocystis hsp17 transcript

at normal growth conditions, permits translation initiation under stress conditions and

shuts down Hsp17 production in the recovery phase. Point mutations that stabilized

or destabilized the RNA structure deregulated reporter gene expression in vivo and

ribosome binding in vitro. Introduction of such point mutations into the Synechocystis

genome produced severe phenotypic defects. Reversible formation of the open and

closed structure was beneficial for viability, integrity of the photosystem and oxygen

evolution. Continuous production of Hsp17 was detrimental when the stress declined,

indicating that shutting-off heat shock protein production is an important, previously

unrecognized function of RNA thermometers. We discovered a simple biosensor that

strictly adjusts the cellular level of a molecular chaperone to the physiological need.


2

3

Introduction

Cyanobacteria are ubiquitiously distributed on earth and - together with plants - provide the

foundation of aerobic life by the photosynthetic generation of oxygen. The integrity of the

photosynthesis machinery is challenged by highly fluctuating environmental conditions. In

particular, heat, high light intensities, reactive oxygen species, salt and metal stress are

known to cause defects of the thylakoid membrane-associated photosystems (1,2).

The small heat shock protein Hsp17 (also known as Hsp16.6 or HspA) is essential for

stress tolerance in the model cyanobacterium Synechocystis sp. PCC 6803 (3,4). Hsp17

belongs to the ubiquitous family of α-crystallin-type ATP-independent chaperones (5). Small

heat shock proteins (sHsps) capture unfolded proteins to prevent formation of irreversible

aggregates (6). Synechocystis Hsp17 not only possesses protein-protective activity but also

stabilizes the lipid phase of membranes, thus maintaining thylakoid membrane integrity

under stress conditions (7).

The exposure of Synechocystis to a sudden increase in temperature or light intensity

triggers expression of the heat shock regulon including hsp17 (3,8). Shifting Synechocystis

cells from 34°C to 44°C results in a more than 60-fold induction of hsp17 mRNA (9). Global

gene expression profiling revealed a 20-fold induction of the hsp17 transcript under light

stress (8). Transcription of heat shock genes, including hsp17, was shown to rely on the

alternative sigma factors SigB and SigE (10,11). Furthermore, hsp17 transcription is strongly

regulated by changes in the physical order of membranes (12). A combined transcriptomics

and proteomics approach suggested that regulation of heat shock gene expression in

Synechocystis is governed by transcriptional and yet unknown translational regulation

(9,11,13,14).

In recent years, the universal importance of regulatory RNAs as posttranscriptional

gene control elements has been recognized (15,16). In bacteria, small regulatory RNAs

(sRNAs) are very abundant regulators that often act through base-paring with target mRNAs,

thereby modulating translation efficiency and mRNA stability (17,18). Biocomputational

predictions and experimental strategies have revealed several hundred sRNAs in


3

4

Synechocystis; some acting as trans-encoded regulatory RNAs with short and discontinuous

complementary to their targets, others as cis-encoded perfectly complementary antisense

RNAs (19-21).

In contrast to numerous sRNAs mRNA-inherent riboregulators like riboswitches and

RNA thermometers have received little attention in cyanobacteria. Riboswitches are mRNA

leader sequences that fold into a complex structure whose conformation changes upon

ligand binding (22). RNA thermometers are translational control elements built-into the 5’-

untranslated region (5’-UTR) of bacterial heat shock or virulence genes (23). Typically, they

fold into a complex structure that traps the Shine-Dalgarno (SD) sequence at low

temperatures. An increase in temperature to 37°C (virulence genes) or higher (heat shock

genes) destabilizes the structure, liberates the SD sequence and permits formation of the

translation initiation complex. Functionality of RNA thermometers in the relevant temperature

range of mesophilic bacteria requires a structure that is stable enough to resist opening at

temperatures below 30°C but sufficiently unstable to melt as the temperature increases. This

can be achieved by a delicate balance of Watson-Crick base pairs, internal bulges and loops

and non-canonical base pairing (24-27).

An RNA thermometer-like structure is located in the 5’-UTR of the Synechocystis

hsp17 transcript. The hairpin engages the SD sequence and part of the AUG start codon in a

secondary structure, contains an internal loop and might thus act as RNA thermometer (Fig.

1A). With only 44 nucleotides in length, the hsp17 5’-UTR is the smallest natural

thermometer candidate discovered yet. In this work, we provide genetic and biochemical

proof that it acts as bona fide RNA thermometer that has important not previously described

physiological functions.


4

5

Materials and methods

Strains and growth conditions

E. coli cells (DH5α and DH5αZ1) were grown at 28 or 37°C in Luria-Bertani (LB) medium

supplemented with ampicillin (Ap, 150 µg/ml) or chloramphenicol (Cm, 50 µg/ml). For

induction of the pBAD promoter in strains carrying translational bgaB fusions, 0.01% (w/v) L-

arabinose was added. Expression of translational gfp fusions was induced via inactivation of

the Tet repressor with 50 ng/ml doxycycline.

Synechocystis cells were grown under low light conditions (30 µmol photons m-2s-1) at 28°C

on BG11/agar (28) plates or in BG11 liquid media as described (29). Liquid media was

supplemented with 5 mM glucose when appropriate.

For the measurement of chlorophyll concentrations, cells were sedimented by centrifugation

and extracted with 100% methanol. The concentration of chlorophyll was calculated from the

absorbance values of the extract at 666 and 750 nm (30).

Plasmid construction

The hsp17-bgaB fusion (pBO1293) was constructed by transfer of the hsp17 5’-UTR from

pBO1292 upon NheI/EcoRI digestion into the corresponding site in pBO415 (Table S1). To

obtain the translational gfp fusion (pBO1325), the hsp17 5’-UTR was transfered from

pBO1292 via NheI and an introduced PstI site into pXG-10 (31). Site-directed mutagenesis to

generate pBO1312, 1310, 1311, 1316, 1314, 1315, 1313, 1801 and 1802 was performed

according to the instruction manual of the QuikChange® mutagenesis kit (Stratagene, La

Jolla, USA). Plasmid pBO1292 served as a template for PCR with mutagenic primers (Table

S1). The inserts containing mutated hsp17 UTRs were isolated upon NheI/EcoRI or PstI/

NheI digestion and cloned into the corresponding site upstream the bgaB or gfp gene,

respectively. The entire hsp17 coding region including its 5’-UTR was amplified and cloned

into pUC18 (pBO1347) for subsequent site directed mutagenesis (Table S1). Using unique

restriction sites BamHI/CpoI, hsp17 thermometer variants rep, derep and WT were cloned

into pNaive.16 (29) resulting in pBO1834, 1806 and 1807. The correct nucleotide sequence


5

6

was confirmed by automated sequencing (eurofins, Martinsried, Germany). pNaive.16

(pAZ877) was provided by Prof. Dr. Elisabeth Vierling (University of Arizona).

RNA and protein detection

Preparation of total RNA from E. coli and Northern analysis followed previously published

protocols (32). Preparation of total RNA from Synechocystis was performed with a Qiagen

RNeasy® kit (Qiagen, Hilden, Germany) according to the instruction manual. RNAs were

detected with a DIG-labeled bgaB or hsp17 RNA probe, respectively. The DIG-HIGH prime

labeling kit (Roche Applied Science, Mannheim, Germany) was used for preparation of

probes (see Table S1 for details). For E. coli protein extraction, cell pellets were resuspended

in lysis buffer (10 mM sodiumphosphate, pH 7.0, 20% glycerol, 0.5 mM DTT) according to

their cell density (100 µl buffer per OD580 of 1.0). SDS sample buffer was added, cells were

boiled for 5 min and equal volumes were subjected to SDS-PAGE. Synechocystis whole cell

lysates were prepared according to Klinkert et al. (33). Soluble fractions corresponding to 20

µg of chlorophyll were separated on 12.5% polyacrylamide gels. SDS-PAGE and Western

blot was performed as described (34). GFP was detected on a Western blot using a

polyclonal α-GFP antibody (abcam209; Abcam, Cambridge, USA). Hsp17 antigen was

revealed by α-Hsp17 antibody, kindly provided by Prof. Dr. Elisabeth Vierling (University of

Arizona). Signals were detected with a ChemiImager™ Ready (Alpha Innotech, Biozym,

Wien, Austria).

In vitro transcription

RNAs were synthesized in vitro by runoff transcription with T7 RNA polymerase from

linearized plasmid templates. Plasmids pBO1301, 1304 and 1302 (linearized with MlsI) were

used to generate RNA for enzymatic structure probing and plasmids pBO1305, 1349 and

1348 (linearized with HpyCH4V) to generate RNA for toeprinting experiments (Table S1).


RNA structure formation at either 28 and 42°C was compared. RNA was 5’-end labeled as

described (35). Partial digestion of 5’-end-labeled RNAs with ribonucleases T1 (0.004U and


6

7

0.01U), V (0.008U and 0.02U) was conducted according to Waldminghaus et al. (32). For

chemical probing, labelled RNA was mixed with 2 µl 5x lead buffer (250 mM tris acetate pH

7.5, 25 mM Mg acetate; 250 mM Na acetate) and 1 µ g tRNA in a total volume of 10 µl.

Lead(II) probing assay was conducted as described (36). RNA fragments were separated on

denaturing 8% polyacrylamide gels. Alkaline ladders were generated as described previously

(35).

Toeprinting analysis

Primer extension inhibition experiments were carried out using 30S ribosomal subunits,

target mRNA and tRNAfMet basically according to (37). The 5’-[32P]-labeled hsp17-specific

oligonucleotide hsp17therm-runoff-toeprint (Table S1) was used as a primer for cDNA

synthesis. An aliquot of 0.08 pmol mRNA (5’-UTR plus 63 nt of the hsp17 coding region)

annealed to the oligonucleotide was incubated for 10 min at 28 or 42°C, respectively,

together with 16 pmol of uncharged tRNAfMet (Sigma-Aldrich, St. Louis, Missouri). 6 pmol of

30S subunits or water (negative control) was added and incubation for another 10 min

followed before 2µl of MMLV-Mix (VD+Mg2+-buffer, BSA, dNTPs and MMLV reverse

transcriptase (USB, Cleveland, Ohio)) was added. cDNA synthesis was performed at 28°C.

Reactions were stopped after 10 min by adding formamide loading dye and aliquots were

separated on a denaturing 8% polyacrylamide gel.

CD spectroscopy

Circular dichroism (CD) unfolding and refolding curves were recorded with a JASCO

spectropolarimeter J-810. RNA concentration was adjusted to 25 µM. Buffer

conditions: 15 mM KxHy(PO4), 25 mM KCl, pH 6.5. CD unfolding curves were recorded with a

temperature slope of 1°C/min at a wavelength of 263 nm between 5°C-90°C. CD refolding

curves were recorded with a temperature slope of -1°C/min starting from 90°C to 5°C. The

CD melting curves were normalized to determine the fraction of the unfolded RNA α(T)

according to Equation (1).


7

8

(1)

In Equation (1) T is the temperature, θ(T) the ellipticity in [mdeg], θunfolded(T) the ellipticity

of the unfolded RNA, θfolded(T) the ellipticity of the folded RNA and α(T) the temperature

dependent fraction of unfolded RNA (RNAunfolded) with respect to the total amount of RNA

(RNAtotal). At the melting temperature Tm the fraction of unfolded RNA is α(Tm) = 0.5.

The normalized CD unfolding and refolding curves were fitted according to Hill’s equation

In Equation (2) Tm is the melting temperature of the RNA, a the amplitude, T the temperature

and b the Hill coefficient. The Hill coefficient is a measure for the cooperativity of the RNA

unfolding transition. High Hill coefficients indicate sharp unfolding transitions while low Hill

coefficients indicate a gradual transition from the folded to the unfolded conformation.

β-Galactosidase assays

β-Galactosidase activities of E. coli strains carrying bgaB-fusions (pBO1312, 1310, 1311,

1316, 1314, 1315, 1313, 602 and 1056 Table S1) were measured as described previously

(38), except that enzyme activity was measured at 55°C.

GFP-fluorescence assays

25 ml of LB-Cm medium was inoculated with 2 ml of E. coli DH5αZ1 overnight cultures,

carrying translational gfp-fusions (pBO1325, 1801 and 1802, Table S1) of the respective

hsp17 thermometer variants. Cultures were grown at 28°C to a final OD600 of 0.5 to 0.6. 10

ml of the culture was transferred to a prewarmed flask at 42°C. Subsequent to heat shock,

cells were shifted to 28°C for 90 min to allow full maturation of GFP-fusion proteins. Aliquots

were taken for Western analysis. Two times 2.5 ml of cells were spun down (13.000 rpm, 1

min) and resuspended in 500 µl 1x PBS buffer. 10 µl of cell suspension was pipetted on


8

(2)

9

object slides and fixed with 10 µl 0.5% low-melting agarose. The samples were analyzed

under a fluorescence microscope (BX51; Olympus, Hamburg, Germany).

Engineered Synechocystis strains

The Synechocystis strains used in this work were generated by transforming pNaive- hsp17

derivates (pBO1834, 1806 and 1807) into the kanamycin-resistant hsp17 deletion strain

HK1-1 (Kosaka and Fukuzawa, Kyoto University, Japan) kindly provided by Prof. Dr.

Elisabeth Vierling (University of Arizona). Transformations were performed according to

Klinkert et al. (33), prior to selecting for increasing spectinomycin resistance, at

concentrations up to 250 µg/ml spectinomycin dihydrochloride as described (29).

Homologous recombination of the hsp17 variants (WT, rep and derep) into Synechocystis

genome was confirmed by PCR, Northern and Western analysis.

Synechocystis heat shock assays

Heat shock treatments (42°C) for subsequent analysis were conducted by shifting cells from

28°C to prewarmed flasks at 42°C for various time lengths as indicated in the figure legends.

Synechocystis high light stress assays

High light experiments were performed by exposing cells to 600 µmol of photons m-2s-1 at

28°C for various time lenghts as indicated in the figure legends.

Chlorophyll determination

Chlorophyll determinations of Synechocystis cells was based on the method described by

Porra et al. (39). 500 µl of each culture was pelleted and resuspended in 1 ml MeOH prior to

sonification for 15 minutes. After centrifugation, absorbance of the supernatant was read at

652, 665.2 and 750 nm on a Novaspec spectrophotometer (Pharmacia Biotech, Freiburg,

Germany). Chlorophyll a (Chl a) concentration was calculated using the following formula:

Concentration (Chl a) [mg/ml] = 18.22 x (OD665.2 – OD750) – 9.55 x (OD652 – OD750)


9

10

Thylakoid stability assays

In vivo examinations of thylakoid thermostability were conducted with a luminescence

spectrometer (Aminco Bowman II, Thermo Fisher Scientific, Langenselbold, Germany) as

described (12). The temperature of respective Synechocystis cultures („WT“, Rep and

Derep) was increased at 2°C/min. Thylakoid photostability was determined by exposing cells

to high light at 28°C for 380 min. Changes in chlorophyll a (Chl a) fluorescence were

measured every 20 min.

Photosynthetic assays

A water-cooled Clark-type electrode (Bachofer, Reutlingen, Germany) was used to measure

the photosynthetic rates of Synechocystis strains carrying different hsp17 mutations.

Samples of heat shocked or high light stressed cells were immediately transfered to an

oxygen electrode chamber. To prevent CO2 depletion, 1mM NaHCO3 was added to the

culture as described (3). For analysis of cellular recovery, cells were transfered to

physiological conditions (28°C and low light).

In silico RNA structure prediction

RNA secondary structures were predicted by using the mfold server (http://

frontend.bioinfo.rpi.edu/applications/mfold/cgi-bin/rna-form1.cgi) running version 3.2 (40).


10

http://frontend.bioinfo.rpi.edu/applications/mfold/cgi-bin/rna-form1.cgi




11

Results

Characterization of the first cyanobacterial RNA thermometer

In contrast to other RNA thermometers, the 5’-UTR of Synechocystis hsp17 exhibits a rather

minimalistic architecture. Based on the previously determined transcription start site (41,42),

the calculated structure of the 5’-UTR consists of a single hairpin of 44 nucleotides, in which

the SD sequence site is flanked by two loops, the internal asymmetric L1 loop and the large

L2 loop at the top (Fig. 1A). Nearly perfect canonical base pairing exists between the SD

(AGGAG) and the anti-SD (UCCUU) sequence. The AUG triplet is only partially embedded in

the structure at the base of the hairpin. The calculated free energy of the entire structure is

-5.5 kcal mol-1 (mfold; (40)).

A well-established Escherichia coli reporter gene system (27) was used to test

whether the cyanobacterial RNA element is able to confer temperature-dependent

translational control. The hsp17 5’-UTR element was cloned between the L-arabinose-

inducible pBAD promoter and the bgaB gene coding for a heat-stable β-galactosidase (43)

(Fig. 1B). At 28°C the wildtype (WT) fusion allowed a basal β-galactosidase activity of 30 MU

that increased 6-fold to 180 MU after a shift to 42°C (Fig. 1C). The induction by the hsp17 5’-

UTR is comparable to the Salmonella agsA fourU thermometer in our control experiments

and clearly exceeds induction of a control fusion to the 5’-UTR of the E. coli housekeeping

gene gyrA coding for the DNA gyrase.

As the efficiency of translation initiation correlates with the accessibility of the

ribosome binding site (44,45), stabilizing and destabilizing point mutations should have an

impact on RNA thermometer function. Selected sites for oligonucleotide-directed

mutagenesis are outlined in Fig. 1A. The first set of mutations (M1 to M4) was aimed at

stabilizing the overall thermometer structure. Indeed, M1, M2 and M3 significantly lowered

expression both at 28°C and at 42°C (Fig. 1C). Introduction of a G-C pair instead of the

kinked internal loop in M1 (AAC39-41G; henceforth called rep for “repressed”) resulted in

complete loss of reporter activity at both low and high temperatures. Mutation M2 (U17C)


11

12

A

C

B

D


12

Figure 1. Translational control by the hsp17 UTR element in E. coli. (A) The secondary structure as predicted by the mfold program (40) of the entire hsp17 5’-UTR is shown. The start codon (AUG,

marked by gray box) is located 45 nucleotides downstream of the transcription start site. The SD and anti-SD sequences, loop1 (L1) and loop2 (L2) are labelled. Site-directed mutations M1 to M4 and the

exchanged nucleotides are denoted in red letters; RR, variable nucleotides derived from random mutagenesis (primer: hsp17therm-M4-fw + hsp17therm-M4-rv, Table S1). (B) Schematic

representation of the reporter gene fusion on plasmid pBAD-bgaB. Additional nucleotides inserted due to the position of the NheI cloning site relative to the pBAD promoter are indicated by a box upstream

of the 5’-UTR. The artifical nucleotides at the 5’ end of the hsp17 transcript do not influence RNA folding and expression of the gene (data not shown). (C) Expression of the translational bgaB reporter

fusions (Miller Units, MU) to various hsp17 5’-UTRs. E. coli DH5α cells containing the corresponding

plasmids were grown in LB medium at 28°C and either kept at this temperature (white columns) or transferred to 42°C (black columns) for 30 min before β-galactosidase activity was measured. All

experiments were repeated at least in triplicate. Induction rates are shown above each fusion. A Salmonella agsA-bgaB fusion (fourU element; (27) was used as a positive control (C.1), while E. coli

13

substituted a G-U base pair by a more stable G-C base pair resulting in tighter repression at

both temperatures. M3 (U22G) was constructed to reduce the size of loop L2 (Fig. 1A). The

extra G-C pair provided additional stability to the stem and reduced β-galactosidase activity

at 28°C and 42°C but retained a 5-fold induction (Fig. 1C).

A collection of destabilizing mutations was obtained by partially randomized

oligonucleotides that introduced various nucleotides at the positions C19 and C20 (see

Material and Methods and supplementary Table S1). Four different hsp17 5’-UTR variants

(M4.1-M4.4) that were predicted to reduce the thermodynamic stability of the SD/anti-SD

interaction resulted in elevated expression at 28°C and 42°C (Fig. 1C). As an example, the

M4.4 variant (henceforth called derep for “derepressed”) produced 200 and 790 MU (as

compared to 30 and 180 MU, respectively, in the WT). Elevated reporter gene activity at

28°C resulted in reduced heat induction (2.5 to 3.9-fold) by all four constructs.

To demonstrate that the changes in expression levels at different temperatures were

due to translational control rather than to different transcript levels, we conducted Northern

blot experiments (Fig. 1D). The amounts of WT, rep and derep mRNAs were monitored at

28°C and 42°C using a probe directed against the coding region of the bgaB reporter gene.

Temperature changes had no influence on the steady-state level of the transcripts.

Translational control by the hsp17 5’-UTR was further assessed by a newly

developed green-fluorescent protein (gfp)-based reporter system (Fig. 2A). In contrast to the

bgaB system, it does not add any vector-derived nucleotides to the 5’ end of the transcript.

Transcription is driven by the PLtetO-1 promoter and initiates at the natural +1 site immediately

at the 5’ end of the inserted fragment (46). In E. coli DH5αZ1, this promoter is tightly

repressed by the Tet repressor and can be regulated by supplying 50 ng/ml doxycycline to

the culture. Western analysis demonstrated doxycycline-dependent and temperature-


13

gyrA-bgaB (27) served as a negative control (C.2). Absolute β-galactosidase levels are listed in Table S2. (D) mRNA levels of hsp17-bgaB fusions before and after heat shock. Total RNA was extracted

from E. coli cultures incubated at either 28 or 42°C. Equal amounts were separated on a 1.2% denaturing agarose gel and Northern blot experiments were carried out using digoxygenin-labeled

RNA probes to detect bgaB transcripts. Ethidum-bromide stained rRNAs from the gel before blotting are shown as loading control. The bgaB fusion transcript runs at 2 kb.

14

controlled expression of the translational WT fusion (Fig. 2B). In case of the rep fusion,

expression occurred neither at 28°C nor at 42°C confirming the importance of loop L1 for

thermometer function. The derep fusion produced equal amounts of GFP protein at both

A

B

C

Figure 2. The hsp17 5’-UTR controls gfp expression in E. coli. (A) Schematic representation of the reporter gene fusions on the low-copy vector pXG10 (31). (B) Detection of GFP fusion proteins. E.

coli DH5αZ1 cells (46) carrying reporter plasmids with the WT, rep and derep hsp17 UTR element

were grown in LB medium at 28°C. Following heat shock as described in the legend to Fig. 1C, cells were incubated at room temperature for 90 min to allow fully maturation of GFP fusion proteins.

Samples were subjected to Western blot analysis using monoclonal α-GFP antibodies. Transcription

of the gfp fusions was induced by application of doxycycline (50 ng/ml), which inactivates the Tet

repressor. (C) Aliquots from the same samples were inspected by phase contrast and fluorescence microscopy. GFP fluorescence was excited at 460 nm, and light emission was recorded using a 510

nm filter. Representative examples are shown from three independent experiments, all of which gave similar results.


14

15

28°C and 42°C. The determined protein levels were fully reflected by GFP fluorescence in

vivo (Fig. 2C). Fluorescence microscopy revealed weak basal GFP activity at 28°C from the

WT fusion that was enhanced when cells were shifted to 42°C. The rep variant produced no

fluorescence at all, whereas cells containing the derep fusion emitted fluorescence at both

temperatures.

Taken together, the 5’-UTR of the Synechocystis hsp17 gene displays all features

characteristic of a typical RNA thermometer when tested in E. coli reporter systems. The rep

and derep versions are presumably locked into “closed” and “open” states, respectively.

Temperature-mediated structural changes in the hsp17 leader sequence

To map the structure and temperature responsiveness of the hsp17 5’-UTR in vitro, we

synthesized WT, rep and derep fragments by T7 RNA polymerase-mediated in vitro

transcription and performed comparative enzymatic and chemical probing experiments.

Cleavages introduced at 28 and 42°C by lowest enzyme or lead(II) concentrations,

respectively, were used for structural interpretations. The cleavage pattern of the WT UTR

after limited digestion with various RNases indicated that the computer-predicted structure

(Fig. 1A) is almost correct (Fig. 3A). Nucleotide G9 proposed to mask the uridine of the AUG

start codon appeared to be partially single-stranded at 28°C and became highly susceptible

to RNase T1, which cuts 3’ of single-stranded nucleotides, at 42°C. Temperature-mediated

disengagement of the AUG start codon was also suggested by enhanced T1 cleavage of

G47 at 42°C. The SD sequence-forming nucleotides G33, G34 and G36 were moderately

cleaved by RNase T1 at 28°C. The susceptibility of this region was significantly increased at

42°C, providing evidence for temperature-induced liberation of the SD region. G36 was most

sensitive towards RNase T1 suggesting that melting initiates from L1 towards G36.

The structure of the rep RNA clearly deviates from the WT structure (Fig. 3A). Absent

T1 cuts supported the predicted tight structure. Nucleotides U42 and A43 were cleaved by

RNase V at low and high temperature suggesting permanent sequestration of the start

codon. RNase V primarily cleaves double-stranded and stacked regions. The anti-SD

nucleotides were also cleaved by RNase V at 28 and 42°C. Most importantly, the SD


15

16

sequence did not become accessible to RNase T1 at 42°C indicating a “closed” state, in

which the SD sequence is not accessible to the 16S rRNA.

Figure 3. Enzymatic and chemical probing of hsp17 UTR variants. (A-B) Enzymatic hydrolysis and lead(II)-induced cleavages performed on 5’-end-labeled hsp17 5’-UTR at 28°C or 42°C. The

conditions for RNase and lead(II) concentrations were as follows: (A) RNase T1 (0.004U and 0.01U), RNase V (0.008U and 0.02U); (B) lead(II) (10 and 20 mM). RNA fragments were separated on 8%

polyacrylamide gels. Lanes N, controls without RNase or modifying agents; lanes T, RNase T1 cleavages under denaturing conditions; lanes L, alkaline ladder. SC (Start Codon), L1 (internal

Loop1), SD (Shine Dalgarno), L2 (Loop2) and anti-SD regions are indicated. (C) Computer-predicted secondary structures and enzymatic and lead(II)-induced cleavage sites of WT and mutated hsp17

UTRs. Cleavage sites introduced at 28°C by lowest enzyme or lead(II) concentrations are depicted by arrows as indicated. Circled nucleotides are highly susceptible to RNase T1 at 42°C. Enhanced

lead(II) cleavage at 28°C occured at nucleotides marked by asterisks.

A B

C


16

17

In the derep RNA, the introduction of two Gs instead of two Cs at position 19 and 20

(pairing with the two Gs of the SD sequence in the WT RNA, Fig. 1A) resulted in an altered

and less stable structure with a shifted L2 loop and a wider L1 loop (Fig. 3C). The instable

structure at low temperature was most evident by chemical probing (Fig. 3B). Lead was used

as a single-strand-specific probe to detect subtle conformational changes in rather flexible

regions, e.g. internal loops and bulged nucleotides (47). Nine nucleotides (A12, U13, C14,

U44, and in particular A15, A16, C41, A42, U43) in or flanking the internal loop L1 of the

derep RNA were attacked by lead (II) at 28°C. Loop L1 of the WT structure was much less

sensitive towards lead(II). Lead probing confirmed the predicted existence of the L2 loop in

the WT and rep RNAs. The SD sites of all RNAs remained unaffected by lead(II) attack

probably due to strong base stacking of the purine nucleotides.

Collectively, these results support the model that the 5’-UTR of Synechocystis hsp17

blocks access to the SD sequence at low temperatures and responds to a temperature

upshift by melting that liberates the ribosome binding site.

To provide further evidence for the melting process and the differences between the

three RNA species, commercially synthesized RNA was subjected to temperature-gradient

circular dichroism (CD) spectrometry (Fig. 4A). The unfolding curves exhibit Tm values of

45.1°C for the derep RNA, 50.2°C for the WT RNA and 56.9°C for the rep RNA. Sigmoidal

Figure 4. Melting studies of hsp17 thermometer element by CD spectroscopy. (A) Temperature-dependent fraction of unfolded RNA α(T) of the hsp17 WT (blue line), derep (black line) and rep (red

line) RNA as derived from CD unfolding curves recorded at a wavelength of 263 nm. (B) Comparison

of unfolding and refolding α(T) curves of the hsp17 WT RNA as derived from CD unfolding and

refolding curves recorded at a wavelength of 263 nm.

A B


17

18

fitting of the α(T) curves results in Hill coefficients of b = 6.1 for the derep RNA, b = 4.2 for

the WT RNA and b = 8.2 for the rep RNA. Unfolding and refolding curves of the WT RNA are

nearly identical (Fig. 4B) indicating that unfolding is a completely reversible process.

Temperature-controlled ribosome binding to the hsp17 thermometer

In order to directly examine binding of the ribosome to the Synechocystis hsp17 5’-UTR, we

performed toeprinting (primer extension inhibition) assays. Complex formation between the

radio-labelled primer, 30S ribosome and initiator tRNA and the hsp17 UTRs (WT and derep:

104 nucleotides; rep: 102 nucleotides; see full length products in Fig. 5) was allowed at 28°C

or 42°C. The extent of ternary complex formation was determined by primer extension.

Prematurely terminated products (toeprints) corresponding to the +17 position downstream

Figure 5. Temperature-dependent ribosome binding to the hsp17 5’-UTR. Toeprinting was carried out on 2 pmol of WT, rep and derep RNAs as described in Materials and Methods. The absence (-) or

presence (+) of 30S subunits is indicated. Terminated reverse transcription products (toeprints) at position +17 relative to the A of the translation start codon and full-length products are pointed out by

arrows. TGCA refers to a sequencing ladder generated with the same oligonucleotide as in the toeprint experiments. The position of the start codon is boxed.


18

19

of the AUG start codon were expected if ribosome was bound to the RNA. At 28°C, the

majority of reverse transcripts were extended to the 5’ end of the template (Fig. 5). Only

small amounts of truncated cDNAs were obtained at the characteristic toeprint position. In

contrast, prominent toeprint signals accompanied by a reduced yield of full-length cDNA

occurred at 42°C indicating that formation of a translation initiation complex was greatly

stimulated at heat shock temperatures.

The complete absence of a toeprint signal when the rep RNA was used and

constitutive, temperature-independent formation of a ternary complex with the derep RNA

confirmed the importance of the RNA architecture for ribosome binding.

Introduction of hsp17 thermometer variants into the Synechocystis background

As reported previously, inactivation of the Synechocystis hsp17 gene results in reduced

thermotolerance and thylakoid stability under heat stress conditions (3,48). Conversely,

constitutive expression of hsp17 confers thermotolerance and protection of the

photosynthetic apparatus (49). This offers the unique opportunity to test for the physiological

importance of the hsp17 thermometer element. We made use of a Δhsp17 mutant and

engineered stable Synechocystis strains carrying chromosomally integrated WT, rep and

derep 5’-UTRs upstream of hsp17 (henceforth called „WT“, Rep and Derep strains). The

Synechocystis HK-1 strain, which lacks the hsp17 open reading frame sll1514 (50) was used

for homologous recombination via flanking sequences enabling selection for increasing

spectinomycin resistance (Fig. 6A). Correct insertion into the Synechocystis genome was

confirmed by PCR (data not shown).

Expression of hsp17 in the recombinant strains was assayed by Northern and

Western blot analyses. All three strains produced comparable amounts of hsp17 mRNA (Fig.

6B and C). Consistent with previous results (42), the level of hsp17 transcript was low at

28°C and increased after a shift to 42°C for 1 hour (Fig. 6B). Despite the presence of hsp17

mRNA, the small heat shock protein was not detectable at low temperature suggesting

translation inhibition. Hsp17 protein accumulated at 42°C. The Rep strain was incapable of

translating hsp17 mRNA whereas the Derep mutant synthesized equal amounts of Hsp17 at

28°C and at 42°C.


19

20

Induction of hsp17 in Synechocystis occurs not only after heat-shock but also after

exposure to strong visible light (8). As Synechocystis cells exposed to 300 µmol photons

m-2s-1 transcribe only little hsp17 mRNA (3), we choose higher light intensities of 600 µmol

photons m-2s-1 for 30 min. Light stress-dependent synthesis of Hsp17 in „WT“, Rep and

Derep cells followed the same pattern as in heat-shocked cells; i.e. it was induced, absent or

constitutively high, respectively (Fig. 6C). Comparative Western blot analysis showed that

heat shock is a stronger inductor of hsp17 expression than high light stress (Fig. S2).

Moreover, Hsp17 protein is a very stable protein as it was still traceable in the late recovery

phase (60 min post-shock) of stressed „WT”, Rep and Derep strains.

Figure 6. Effect of chromosomally integrated hsp17 UTR variants on Hsp17 production in Synechocystis. (A) Outline of the strategy for construction of hsp17 mutants. The Synechocystis

HK-1 (Δhsp17) strain was used for integration of hsp17 and its 5’-UTR via upstream (red) and

downstream (blue) flanking sequences. SmR, spectinomycin resistance; KmR, kanamycin resistance. Homologous recombination resulted in generation of the so-called „WT“, Rep and Derep strains. (B and C) Determination of hsp17 mRNA and Hsp17 protein levels by Northern and Western analysis, respectively. (B) Total RNA and protein was extracted from Synechocystis cells incubated at either 28

or 42°C. Ethidium bromide stained 16s rRNA served as a loading control in Northern blot experiments. Equal amounts of total protein were checked by Coomassie-stained SDS-PAGE gels

(data not shown). A digoxygenin-labelled RNA probe was used to detect hsp17 transcripts, Hsp17 protein was detected via monoclonal α-Hsp17 antibody. (C) Synechocystis cells were incubated under

low light (LL: 30 µmol photons m-2s-1) or high light (HL: 600 µmol photons m-2s-1) conditions at 28°C

for 30 min. Temperature-stability of the culture was monitored. Subsequent Northern and Western analysis was conducted as described above.

A

B C


20

21

Open and closed hsp17 UTRs confer growth defects under stress conditions

In order to determine their stress resistance, Synechocystis „WT”, Rep and Derep strains

were challenged with different stress conditions. First, cells were exposed to a 6 h heat

shock at 42°C and subsequently incubated at 28°C under low light conditions (30 µmol

photons m-2s-1) for 5 days (Fig. 7A, top panel). The pale phenotype showed that the Δhsp17

strain was sensitive to this treatment. The complemented „WT” strain was protected, and the

Rep and Derep mutants behaved like the Δhsp17 and „WT” strain, respectively.

Heat sensitivity of the Δhsp17 and Rep strains coincided with a reduced Chlorophyll a

(Chl a) content (1.0 mg/ml in Δhsp17 and 1.5 mg/ml in Rep compared to 6.0 mg/ml in „WT”

cells; Fig. 7B). As Chl a is functionally linked to PSII reaction centers, the reduced Chl a

concentrations suggest a defective photosynthetic apparatus in the absence of Hsp17. When

the four strains were exposed to high light (600 µmol photons m-2s-1) for 6 h at 28°C, they

displayed a similar phenotype as after heat stress (Fig. 7A, second panel). However, light

stress caused less Chl a decay in Δhsp17 and Rep cells (3-fold and 2-fold, respectively; Fig.

7B) indicating a milder impact on cellular fitness. A defect of the Derep mutant became

evident when a combined heat/light stress was applied (Fig. 7A, third panel) suggesting that

permanent overproduction of Hsp17 alters cell physiology. Here, a heat shock for 1 h was

applied prior to 5 h high light exposure. While the „WT” strain was protected against this

severe stress, the Δhsp17 and the Rep strain were equally sensitive. The Derep mutant

showed an intermediate phenotype retaining one third of its original Chl a content (Fig. 7B).

The importance of appropriate amounts of Hsp17 for the fitness of Synechocystis was

further demonstrated by growth tests in the presence (heterotrophic growth) or absence

(phototrophic growth) of glucose. The Rep mutant had a strongly reduced growth rate

compared to the „WT” under all stress conditions tested (Fig. 7C). The Derep strain grew well

heterotrophically in the presence of glucose. Only under combined heat/light stress

conditions the growth rate was reduced by 10%. Under photosynthetic growth conditions in

the absence of glucose, however, the Derep strain suffered from continuous Hsp17

production. The growth rate was reduced to 60 % under light stress and to 40% under heat/


21

22

A

B

C


22

Figure 7. Stress-induced phenotypes of Synechocystis hsp17 mutants. (A) Cells were grown to early log phase prior to stress treatment. HS, cells were incubated at 42°C for 6 h; HL, cells were

exposed to 600 µmol photons m-2s-1 for 6 h; HL*, cells were incubated at 42°C for 60 min prior to 5 h

HL (600 µmol photons m-2s-1) treatment. Following the different stress conditions, the cultures were

transferred to 28°C and LL conditions for 5 days. Before documentation, cultures were diluted to an

23

light stress suggesting that deregulated hsp17 expression in particular affects the

photosynthetic apparatus.

Open and closed hsp17 thermometer elements affect photosynthesis activity of

Synechocystis

The Hsp17 protein stabilizes the lipid phase of membranes and contributes to the

maintenance of the thylakoid integrity, especially under stress conditions (7). This prompted

us to examine the integrity of the photosynthetic apparatus in our hsp17 mutants. Chlorophyll

a (Chl a) fluorescence can be used as an intrinsic probe for the stability of PSII-protein

complexes (12). Loss of thylakoid membrane stability is correlated with an increase in Chl a

fluorescence. Maximal fluorescence in the „WT” strain was measured at 48°C (Fig. 8A). A

striking reduction of thermal stability to 42°C was monitored in the Rep mutant whereas

thermostability of the photosynthetic apparatus was increased to 55°C in the Derep strain.

Light stress led to comparable results (Fig. 8B). Maximal Chl a fluorescence was measured

in the „WT” after 200 min of high light exposure. Photostability was reduced to 140 min in the

Rep mutant and increased to 300 min in the Derep strain.

To measure photosynthetic activity of the hsp17 mutants, we determined oxygen

evolution after exposure to 42°C or high light conditions. While there was a drop in oxygen

evolution of about 30% during the first hour at 42°C in the „WT”, the Derep mutant was

barely affected suggesting that the photosynthetic machinery was well-protected (Fig. 8C).

Heat sensitivity of the Rep mutant on the other hand was reflected by a sharp decrease in

oxygen evolution to 20 % within 60 min after heat shock. Interesting differences were

observed in the recovery phase after the cultures had been returned to 28°C and low light

conditions. The „WT” and in particular the Rep strain, which is unable to produce Hsp17,


23

optical density (OD730) of 1.5. Representative examples of at least three experimental repetitions are shown. (B) Samples from these Synechocystis cell cultures were used for Chl a extraction. (C) Early

log phase cells grown in the presence or absence of glucose were treated with HS, HL, HL* as described in (A). For growth rate (µ) determination, cells were transferred to 28°C and LL conditions

for 48 h (µ= lg2*OD-lg2*OD0/t-t0). Growth of the Rep and Derep mutants relative to the „WT” cultures is

shown.

24

recovered rapidly and regained full oxygen evolution capacity within one hour. In contrast,

the Derep mutant suffered most in the recovery phase and returned to pre-shock efficiency

only slowly indicating that continued production of Hsp17 is counterproductive once the

stress has declined.

Figure 8. Integrity of the photosynthetic machinery in Synechocystis strains with mutated hsp17 5’-UTRs. (A) The temperature effect on Chl a fluorescence was measured over a temperature

range from 30 to 60°C in „WT“ (circles), Rep (squares) and Derep (triangles) cells grown at 28°C under LL conditions. (B) The impact of light stress on Chl a fluorescence was measured in cells from

the same pre-culture as in (A). Cultures were exposed to HL over period of 380 min. (C) Oxygen evolution was monitored after a heat shock from 28 to 42°C at the indicated time points. After 380

min, cultures were returned to 28°C. (D) Oxygen evolution after shift to HL conditions. For recovery, the cultures were returned to LL conditions for 60 min. Cells from the same cultures were used for the

experiments in (C) and (D). Results are presented as percentage of the oxygen evolution rate measured at time 0. The photosynthetic activities before stress treatment were 3.02±0.04, 2.96±0.01

and 2.87±0.07 µmol O2 mg Chl-1min-1 in the „WT“ (circles), Rep (squares) and Derep (triangles)

stains, respectively. Error bars represent standard deviations obtained from three independent experiments.

A

B D

C


24

25

Exposure to high light intensities had a similar effect on oxygen evolution. Heat-

preincubation of the cells increased the effect of high light stress in all strains (data not

shown). Again, intermediate damage after stress exposure occurred in the „WT” background

(Fig. 8D). The Rep mutant was most sensitive and the Derep strain was barely affected.

Under recovery conditions, the „WT” and Rep strain performed best, whereas the Derep

strain was delayed in full oxygen production. Apparently, well-adjusted synthesis of Hsp17

protein by the hsp17 UTR is important for stress management in Synechocystis.


25

26

Discussion

A novel RNA thermometer family

RNA thermometers are widely distributed genetic control elements in the 5’-UTR of

temperature controlled genes (23,51). They have been found in numerous α- and γ-

proteobacteria and in the Gram-positive pathogen Listeria monocytogenes (25,27,52). Here,

we document the first cyanobacterial RNA thermometer that controls translation initiation of

the hsp17 gene in Synechocystis sp. PCC 6803. Consisting of only 44 nucleotides forming a

single stemloop structure it is by far the shortest and most simple natural RNA thermosensor

known to date. Typical ROSE (Repression Of heat Shock gene Expression) elements are

between 60 and 110 nucleotides long (52). The fourU element upstream of the Salmonella

agsA gene contains 58 nucleotides (27). The E. coli rpoH thermometer that reaches far into

the coding region is composed of 227 nucleotides (24). In its simplicity, the cyanobacterial

element resembles rationally designed synthetic RNA thermometers consisting of a short

single stemloop (53).

Unfolding curves (Fig. 4) supported the different stabilities of the WT, derep and rep

RNAs observed by reporter gene fusions in vivo and probing results in vitro. According to the

CD measurements the WT RNA exhibits a higher Tm value than the destabilized derep RNA

and a lower Tm value than the stabilized rep RNA. Interestingly, the unfolding transition of the

WT RNA is extraordinarily uncooperative (b=4.2). The derep RNA shows slightly higher

cooperativity (b=6.1) and the unfolding transition of the rep RNA exhibits the highest

cooperativity (b=8.2). In comparison to the Salmonella fourU RNA thermometer (b=10.6)

(Rinnenthal et al., 2010) the cooperativity of the Synechocystis thermometer is very low

(b=4.2). In other words, the cyanobacterial RNA exhibits a more gradual dimmer-like

behavior than the Salmonella fourU element.

Riboswitches and RNA thermometers are simple regulatory elements that have

repeatedly been suggested to originate from an ancient RNA world (23,54,55). Recently

discovered cyanobacterial fossils were dated 3.5 billion years old (56) marking the advent of

oxygenic photosynthesis. Apparently the presence of a functional hsp17 5’-UTR is beneficial


26

27

to Synechocystis sp. PCC 6803. This prompted us to ask whether other cyanobacteria

possess similar elements. Interestingly, likely candidates were identified in the long 5’-UTRs

of the Thermosynechococcus elongatus and T. vulcanus small heat shock gene hspA. At

their 3’ end they exhibit significant sequence similarity to the hsp17 leader sequence

(supplementary Fig. S1). According to in silico calculations the extended 5’ end is predicted

to form a long hairpin structure which might be required for overall stability of the RNA

structure in a thermophilic habitat. The presence of thermometer-like sequences upstream of

small heat shock genes in distantly related, thermophilic cyanobacteria suggests that this

translational control element might be commonly used to withstand constantly changing

temperature and light conditions.

Physiological relevance of the cyanobacterial thermometer

Our study provides first experimental evidence for the physiological importance of the on-

and off-function of an RNA thermometer. Although the structure and temperature-induced

conformational changes of several RNA thermometers have been studied in detail, evidence

for their in vivo significance has been lacking except for the Listeria prfA thermosensor that

activates virulence gene expression inducing host cell invasion (25). A major reason is that

most known RNA thermometers control translation of small heat shock genes, which usually

are dispensable because the cellular chaperone network is very redundant (5). In contrast,

the hsp17 gene is critically important for Synechocystis because its major target, the

photosynthetic machinery is very sensitive to stress-induced damage. Therefore, Hsp17 is

essential for tolerance to high temperatures and light stress in several mesophilic and

thermophilic cyanobacteria (3,49,57). Heterologous expression of the sHsp from

Synechococcus vulcanus in Synechococcus sp. PCC 942 conferred increased thermal

resistance and prevented inactivation of the photosynthetic apparatus (49). The protective

effect of the amphitrophic Hsp17 protein depends on its dual role as a protein and membrane

chaperone (7). In vitro, Hsp17 is able to protect model proteins from heat-induced

aggregation (7). In vivo, heat stress-induced Hsp17 interacts with a large variety of proteins

and protects a wide range of cellular functions (58). The second important activity is its

membrane association (59). Most newly synthesized Hsp17 is associated with the thylakoid


27

28

membrane (12). Here it plays a critical role in controlling the physical order, bilayer stability

and integrity of membranes (7). Further evidence for the importance of this property derives

from an hsp17 mutant with increased thylakoid association, which provided elevated

resistance against UV stress (60). Isolated Synechococcus elongatus PCC7942 phycocyanin

interacts directly with HspA, a Hsp17 homolog (57). Thus, the severe defect of stressed

Synechocystis Δhsp17 and Rep mutants (Fig. 7A) might be due to detachment and

degradation of accessory pigments. This assumption is well supported by the reduced Chl a

levels (Fig. 7B).

Despite the importance of Hsp17 for photosynthetic activity, the mechanisms

controlling its expression were largely unexplored. Alternative sigma factors are known to be

required for transcription of hsp17. However, the mRNA is not translated in the absence of

stress (Fig. 6). Consistent with our Northern blot experiments, DNA microarray assays

revealed basal transcription of the hsp17 gene even if the inducing SigB factor was missing

(10,11). The absence of Hsp17 protein under normal growth conditions despite the presence

of significant amounts of hsp17 mRNA (Fig. 6) indicates that the 5’-UTR of hsp17 blocks

translation initiation (Fig. 9) when the chaperone is not required. In vitro ribosome binding

assays demonstrated that translational is strictly temperature-controlled and does not require

the aid of additional cellular factors. Constitutive basal transcription of hsp17 apparently

provides a cellular pool of mRNA intended for instantaneous „translation-on-demand“, in

case the conditions become unfavourable.

Under stress conditions, the simultaneous induction of hsp17 transcription and

translation allows rapid accumulation of Hsp17 protein (Fig. 9). In turn, the sHsp promotes

readjustment of membrane fluidity and repair of unfolded proteins in the cytoplasm. In the

post-stress phase, rapid shut-down of Hsp17 synthesis is achieved by the thermometer

inherent to the mRNA. The defect of the Derep mutant under phototrophic conditions and in

the stress recovery phase strongly suggests that turning off hsp17 translation is as important

as turning it on. Apparently, permanent accessibility of the SD sequence is deleterious in the

recovery phase when hsp17 mRNA levels are still very high (Fig. 9). Immediate

sequestration of the SD sequence ensures that the abundant mRNA is silenced after

restoration of physiological conditions.


28

29

In the course of our experiments we made the puzzling observation that translation of

hsp17 mRNA was not only induced by heat stress but also, although weaker (Fig. S2), by

high light conditions (Fig. 6). As we constantly monitored temperature during light exposure,

we exclude that the observed induction was simply due to heating-up the growth medium.

Thus, it appears that the hsp17 thermometer responds to high light stress. At this point we

can only speculate on the mechanism underlying the induction of hsp17 translation. The

exposure of phototrophic organisms to light quantities above the level required for saturating

photosynthetic electron flow results in irreversible damage to the D1 protein and inactivation

of PSII (61). To avoid progressive photoinactivation, excess photon energy is partially

Figure 9. The 5’-UTR of the Synechocystis hsp17 gene controls translation on demand. The WT RNA forms a secondary structure at physiological temperature (28°C) masking the ribosomal

binding site of hsp17, thus preventing the binding of the ribosome. A heat shock induces hsp17 transcription. Concomitant melting of the hairpin structure in the 5’-UTR allows translation initiation. A

downshift to physiological temperatures shuts off translation in spite of high transcript levels. Transcriptional induction of the Derep and Rep variants is unaffected. However, the blocked SD

sequence in the Rep mutant prevents translation under all conditions, whereas translation is constitutively on in the Derep mutant.


29

30

dissipated as heat from non-functional PSII centres (62,63). Although this might not induce a

global heat shock response, it might be sufficient to cause partial melting of an RNA

thermometer given the prolonged and intensive high light stress (we were not able to induce

Hsp17 translation with visible light intensities below 600 µmol photons m-2s-1). In this context

it is interesting that de novo synthesis of thylakoid-associated Hsp17 at ambient temperature

can be induced by altering membrane microviscosity by addition of 30 mM benzyl alcohol

(12). As interaction of benzyl alcohol with ribonucleic acids has been reported, the alcohol

might be able to induce partial melting of an RNA thermometer (64). Ethanol also was shown

to induce sHsp biosynthesis controlled by the ROSE thermometer in Bradyrhizobium

japonicum (65). In any case, alcohol was a much weaker inducer of sHsp biosynthesis than

heat shock.

In γ-proteobacteria like E. coli and Salmonella, RNA thermometers modulate heat

shock gene expression by adding an additional layer of control to the efficient transcriptional

induction by the alternative sigma factor σ32 (27,36,66). Instead, the hsp17 thermometer is

the predominant regulator of hsp17 expression in Synechocystis. Severe phenotypes were

elicited by the exchange of only a few nucleotides in the chromosomally integrated

thermometer. Weakening the SD/anti-SD interaction by two point mutations resulted in

permanent hsp17 translation, which offered a significant protection to the photosynthetic

apparatus in the first hours after stress exposure. As a drawback, cells with elevated Hsp17

levels were delayed in stress recovery and showed reduced fitness under photosynthetic

growth conditions in the presence of stress. Apparently, the architecture of the hsp17 UTR is

well-adjusted to supply the perfect amount of the chaperone under normal, stress and

recovery conditions. It is a sensitive, efficient and rapidly responding gene control element

that performs equally well in vitro, in E. coli and in Synechocystis making it an attractive

candidate for applications in green biotechnology, which uses cyanobacteria or plants as

biofactories (67). Owing to its simple architecture the Synechocystis element is much more

suitable as versatile gene control element than all other previously described RNA

thermometers.


30

31

Funding

This work was funded by a grant from the German Research Foundation (DFG priority

program 1258) to FN and by a fellowship from the Studienstiftung des Deutschen Volkes to

JK.

Acknowledgements

We thank Elizabeth Vierling and Heather O’Neill (University of Arizona) for providing strains,

plasmids and α-Hsp17 antisera. We are grateful to Matthias Rögner, Thilo Rühle, Birgit

Klinkert, Nicole Frankenberg-Dinkel and Sebastian Rasche for experimental support and to

Ulla Aschke-Sonnenborn for technical assistance. All members of the RNA group, Nicole

Frankenberg-Dinkel and Bernd Masepohl are acknowledged for critical comments on the

manuscript and helpful discussions.


31

32

References

1. Castielli, O., De la Cerda, B., Navarro, J.A., Hervas, M. and De la Rosa, M.A. (2009) Proteomic analyses of the response of cyanobacteria to different stress conditions. FEBS Lett., 583, 1753-1758.

2. Latifi, A., Ruiz, M. and Zhang, C.C. (2009) Oxidative stress in cyanobacteria. FEMS Microbiol. Rev., 33, 258-278.

3. Lee, S., Prochaska, D.J., Fang, F. and Barnum, S.R. (1998) A 16.6-kilodalton protein in the Cyanobacterium Synechocystis sp. PCC 6803 plays a role in the heat shock response. Curr. Microbiol., 37, 403-407.

4. Nakamoto, H. and Vígh, L. (2007) The small heat shock proteins and their clients. Cell. Mol. Life Sci., 64, 294-306.

5. Narberhaus, F. (2002) Alpha-crystallin-type heat shock proteins: socializing minichaperones in the context of a multichaperone network. Microbiol. Mol. Biol. Rev., 66, 64-93; table of contents.

6. Lee, G.J., Roseman, A.M., Saibil, H.R. and Vierling, E. (1997) A small heat shock protein stably binds heat-denatured model substrates and can maintain a substrate in a folding-competent state. EMBO J., 16, 659-671.

7. Török, Z., Goloubinoff, P., Horvath, I., Tsvetkova, N.M., Glatz, A., Balogh, G., Varvasovszki, V., Los, D.A., Vierling, E., Crowe, J.H. et al. (2001) Synechocystis HSP17 is an amphitropic protein that stabilizes heat-stressed membranes and binds denatured proteins for subsequent chaperone-mediated refolding. Proc. Natl. Acad. Sci. U S A, 98, 3098-3103.

8. Huang, L., McCluskey, M.P., Ni, H. and LaRossa, R.A. (2002) Global gene expression profiles of the cyanobacterium Synechocystis sp. strain PCC 6803 in response to irradiation with UV-B and white light. J. Bacteriol., 184, 6845-6858.

9. Suzuki, I., Simon, W.J. and Slabas, A.R. (2006) The heat shock response of Synechocystis sp. PCC 6803 analysed by transcriptomics and proteomics. J. Exp. Bot., 57, 1573-1578.

10. Tuominen, I., Pollari, M., Tyystjarvi, E. and Tyystjarvi, T. (2006) The SigB sigma factor mediates high-temperature responses in the cyanobacterium Synechocystis sp. PCC6803. FEBS Lett., 580, 319-323.

11. Singh, A.K., Summerfield, T.C., Li, H. and Sherman, L.A. (2006) The heat shock response in the cyanobacterium Synechocystis sp. Strain PCC 6803 and regulation of gene expression by HrcA and SigB. Arch. Microbiol., 186, 273-286.

12. Horváth, I., Glatz, A., Varvasovszki, V., Torok, Z., Pali, T., Balogh, G., Kovacs, E., Nadasdi, L., Benko, S., Joo, F. et al. (1998) Membrane physical state controls the signaling mechanism of the heat shock response in Synechocystis PCC 6803: identification of hsp17 as a "fluidity gene". Proc. Natl. Acad. Sci. U S A, 95, 3513-3518.

13. Asadulghani, Suzuki, Y. and Nakamoto, H. (2003) Light plays a key role in the modulation of heat shock response in the cyanobacterium Synechocystis sp PCC 6803. Biochem. Biophys. Res. Commun., 306, 872-879.


32

33

14. Tuominen, I., Pollari, M., von Wobeser, E.A., Tyystjarvi, E., Ibelings, B.W., Matthijs, H.C. and Tyystjarvi, T. (2008) Sigma factor SigC is required for heat acclimation of the cyanobacterium Synechocystis sp. strain PCC 6803. FEBS Lett., 582, 346-350.

15. Sharp, P.A. (2009) The centrality of RNA. Cell, 136, 577-580.

16. Waters, L.S. and Storz, G. (2009) Regulatory RNAs in bacteria. Cell, 136, 615-628.

17. Storz, G., Altuvia, S. and Wassarman, K.M. (2005) An abundance of RNA regulators. Annu. Rev. Biochem., 74, 199-217.

18. Gottesman, S. (2005) Micros for microbes: non-coding regulatory RNAs in bacteria. Trends Genet., 21, 399-404.

19. Dühring, U., Axmann, I.M., Hess, W.R. and Wilde, A. (2006) An internal antisense RNA regulates expression of the photosynthesis gene isiA. Proc. Natl. Acad. Sci. U S A, 103, 7054-7058.

20. Georg, J., Voss, B., Scholz, I., Mitschke, J., Wilde, A. and Hess, W.R. (2009) Evidence for a major role of antisense RNAs in cyanobacterial gene regulation. Mol. Syst. Biol., 5, 305.

21. Voss, B., Georg, J., Schon, V., Ude, S. and Hess, W.R. (2009) Biocomputational prediction of non-coding RNAs in model cyanobacteria. BMC Genomics, 10, 123.

22. Winkler, W.C. and Breaker, R.R. (2005) Regulation of bacterial gene expression by riboswitches. Annu. Rev. Microbiol., 59, 487-517.

23. Narberhaus, F., Waldminghaus, T. and Chowdhury, S. (2006) RNA thermometers. FEMS Microbiol. Rev., 30, 3-16.

24. Morita, M.T., Tanaka, Y., Kodama, T.S., Kyogoku, Y., Yanagi, H. and Yura, T. (1999) Translational induction of heat shock transcription factor sigma32: evidence for a built-in RNA thermosensor. Genes Dev., 13, 655-665.

25. Johansson, J., Mandin, P., Renzoni, A., Chiaruttini, C., Springer, M. and Cossart, P. (2002) An RNA thermosensor controls expression of virulence genes in Listeria monocytogenes. Cell, 110, 551-561.

26. Chowdhury, S., Maris, C., Allain, F.H. and Narberhaus, F. (2006) Molecular basis for temperature sensing by an RNA thermometer. EMBO J., 25, 2487-2497.

27. Waldminghaus, T., Heidrich, N., Brantl, S. and Narberhaus, F. (2007) FourU: a novel type of RNA thermometer in Salmonella. Mol. Microbiol., 65, 413-424.

28. Rippka, R. (1988) Isolation and purification of cyanobacteria. Methods Enzymol., 167, 3-27.

29. Giese, K.C. and Vierling, E. (2002) Changes in oligomerization are essential for the chaperone activity of a small heat shock protein in vivo and in vitro. J. Biol. Chem., 277, 46310-46318.

30. Lichtenthaler, H.K., Buschmann, C., Rinderle, U. and Schmuck, G. (1986) Application of chlorophyll fluorescence in ecophysiology. Radiat. Environ. Biophys., 25, 297-308.

31. Urban, J.H. and Vogel, J. (2007) Translational control and target recognition by Escherichia coli small RNAs in vivo. Nucleic Acids Res., 35, 1018-1037.


33

34

32. Waldminghaus, T., Kortmann, J., Gesing, S. and Narberhaus, F. (2008) Generation of synthetic RNA-based thermosensors. Biol. Chem., 389, 1319-1326.

33. Klinkert, B., Ossenbuhl, F., Sikorski, M., Berry, S., Eichacker, L. and Nickelsen, J. (2004) PratA, a periplasmic tetratricopeptide repeat protein involved in biogenesis of photosystem II in Synechocystis sp. PCC 6803. J. Biol. Chem., 279, 44639-44644.

34. Obrist, M., Langklotz, S., Milek, S., Fuhrer, F. and Narberhaus, F. (2009) Region C of the Escherichia coli heat shock sigma factor RpoH (sigma 32) contains a turnover element for proteolysis by the FtsH protease. FEMS Microbiol. Lett., 290, 199-208.

35. Brantl, S. and Wagner, E.G. (1994) Antisense RNA-mediated transcriptional attenuation occurs faster than stable antisense/target RNA pairing: an in vitro study of plasmid pIP501. EMBO J., 13, 3599-3607.

36. Waldminghaus, T., Gaubig, L.C., Klinkert, B. and Narberhaus, F. (2009) The Escherichia coli ibpA thermometer is comprised of stable and unstable structural elements. RNA Biol., 6.

37. Hartz, D., McPheeters, D.S., Traut, R. and Gold, L. (1988) Extension inhibition analysis of translation initiation complexes. Methods Enzymol., 164, 419-425.

38. Miller, J.H. (1972) Experiments in Molecular Genetics. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York.

39. Porra, R.J., Thompson, W.A. and Kriedmann, P.E. (1989) Determination of accurate extinction coefficients and simultaneous equations for assaying chlorophylls a and b extracted with four different solvents: verification of the concentration of chlorophyll standards by atomic absorption spectroscopy. Biochem Biophys Acta, 975, 384-394.

40. Zuker, M. (2003) Mfold web server for nucleic acid folding and hybridization prediction. Nucleic Acids Res., 31, 3406-3415.

41. Imamura, S., Yoshihara, S., Nakano, S., Shiozaki, N., Yamada, A., Tanaka, K., Takahashi, H., Asayama, M. and Shirai, M. (2003) Purification, characterization, and gene expression of all sigma factors of RNA polymerase in a cyanobacterium. J. Mol. Biol., 325, 857-872.

42. Fang, F. and Barnum, S.R. (2004) Expression of the heat shock gene hsp16.6 and promoter analysis in the cyanobacterium, Synechocystis sp. PCC 6803. Curr. Microbiol., 49, 192-198.

43. Hirata, H., Fukazawa, T., Negoro, S. and Okada, H. (1986) Structure of a beta-galactosidase gene of Bacillus stearothermophilus. J. Bacteriol., 166, 722-727.

44. Chevalier, C., Geissmann, T., Helfer, A.C. and Romby, P. (2009) Probing mRNA structure and sRNA-mRNA interactions in bacteria using enzymes and lead(II). Methods Mol. Biol., 540, 215-232.

45. de Smit, M.H. and van Duin, J. (1994) Translational initiation on structured messengers. Another role for the Shine-Dalgarno interaction. J. Mol. Biol., 235, 173-184.

46. Lutz, R. and Bujard, H. (1997) Independent and tight regulation of transcriptional units in Escherichia coli via the LacR/O, the TetR/O and AraC/I1-I2 regulatory elements. Nucleic Acids Res., 25, 1203-1210.

47. Hartmann, K., Bindereif, A., Schön, A., Westhof, E. (2005) Handbook of RNA Biochemistry. 1st ed. Wiley-VCH, Weinheim.


34

35

48. Lee, S., Owen, H.A., Prochaska, D.J. and Barnum, S.R. (2000) HSP16.6 is involved in the development of thermotolerance and thylakoid stability in the unicellular cyanobacterium, Synechocystis sp. PCC 6803. Curr. Microbiol., 40, 283-287.

49. Nakamoto, H., Suzuki, N. and Roy, S.K. (2000) Constitutive expression of a small heat-shock protein confers cellular thermotolerance and thermal protection to the photosynthetic apparatus in cyanobacteria. FEBS Lett., 483, 169-174.

50. Kaneko, T., Sato, S., Kotani, H., Tanaka, A., Asamizu, E., Nakamura, Y., Miyajima, N., Hirosawa, M., Sugiura, M., Sasamoto, S. et al. (1996) Sequence analysis of the genome of the unicellular cyanobacterium Synechocystis sp. strain PCC6803. II. Sequence determination of the entire genome and assignment of potential protein-coding regions. DNA Res., 3, 109-136.

51. Storz, G. (1999) An RNA thermometer. Genes Dev., 13, 633-636.

52. Waldminghaus, T., Fippinger, A., Alfsmann, J. and Narberhaus, F. (2005) RNA thermometers are common in alpha- and gamma-proteobacteria. Biol. Chem., 386, 1279-1286.

53. Neupert, J., Karcher, D. and Bock, R. (2008) Design of simple synthetic RNA thermometers for temperature-controlled gene expression in Escherichia coli. Nucleic Acids Res., 36, e124.

54. Vitreschak, A.G., Rodionov, D.A., Mironov, A.A. and Gelfand, M.S. (2004) Riboswitches: the oldest mechanism for the regulation of gene expression? Trends Genet., 20, 44-50.

55. Blouin, S., Mulhbacher, J., Penedo, J.C. and Lafontaine, D.A. (2009) Riboswitches: ancient and promising genetic regulators. Chembiochem., 10, 400-416.

56. Schopf, J.W. (2006) Fossil evidence of Archaean life. Philos. Trans. R. Soc. Lond. B. Biol. Sci., 361, 869-885.

57. Sakthivel, K., Watanabe, T. and Nakamoto, H. (2009) A small heat-shock protein confers stress tolerance and stabilizes thylakoid membrane proteins in cyanobacteria under oxidative stress. Arch. Microbiol., 191, 319-328.

58. Basha, E., Lee, G.J., Breci, L.A., Hausrath, A.C., Buan, N.R., Giese, K.C. and Vierling, E. (2004) The identity of proteins associated with a small heat shock protein during heat stress in vivo indicates that these chaperones protect a wide range of cellular functions. J. Biol. Chem., 279, 7566-7575.

59. Horváth, I., Multhoff, G., Sonnleitner, A. and Vigh, L. (2008) Membrane-associated stress proteins: more than simply chaperones. Biochim. Biophys. Acta, 1778, 1653-1664.

60. Balogi, Z., Cheregi, O., Giese, K.C., Juhasz, K., Vierling, E., Vass, I., Vígh, L. and Horvath, I. (2008) A mutant small heat shock protein with increased thylakoid association provides an elevated resistance against UV-B damage in Synechocystis 6803. J. Biol. Chem., 283, 22983-22991.

61. Kyle, D.J., Ohad, I. and Arntzen, C.J. (1984) Membrane protein damage and repair: Selective loss of a quinone-protein function in chloroplast membranes. Proc. Natl. Acad. Sci. U S A, 81, 4070-4074.

62. Shikanai, T., Munekage, Y. and Kimura, K. (2002) Regulation of proton-to-electron stoichiometry in photosynthetic electron transport: physiological function in photoprotection. J Plant Res, 115, 3-10.


35

36

63. Demmig-Adams, B. and Adams, W.W., 3rd. (2006) Photoprotection in an ecological context: the remarkable complexity of thermal energy dissipation. New Phytol, 172, 11-21.

64. Tsukiji, S., Pattnaik, S.B. and Suga, H. (2003) An alcohol dehydrogenase ribozyme. Nat. Struct. Biol., 10, 713-717.

65. Münchbach, M., Nocker, A. and Narberhaus, F. (1999) Multiple small heat shock proteins in rhizobia. J. Bacteriol., 181, 83-90.

66. Vogel, J. (2009) A rough guide to the non-coding RNA world of Salmonella. Mol. Microbiol., 71, 1-11.

67. Rittmann, B.E. (2008) Opportunities for renewable bioenergy using microorganisms. Biotechnol. Bioeng., 100, 203-212.


36

37

Figure S1. Alignment of Synechocystis hsp17 5’-UTR (thermometer element) with the 5’-UTRs of T. elongatus and T. vulcanus. Identical nucleotides are indicated by bold letters.

Figure S2. Comparative Western blot analysis of Hsp17 protein levels after heat shock (HS) and high light stress (HL) and in the recovery phase. (A) Synechocystis „WT“ and (B) Derep cells were incubated at 42°C (for 60 min) or stressed with high light (for 30 min). Following the different stress

conditions, the cultures were transferred to 28°C and LL conditions (recovery phase). Total protein was extracted directly after stress (HS or HL) and at time points during recovery phase as indicated. K,

control (total protein extracted from cells grown at 28°C and low light). (C) Total protein was extracted from Synechocystis Rep cells incubated at 42°C or under high light conditions and blotted beside total

protein originating from heat shocked „WT“ cells. Hsp17 protein was detected via monoclonal α-Hsp17 antibody. Equal amounts of total protein were checked by Coomassie-stained SDS-PAGE gels (data

not shown).


37

38

Table SI. Strains, plasmids and oligonucleotides used in this study

Strain, plasmid or oligonucleotide

Relevant characteristic(s) or sequencea Source or reference

StrainsE. coli DH5α supE44 ΔlacU169 (Φ80lacZΔM15) hsdR17 recA1 gyrA96 Gibco-BRLE. coli DH5αZ1 Δ(argF-lac)I69ϕ 80ΔlacZ58(M15) glnV44 (AS) rfbD1 gyrA96 (NalR) recA1

endA1 sρoT1 thi-1hsdRI7 ZI (lacR tetR SpR)Lutz and Bujard, 1997

Synechocystis sp.

PCC6803 HK-1

Δ hsp17 (KmR) Kosaka and Fukuzawa

PlasmidspBAD-bgaB

(pBO415)

Translational bgaB fusion vector, bgaB: heat-stable β-galactosidase, AmpRWaldminghaus et al., 2007

pXG-10 Translational gfp fusion vector, CmR, PLTet-O Promotor Urban and Vogel, 2006pNaive.16 (pAZ877) Vector for integration into the hsp17 locus, Restriction sites used for

subcloning: BamHI (upstream region); CpoI (hsp17 coding region), SpecR , AmpR

Giese and Vierling, 2002

pBO1292 Synechocystis hsp17 5’-UTR (thermometer element) in pUC18 (QuikChange® template)

This study

pBO1347 fragment of ORF sll1514 containing hsp17 thermometer element in pUC18, (pNaive-QuikChange® template)

This study

pBO1293 Synechocystis hsp17 5’-UTR-bgaB fusion in pBAD-bgaB This studypBO1312 Synechocystis hsp17 5’-UTR-AAC39-41G-bgaB fusion in pBAD-bgaB

(M1-rep)This study

pBO1310 Synechocystis hsp17 5’-UTR-T17C-bgaB fusion in pBAD-bgaB (M2) This studypBO1311 Synechocystis hsp17 5’-UTR-T22G-bgaB fusion in pBAD-bgaB (M3) This studypBO1316 Synechocystis hsp17 5’-UTR-C19T-bgaB fusion in pBAD-bgaB (M4.1) This studypBO1314 Synechocystis hsp17 5’-UTR-CC19/20GA-bgaB fusion in pBAD-bgaB

(M4.2)This study

pBO1315 Synechocystis hsp17 5’-UTR-CC19/20AG-bgaB fusion in pBAD-bgaB (M4.3)

This study

pBO1313 Synechocystis hsp17 5’-UTR-CC19/20GG-bgaB fusion in pBAD-bgaB (M4.4-derep)

This study

pBO602 Salmonella agsA-bgaB fusion in pBAD-bgaB (Control C.1) Waldminghaus et al., 2007

pBO1056 E. coli gyrA-bgaB fusion in pBAD-bgaB (Control C.2) Waldminghaus et al., 2007

pBO1325 Synechocystis hsp17 5’-UTR-gfp fusion in pXG-10 This studypBO1801 Synechocystis hsp17 5’-UTR-rep-gfp fusion in pXG-10 This studypBO1802 Synechocystis hsp17 5’-UTR-derep-gfp fusion in pXG-10 This studypBO1301 Synechocystis hsp17 5’-UTR-WT-in vitro transcripts for structure probing

experiments, runoff vector (via MlsI site), pUC18-basedThis study

pBO1304 Synechocystis hsp17 5’-UTR-rep-in vitro transcripts for structure probing experiments, runoff vector (via MlsI site), pUC18-based

This study

pBO1302 Synechocystis hsp17 5’-UTR-derep-in vitro transcripts for structure probing experiments, runoff vector (via MlsI site), pUC18-based

This study

pBO1305 Synechocystis hsp17 5’-UTR-WT-in vitro transcripts (+63 bp coding region) for toeprinting experiments, runoff vector (via HpyCH4V site), pUC18-based

This study

pBO1349 Synechocystis hsp17 5’-UTR-rep-in vitro transcripts (+63 bp coding region) for toeprinting experiments, runoff vector (via HpyCH4V site), pUC18-based

This study

pBO1348 Synechocystis hsp17 5’-UTR-derep-in vitro transcripts (+63 bp coding region) for toeprinting experiments, runoff vector (via HpyCH4V site), pUC18-based

This study

pB01834 pNaive- hsp17 5’-UTR-WT (pNaive.16 derivate) This study

pBO1806 pNaive- hsp17 5’-UTR-rep (pNaive.16 derivate) This study

pBO1807 pNaive- hsp17 5’-UTR-derep (pNaive.16 derivate) This study

OligonucleotidesNheI-hsp17therm TTTGCTAGCATTCAAGGGTAATCAA

(*pBO1293)hsp17therm-EcoRI TTTGAATTCAGACATAATGTTAACTCC

(*pBO1293)hsp17therm-M1-fw CACACATCAGGAGTTGATTATGTCTGAATTC

(*pBO1312, pBO1801, pBO1304 and pBO1806)hsp17therm-M1-rv CTCCTGATGTGTGGCAGGAATTGATTACCC

(*pBO1312, pBO1801, pBO1304 and pBO1806)


38

39

hsp17therm-M2-fw CAAGGGTAATCAACTCCTTCCACACATCAGG

(*pBO1310)hsp17therm-M2-rv CCTGATGTGTGGAAGGAGTTGATTACCCTTG

(*pBO1310)hsp17therm-M3-fw GGGTAATCAATTCCTGCCACACATCAGGAG

(*pBO1311)hsp17therm-M3-rv CTCCTGATGTGTGGCAGGAATTGATTACCC

(*pBO1311)hsp17therm-M4-fw CAAGGGTAATCAATTRRTTCCACACATCAGG

(*pBO1316, pBO1314, pBO1315 and pBO1313)hsp17therm-M4-rv CCTGATGTGTGGAARRAATTGATTACCCTTG

(*pBO1316, pBO1314, pBO1315 and pBO1313)hsp17therm-der.-fw CAAGGGTAATCAATTGGTTCCACACATCAGG

(*pBO1802, pBO1302 and pBO1807)hsp17therm-der.-rv CCTGATGTGTGGAACCAATTGATTACCCTTG

(*pBO1802, pBO1302 and pBO1807)PstI-rep-fw TTTCTGCAGATTCAAGGGTAATCAATTGG

(*pBO1802)derep-NheI-rv AAAAGCTAGCAGACATAATCAACTCCTG

(*pBO1801)T7- hsp17therm GAAATTAATACGACTCACTATAGGGATTCAAGGGTAATCAATTCC

(*pBO1301 and pBO1305)hsp17therm-runoff-SP TGGCCAGACATAATGTTAACTCCTG

(*pBO1301)hsp17 therm-runoff-toeprinting

TGCAAACAGTTGGTTCATCTGCTGCTGG

(*pBO1305)hsp17therm-ORF-fw TTGAATTCCATTATTGCCGGGGCCGTC

(*pBO1347)hsp17therm-ORF-rv TTCCGTGGCGGTCCGTAGGGAC

(*pBO1347)rep-toeprinting-fw CACATCAGGAGTTGATTATGTCTCTCATTC

(*pBO1349)rep-toeprinting-rv GAATGAGAGACATAATCAACTCCTGATGTG

(*pBO1349)derep-toeprinting-fw CAAGGGTAATCAATTGGTTCCACACATCAGG

(*pBO1348)derep-toeprinting-rv CCTGATGTGTGGAACCAATTGATTACCCTTG

(*pBO1348)fw-hsp17-probe TGTCTCTCATTCTTTACAAT (Northern blot probe)

rv-hsp17-probe TAATACGACTCACTATCATTTATTAGGAAAGCTGAAC (Northern blot probe)

fw-bgaB-probe AGAGCAATGGCCAGAGGAAA (Northern blot probe)

rv-bgaB-probe TAATACGACTCACTATAGATCGGCAAAGAATCTGGAT (Northern blot probe)

up-fw GCGGCTAGAAATGTAATTTCGGCAATC (segregation analysis via PCR)

cr-rv GTTAGGATACCGGCATCGTAATTAGC (segregation analysis via PCR)

cr-fw GCTAATTACGATGCCGGTATCCTAAC (segregation analysis via PCR)

down-rv GACAACTTTTTCAGCAGTCCATTCCCATGG (segregation analysis via PCR)

a Introduced restriction sites are underlined. * Corresponding plasmids


39

40

Table SII. Absolute levels of bgaB fusion constructs


40

E. Temperature-mediated translational regulation by the Vibrio cholerae toxT 5‘ mRNA leader is based on nucleotide slippage and pseudoknot

formation

Jens Kortmann, Gregor Weber, Karl E. Klose


in preparation

E. Temperature-mediated translational regulation by the Vibrio cholerae toxT 5‘ mRNA leader

15

Temperature-mediated translational regulation by the

Vibrio cholerae toxT 5’ mRNA leader is based on nucleotide

slippage and pseudoknot formation

Jens Kortmann1, Gregor Weber†, Karl E. Klose† and Franz Narberhaus1

1Lehrstuhl für Biologie der Mikroorganismen, Ruhr-Universität Bochum, 44780 Bochum,

Germany

†South Texas Center for Emerging Infectious Diseases and Department of Biology, The

University of Texas at San Antonio, San Antonio, Texas

Running title: Vibrio RNA thermosensor

Keywords: riboregulator; FourU RNA thermometer; post-transcriptional control; pseudoknot;

virulence; ToxT; autoregulatory loop

1Corresponding author: Franz Narberhaus, Lehrstuhl für Biologie der Mikroorganismen,

Ruhr-Universität Bochum, Universitätsstrasse 150, NDEF 06/783, 44780 Bochum, Germany.

Tel: +49 (0)234 322 3100; Fax: +49 (0)234 321 4620; E-mail: [email protected]


1



Thermo-sensitive, cis-regulatory 5‘ untranslated regions (UTRs) of mRNAs modulate

virulence gene expression in pathogenic microbes such as Listeria monocytogenes or

Yersinia pestis by controlled melting of the Shine Dalgarno sequence. Here, we

present a novel regulatory mechanism in a Vibrio cholerae RNA thermosensor. The 68-

nucleotide FourU element resides upstream toxT coding for a virulence master

regulator and, in contrast to all other virulence thermometers, inhibits ribosome

binding and associated translation at 37°C when tested in vitro and in E. coli. Proper

function of the toxT leader is based on two regulatory elements, the FourU

thermometer and a flexible top portion module. We pinpoint the nucleotides that

contribute to sequestration of the ribosome binding site at 37°C. Nucleotide slippage

and subsequent pseudoknot formation between two palindromic sequences result in

formation of an untranslatable tertiary structure. The repressive RNA-inherent feature

of the toxT 5‘-UTR is overcome by an unidentified mechanism in V. cholerae strains.

As Vibrio virulence is ruled by a multifaceted regulatory network, we propose that a

Vibrio-specific factor blocks the conformational switch when expression of toxT and

the dependent virulence factors is needed. Our findings suggest that the toxT

thermometer contributes to Vibrio pathogenicity by modulating virulence gene

expression at different stages of host infection.


2

Introduction

The Gram-negative aquatic microbe Vibrio cholerae is the etiological agent of cholera, an

epidemic plague that afflicts several million people per year (1). Successful colonization of

the human intestine is crucially driven by the two primary virulence factors cholera toxin (CT)

and the toxin-coregulated pilus (TCP), whose variable expression is under control of a tightly

regulated transcriptional cascade known as the ToxR regulon (2,3). This virulence cascade

culminates in expression of ToxT, an AraC-family regulator, which directly activates

transcription of CT and TCP genes by binding to degenerate 13 bp sequences called

toxboxes (4-8). ToxT additionally activates transcription of two chemoreceptor genes, tcpI

and acfB, located within the Vibrio Pathogenicity Island, which contribute to intestinal

colonization (9). Thus, ToxT is an inevitable prerequisite and master regulator of Vibrio

virulence.

Multiple environmental stimuli feed into the Vibrio virulence regulon, thereby

modulating activity, (promoter)-specificity and abundance of the ToxT master regulator

(10,11). Sensitivity of ToxT to temperature, intestinal bicarbonate and bile (10,12-14) reflects

situations that occur either in aquatic reservoirs (<30°C), or distinct niches in the human body

(37°C, bile, bicarbonate). Bicarbonate might act as a positive effector molecule directly

modulating the ToxT protein (12). Recently solved crystal structures revealed that

monosaturated fatty acid compounds in human bile govern dimerization of the ToxT protein

and thereby its promoter specificity (14). A temperature upshift from 30 to 37°C down-

regulates ToxT-dependent transcription of the CT encoding ctxA gene (13-fold) (10). The

exact mechanism by which temperature affects synthesis or performance of the ToxT protein

itself remains unclear. ToxR and TcpP, two inner membrane proteins, initially activate toxT

transcription (15-17). Both require accessory proteins, ToxS and TcpH respectively, for

maximal activity (16). This primes an autoregulatory loop in which ToxT positively influences

its own transcription via the tcp promoter (18) (Fig.1). It is not clear how the autoregulatory

loop is shut off. Indeed, much research has been focused on the dissection of transcriptional


3

and post-translational events responsible for toxT gene expression, e.g. recent antimicrobial

drugs target either the ToxT protein (19), or act on DNA level by suppressing toxT

transcription (20).

During the last decade, the universality of post-transcriptional regulation by means of

regulatory RNAs became evident (21-26). In V. cholerae, small RNAs are widely used as key

regulatory elements responsible for the regulation of cellular processes such as

pathogenicity (27-29) or quorum sensing (30-32), mostly by decreasing the abundance of

target mRNAs. Exploiting Vibrio datasets obtained by deep-sequencing-based

transcriptomics gave rise to the discovery of multiple sRNAs and cis-regulatory 5‘-leaders

(33,34). Described Vibrio riboswitches undergo conformational changes upon binding of a

small molecule ligand to their aptamer domain (35-38). This affects formation of transcription

terminators or alters accessibility of the ribosome binding site (RBS) (39,40).

RNA thermometers are translational control devices that reside in the 5‘ untranslated

region (UTR) of bacterial heat shock or virulence genes and exclusively respond to

temperature alterations (41). At low temperatures the RBS-inherent Shine Dalgarno (SD)

sequence is blocked by base pairing. An upshift to human body temperature (37°C, virulence

genes) or higher (42°C, heat shock genes) usually liberates the SD sequence and facilitates

formation of the ternary translation initiation complex. RNA thermometer functionality within a

physiological temperature range is achieved by a delicate composition of its secondary

structure comprised of canonical and non-canonical base pairs, loops and bulges (42-46).

Figure 1. The ToxT master regulator is centrally positioned within Vibrio virulence networks. Transcription of toxt mRNA is activated by ToxR/S and TcpP/H. The ToxT protein activates

transcription of CT and TCP encoding genes (ctx and tcp, respectively). ToxT is also capable to activate its own transcription via the tcpA promoter (autoregulatory loop). This work focuses on

dissecting temperature-mediated regulation of toxT mRNA.


4

In this work, we characterize the first virulence thermometer crucially dependent on

tertiary structure rearrangements. An RNA thermosensor-like structure is built-into the 5‘-

leader of the Vibrio toxT messenger. While sequestration and liberation of the SD sequence

is based on pairing with four uridines as in typical FourU thermometers (46), this element

favours translation at low (30°C) but not at elevated temperature (37°C) when tested in vitro

and in E. coli. We demonstrate by in vitro structure probing and toeprinting experiments that

repression of translation initiation at 37°C is based on nucleotide slippage and pseudoknot

formation. Strikingly, negative regulation at host temperature is overcome when tested in the

background of highly pathogenic Vibrio strains.


5

Materials and Methods

Strains and growth conditions

E. coli (DH5α) and V. cholerae cells (Classical biotype strain KKV598 and El Tor biotype

strain C6706) were grown at 30 or 37°C in Luria-Bertani (LB) medium supplemented with

ampicillin (ApE.coli, 150 µg/ml; ApV.cholerae, 100 µg/ml). For induction of the pBAD promoter in

strains carrying translational lacZ fusions, 0.01% (w/v) L-arabinose was added.

Plasmid construction

The V. cholerae toxT 5‘-UTR was amplified via PCR (for primer sequences, see Table 1),

using chromosomal DNA from Classical N16961 strain and cloned into pUC18 (pBO1294).

The toxT-lacZ fusion (pBO1296) was constructed by transfer of the toxT 5’-UTR from

pBO1294 upon NheI/EcoRI digestion into the corresponding site in pBAD18-lacZ481 (Table

1). Site directed mutagenesis to generate pBO1826 (U5C), 1827 (∆G28), 1828 (∆14-48),

1829 (U7C), 1830 (SCE4), 1831 (G28C), 1839 (Kolkata), 1840 (SCE200), 1841 (C55G),

1842 (GG28/28CC) and 1843 (∆GG28/29) was performed according to the instruction

manual of the QuikChange® mutagenesis kit (Stratagene, La Jolla, USA). Plasmid pBO1294

served as a template for PCR with mutagenic primers (Table 1). The inserts containing

mutated toxT UTRs were isolated upon NheI/EcoRI digestion and cloned into the

corresponding site upstream of the lacZ gene. The correct nucleotide sequence was

confirmed by automated sequencing (eurofins, Martinsried, Germany). Chromosomal

N16961 DNA was provided by Prof. Dr. Joachim Reidl (University of Graz, Austria).

RNA detection

Preparation of total RNA from E. coli and Northern analysis followed previously published

protocols (47). RNAs were detected with a DIG-labeled lacZ RNA probe (DIG-HIGH prime

labeling kit; Roche Applied Science, Mannheim, Germany; see Table 1). Signals were

detected with a ChemiImager™ Ready (Alpha Innotech, Biozym, Wien, Austria).


6

In vitro transcription

RNAs were synthesized in vitro by runoff transcription with T7 RNA polymerase from

linearized plasmid templates. Plasmids pBO1299, 1308 and 1309 (linearized with MlsI) were

used to generate RNA for enzymatic structure probing and plasmids pBO1300, 1307 and

1331 (linearized with Bsp681) to generate RNA for toeprinting experiments (Table 1).


RNA structure formation alongside a temperature gradient (20-50°C) or at either 28 and 42°C

was compared. RNA was 5’-end labeled as described (48). Partial digestion of 5’-end-labeled

RNAs with ribonucleases T1 (0.004U), V (0.008U) was conducted as described (this study).

For chemical probing, labeled RNA was mixed with 2 µl 5x lead buffer (250 mM tris acetate

pH 7.5, 25 mM Mg acetate; 250 mM Na acetate) and 1 µg tRNA in a total volume of 10 µl.

Lead(II) probing assay was conducted as described (this study). RNA fragments were

separated on denaturing polyacrylamide gels (8 or 15%). Alkaline ladders were generated as

described previously (48). The Aida Image Analyzer software (version 4.19) was used for

quantification of RNase cleavage intensity (Fig. 6).

Toeprinting analysis

Primer extension inhibition experiments were carried out using 30S ribosomal subunits,

target mRNA and tRNAfMet basically according to Hartz et al. (49). The 5’-[32P]-labeled toxT-

specific oligonucleotide toxT-runoff-toeprinting (Table S1) was used as a primer for cDNA

synthesis. An aliquot of 0.08 pmol mRNA (5’-UTR plus 60 nt of the toxT coding region)

annealed to the oligonucleotide was incubated for 10 min at 30 or 37°C, respectively,

together with 16 pmol of uncharged tRNAfMet (Sigma-Aldrich, St. Louis, Missouri). 6 pmol of

30S subunits or ribosome-buffer (TICO buffer, negative control) was added and incubation

for another 10 min followed before 2µl of MMLV-Mix (VD+Mg2+-buffer, BSA, dNTPs and

MMLV reverse transcriptase (USB, Cleveland, Ohio)) was added. cDNA synthesis was

performed at 30°C. Reactions were stopped after 10 min by adding formamide loading dye

and aliquots were separated on a denaturing 8% polyacrylamide gel.


7

β-Galactosidase assays

β-Galactosidase activities of E. coli and V. cholerae strains carrying lacZ-fusions (pBO1296,

1826, 1827, 1828, 1829, 1830, 1831, 1839, 1840, 1841, 1842 and 1843) were measured as

described previously (50). The cells were shifted from 30°C to prewarmed flasks at 37°C for

various time lengths as indicated in the figure legends.

In silico RNA structure prediction

RNA secondary structures were predicted by using the mfold server (http://

frontend.bioinfo.rpi.edu/applications/mfold/cgi-bin/rna-form1.cgi) running version 3.2 (51) and

the RNAsubopt package (http://mobyle.pasteur.fr/cgi-bin/portal.py?form=rnasubopt; (52). For

pseudoknot predictions we used the pnotsRG program from the Bielefeld University

Bioinformatics Server (http://bibiserv.techfak.uni-bielefeld.de/pknotsrg/; (53).


8





http://mobyle.pasteur.fr/cgi-bin/portal.py?form=rnasubopt

http://mobyle.pasteur.fr/cgi-bin/portal.py?form=rnasubopt

http://bibiserv.techfak.uni-bielefeld.de/pknotsrg/

http://bibiserv.techfak.uni-bielefeld.de/pknotsrg/

Results

Functional analysis of the Vibrio toxT 5‘ element

The entire toxT 5‘-UTR (as found in Classical and El Tor strains) including its determined

ToxR-dependent transcription start site (54) and the AUG triplet was used for an in silico

folding approach (51). Consisting of 68 nucleotides with a calculated overall free energy of

-12.0 kcal mol-1 (51), the estimated toxT 5‘ leader structure comprises a stable stem

harbouring the SD (AGAG) and anti-SD FourU-motif, the internal asymetric loop L1 and the

top loop L2 (Fig. 2A). The AUG is separated from the basis of the stem by a palindromic five-

nucleotide stretch.

The Escherichia coli reporter plasmid system pBAD18-lacZ481 (55) was used to

examine temperature-dependent regulation of translation by the toxT 5‘-UTR. The leader

sequence was cloned between the L-arabinose-inducible pBAD promoter and the lacZ

reporter cassette (Fig. 2B). As Vibrio is found either in marine habitats or human hosts, we

checked for reporter gene expression at 30 and 37°C. To our surprise, the β-galactosidase

activity of 21 MU at 30°C was drastically reduced to merely 2 MU by a sudden shift to 37°C

(Fig. 2C). This shut-off of reporter gene activity by the toxT 5‘-UTR at human body-

temperature was contrasted by the control experiments with the Salmonella agsA FourU

thermometer (46) and its >5-fold induction upon temperature upshift. Even a translational

fusion to the 5‘-UTR of the E. coli housekeeping gene gyrA (coding for the DNA gyrase)

showed 2-fold induction at 37°C. Subsequent Northern analysis demonstrated that the

decline in reporter gene activity at 37°C was due to translational control by the toxT leader

rather than to altered transcript levels (Fig. 2D). This indicates tight and efficient regulation by

the Vibrio toxT 5‘-leader at the post-transcriptional level.

The top portion of toxT leader mRNA undergoes temperature-mediated slippage, enabling

pseudoknot formation in close vicinity to SD sequence and AUG start site

As reduction of translation initiation at elevated temperatures is a rare feature of cis-

regulatory mRNAs, we addressed the structural changes of the toxT 5‘-UTR in detail. The

toxT 5‘-UTR was synthesized by T7 RNA polymerase-mediated in vitro transcription and its


9

Figure 2. Translational control by the toxT 5‘-UTR in E. coli. (A) Predicted secondary structure (Zuker, 2003) of the entire toxT leader. The start codon (AUG, bold letters) is located 69 nucleotides

downstream of the transcription start site. The SD and 4U (anti-SD) sequences, loop 1 (L1) and loop 2 (L2) are labeled. (B) Schematic representation of the reporter gene fusion on plasmid pBAD18-

lacZ481. Additional nucleotides inserted due to the position of the NheI cloning site relative to the pBAD promoter are indicated by a box upstream of the 5’-UTR. The artifical nucleotides at the 5’ end

of the toxT transcript do not influence RNA folding and expression of the gene (data not shown). (C) Expression of translational lacZ reporter fusions (Miller Units, MU) to the toxT 5‘-UTR. E. coli DH5α

cells containing plasmid pBO1296 carrying the toxT-lacZ fusion were grown in LB medium at 30°C and either kept at this temperature (white columns) or transferred to 37°C (black columns) for 30 min

before β-galactosidase activity was measured. A Salmonella agsA-lacZ fusion (FourU thermometer; Waldminghaus et al. 2010) was used as a positive control, while E. coli gyrA-lacZ served as a

negative control. All experiments were repeated at least in triplicate. (D) mRNA levels of toxT, agsA and gyrA-lacZ fusions at 30 and 37°C. Total RNA was extracted from E. coli cultures incubated at

either 30 or 37°C. Equal amounts were separated on a 1.2% denaturing agarose gel and Northern blot experiments were carried out using digoxygenin-labeled RNA probes to detect lacZ transcripts.

Ethidium-bromide stained 16S rRNAs from the gel before blotting are shown as loading control. The lacZ fusion transcripts run at 3 kb.

A B

C

D


10

structure was mapped by enzymatic and chemical probing at a temperature gradient from 20

to 50°C. The cleavage pattern after limited digestion with different RNases indicated that the

in silico predicted structure (Fig. 2A) only applies to low temperature conditions (20-30°C) but

undergoes subtle conformational changes in its top portion above 30°C (Fig. 3A). As

predicted, the two guanine residues G28 and G29 in loop L2 were sensitive towards RNase

T1, which cuts 3‘ of single-stranded guanines, from 20 to 30°C. However, above 30°C both

nucleotides became increasingly susceptible to RNase V which is specific for double-

stranded (paired) regions (56). The RNAsubopt package (52) predicted suboptimal folding of

the toxT RNA at various temperatures (supplementary Fig. S1), providing additional in silico

evidence that G28 and G29 move into the top portion stem via a slippage-like mechanism as

in the synthetic theophylline riboswitch (57). The translational shut-down at 37°C by the toxT-

leader does not depend on sequestration of the SD sequence, as we detected T1 cleavage

of SD guanines from 30°C upwards. Poor sensitivity of nucleotides G57 and G59 at 20 and

25°C suggested pairing with the anti-SD region at low temperatures as in other FourU

thermometers. Another structural conversion above 30°C occurred in close proximity to the

SD. The palindromic stretch ACGCA motif (PS1) became increasingly sensitive towards

RNase V above 30°C. Lead probing supported the enzymatic probing results. Lead is a

single-strand-specific probe that induces cleavage of the sugar-phosphate backbone. The

PS1 nucleobases appeared to be single stranded at 20, 25 and 30°C but were protected

against cleavage at higher temperatures (Fig. 3B). Sequestration of the PS1 side was

accompanied by base pair slippage in stem loop L2 beyond 30°C as nucleotides C32, U33

and C34 were progressively attacked by lead ions. This slippage liberated a second

palindromic sequence, UGCGU (PS2), with perfect complementarity to PS1 (Fig. 3C).

Potential pseudoknot (PK) interaction between the upstream residing PS1 sequence and the

temperature-sensitive PS2 region at 37°C is supported by in silico analysis using the

pknotsrg program. The resulting tertiary structure might prevent docking of the 30S ribosome

to the SD sequence, thereby shutting off translation initiation at 37°C.


11

A B

C


12

Figure 3. Enzymatic and chemical „melting curve“ probing of the toxT leader. (A-B) Enzymatic hydrolysis and lead(II)-induced cleavages performed on 5‘-end-labeled toxT 5‘-UTR alongside a

temperature gradient (20-50°C, using a 5°C-stepped gradation). The conditions for RNase and lead(II) concentrations were as follows: (A) RNase T1 (0.004U), RNase V (0.008U); (B) lead(II) (10

mM). RNA fragments were separated on 8% (A) or 8 and 15% (B) polyacrylamide gels. Lanes N, controls without RNase or modifying agents; lanes 50, RNase cleavages under denaturing conditions;

lanes L, alkaline ladder. SD (Shine Dalgarno), L1 (loop 1), PS1/2 (Palindromic Sequence 1/2), top portion and anti-SD regions are indicated; PK (Pseudoknot). (C) Computer predicted (Wuchty et al.,

1999; Zuker, 2003) secondary structures of the toxT 5‘-UTR at 30 (blue) and 37°C (red). Direction of nucleobase slippage is depicted by arrows. PK formation between PS2 and PS1 at 37°C is visualized

by dotted lines. Nucleotides of interest are encircled. The AUG start codon is marked by bold letters.

The toxT 5‘-UTR inhibits ribosome binding at 37°C

To examine temperature-controlled ribosome binding to the toxT 5‘-leader, we performed

toeprinting (primer extension inhibition) assays at 30 and 37°C. Ternary complex formation

between initiator tRNAfMet, 30S ribosomes and the toxT transcript (68 nucleotides 5‘-UTR +

60 nucleotides coding region) was defined by extension of a radio-labeled primer.

Prematurely terminated cDNA products (toeprints) corresponding to the +14 position

downstream of the AUG triplet were expected if ribosome was bound to the toxT RNA.

Consistent with the reporter gene fusion results (Fig. 2C), ribosome binding evidenced by a

prominent toeprint associated with reduced yield of full-length cDNA at 30 but not 37°C (Fig.

4). A structural rearrangement at 37°C is supported by the appearance of two additional

Figure 4. Temperature-dependent ribosome binding to the toxT leader. Toeprinting was carried out on 2 pmol RNA as described in Materials and Methods. The absence (-) or presence (+) of 30S

subunits is indicated. Terminated reverse transcription products (toeprints) at position +14 relative to the A of the start codon and full-length products are pointed out by arrows. TGCA refers to a

sequencing ladder generated with the same oligonucleotide as in the toeprint experiments. The position of the start codon is boxed. Position of the SD (Shine Dalgarno) sequence is indicated.


13

toeprint signals at positions of guanine 38 and cytosine 32 in the presence and absence of

30S ribosomes.

Characterization of rationally designed and natural oriented toxT leader variants

Inhibition of toxT translation initiation is based on secondary and tertiary structure

rearrangements interfering with ribosome access. Since the in vitro experiments suggested

that this happened in an RNA-only fashion, point mutations in critical RNA regions should

have an impact on toxT thermosensing. Selected sites for oligonucleotide-directed

mutagenesis are outlined in Fig. 5A, including those of naturally occurring toxT variants,

which deviate from Classical/El Tor leader sequences. The alignment includes 5‘-UTRs from

less infectious environmental strains and recent patient isolates (Kolkata strains, (Chatterjee

et al., 2009) (Fig. 5B). All four Kolkata variants SC132, SC124, SC107 and SC72 carry

changes (G3A, U5C and U13C) in or around the anti-SD sequence as does the

environmental strain SCE200 (G3A and U13C). SCE4 contains a substitution in the top

portion loop L2 (C32U), one downstream of the SD sequence (A61G) and a deletion of

bulged cytosine 55 (ΔC55).

The first set of rational mutations (M1-M4) directly targeted the two purines G28 and

G29 to override translational repression by blocking temperature-induced base pair slippage

of loop L2. Indeed, M1 (ΔG28/G29), M2 (GG28/29CC), M3 (ΔG28) and M4 (G28C)

prevented repression at 37°C suggesting impaired liberation of the PK forming PS2 site (Fig.

5C). M1 to M4 exhibited increased β -galactosidase activity upon a shift from 30 to 37°C.

Neither of the four variants was transformed into a typical RNA thermometer, like the

Salmonella agsA 5‘-UTR, which revealed a 5.9-fold induction. Interestingly, efficient heat

induction was achieved by removal of the entire stemloop II through deletion mutation M5

(Δ14-48).

With a 6.5-fold induction from 19.8 MU (30°C) and 124.9 MU (37°C) M5 acted as bona fide

RNA thermometer (for secondary structure prediction see supplementary Fig. S2). This

indicates that the toxT 5‘-UTR is a bipartite thermosensor, in which stemloop II prevents the

otherwise favourable melting of stemloop I at 37°C. To study the contribution of the anti-SD


14

sequence we substituted substituted G-U base pairs by more stable G-C base pairs. M6

(U5C) and M7 (U7C) both exhibited tighter repression at both temperatures. Exchange of the

bulged cytosine immediately upstream of the SD sequence (C55) to a G (M8) had little effect

on β -galactosidase activity at 30 and 37°C suggesting that this residue plays no significant

role in the toxT 5‘-UTR.

The natural toxT 5‘-UTR variants revealed different temperature responses. While the

M9 (Kolkata) and M11 (SCE200) variants still repressed reporter translation (although less

Figure 5. Characterization of rationally designed and natural oriented toxT leader variants. (A) Site-directed mutations M1 to M11 and the exchanged nucleotides are denoted in red letters. (B) Alignment of toxT 5‘-UTR variants from isolated environmental and clinical strains (Kolkata) to the El Tor O395 sequence (which we used as WT toxT leader sequence in this work). Deviating nucleotides

are marked with bold letters. The respective position is underlined in the WT sequence. (C) Expression of the translational lacZ reporter fusions (Miller Units, MU) to various toxT 5‘-UTRs.

Experiments were conducted as described (legend Fig. 2; Materials and Methods). The bars indicate the means of at least three independent experiments, and the error bars indicate standard deviations.

Induction / repression rates are shown above each fusion. (D) In vitro transcribed toxT thermometer variants M1 and M2 were used for toeprinting analysis at 30 and 37°C as described (legend Fig. 4;

Materials and Methods). The arrows indicate up- or down regulation.

A B

C

D


15

effective than the WT), M10 (SCE4) lacked the ability to repress translation at 37°C. This

might hint for differences in virulence gene regulation in evolutionary diverse Vibrio strains.

To obtain further evidence for the requirement of G28 and G29 in translational

repression at 37°C, we conducted toeprinting analysis of M1 and M2 (Fig. 5D). Both variants

allowed equally effective docking of the ribosome to the SD sequence at 30 and 37°C.

Deletion of G28/G29 (M1) or substitution by cytosine residues (M2) prevented formation of

ribosome-blocking structures in good agreement with the abolished reporter gene induction

in the lacZ assay. To validate the effect of G28 and G29 on base pair slippage, we compared

the structure of the M2 RNA with the WT transcript (Fig. 6). The M2 RNA revealed

comparatively increased rigidity of stemloop L2, visible by enhanced RNase V cleavage at

positions C34, U35, C37, G38 and U39. Thus, a proper base pair slippage is presumably not

longer possible. The SD residing nucleotides G57 and G59 were attacked by RNase T1 to a

greater extent, when compared to the WT RNA. This suggested an enhanced susceptibility

of the RBS site, due to failed PK formation in the M2 variant.

Figure 6. Comparative structure probing analysis of toxT WT and M1 5‘-UTR. Enzymatic cleavages performed on 5‘-end-labeled toxT 5‘-UTR at 30 or 37°C. The conditions for RNase T1 and

RNase V were as described (legend Fig. 3; Materials and Methods). Bars mark the fold difference in RNase V (black) or T1 (grey) cleavage intensity at 37°C of M2 variant relative to the WT. Positions of

top portion, SD (Shine Dalgarno) and start (AUG) codon were indicated relative to the transcription start site.


16

The Vibrio case: high induction by the toxT 5‘-leader at host body temperature (37°C)

Spatio-temporal regulation of virulence gene expression is inevitable to avoid early immune

responses and start host invasion at the right time point (2,58). Somewhat counterintuitively,

the toxT 5‘-UTR successfully repressed formation of a translation initiation complex at 37°C

in vitro and in E. coli by an RNA-only mechanism. However, when checked in the

background of a Classical V. cholerae strain the toxT cis-element enabled a 19-fold induction

of the lacZ reporter gene upon a shift from 30 to 37°C (Fig. 7). The Vibrio El Tor strain

background caused higher β-galactosidase activity at low temperature resulting in a 3.2-fold

induction.

The conversion of a repressing cis-element into an activating element suggests that the

RNA-inherent capacity of the toxT 5‘-UTR to repress translation at 37°C is overcome by a yet

undefined, trans-active factor in V. cholerae.

Figure 7. Translational control by the toxT 5‘-UTR in Vibrio. V. cholerae KKV598 (Classical Ogawa strain) or C6706 (El Tor Inaba strain) cells containing plasmid pBO1296 were grown in LB

medium at 30°C and either kept at this temperature (white columns) or transferred to 37°C (black columns) for 30 min before β-galactosidase activity was measured. Induction rates are indicated. All

experiments were repeated at least in triplicate. Arrows indicate upregulation.


17

Discussion

Hallmarks of the toxT thermosensor

Until recently, virulence gene expression in V. cholerae was thought to be controlled mainly

at the level of transcription initiation by activating or repressing proteins (2). Although several

regulatory RNAs have been described in Vibrio, most of them are related to physiological

processes (30,32,59,60). Song et al. recently described a regulative RNA with probable

impact on Vibrio pathogenesis. A mutant strain lacking the small RNA vrrA exhibited

increased expression of the ToxT-dependent virulence factor TCP (28). The trans-activity of

vrrA was shown to depend on the RNA chaperone Hfq (29).

This study describes the discovery of a cis-regulatory RNA found upstream of the

virulence master regulator ToxT in highly pathogenic V. cholerae strains. The toxT leader is

the first RNA thermometer found in a Vibrio species. The isolated element represses

translation initiation at 37°C in vitro and in E. coli by sequestration of the RBS at 37°C in an

RNA-only mechanism. The structure-based negative regulation at human body temperature

was overcome in the two most-pathogenic Vibrio biotypes, Classical (strain KKV598) and El

Tor (strain C6706). We propose that a trans-acting Vibrio-factor is involved in this process

(see below).

Having a length of 68 nucleotides, an internal loop and a paired RBS, the toxT 5‘-UTR

comprises all features of a functional RNA thermosensor (61,62). Since four uridine residues

pair with the SD sequence, it belongs to the class of FourU thermometer elements like

Salmonella agsA (46) or Yersinia lcrF (63). In contrast to agsA or lcrF, the toxT 5‘-UTR is

organized in a bipartite fashion. Typical thermometer-like melting and translation initiation at

elevated temperatures is possible with hairpin I alone. Hairpin II, however, prevents

translation at 37°C in E. coli and in vitro by a complex mechanism involving nucleobase

slippage and pseudoknot formation. It has been reported that single nucleotide slippage in a

rationally designed theophylline riboswitch can be sufficient to prevent translation initiation

(57). This was achieved by coupling the theophylline aptamer domain to a synthetic induction

module developed by the Breaker lab (64) and clearly demonstrates that subtle

conformational changes in an RNA element may alter functionality in vivo (57,65). Here, we


18

demonstrate slippage of a complete nucleotide chain. At elevated temperatures, sliding of

nucleotides in the toxT top portion element liberates a palindromic stretch of five nucleotides

(UGCGU, PS2) with perfect complementarity to another palindromic sequence (ACGCA,

PS1) between the SD sequence and the AUG start codon. Structural reorganization of the

top portion element dictates the accessibility of the adjoining FourU thermometer module by

PK formation between PS2 and PS1 (Fig. 3). The PK was stable enough to prevent binding

of 30S ribosomal subunits at 37°C in toeprinting experiments (Fig. 4). The fact that deletion

of the stem II module turns the repressing toxT element into a classical FourU thermometer

might be a hint that the toxT thermosensor evolved from a heat-sensing RNA thermometer,

to which an additional control module has been added during co-evolution with the human

host.

Functionality of both the slippage module and the toxT FourU thermometer was

sensitive towards single point mutations. Substitution of two guanine residues in the L2 loop

impaired nucleotide chain slippage and interfered with formation of RBS masking structures.

The mutants were able to bind 30S ribosomal subunits at 37°C, which was also evident by

enhanced accessibility of the SD sequence towards RNase T1 and elevated reporter gene

activity. In summary, the toxT 5‘-UTR is an unique RNA element consisting of a slippage

module and the FourU thermometer and a downstream box whose concerted action controls

translation of the virulence master regulator ToxT.

The first six cholera pandemics (1817-1923) were caused by the Classical, and the

ongoing seventh pandemic (1961-present) by the El Tor biotype (66).

The toxT 5‘-UTR is identical in both biotypes. Interestingly, there are differences in the 5‘

leader sequences of the less infectious Vibrio strains SC132, SC124, SC107 and SC72 that

were recently isolated from hospitalized diarrheal patients in Kolkata, India (67). These

strains lack ~6% of the V. cholerae genome and have different virulence factors including

alleles of the toxT gene. The 5‘-UTR of alternate toxT genes of all four Kolkata strains

deviate in three nucleotides from the WT allele. The Kolkata consensus 5‘-UTR still

repressed E. coli reporter gene expression but less efficient than the toxT WT thermometer

(Fig. 5). We obtained equal results for an environmental toxT leader variant (SC200), only

the SC4 strain completely lacked negative regulation. How these different toxT thermometer


19

variants influence toxT expression in Vibrio and how this affect virulence remains to be

studied.

Temperature-controlled toxT expression in V. cholerae

ToxT is centrally positioned in the V. cholerae virulence cascade. Since a toxT deletion

mutant highly attenuated for virulence (68), every alteration in abundance of the ToxT will

have an impact on virulence gene expression. ToxT transduces environmental signals

detected by a complex sensory system including ToxR/ToxS, TcpP/TcpH and the outer

membrane proteins OmU/OmpT (2,16). Bile and temperature directly affect expression of

ToxT-dependent genes (10) as well as other intestinal compounds (12,14). On basis of our

study, we postulate another layer of control exerted by the toxT thermosensor. There is basal

ToxR-dependent expression of toxT under environmental conditions (69). Seasonal warming

of V. cholerae aquatic reservoirs to 30°C might be sufficient to melt the toxT SD sequence

(Fig. 3), thereby facilitating translation initiation and expression of the ToxT protein (Fig. 8a).

The present ToxT activator starts an autoregulatory loop (18) resulting in constant increase of

toxT mRNA at elevated environmental temperatures (30°C), priming Vibrio for host contact. It

is known that warming of the aquatic environment favours survival and growth of V. cholerae.

The importance of this ecological parameter is reflected by annual increases of cholera

incidents in Southeastern Africa (70). The multiplication and persistence of V. cholerae in the

aquatic environment is correlated with massive proliferation of phytoplankton at 30°C (71) on

which Vibrio species form biofilms which enhances the chance of ingestion by the human

host via contaminated water. Ingestion by the warm-blooded human host leads to a sudden

increase in temperature (37°C). This induces tertiary structure rearrangements in the toxT 5‘

leader. Concomitant PK formation shuts off expression of the ToxT protein and, inevitably,

downregulates all ToxT-dependent virulence factors (Fig. 8b) which might protect Vibrio from

the host innate immune defense, especially the human complement system (72,73). This

RNA-only repressive mechanisms can be counteracted by an unknown Vibrio-specific factor

(VSF) (Fig. 7). Binding of the VSF might hinder nucleobase slippage and PK formation

granting the ribosome access to the SD site. Switching on toxT expression induces the


20

virulence factors TCP and CT and, by this, initiates the final phase of host-invasion (Fig. 8c).

Most likely, VSF expression and docking to the toxT slippage module happens before the

intestinal entry, because TCP is needed for tethering of Vibrio cells to prevent sheering

forces (2). The toxT expression is shut down at low temperatures of cold marine habitats

(<20°C), simply because the base pairing between the FourU and the SD sequence is too

stable (Fig. 3) to allow binding of the ribosome (Fig. 8d).

The nature of the VSF is unknown. It could either be a protein or a regulatory RNA.

An example of a complex virulence thermometer is the L. monocytogenes prfA element,

which was initially reported to act by the classical melting mechanism (43). However, recently

the involvement of a S-adenosylmethionine (SAM) riboswitch, SreA, which represses

expression of prfA by binding to the thermometer region, has been reported (74). Screening

large-scale sequence-defined mutant libraries could help identifying the unknown VSF (75).

Figure 8. The toxT thermometer governs spatiotemporal expression of the ToxT virulence master regulator by temperature-mediated conformational changes. For detailed information,

see discussion.


21

Given the involvement of a regulatory RNA, it might be included in previously reported data

sets (33,34).


22

Funding

This work was funded by a grant from the German Research Foundation (DFG priority

program 1258) to FN and by a fellowship from the Studienstiftung des Deutschen Volkes to

JK.

Acknowledgements

We thank Joachim Reidl (Graz) for providing V. cholerae chromosomal DNA. We are grateful

to Birgit Klinkert for preparation of 30S ribosomal subunits and to Ulla Aschke-Sonnenborn

for technical assistance. All members of the RNA group, Robert Giegerich (Bielefeld) and

Petra Dersch (Braunschweig) are acknowledged for critical comments on the manuscript and

helpful discussions.


23

References

1. Sack, D.A. (2006) Herd protection and herd amplification in cholera. J Health Popul Nutr, 24, 1-5.

2. Childers, B.M. and Klose, K.E. (2007) Regulation of virulence in Vibrio cholerae: the ToxR regulon. Future Microbiol, 2, 335-344.

3. DiRita, V.J. and Mekalanos, J.J. (1991) Periplasmic interaction between two membrane regulatory proteins, ToxR and ToxS, results in signal transduction and transcriptional activation. Cell, 64, 29-37.

4. Bellair, M. and Withey, J.H. (2008) Flexibility of Vibrio cholerae ToxT in transcription activation of genes having altered promoter spacing. J Bacteriol, 190, 7925-7931.

5. DiRita, V.J., Parsot, C., Jander, G. and Mekalanos, J.J. (1991) Regulatory cascade controls virulence in Vibrio cholerae. Proc Natl Acad Sci U S A, 88, 5403-5407.

6. Higgins, D.E., Nazareno, E. and DiRita, V.J. (1992) The virulence gene activator ToxT from Vibrio cholerae is a member of the AraC family of transcriptional activators. J Bacteriol, 174, 6974-6980.

7. Ogierman, M.A. and Manning, P.A. (1992) Homology of TcpN, a putative regulatory protein of Vibrio cholerae, to the AraC family of transcriptional activators. Gene, 116, 93-97.

8. Withey, J.H. and DiRita, V.J. (2006) The toxbox: specific DNA sequence requirements for activation of Vibrio cholerae virulence genes by ToxT. Mol Microbiol, 59, 1779-1789.

9. Chaparro, A.P., Ali, S.K. and Klose, K.E. (2010) The ToxT-dependent methyl-accepting chemoreceptors AcfB and TcpI contribute to Vibrio cholerae intestinal colonization. FEMS Microbiol Lett, 302, 99-105.

10. Schuhmacher, D.A. and Klose, K.E. (1999) Environmental signals modulate ToxT-dependent virulence factor expression in Vibrio cholerae. J Bacteriol, 181, 1508-1514.

11. Skorupski, K. and Taylor, R.K. (1997) Sequence and functional analysis of the gene encoding Vibrio cholerae cAMP receptor protein. Gene, 198, 297-303.

12. Abuaita, B.H. and Withey, J.H. (2009) Bicarbonate Induces Vibrio cholerae virulence gene expression by enhancing ToxT activity. Infect Immun, 77, 4111-4120.

13. Gupta, S. and Chowdhury, R. (1997) Bile affects production of virulence factors and motility of Vibrio cholerae. Infect Immun, 65, 1131-1134.

14. Lowden, M.J., Skorupski, K., Pellegrini, M., Chiorazzo, M.G., Taylor, R.K. and Kull, F.J. (2010) Structure of Vibrio cholerae ToxT reveals a mechanism for fatty acid regulation of virulence genes. Proc Natl Acad Sci U S A, 107, 2860-2865.

15. Hase, C.C. and Mekalanos, J.J. (1998) TcpP protein is a positive regulator of virulence gene expression in Vibrio cholerae. Proc Natl Acad Sci U S A, 95, 730-734.

16. Krukonis, E.S., Yu, R.R. and Dirita, V.J. (2000) The Vibrio cholerae ToxR/TcpP/ToxT virulence cascade: distinct roles for two membrane-localized transcriptional activators on a single promoter. Mol Microbiol, 38, 67-84.


24

17. Miller, V.L. and Mekalanos, J.J. (1985) Genetic analysis of the cholera toxin-positive regulatory gene toxR. J Bacteriol, 163, 580-585.

18. Yu, R.R. and DiRita, V.J. (1999) Analysis of an autoregulatory loop controlling ToxT, cholera toxin, and toxin-coregulated pilus production in Vibrio cholerae. J Bacteriol, 181, 2584-2592.

19. Shakhnovich, E.A., Hung, D.T., Pierson, E., Lee, K. and Mekalanos, J.J. (2007) Virstatin inhibits dimerization of the transcriptional activator ToxT. Proc Natl Acad Sci U S A, 104, 2372-2377.

20. Chatterjee, S., Asakura, M., Chowdhury, N., Neogi, S.B., Sugimoto, N., Haldar, S., Awasthi, S.P., Hinenoya, A., Aoki, S. and Yamasaki, S. (2010) Capsaicin, a potential inhibitor of cholera toxin production in Vibrio cholerae. FEMS Microbiol Lett, 306, 54-60.

21. Geissmann, T., Marzi, S. and Romby, P. (2009) The role of mRNA structure in translational control in bacteria. RNA Biol, 6, 153-160.

22. Liu, J.M. and Camilli, A. (2010) A broadening world of bacterial small RNAs. Curr Opin Microbiol, 13, 18-23.

23. Narberhaus, F. and Vogel, J. (2009) Regulatory RNAs in prokaryotes: here, there and everywhere. Mol Microbiol, 74, 261-269.

24. Naville, M. and Gautheret, D. (2010) Transcription attenuation in bacteria: theme and variations. Brief Funct Genomics, 9, 178-189.

25. Sharp, P.A. (2009) The centrality of RNA. Cell, 136, 577-580.


27. Romby, P., Vandenesch, F. and Wagner, E.G. (2006) The role of RNAs in the regulation of virulence-gene expression. Curr Opin Microbiol, 9, 229-236.

28. Song, T., Mika, F., Lindmark, B., Liu, Z., Schild, S., Bishop, A., Zhu, J., Camilli, A., Johansson, J., Vogel, J. et al. (2008) A new Vibrio cholerae sRNA modulates colonization and affects release of outer membrane vesicles. Mol Microbiol, 70, 100-111.

29. Song, T., Sabharwal, D. and Wai, S.N. (2010) VrrA mediates Hfq-dependent regulation of OmpT synthesis in Vibrio cholerae. J Mol Biol, 400, 682-688.

30. Hammer, B.K. and Bassler, B.L. (2007) Regulatory small RNAs circumvent the conventional quorum sensing pathway in pandemic Vibrio cholerae. Proc Natl Acad Sci U S A, 104, 11145-11149.

31. Svenningsen, S.L., Waters, C.M. and Bassler, B.L. (2008) A negative feedback loop involving small RNAs accelerates Vibrio cholerae's transition out of quorum-sensing mode. Genes Dev, 22, 226-238.

32. Svenningsen, S.L., Tu, K.C. and Bassler, B.L. (2009) Gene dosage compensation calibrates four regulatory RNAs to control Vibrio cholerae quorum sensing. Embo J, 28, 429-439.

33. Liu, J.M., Livny, J., Lawrence, M.S., Kimball, M.D., Waldor, M.K. and Camilli, A. (2009) Experimental discovery of sRNAs in Vibrio cholerae by direct cloning, 5S/tRNA depletion and parallel sequencing. Nucleic Acids Res, 37, e46.


25

34. Livny, J. and Waldor, M.K. (2010) Mining regulatory 5'UTRs from cDNA deep sequencing datasets. Nucleic Acids Res, 38, 1504-1514.

35. Kulshina, N., Baird, N.J. and Ferre-D'Amare, A.R. (2009) Recognition of the bacterial second messenger cyclic diguanylate by its cognate riboswitch. Nat Struct Mol Biol, 16, 1212-1217.

36. Lipfert, J., Das, R., Chu, V.B., Kudaravalli, M., Boyd, N., Herschlag, D. and Doniach, S. (2007) Structural transitions and thermodynamics of a glycine-dependent riboswitch from Vibrio cholerae. J Mol Biol, 365, 1393-1406.

37. Lipfert, J., Sim, A.Y., Herschlag, D. and Doniach, S. (2010) Dissecting electrostatic screening, specific ion binding, and ligand binding in an energetic model for glycine riboswitch folding. Rna, 16, 708-719.

38. Smith, K.D., Lipchock, S.V., Ames, T.D., Wang, J., Breaker, R.R. and Strobel, S.A. (2009) Structural basis of ligand binding by a c-di-GMP riboswitch. Nat Struct Mol Biol, 16, 1218-1223.

39. Tucker, B.J. and Breaker, R.R. (2005) Riboswitches as versatile gene control elements. Curr Opin Struct Biol, 15, 342-348.

40. Winkler, W.C. and Breaker, R.R. (2005) Regulation of bacterial gene expression by riboswitches. Annu Rev Microbiol, 59, 487-517.

41. Klinkert, B. and Narberhaus, F. (2009) Microbial thermosensors. Cell. Mol. Life Sci., 66, 2661-2676.




45. Rinnenthal, J., Klinkert, B., Narberhaus, F. and Schwalbe, H. (2010) Direct observation of the temperature-induced melting process of the Salmonella fourU RNA thermometer at base-pair resolution. Nucleic Acids Res.



48. Brantl, S. and Wagner, E.G. (1994) Antisense RNA-mediated transcriptional attenuation occurs faster than stable antisense/target RNA pairing: an in vitro study of plasmid pIP501. EMBO J., 13, 3599-3607.

49. Hartz, D., McPheeters, D.S., Traut, R. and Gold, L. (1988) Extension inhibition analysis of translation initiation complexes. Methods Enzymol., 164, 419-425.

50. Miller, J.H. (1972) Experiments in Molecular Genetics. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York.


26

51. Zuker, M. (2003) Mfold web server for nucleic acid folding and hybridization prediction. Nucleic Acids Res., 31, 3406-3415.

52. Wuchty, S., Fontana, W., Hofacker, I.L. and Schuster, P. (1999) Complete suboptimal folding of RNA and the stability of secondary structures. Biopolymers, 49, 145-165.

53. Reeder, J. and Giegerich, R. (2004) Design, implementation and evaluation of a practical pseudoknot folding algorithm based on thermodynamics. BMC Bioinformatics, 5, 104.

54. Higgins, D.E. and DiRita, V.J. (1994) Transcriptional control of toxT, a regulatory gene in the ToxR regulon of Vibrio cholerae. Mol Microbiol, 14, 17-29.

55. Waldminghaus, T., Fippinger, A., Alfsmann, J. and Narberhaus, F. (2005) RNA thermometers are common in alpha- and gamma-proteobacteria. Biol Chem, 386, 1279-1286.

56. Hartmann, K., Bindereif, A., Schön, A., Westhof, E. (2005) Handbook of RNA Biochemistry. 1st ed. Wiley-VCH, Weinheim.

57. Suess, B., Fink, B., Berens, C., Stentz, R. and Hillen, W. (2004) A theophylline responsive riboswitch based on helix slipping controls gene expression in vivo. Nucleic Acids Res, 32, 1610-1614.

58. Pacheco, A.R. and Sperandio, V. (2009) Inter-kingdom signaling: chemical language between bacteria and host. Curr Opin Microbiol, 12, 192-198.

59. Davis, B.M., Quinones, M., Pratt, J., Ding, Y. and Waldor, M.K. (2005) Characterization of the small untranslated RNA RyhB and its regulon in Vibrio cholerae. J Bacteriol, 187, 4005-4014.

60. Davis, B.M. and Waldor, M.K. (2007) RNase E-dependent processing stabilizes MicX, a Vibrio cholerae sRNA. Mol Microbiol, 65, 373-385.


62. Narberhaus, F. (2010) Translational control of bacterial heat shock and virulence genes by temperature-sensing mRNAs. RNA Biol, 7, 84-89.

63. Hoe, N.P. and Goguen, J.D. (1993) Temperature sensing in Yersinia pestis: translation of the LcrF activator protein is thermally regulated. J. Bacteriol., 175, 7901-7909.

64. Soukup, G.A. and Breaker, R.R. (1999) Engineering precision RNA molecular switches. Proc Natl Acad Sci U S A, 96, 3584-3589.

65. Verhounig, A., Karcher, D. and Bock, R. (2010) Inducible gene expression from the plastid genome by a synthetic riboswitch. Proc Natl Acad Sci U S A, 107, 6204-6209.

66. Safa, A., Nair, G.B. and Kong, R.Y. (2009) Evolution of new variants of Vibrio cholerae O1. Trends Microbiol, 18, 46-54.

67. Chatterjee, S., Ghosh, K., Raychoudhuri, A., Chowdhury, G., Bhattacharya, M.K., Mukhopadhyay, A.K., Ramamurthy, T., Bhattacharya, S.K., Klose, K.E. and Nandy, R.K. (2009) Incidence, virulence factors, and clonality among clinical strains of non-O1, non-O139 Vibrio cholerae isolates from hospitalized diarrheal patients in Kolkata, India. J Clin Microbiol, 47, 1087-1095.


27

68. Champion, G.A., Neely, M.N., Brennan, M.A. and DiRita, V.J. (1997) A branch in the ToxR regulatory cascade of Vibrio cholerae revealed by characterization of toxT mutant strains. Mol Microbiol, 23, 323-331.

69. Brown, R.C. and Taylor, R.K. (1995) Organization of tcp, acf, and toxT genes within a ToxT-dependent operon. Mol Microbiol, 16, 425-439.

70. Paz, S. (2009) Impact of temperature variability on cholera incidence in southeastern Africa, 1971-2006. Ecohealth, 6, 340-345.

71. Huq, A., Small, E.B., West, P.A., Huq, M.I., Rahman, R. and Colwell, R.R. (1983) Ecological relationships between Vibrio cholerae and planktonic crustacean copepods. Appl Environ Microbiol, 45, 275-283.

72. Konkel, M.E. and Tilly, K. (2000) Temperature-regulated expression of bacterial virulence genes. Microbes Infect, 2, 157-166.

73. Lambris, J.D., Ricklin, D. and Geisbrecht, B.V. (2008) Complement evasion by human pathogens. Nat Rev Microbiol, 6, 132-142.

74. Loh, E., Dussurget, O., Gripenland, J., Vaitkevicius, K., Tiensuu, T., Mandin, P., Repoila, F., Buchrieser, C., Cossart, P. and Johansson, J. (2009) A trans-acting riboswitch controls expression of the virulence regulator PrfA in Listeria monocytogenes. Cell, 139, 770-779.

75. Cameron, D.E., Urbach, J.M. and Mekalanos, J.J. (2008) A defined transposon mutant library and its use in identifying motility genes in Vibrio cholerae. Proc Natl Acad Sci U S A, 105, 8736-8741.


28

Figure S1. Suboptimal folding of the toxT 5’-UTR. Dot-bracket annotations of the toxT leader RNA as emitted by RNAsubopt in silico prediction (Wuchty et al., 1999). The -11.54 free energy score

reflects the most stable structure (100%). Free energy is given in kcal mol-1.


29

Figure S2. Secondary structure prediction of toxT leader variant M5. In silico prediction of structure and overall free energy was realized with mfold (Zuker, 2003).

Table S1. Strains, plasmids and oligonucleotides used in this study

Strain, plasmid or oligonucleotide

Relevant characteristic(s) or sequence Source or reference

Strains

E. coli DH5α supE44 ΔlacU169 (Φ80lacZΔM15) hsdR17 recA1 gyrA96 Gibco-BRL

V. cholerae KKV598 Classical Ogawa strain, ΔlacZ Correa et al., 2000

V. cholerae C6706 El Tor Inaba strain, ΔlacZ, StrepR Thelin and Taylor, 1996

Plasmids

pUC18 Cloning vector, AmpR Norrander et al. 1983

pBAD18-lacZ481 Translational lacZ fusion vector, AmpR Waldminghaus et al. 2005

pBO1294 Vibrio toxT 5’-UTR (thermometer element) in pUC18 (QuikChange® template)

This study

pBO1296 Vibrio toxT 5’-UTR-lacZ fusion in pBAD18-lacZ481 This study

pBO1826 Vibrio toxT 5’-UTR-U5C-lacZ fusion in pBAD18-lacZ481 (M6) This study

pBO1827 Vibrio toxT 5’-UTR-ΔG28-lacZ fusion in pBAD18-lacZ481 (M3) This study

pBO1828 Vibrio toxT 5’-UTR-Δ14-48-lacZ fusion in pBAD18-lacZ481 (M5) This studypBO1829 Vibrio toxT 5’-UTR-U7C-lacZ fusion in pBAD18-lacZ481 (M7) This study

pBO1830 Vibrio SCE4 toxT 5’-UTR-lacZ fusion in pBAD18-lacZ481 (M10) This study

pBO1831 Vibrio toxT 5’-UTR-G28C-lacZ fusion in pBAD18-lacZ481 (M4) This study

pBO1839 Vibrio Kolkata toxT 5’-UTR-lacZ fusion in pBAD18-lacZ481 (M9) This study

pBO1840 Vibrio SCE200 toxT 5’-UTR-lacZ fusion in pBAD18-lacZ481 (M11) This study

pBO1841 Vibrio toxT 5’-UTR-C55G-lacZ fusion in pBAD18-lacZ481 (M8) This study

pBO1842 Vibrio toxT 5’-UTR-GG28/29CC-lacZ fusion in pBAD18-lacZ481 (M2)

This study

pBO1843 Vibrio toxT 5’-UTR-ΔGG28/29-lacZ fusion in pBAD18-lacZ481 (M1) This study

pBO1297 Salmonella agsA-lacZ fusion in pBAD-lacZ481 (Control C.1) This study

pBO1298 E. coli gyrA-lacZ fusion in pBAD-lacZ481 (Control C.2) This study

pBO1299 Vibrio toxT 5’-UTR-WT-in vitro transcripts for structure probing experiments, runoff vector (via MlsI site), pUC18-based

This study

pBO1308 Vibrio toxT 5’-UTR-M1-in vitro transcripts for structure probing experiments, runoff vector (via MlsI site), pUC18-based

This study

pBO1309 Vibrio toxT 5’-UTR-M2-in vitro transcripts for structure probing experiments, runoff vector (via MlsI site), pUC18-based

This study

pBO1300 Vibrio toxT 5’-UTR-WT-in vitro transcripts (+60 bp coding region) for toeprinting experiments, runoff vector (via Bsp681 site), pUC18-based

This study

pBO1307 Vibrio toxT 5’-UTR-M1-in vitro transcripts (+60 bp coding region) for toeprinting experiments, runoff vector (via Bsp681 site), pUC18-based

This study

pBO1331 Vibrio toxT 5’-UTR-M2-in vitro transcripts (+60 bp coding region) for toeprinting experiments, runoff vector (via Bsp681 site), pUC18-based

This study

Oligonucleotides

NheI-toxT TTTGCTAGCTCGATTTTAAGATAAC (*pBO1296)

toxT-EcoRI TTTGAATTCAGACATAATGTTAACTCC (*pBO1296)

toxT-M1-fw CTTTACGTGGATCTCTCTGCGTTTA (*pBO1843)

toxT-M1-rv TAAACGCAGAGAGATCCACGTAAAG (*pBO1843)

toxT-M2-fw CTTTACGTGGATCCCTCTCTGCGTTTA (*pBO1842)

toxT-M2-rv TAAACGCAGAGAGGGATCCACGTAAAG (*pBO1842)

toxT-M3-fw CTTTACGTGGATGCTCTCTGCGTTTA (*pBO1827)

toxT-M3-rv TAAACGCAGAGAGCATCCACGTAAAG (*pBO1827)

toxT-M4-fw CTTTACGTGGATCGCTCTCTGCGTTTA (*pBO1831)

toxT-M4-rv TAAACGCAGAGAGCGATCCACGTAAAG (*pBO1831)


30

toxT-M5-fw GATAACTTTATTTATTTATATATG (*pBO1828)

toxT-M5-rv CATATATAAATAAATAAAGTTATC (*pBO1828)

toxT-M6-fw TCGACTTTAAGATAACTTTACGTGG (*pBO1826)

toxT-M6-rv CCACGTAAAGTTATCTTAAAGTCGA (*pBO1826)

toxT-M7-fw TCGATTCTAAGATAACTTTACGTGG (*pBO1829)

toxT-M7-rv CCACGTAAAGTTATCTTAGAATCGA (*pBO1829)

toxT-M8-fw TTATATATCTTGAGAGTAGAACGCAATG (*pBO1841)

toxT-M8-rv CATTGCGTTCTACTCTCAAGATATATAA (*pBO1841)

toxT-M9-fw TCAACTTTAAGACAACTTTACGTGGATG (*pBO1839)

toxT-M9-rv CATCCACGTAAAGTTGTCTTAAAGTTGA (*pBO1839)

toxT-M10-fw ATGGCTTTCTGCGTTTATTTATATATCTGAGTGGAAC (*pBO1830)

toxT-M10-rv GTTCCACTCAGATATATAAATAAACGCAGAAAGCCAT (*pBO1830)

toxT-M11-fw TCAATTTTAAGACAACTTTACGTGGATG (*pBO1840)

toxT-M11-rv CATCCACGTAAAGTTGTCTTAAAATTGA (*pBO1840)

T7-toxT GAAATTAATACGACTCACTATAGGGTCGATTTTAAGATAACTTTACG (*pBO1299 and pBO1300)

toxT-runoff-SP TGGCCATTGCGTTCTACTCTGAAG (*pBO1299)

toxT-runoff-toeprinting

TCGCGAATATGTAAGTATCAAATTTACTC (*pBO1300)

fw-lacZ-probe CTGGCGTAATAGCGAAGAGG (Northern blot probe)

rv-lacZ-probe TAATACGACTCACTATTTGATGAAAGCTGGCTACAGG (Northern blot probe)


31

F. Discussion

1. Synthetic biology - molecular tailoring of biological systems at the nanoscale

A strategy in engineering design is the combination of refined parts that can perform a human-

defined function (53). Jacques Monod was one of the first scientists who proposed a circuit-like

connectivity of biological parts which collectively process logical operations (at the 1961 Cold

Spring Harbor Symposium). Only ten years later, the newly discovered restriction enzymes and

ligases were used to connect viral DNA with chunks of a microbial genome (54). With the new

millennium, breakthroughs in genomic research and genetic engineering have supplied the

technical inventory and methods necessary to physically construct and assemble biomolecular

compounds (55). Today, synthesis of 500 nucleotides DNA of choice costs no more than 150,-

Euros and is done within a week (information by MWG biotech AG, Martinsried, Germany).

Most synthetic biology efforts have focused on engineering regulatory networks that rely on

protein-DNA interactions to perform certain tasks (56). Recently, attention has shifted towards

applications of regulatory RNA molecules (57). In both eukaryotes and prokaryotes, ribonucleic

acids fulfill multifaceted functions due to their ability to adopt complex structures (1, 58-60).

2. RNA synthetic biology inspired by microbes: construction of translation initiators under

temperature control

Structural motifs in naturally occurring RNAs can be applied as new molecular parts for synthetic

biology to facilitate the development of novel tools and system devices that modulate cellular

functions (61). Often it takes a mix of different experimental procedures to obtain the desired RNA

module. Combined chemical genetics and genetic selection helped converting the adenine-sensing

Vibrio vulnificus add riboswitch into a synthetic device that allows tuneable, dose-dependent

control of gene expression in response to nonnatural synthetic small molecules (62). In this work,

we examined the possibilities in combining a bioinformatic approach with classical wetlab

experiments to design a functional, thermosensitive biobrick. In contrast to Dixon and colleagues,

we had no source material as we started. The naturally occurring λ cIII thermosensor, an RNA-only

system with an equilibrium between two alternative thermometer conformations (24, 63), inspired

us to generate a switch-like thermosensor. Our approach did not utilize any nucleotide sequences

or characteristic structural domains of λ cIII. We made use of certain RNA structure prediction

F. Discussion

16

programs (SWITCH by Flamm et al. (64); RNAfold and RNAheat of the Vienna RNA Package (65))

and error-prone mutagenesis (in vivo screening) to finally come up with a nucleotide sequence that

seemed to fulfill the fixed criteria: to fold into two alternative secondary structures upon

temperature alterations, the OFF (30°C, no translation) and the ON (42°C, translation) state.

However, structure probing experiments revealed that only one conformation of the synthetic

thermometer was present at both temperatures. This structure acts by melting like a typical

thermometer. To receive a simple genetic element, we had chosen a sequence length of only 45

nucleotides including the AUG codon. The regulatory principle of the λ cIII thermometer might not

be transferable to the rather small synthetic RNA device, as λ cIII required not only 85 nucleotides

5‘-leader sequence but also 45 nucleotides of the coding region to be fully functional. Furthermore,

the λ cIII messenger flipped into a SD-blocking conformation at high temperature (24), a feature

comparable to translational repression by the Vibrio toxT thermometer analyzed in this work, but

unwanted in our synthetic approach. Another RNA-based thermosensor that falls into two

alternative conformations and blocks translation at high temperature has been described in the E.

coli cspA gene (42). Here, the region involved also is rather long and reaches far into the coding

region of cspA (159 nucleotides UTR + 187 nucleotides coding region).

The small size of the synthetic thermometer might have contributed to the fact that it took

only two rounds of mutagenesis and in vivo selection to obtain a temperature-sensing RNA as

efficient as naturally occurring variants. This fits well to the accepted „early RNA-world“ hypothesis

(66), where simple RNA regulators were formed under prebiotic conditions by Darwinian evolution

(and primordal self-replication) (67-69). It is conceivable, that contemporary complex RNA

elements have evolved from a plethora of simple ancient RNA modules.

Such a „construction kit-like“ attempt has been used to generate a couple of synthetic RNA

thermosensors (70). In contrast to our approach, Neupert and co-workers desired a simple one-

stem thermosensor that gradually melts due to its weak stem-loop structure rather than a switch

between two mutually exclusive conformations. They used three key modules (1. SD sequence, 2.

anti-SD sequence and 3. a spacer/loop sequence between SD and anti-SD) that allowed a quick

replacement through unique restriction sites for de novo synthesis of a temperature-sensitive RNA

(71). Two main parameters were manipulated to adjust the melting temperature: stem stability

(strength of base-pairing in the stem) and the loop size. The synthetic U6 thermometer variant

performed „even better than the natural Listeria monocytogenes prfA thermometer“ in that

temperature inducibility was stronger and background expression was virtually absent (70). Like

prfA, the Synechocystis hsp17 5‘-leader (this work), Salmonella agsA (27), ROSE (35) and ROSE-

F. Discussion

17

like thermometers (29, 37) also exhibited a certain degree of translation initiation under non-stress

conditions even when the gene product was not urgently needed by the cell. This is probably due

to constant „breathing“ of the structure facilitated by special architectural features (see

introduction). Natural thermosensors might not be optimized for full repression because a certain

degree of „leakiness“ might be beneficial under physiological conditions. A basal level of translation

would allow immediate priming of autoregulatory loops, e.g. the prfA gene is regulated by PrfA

itself via an autoregulatory loop mediated by the upstream PrfA-dependent lacA promoter (72), a

principle also discovered in Vibrio cholerae (73) and discussed in context of the newly found toxT

RNA thermometer within this work.

Simplification and, above-all, decoupling of biological design principles are the key

elements of today´s synthetic biology. But, theoretical assumptions and information obtained in

vitro are not necessarily transferable to an in vivo situation. Implementation of a (decoupled)

synthetic RNA device into a non natural context harbours the (unpredictable) potential of unwanted

side effects or aberrant regulatory capacities. Recent work by the Cossart and Johansson groups

showed that the Listeria prfA thermometer is trans-regulated via a SAM-riboswitch element, SreA,

that represses translation by binding to the thermometer region (52). Therefore, it is conceivable

that an exchange of the prfA 5‘-UTR for another, synthetic or natural, thermometer would not

reconstitute a wild type phenotype. Foreign thermometers will presumably not fit into the Listeria

virulence regulon and therefore will not be recognized by the Listeria antisense-RNAs. Mis-

regulation of the Listeria virulence cascade might cause early activation of the human immune

response and attenuate or decrease infectivity.

Another example for the unpredictability of rationally designed RNA elements is a synthetic

riboswitch derived from the transcriptional Bacillus subtilis glycine riboswitch, which is a

transcriptional ON riboswitch (74). The synthetic variant contained an anti-SD sequence designed

to allow translational regulation (translational ON riboswitch) by base-pairing with the SD sequence

(75). Induction via glycine was still possible in gram-negative E. coli, but unforeseeable, the

synthetic RNA switch behaved like a translational OFF switch. Therefore, double-checking

functionality of synthetic thermometers under multiple conditions and in different genetic

backgrounds is recommended to finally receive a tight synthetic RNA biosensor, which

„communicates the state of a specific microenvironment within a sea of environmental conditions

(55)“. From this view, the short and simple Synechocystis hsp17 leader makes a perfect template

for synthetic RNA thermometer devices as we carefully examined its functionality under several in

vitro and in vivo situations (this work).

F. Discussion

18

3. Potential applications of the synthetic RNA thermometer module

Synthetic biology uses certain regulatory devices as composite parts to generate tools with

adjustable functionality. We envisage to employ synthetic thermometers as versatile modules that

are suitable for biotechnological applications but also fundamental research (Fig. 1). Fused to a

gene of choice, the RNA thermometer could induce protein overexpression simply by raising the

ambient temperature (Fig. 1a). The avoidance of chemical inducers reduces potential toxic effects

and lowers the overall costs when planned as a large scale application, e.g. industrial

fermentation. Experiments with the Synechocystis thermometer suggest that cooling-down the

culture will result in immediate translational shut-off. To avoid translational read-through at low

temperature, the thermosensor can be placed under additional control of environment-responsive

promoter sequences (Fig. 1b). This would combine early design strategies adopted for establishing

inducible expression systems (e.g. the LacR/O, TetR/O and AraC/I1-I2 regulatory elements, (76))

with novel translational regulator elements and, by this, allow fine-tuning of synthetic systems via

dual control. The pBAD-lacZ or pBAD-bgaB vectors used in our laboratory (27, 36) follow this

principle. Custom-designed thermometer variants could be applied to express enzymes or

activator proteins, which in turn could induce a specific cellular pathway. Two classes of synthetic

thermometer variants might be appropriate: T (Temperature)-variants, designed as psychrophilic or

thermophilic thermometers (full expression at very low or very high temperatures) and I (Induction)-

variants, with adjustable induction capacities (for example: strong, medium and weak base pairing

of SD and anti-SD sequence) for modulated expression of a certain gene product. The E. coli cspA

thermosensor is an example of a natural cold-shock sensing RNA (41, 42) which is more efficiently

translated at low temperatures. The Thermosynechococcus elongatus hspA 5‘-UTR might act as a

high-temperature sensor with an optimum at 55°C (77). These and other natural RNA

thermometers could be used for the design of synthetic T-variants. It was straightforward to

construct I-variants by rational site-directed mutagenesis of the Synechocystis hsp17 leader (this

work). The biotech engineer could choose from this toolbox and freely combine them. The I-

variants are also suitable for gradual down-regulation of selected genes (Fig. 1c). Conditional cold-

inducible knockdown strains for essential microbial genes could be generated by simply placing

the target gene under the control of synthetic thermometer I-variants and exchanging the resident

F. Discussion

19

copy. Combination of an engineered thermometer with other functional RNA domains (e.g. Rho-

independent terminators), could generate completely new RNA switches which control transcription

termination (Fig. 1d). Transcriptional control is common in riboswitches (20) but has not yet been

discovered in RNA thermometers.

Figure 1. Possible applications of synthetic RNA-based thermosensors. (A) The basic thermosensor model and (B-D) device design strategies for useful implementation of RNA thermometers as

biotechnological tools. (B) The synthetic thermometer as a temperature-sensitive link between an environment-responsive promoter (e.g. arabinose inducible) and the desired open reading frame, intended

for combined transcriptional and translational regulation of protein synthesis. (C) A regulatory RNA module, consisting of an exchangeable RNA thermometer module for differential down regulation of 3‘-attached

genes. Integration into the chromosome is possible via upstream and downstream flanking sequences. (D) Thermosensitive 5‘-element used to prematurely terminate the transcription of downstream genes.

Formation of the terminator hairpin structure is only possible under fixed temperature conditions, otherwise transcription will proceed. SD, Shine Dalgarno; ΔT, temperature shift

A

B

C

D

SD

OFF ON

ΔT

thermometer gene of choicepromoter

low medium high

complementarity

anti-SD

up downthermometer

Induction (I)-variantstarget gene

termination

UUUUU

elongationUUUUU

ΔT

+ +

F. Discussion

20

Linking engineered RNA regulatory components with existing modules could be used to construct

RNA-based biosensors which sense certain stimuli and generate stimulus-specific functional

responses (56). As it has become possible to generate fully functional and reproducing bacterial

cells by a chemically synthesized genome (78), the next steps might include customized cell-

specific organelles for the production and delivery of drugs to humans and domesticated animals

(79). Microbes engineered with optimized biosynthesis circuits might be used to convert biomass

into biofuels (80). The coupling of a sensory module to an engineered gene circuit was already

possible and allowed E. coli cells to act as biosensors that respond to input signals in a

programmable fashion (81). As „the simplest system is one in which control is exerted solely by a

direct sensor of temperature (82)“, synthetic thermometers would be the perfect supplement to

existing regulatory devices.

4. What it takes to be an RNA thermometer - the consensus algorithm

The implementation of bioinformatics into our classic experimental approach for the design of

synthetic RNA thermosensors seemed to be dispensable. However, computational approaches

might be applicable to facilitate the interpretation of experimental results. In our case, the

RNAsubopt (83) program helped us to interpret the various structure probing signals.

Implementation of in vitro and in vivo data, as obtained in this work, into mathematical algorithms

will help to accelerate the development of appropriate computational tools (84).

An appropriate iterative approach is conceivable for the SURIBA (Structures of

Untranslated Regions in Bacteria) database, which predicts putative thermosensor structures in 5‘-

UTRs preceding annotated genes (85). SURIBA uses the RNAfold program (65) for RNA structure

predictions which allows to fix certain structural parameters via dot-bracket annotation. By this, it

was possible to filter out many candidates which share certain structural features: being ROSE-like

or a FourU RNA thermometer (36, 85). Both searches were based on parameters provided by

multiple experiments (26, 27, 38, 39). Today, there are several examples of functional RNA

thermometers with highly diverse structural features (this work; Cimdins unpublished data;

Krajewski unpublished data). Novel bioinformatic tools like RNAalifold (86) could help to generate

a thermometer consensus pattern. RNAalifold scores a combination of sequence consensus and

secondary structure consensus to compute an „universal“ RNA thermometer type (Fig. 2). For this

F. Discussion

21

purpose, we used the SD-harbouring stems of six experimentally validated RNA thermometers.

Although some thermometers consist of several different hairpins that contribute to the

thermosensing capacity (in a „zipper-like“ fashion; 87), the thermometer activity per se resides in

the hairpin with the SD and anti-SD regions. This was supported by good functionality of reduced

ROSE and FourU thermometer variants (27, 39). We did not use the Listeria prfA thermometer

sequence, as the prfA SD-harbouring stem is much longer than all the others (see introduction).

Furthermore, prfA is the only described RNA thermometer from a gram-positive microbe. On the

basis of a consensus sequence (Fig. 2A), RNAalifold combines two algorithms, the Wuchty (83)

and the McCaskill (88) algorithm, to compute secondary structure predictions which illustrate the

likelihood of each base position by colour coding (Fig. 2B). The consensus RNA thermometer

could be used as input query to search for structures with both similar sequences and architecture.

The recently developed Infernal software (INFERence of RNA ALignment; 89) should be an

appropriate search tool, when combined with the SURIBA database. By this, it might be possible to

discover previously undetected RNA thermometer candidates. But, what could we learn from the

consensus pattern? What does it take to be an RNA thermometer?

Figure 2. Prediction of an RNA thermometer consensus format. (A) The SD-harbouring stems of six well-investigated RNA thermometers were used to predict a combined sequence via RNAalifold. (B) Prediction of secondary structure consensus on basis of the underlying structural alignment. Likelihood of temperature-dependent base positioning was calculated (28 and 42°C). The colour coding indicates the

probability of base positioning. blue (0), low probability; red (1), high probability; SD, Shine Dalgarno

!G: -6.96 kcal/mol!G: -4.21 kcal/mol

B

28°C 42°C

SD SD

>ROSE ( )AGGA

> ( )AGGA

> ( )AGGA

> ( )AGAG

> ( )AGGA

> ( )AGGA

consesus sequence RNAalifold:AGGA

hspA B. japonicum

agsA S. typhimurium

hsp17 Synechocystis PCC.6803

toxT V. cholerae

lcrF Y. pseudotuberculosis

ibpA E. coli

CUCGUACCCAUCUUGCUCCUUGG UUUGGCUAUG

GUUGAACUUUUGAAUAGUGAUUC GGUUAAUGAUG

GUAAUCAAUUCCUUCCACACAUC GUUAACAUUAUG

UCGAUUUUAAGAUAUAUCUUC UAGAACGCAAUG

AUAAAUAUAUACAAGUUUUAGAUUUUU CAGUAUAACAUUUAUG

CAUUCUCGCUGAUUUC GCUAUUGAUUAUG

CUAAUUCUAUGCUAUCUCGAGAC GUUAACAAUG

AA B

consensus sequence RNAalifold:

F. Discussion

22

The consensus RNA thermometer exhibits a certain degree of non-perfect base pairing

between the SD and the anti-SD, which is most probably very important for a proper temperature-

mediated melting of the structure. No less crucial are the bulged or unpaired nucleotides in close

vicinity to the SD site. The nucleobases which form an internal loop at 42°C are already imperfectly

matched at 30°C (highlighted in green, which indicates a certain tendency to seek for a new

position within the structure, Fig. 2b). They appear to function as the primary sensing sites, as they

respond already to low temperature variations and might destabilize the overall structure before

the SD sequence is released at higher temperatures, similar to the micro-ROSE thermometer (39).

Formation of the internal loop at 42°C did not affect the nearest flanking nucleotides, but the A-U

base pairs at both ends of the stem. The effect that single conformational changes within a

thermometer molecule are transmitted to distant, not directly connected parts, was revealed by

recent NMR spectroscopy experiments. Long-range effects in the Salmonella FourU thermometer

might be transduced by the surrounding hydrate shell (Dr. Jörg Rinnenthal, Schwalbe lab,

Frankfurt, personal communication) and could be further analyzed via Thz (Terrahertz) laser-

spectroscopy (in collaboration with Prof. Martina Havenith-Neven, Bochum).

5. Destabilization of a bipartite stem - a novel principle among cyanobacterial RNA thermometers?

The Synechocystis hsp17 5‘-leader, the hitherto simplest natural RNA thermosensor, has been

useful to study the effects of conformational changes that do not directly affect the SD or anti-SD

sequence. We could show in this work, that deletion of the kinked internal loop led to a „repressed“

thermometer. Recent imino exchange NMR spectroscopy data (collaboration with Prof. Harald

Schwalbe, Frankfurt) suggests that melting of the hsp17 thermometer comprises consecutive

destabilization of the bipartite stem structure (Fig. 3; by Dominic Wagner, Schwalbe lab, Frankfurt).

Helical stability decreases with increasing temperature, thus raising the probability of a nucleobase

to flip out and become solvent accessible. Therefore, imino protons exchange with water protons,

which in turn lead to attenuation of the imino resonance. Using 1D-1H NMR-spectra recorded

within the CD-derived melting range (this work), we got first insights into which base pairs open at

given temperatures during the melting process. Imino resonances from stem I (Fig. 3, highlighted

F. Discussion

23

in red) of the hsp17 5‘-UTR WT-hairpin decreased, while the resonances of G28 and G29 in stem

II (Fig. 3, highlighted in blue) became stronger at elevated temperatures. Thermally induced local

opening and closing events in stem I probably lead to conformational heterogeneity with a

stabilizing effect on stem II, and therefore explain the observed changes in intensity. Above 288 K

(14,85 °C), the resonances lost intensity, indicating the start of the melting process, which in turn is

in good agreement with the CD-derived melting curves of the hsp17 WT thermometer (this work).

This data suggests that unfolding of the hsp17 thermometer element covers a broad temperature

range and is based on independent helical unwinding of both stems, which is a novel principle of

thermometer opening.

6. Cyotherm - a novel family of „green“ RNA thermometers

We performed a multiple sequence alignment and found 26 putative cyanobacterial RNA

thermometers which might share a hsp17-like melting mechanism (77). Two 5‘-UTRs of Anabaena

variabilis heat shock genes (ava4812 and ava3076) exhibited thermometer-like activity (6-8 fold

induction of translation initiation upon temperature upshift) when tested in our established E. coli

reporter gene system (Cimdins and Klinkert 2010, unpublished data). As for hsp17, there is only

Figure 3. Temperature-dependence of the hsp17 5‘-leader imino resonances. Thermometer function is crucially based on independent and consecutive destabilization of stem I (highlighted in red ) and II

(highlighted in blue). Nucleotides of interest are marked with arrows. Temperature is indicated in Kelvin (K). Figure by Dominic Wagner (Frankfurt), revised.

G

F. Discussion

24

one imperfectly paired nucleotide within the SD sequence of these thermometers. The free energy

of the thermodynamic ensemble (SD and anti-SD) was determined for hsp17, ava4812, ava3076

and the Salmonella agsA via RNAcofold (86, 90; Fig. 4). Strikingly, it would cost 2.6 (Anabaena

ava4812/3076) to 3-fold (Synechocystis hsp17) more energy to open the cyanobacterial SD

regions than that of the FourU (Salmonella agsA) thermometer. This might explain invention of a

novel melting principle which is based on preceding reduction of the overall stability. Interestingly,

different order of the otherwise identical cyanobacterial base pair sets results in different overall

stability (-3.17 kcal/mol for the Anabaena ensemble compared to -3.63 kcal/mol for the

Synechocystis ensemble). This effect might probably be due to base stacking interactions. The

Synechocystis 5‘-GG-3‘ stack is perfectly canonically paired with the opposing 3‘-CC-5‘ stack,

which is not the case for the Anabaena 5‘-GG-3‘ stack.

As both, the Anabaena and the Synechocystis thermosensor, include internal loops, we

could define that as a common feature of cyanobacterial RNA thermometers. As it is a new RNA

thermometer family, we suggest the name Cyotherm, for Cyanobacterial thermometer. Another

cyanobacterial RNA thermosensor, the putative thermophilic Thermosynechococcus elongatus

hspA thermometer, is most probably based on a more sophisticated temperature-sensing

Figure 4. Comparative inspection of Cyotherm and FourU thermometer SD, anti-SD ensembles. Non-

canonical base pairs are marked by boxes. Free energy of the SD, anti-SD ensembles was determined with

RNAcofold (Vienna Package; Bernhart et al. 2006).

Synechocystis sp. PCC6803hsp17

Salmonella typhimuriumagsA

Anabaena variabilisava4812 / ava3076

F. Discussion

25

mechanism (77). The 5‘-UTR includes an additional G-C-rich hairpin, which might act as a

„thermobuffer“ to guarantee proper function under high temperature conditions (55 to 65°C).

Recent work focuses on development of an appropriate reporter gene system based on a

hyperthermophilic Thermus thermophilus strain.

Cyotherm elements fulfill a regulatory task not different from common thermometers. They

fine-tune expression of small heat shock genes. In contrast to previously described RNA

thermometers, these 5‘-UTRs derive from microbes which naturally risk exposure to damaging

high light intensities as cyanobacteria utilize energy from sunlight to drive photosynthesis. The

cyanobacterial light-harvesting antenna systems are comprised of supramolecular

phycobiliproteins and phycobilisomes located on the cytoplasmic surface of the thylakoid

membrane (91). The incoming light energy gathered by phycobilisomes is subsequently converted

into chemical energy by photosystem I and II (PSI and PSII). Electrons are transferred from water

to NADP+ in a cooperative manner of these two membrane-bound multisubunit complexes (92).

Both the light-driven oxidation of water catalyzed by PSII and the multiple light-driven oxidation and

reduction reactions occurring at PSI exhibit cell-damaging potential caused by generation of

reactive oxygen species (ROS) (93). The continuous impairment of PSI and II in combination with

destabilisation of the surrounding thylakoid membrane results in high turnover rates of the entire

photosystem. External influences and stresses (e.g. heat and high light stress) increase

disintegrative effects with direct impact on the microbial metabolism (94). For this reason, present

photosynthesis condition is a hallmark of the present cellular state, making it a sensible indicator to

analyze physiological effects.

7. High light-sensing by a heat shock RNA thermometer? How co-translational protein insertion

might contribute to it

The Vígh lab published several scientific essays about the thylakoid membrane being a primary

sensor of heat and UV stress, whose alteration could induce hsp17 transcription and whose

stability is increased upon subsequent insertion of the Hsp17 protein (95-100). Hsp17 is assumed

to interact with membrane lipids and might directly be involved in repair of defective photosystems

(99). We were able to manipulate lightstress-induced synthesis of Hsp17 by manipulating

functionality of the hsp17 thermometer element (this work). There is no doubt that heat shock is

F. Discussion

26

sensed by an RNA thermometer, but it is questionable if energy dissipation from light-stressed cells

could induce thermometer melting. We suggest a model, in which membrane-associated hsp17

Cyotherm RNA requires a trans-acting factor (protein or sRNA) under high light stress conditions

(Fig. 5). Co-translational insertion of Hsp17 protein into the thylakoid membrane might facilitate

rapid protection of the photosynthetic machinery. A membrane-bound, permanently translatable

hsp17 mRNA, like the Cyotherm derep variant, would cause enhanced and stress-independent

thylakoid stability as observed in the Synechocystis Derep strain (this work). Reduction in

membrane flexibility might hinder fast exchange of damaged PS components in the Derep strain.

Figure 5 is based on a model for co-translational assembly of the D1 protein into PSII (101). A

Figure 5. Hypothetical model in which hsp17 mRNA partitions between the cytoplasm and the thylakoids to preserve membrane integrity by co-translational insertion of the Hsp17 protein under stress situations. (A) Membrane-tethered hsp17 mRNA allows quick insertion of the elongating Hsp17 protein into the thylakoid membrane. The hsp17 5‘-Cyotherm element enables ribosome-binding under heat-

stress conditions (42°C). The nascent polypeptide chain complexed with ribosomes targets Hsp17 to the stromal thylakoids. Resulting changes in the protein to lipid ratio lead to enhanced membrane stability. (B) An

unknown highlight (HL)-induced regulatory factor binds to the hsp17 anti-SD site which facilitates thermometer-independent translation initiation of the small heat shock protein. SD, Shine Dalgarno

A

B

F. Discussion

27

thylakoid-associated protein that tethers mRNA to the membrane has been described (102).

Furthermore, RNA binding proteins are involved in PSII repair cycles of the eukaryotic green alga

Chlamydomonas reinhardtii (103). An AT-rich imperfect inverted repeat (ACAAgcAAATTTagTTGT)

upstream of the hsp17 homologue Thermosynechococcus vulcanus hspA exhibits protein-binding

activity (104). Nevertheless, this region is absent in hsp17 5’-UTR (105). One possibility is that

hsp17 Cyotherm activity is modulated by a small regulatory RNA under high light conditions. So

far, the asRNA IsrR is the only RNA factor known to regulate a photosynthetic component (106).

However, ongoing deep sequencing studies of cyanobacterial transcriptoms in several labs will

certainly yield further candidate sRNAs with putative influence on photosynthesis. A possible

approach to detect regulatory transcripts that bind hsp17 messenger RNA could include isolation of

stressed and non-stressed Synechocystis thylakoid membranes, extraction of the respective total

RNA and analysis via deep sequencing.

8. RNA elements as antibacterial drug targets?

Since the primary discovery of post-transcriptional gene silencing (PTGS) in plants (107) it took

about a decade to fully understand and use this natural mechanism for biotechnological

applications (108-110). 20 years later, scientists from the Berlin Charité hospital tested the potential

of using E. coli cells as vehicles to deliver interfering short hairpin RNAs into cancer cells to stop

proliferation, a procedure called „transkingdom RNA interference“ (111). This underlines the rising

possibilities in using RNA as a valuable drug, but is this omnipresent molecule also a worthwhile

target for drug development?

At the first glance, RNA might not seem very promising due to the limited number of

building blocks. It is made of only four different planar bases bound to a negatively charged

backbone. On the contrary, RNA is able to form complex 3D structures with pockets and cavities

where small molecules can bind and compete with the final steps of RNA folding (112). In theory, it

is possible to modulate the expression levels of any protein by targeting its mRNA instead of

directly inhibiting the protein. We know today that aminoglycosides developed by soil bacteria and

fungi to combat bacterial enemies (113) target ribosomal RNA rather than proteins (114). From this

perspective, RNA is an alternative to available antibiotic compounds and a solution for increasing

multi drug resistance (MDR) caused by excessive use of antibiotics in human medicine and animal

F. Discussion

28

food production. Furthermore, recent studies revealed that available antibiotics disrupt the function

of only four microbial life processes and drug development produced only one new chemical

scaffold in the past 30 years (115). Targeting RNA instead of proteins enables selective inhibition,

exploitation of multivalent interactions and by this more facile attacks on MDR (112).

A straightforward project was initiated by Ron Breaker (Yale University). To achieve

specificity, he selected RNAs that have evolved to form structured and highly selective receptors

for small drug-like metabolites (19). Professor Breaker is cofounder of BioRelix, a biotechnology

company that is pursuing the development of antibiotics that target riboswitches

(www.biorelix.com). At least 20 distinct classes of riboswitches have been reported since the first

riboswitch was reported in 2002 (19, 116-118), revealing their widespread distribution and utility in

bacteria (20). The members of each class share a highly conserved sequence and secondary

structure and bind the same metabolite. It became evident that several known antibacterial

compounds function by targeting riboswitches, e.g. the lysine analog L-aminoethylcysteine (AEC;

119) that inhibits growth of Gram-positive bacteria binds to the lysine riboswitch from the lysC gene

of Bacillus subtilis (120). In most cases, metabolite binding to the riboswitch receptor domain

represses the expression of the genes encoded by the messenger RNA. Recent results indicated

that rationally designed metabolite analogs could be used to inactivate a flavinmononucleotide

(FMN) riboswitch (121).

How are the chances to use RNA thermometers as antibacterial drug targets? Besides the

already described Listeria prfA thermosensor (28), the Vibrio toxT element (this work) and the Y.

pseudotuberculosis lcrF 5‘-UTR there is evidence that other pathogenic microbes, Brucella

melitensis, Salmonella typhimurium, Pseudomonas aeruginosa and Bacillus anthracis, might

potentially utilize RNA thermometers for posttranscriptional gene control (27; Krajewski, Kortmann

and Cimdins, unpublished data). The 4.0 Mbp genome of a pandemic V. cholerae strain is

composed of two circular chromosomes that are predicted to encode a total of 3.885 genes (122),

while the Y. pseudotuberculosis genome is 4.84 Mbp long and contains approximately 4238 genes

(123). The simple substitution of only two nucleotides in thermometer regions of Vibrio and Yersinia

genomes, respectively, resulted in drastic attenuation of virulence in both pathogenic

microorganisms (Fig. 6). The corresponding in vivo mouse experiments where conducted in

F. Discussion

29

http://www.biorelix.com

http://www.biorelix.com

collaboration with Prof. Karl Klose (San Antonio, USA) on Vibrio toxT (this work) and Prof. Petra

Dersch (Braunschweig, Germany) on Yersinia lcrF (this work, data not shown). Therefore, we have

strong evidence that targeting RNA thermometers with appropriate drugs could potentially mimic a

genetic knock-out.

B

com

pete

tive

inde

x

U5C-U7CWT

A

Figure 6. Introduction of single base substitutions at chromosomal thermometer sequences attenuated virulence of highly pathogenic Y. pseudotuberculosis and V. cholerae strains. (A) Point

mutations UU -28/-27 CC that enhance pairing of lcrf SD and anti-SD thermometer sites (for structure information, see supplementary data) were put on Y. pseudotuberculosis chromosome. Yersinia cells were

subsequently assayed for the ability to infect infant mice. 80% of treated mice survived at least 14 days after infection. (B) A similar result was obtained by modulating the SD site of the toxT virulence master regulator.

Stabilization of the FourU thermometer module hindered Vibrio from colonizing infant mice intestines as non of the U5C-U7C mutant cells were recovered from the intestine. WT, V. cholera wildtype strain. In vivo animal

assays were conducted in collaboration with Prof. Petra Dersch (Braunschweig, Germany) and Prof.Karl Klose (Texas, USA). All experiments used at least five mice per treatment group.

Y. pseudotuberculosismouse-survival experiment

V. choleraemouse-colonization experiment

F. Discussion

30

9. Anti-thermometer drugs - a promising attempt?

Riboswitch-antibiotics are highly specific due to the customized ligand-binding pocket of their

target molecule. Anti-riboswitch drugs might turn out to become broad-spectrum antibiotics as

riboswitches are common in many bacteria. Given that RNA thermometers are ligand-free modules

that solely respond to temperature alterations it is probably less likely to generate a compound that

effectively prohibits melting of all known RNA thermometer classes. A conceivable strategy could

be to prevent access of the ribosome to the melted thermometer at host body temperature. One

might envisage a small RNA (sRNA)-based agent, as some sRNAs mask the SD site of target

mRNAs to prevent 30S subunit binding. Because SD sites are not present in eukaryotes, a sRNA-

drug should not interfere with the mammalian metabolism. There is no strict necessity that efficient

SD-sequestration by sRNAs needs complementary base pairing with the target-SD site. The

Salmonella sRNA GcvB specifically inhibits translation of 7 distinct target mRNAs (7). Aside from

directly masking the SD sequence, GcvB can also effectively repress translation by binding to

target mRNAs at upstream sites, outside the SD site. A screen for appropriate thermometer-

targeting sRNAs could be managed by using a novel E. coli reporter system developed in the lab

of Jörg Vogel (124). The vector-based system allows examination of sRNA capacity to

downregulate a gfp-tagged target mRNA. We successfully adapted the corresponding „target-

plasmid“ (pXG-10) in this work to examine control of thermometer-mediated GFP expression by

the hsp17 Cyotherm element.

10. Custom-made drugs to target specific thermometer motifs

Not all regulatory RNAs in a modern cell can be considered relics from an early RNA world. It

appears that some biochemical functions could be well suited for RNA to carry out, and therefore

could have emerged more recently in bacterial evolution. Is it possible that some thermometer

classes are extremely ancient (most likely the heat shock sensing thermometers, as heat has

challenged microbes since their appearance on earth 3.5 billion years ago), while others are of a

more recent origin? Eric Westhof stated that RNA motifs appear to be like Russian dolls, with

smaller motifs associated into larger motifs (125). Do virulence thermometers posses certain

watermark-motifs which might help to identify them and which could be targeted by custom-made

F. Discussion

31

drugs? The toxT thermometer top portion module might, from the evolutionary perspective, be a

younger add-on to an ancient heat shock-sensing FourU thermosensor. Deletion of the toxT leader

top portion element restored a fully functional, classical heat shock RNA thermometer. The

resulting toxT-M5 variant does not only perfectly mimic thermometer function but also shares

noticeable, nearly perfect structure homology to the recently discovered E. coli htrA thermometer

(Cimdins, unpublished data; Fig. 7). We proposed that a Vibrio-specific factor (VSF) binds to the

top module and by this enables toxT thermometer function at host body temperature. If the binding

site were constantly blocked by an antagonizing drug, this would probably freeze the toxT-leader in

its untranslatable state. An alternative approach would be to inactivate the VSF.

Figure 7. Comparative secondary structure predictions of V. cholerae toxT leader variant M5 and the E. coli htrA 5‘-UTR. In silico prediction of structure and overall free energy was realized with mfold (Zuker,

2003). SD, Shine Dalgarno; 4U, FourU anti-SD region

!G : -3.1 kcal/molA B,

30

5'

5'3'

20

10

20

3'

SD4U

SD4U

35

V. cholera toxT-M5 E. coli htrA

AB

V. cholerae toxT-M5 E. coli htrA

A B

F. Discussion

32

G. Summary

Temperature belongs to the many physical and chemical parameters that free-living microbes need

to monitor in their constantly changing environment. There are numerous ways to register a

sudden change in temperature. Most of them, however, do not measure the ambient temperature

but detect indirect consequences of a temperature shift, e.g. the accumulation of misfolded

proteins after a heat shock. RNA thermometers are direct temperature sensors that fine-tune

bacterial heat shock and virulence gene expression by temperature-dependent sequestration of

the Shine Dalgarno (SD) sequence. In this study, we were able to generate a functional synthetic

RNA thermosensor and characterize two natural thermometers found in the cyanobacterium

Synechocystis sp. PCC6803 and the human pathogen Vibrio cholerae.

The main results on each of these projects are briefly summarized below:

1. Generation of synthetic RNA-based thermosensors

The presence of structurally diverse thermosensors upstream of bacterial heat shock and virulence

genes encouraged us to design a synthetic RNA thermometer by a combination of computer-based

rational design and in vivo screening. It took only two rounds of selection to obtain a synthetic

RNA thermometer that was as efficient as natural thermometers. Structure probing experiments

revealed conformational changes in the synthetic element along a temperature gradient.

2. Translation on demand by a simple cyanobacterial RNA-based thermosensor

Our systematic search for RNA thermometers in the 5‘-UTR of bacterial heat shock genes

predicted a promising, exceptionally short candidate upstream of the Synechocystis sp. PCC6803

heat shock gene hsp17. We proved hsp17 thermometer function by a newly established GFP

(Green Fluorescent Protein)-based reporter gene system. A UCCU sequence sequesters the SD

sequence (AGGA) more tightly than in other thermometers. Mutational analysis, enzymatic and

chemical structure probing and toeprinting experiments demonstrated that a large top loop, the

asymmetric internal loop and multiple A-U pairs compensate for the high thermodynamic stability of

the SD region. Chromosomal integration of repressing and derepressing point mutations in the

hsp17 thermometer resulted in Synechocystis strains with severe phenotypic defects under heat

G. Summary

33

shock and high light conditions. Our results demonstrate the physiological relevance of an RNA

thermometer in the synthesis of appropriate amounts of chaperones both in the on- and off-phase

of the heat shock response.

3. Temperature-mediated translational regulation by the V. cholerae toxT 5‘ mRNA leader

A new FourU RNA thermometer is positioned in the V. cholerae toxT leader sequence. ToxT is a

transcriptional activator that regulates genes encoding the cholera toxin and toxin-coregulated

pilus, two factors that are essential for Vibrio virulence. Translational fusions to the toxT leader

sequence resulted in reduced expression at 37°C in E. coli, which is just the opposite from what

one would expect from a typical RNA thermometer. Consistent with this finding, ribosome loading

onto the toxT transcript was efficient at 30°C but impaired at 37°C in toeprinting experiments.

Structure probing analysis of different point mutations suggested that translation inhibition at 37°C

resulted from nucleotide slippage and subsequent pseudoknot formation between two palindromic

sequences. The repressive feature of the toxT 5‘-UTR is overcome by a yet unidentified

mechanism in V. cholerae strains. Here, translation is tuned on at host body temperature (37°C).

We propose that a Vibrio-specific trans-active factor blocks the conformational switch when ToxT is

needed. Chromosomal integration of repressing point mutations in the toxT thermometer resulted

in drastic attenuation of Vibrio virulence. Our findings suggest that the toxT thermometer

contributes to Vibrio pathogenicity by modulating virulence gene expression at different stages of

host infection.

G. Summary

34

H. Zusammenfassung

Frei lebende Bakterien sind häufig den zum Teil stark fluktuierenden, physiko-chemischen

Bedingungen ihres Milieus ausgesetzt. Unter diesem Druck entwickelten sie im Laufe der

Evolution ein komplexes Überwachungssystem, welches ihnen ermöglicht, zelluläre Prozesse an

die jeweiligen Umweltparameter anzupassen. Neben dem Nährstoffangebot, der Osmolarität, dem

pH-Wert und diversen anderen Faktoren, ist vor allem die Temperatur eine für Mikroorganismen

existentielle Messgröße. Dabei bieten sich dem Bakterium zahlreiche Möglichkeiten einen

Temperaturanstieg zu registrieren, wobei die meisten intrazellulären Mess-Systeme nicht die

Temperaturerhöhung an sich, sondern deren indirekte Konsequenz, z.B. die Akkumulation falsch-

gefalteter Proteine, wahrnehmen. RNA-Thermometer hingegen sind direkte Temperatur-Sensoren,

welche die Expression bakterieller Hitzeschock- und Virulenzgene durch Temperatur-abhängige

Maskierung der Shine Dalgarno (SD) Sequenz steuern. Innerhalb dieser Arbeit war es uns

möglich, einen funktionalen, vollständig synthetischen RNA-Thermosensor zu generieren, sowie

die Charakterisierung zweier natürlicher RNA-Thermometer aus dem Cyanobakterium

Synechocystis sp. PCC6803 und dem Humanpathogen Vibrio cholerae durchzuführen.

Die Hauptergebnisse können wie folgt zusammengefasst werden:

1. Erstellung eines synthetischen RNA-basierten Thermosensors

Das Auftreten strukturell sehr unterschiedlicher Thermosensoren stromaufwärts bakterieller

Hitzeschock- und Virulenzgene hat uns veranlasst, mittels Computer-basiertem, rationalem Design

und in vivo Screening ein synthetisches RNA-Thermometer zu generieren. Nach lediglich zwei

Selektionsrunden konnten wir ein synthetisches Thermometer isolieren, welches genauso effizient

funktionierte wie natürlich vorkommende RNA-Thermometer. Die Temperatur-abhängige

Konformationsänderung des synthetischen Thermometers wurde mit Hilfe von Strukturkartierungs-

Experimenten aufgeklärt.

2. Ein cyanobakterielles RNA-Thermometer ermöglicht „Translation nach Bedarf“

Durch die systematische in silico-Suche nach RNA-Thermometern in der 5‘-untranslatierten

Region bakterieller Hitzeschockgene wurde ein extrem kleines RNA-Thermometer stromaufwärts

H. Zusammenfassung

35

des Synechocystis sp. PCC6803 Hitzeschockgens hsp17 vorhergesagt. Die hsp17-

Thermometerfunktion konnte mittels eines neu-etablierten GFP (Green Fluorescent Protein)-

basierten Reportergensystems nachgewiesen werden. Die SD-Sequenz (AGGA) liegt in diesem

Thermometer viel stärker gepaart vor, als es in anderen RNA-Thermometern der Fall ist. Durch

das Einbringen von Mutationen, enzymatischen und chemischen Strukturkartierungs-Analysen und

Toeprinting-Experimenten konnte gezeigt werden, dass ein großer Stemloop, ein asymetrischer

interner Loop und mehrere A-U-Paare die hohe thermodynamische Stabilität der SD-Region

kompensieren. Die chromosomale Integration von reprimierenden und de-reprimierenden

Punktmutationen in das hsp17 Thermometer resultierte in deutlichen phänotypischen Defekten

unter Hitzestress und Starklicht-Bedingungen. Unsere Ergebnisse demonstrieren die

physiologische Relevanz eines RNA-Thermometers in der Regulation der Chaperon-Synthese

während und nach der Hitzestress-Antwort.

3. Temperatur-abhängige Translationsregulation durch die Vibrio cholerae toxT 5‘-UTR

Ein neues FourU-Thermometer befindet sich stromaufwärts des V. cholerae toxT-Gens. ToxT ist

ein Transkriptionsaktivator, welcher die Gene für das Cholera Toxin und den Toxin-coregulierten

Pilus reguliert, beides essentielle Faktoren der Vibrio-Virulenz. Translationale Fusionen an das

toxT-Thermometer resultierten in einer reduzierten Expression bei 37°C in E. coli. In

Übereinstimmung mit diesem Ergebnis konnten isolierte Ribosomen in Toeprinting-Experimenten

zwar bei 30°C an das toxT-Transkript binden, nicht jedoch bei 37°C. Strukturkartierungs-Analysen

verschiedener punktmutierter toxT-Varianten suggerieren, dass die Inhibition der Translation bei

37°C auf die Ausbildung eines Pseudoknotens zwischen zwei palindromischen Sequenzen

zurückzuführen ist. Die reprimierende Eigenschaft des toxT-Thermometers wird in V. cholerae

selbst durch einen bislang unbekannten Mechanismus außer Kraft gesetzt. Hier erfolgt die

Initiation der Translation bei 37°C (der Körpertemperatur des menschlichen Wirts). Es ist denkbar,

dass ein Vibrio-spezifischer, trans-aktiver Faktor den konformationalen Schalter blockiert, wenn der

ToxT Aktivator benötigt wird. Die chromosomale Integration reprimierender Punktmutationen in das

toxT-Thermometer führten zu einer drastischen Attenuation der V. cholerae-Virulenz. Vermutlich

moduliert das toxT-Thermometer die Expression von Virulenzgenen in den verschiedenen Stufen

der Wirtsinfektion.

H. Zusammenfassung

36

I. References


2. Brantl, S. (2007) Regulatory mechanisms employed by cis-encoded antisense RNAs. Curr Opin Microbiol, 10, 102-109.

3. Georg, J., Voss, B., Scholz, I., Mitschke, J., Wilde, A. and Hess, W.R. (2009) Evidence for a major role of antisense RNAs in cyanobacterial gene regulation. Mol Syst Biol, 5, 305.

4. Thomason, M.K. and Storz, G. (2010) Bacterial Antisense RNAs: How Many Are There, and What Are They Doing? Annu Rev Genet.

5. Gottesman, S. (2005) Micros for microbes: non-coding regulatory RNAs in bacteria. Trends Genet, 21, 399-404.

6. Aiba, H. (2007) Mechanism of RNA silencing by Hfq-binding small RNAs. Curr Opin Microbiol, 10, 134-139.

7. Sharma, C.M., Darfeuille, F., Plantinga, T.H. and Vogel, J. (2007) A small RNA regulates multiple ABC transporter mRNAs by targeting C/A-rich elements inside and upstream of ribosome-binding sites. Genes Dev, 21, 2804-2817.

8. Vecerek, B., Moll, I. and Blasi, U. (2007) Control of Fur synthesis by the non-coding RNA RyhB and iron-responsive decoding. Embo J, 26, 965-975.

9. Toledo-Arana, A., Repoila, F. and Cossart, P. (2007) Small noncoding RNAs controlling pathogenesis. Curr Opin Microbiol, 10, 182-188.

10. Chao, Y. and Vogel, J. (2010) The role of Hfq in bacterial pathogens. Curr Opin Microbiol, 13, 24-33.

11. Papenfort, K. and Vogel, J. (2010) Regulatory RNA in bacterial pathogens. Cell Host Microbe, 8, 116-127.

12. Naville, M. and Gautheret, D. (2010) Transcription attenuation in bacteria: theme and variations. Brief Funct Genomics, 9, 178-189.

13. Yanofsky, C. (1981) Attenuation in the control of expression of bacterial operons. Nature, 289, 751-758.

14. Gutierrez-Preciado, A., Henkin, T.M., Grundy, F.J., Yanofsky, C. and Merino, E. (2009) Biochemical features and functional implications of the RNA-based T-box regulatory mechanism. Microbiol Mol Biol Rev, 73, 36-61.

15. Green, N.J., Grundy, F.J. and Henkin, T.M. (2010) The T box mechanism: tRNA as a regulatory molecule. FEBS Lett, 584, 318-324.

16. Mandal, M. and Breaker, R.R. (2004) Gene regulation by riboswitches. Nat Rev Mol Cell Biol, 5, 451-463.

17. Winkler, W.C. and Breaker, R.R. (2005) Regulation of bacterial gene expression by riboswitches. Annu Rev Microbiol, 59, 487-517.

18. Serganov, A. (2009) The long and the short of riboswitches. Curr Opin Struct Biol, 19, 251-259.

I. References

37

19. Blount, K.F. and Breaker, R.R. (2006) Riboswitches as antibacterial drug targets. Nat Biotechnol, 24, 1558-1564.

20. Breaker, R.R. (2009) Riboswitches: from ancient gene-control systems to modern drug targets. Future Microbiol, 4, 771-773.

21. Nechooshtan, G., Elgrably-Weiss, M., Sheaffer, A., Westhof, E. and Altuvia, S. (2009) A pH-responsive riboregulator. Genes Dev, 23, 2650-2662.

22. Bingham, R.J., Hall, K.S. and Slonczewski, J.L. (1990) Alkaline induction of a novel gene locus, alx, in Escherichia coli. J Bacteriol, 172, 2184-2186.

23. Cruz, J.A. and Westhof, E. (2009) The dynamic landscapes of RNA architecture. Cell, 136, 604-609.

24. Altuvia, S., Kornitzer, D., Teff, D. and Oppenheim, A.B. (1989) Alternative mRNA structures of the cIII gene of bacteriophage lambda determine the rate of its translation initiation. J. Mol. Biol., 210, 265-280.

25. Narberhaus, F. (2010) Translational control of bacterial heat shock and virulence genes by temperature-sensing mRNAs. RNA Biol, 7, 84-89.

26. Nocker, A., Hausherr, T., Balsiger, S., Krstulovic, N.P., Hennecke, H. and Narberhaus, F. (2001) A mRNA-based thermosensor controls expression of rhizobial heat shock genes. Nucleic Acids Res, 29, 4800-4807.



29. Gaubig, L.C., Waldminghaus, T. and Narberhaus, F. (2010) Multiple layers of control govern expression of the Escherichia coli ibpAB heat shock operon. Microbiology. Epub ahead of print.

30. Yura, T., Kanemori, M. and Morita, M.T. (eds.) (2000) The heat shock response: regulation and function. ASM Press, Washington.

31. Narberhaus, F. (1999) Negative regulation of bacterial heat shock genes. Mol. Microbiol., 31, 1-8.


33. Morita, M., Kanemori, M., Yanagi, H. and Yura, T. (1999) Heat-induced synthesis of sigma32 in Escherichia coli: structural and functional dissection of rpoH mRNA secondary structure. J Bacteriol, 181, 401-410.

34. de Smit, M.H. and van Duin, J. (2003) Translational standby sites: how ribosomes may deal with the rapid folding kinetics of mRNA. J Mol Biol, 331, 737-743.

35. Nocker, A., Krstulovic, N.P., Perret, X. and Narberhaus, F. (2001) ROSE elements occur in disparate rhizobia and are functionally interchangeable between species. Arch Microbiol, 176, 44-51.

I. References

38

36. Waldminghaus, T., Fippinger, A., Alfsmann, J. and Narberhaus, F. (2005) RNA thermometers are common in alpha- and gamma-proteobacteria. Biol Chem, 386, 1279-1286.

37. Waldminghaus, T., Gaubig, L.C., Klinkert, B. and Narberhaus, F. (2009) The Escherichia coli ibpA thermometer is comprised of stable and unstable structural elements. RNA Biol., 6.

38. Chowdhury, S., Ragaz, C., Kreuger, E. and Narberhaus, F. (2003) Temperature-controlled structural alterations of an RNA thermometer. J Biol Chem, 278, 47915-47921.


40. Bissonnette, S.A., Rivera-Rivera, I., Sauer, R.T. and Baker, T.A. (2010) The IbpA and IbpB small heat-shock proteins are substrates of the AAA+ Lon protease. Mol Microbiol, 75, 1539-1549.

41. Yamanaka, K., Mitta, M. and Inouye, M. (1999) Mutation analysis of the 5' untranslated region of the cold shock cspA mRNA of Escherichia coli. J Bacteriol, 181, 6284-6291.

42. Giuliodori, A.M., Di Pietro, F., Marzi, S., Masquida, B., Wagner, R., Romby, P., Gualerzi, C.O. and Pon, C.L. (2010) The cspA mRNA is a thermosensor that modulates translation of the cold-shock protein CspA. Mol Cell, 37, 21-33.

43. Konkel, M.E. and Tilly, K. (2000) Temperature-regulated expression of bacterial virulence genes. Microbes Infect, 2, 157-166.

44. Lambris, J.D., Ricklin, D. and Geisbrecht, B.V. (2008) Complement evasion by human pathogens. Nat Rev Microbiol, 6, 132-142.

45. Skurnik, M. and Toivanen, P. (1992) LcrF is the temperature-regulated activator of the yadA gene of Yersinia enterocolitica and Yersinia pseudotuberculosis. J Bacteriol, 174, 2047-2051.

46. Hoe, N.P. and Goguen, J.D. (1993) Temperature sensing in Yersinia pestis: translation of the LcrF activator protein is thermally regulated. J. Bacteriol., 175, 7901-7909.

47. Johansson, J. (2009) RNA thermosensors in bacterial pathogens. Contrib Microbiol, 16, 150-160.

48. Rinnenthal, J., Klinkert, B., Narberhaus, F. and Schwalbe, H. (2010) Direct observation of the temperature-induced melting process of the Salmonella fourU RNA thermometer at base-pair resolution. Nucleic Acids Res., 38, 3834-3874.

49. Childers, B.M. and Klose, K.E. (2007) Regulation of virulence in Vibrio cholerae: the ToxR regulon. Future Microbiol, 2, 335-344.

50. Freitag, N.E., Port, G.C. and Miner, M.D. (2009) Listeria monocytogenes - from saprophyte to intracellular pathogen. Nat Rev Microbiol, 7, 623-628.

51. Hamon, M., Bierne, H. and Cossart, P. (2006) Listeria monocytogenes: a multifaceted model. Nat Rev Microbiol, 4, 423-434.

52. Loh, E., Dussurget, O., Gripenland, J., Vaitkevicius, K., Tiensuu, T., Mandin, P., Repoila, F., Buchrieser, C., Cossart, P. and Johansson, J. (2009) A trans-acting riboswitch controls expression of the virulence regulator PrfA in Listeria monocytogenes. Cell, 139, 770-779.

53. Endy, D. (2005) Foundations for engineering biology. Nature, 438, 449-453.

I. References

39

54. Jackson, D.A., Symons, R.H. and Berg, P. (1972) Biochemical method for inserting new genetic information into DNA of Simian Virus 40: circular SV40 DNA molecules containing lambda phage genes and the galactose operon of Escherichia coli. Proc Natl Acad Sci U S A, 69, 2904-2909.

55. Khalil, A.S. and Collins, J.J. (2010) Synthetic biology: applications come of age. Nat Rev Genet, 11, 367-379.

56. Isaacs, F.J., Dwyer, D.J. and Collins, J.J. (2006) RNA synthetic biology. Nat Biotechnol, 24, 545-554.

57. Win, M.N., Liang, J.C. and Smolke, C.D. (2009) Frameworks for programming biological function through RNA parts and devices. Chem Biol, 16, 298-310.

58. Roth, A. and Breaker, R.R. (2009) The structural and functional diversity of metabolite-binding riboswitches. Annu Rev Biochem, 78, 305-334.

59. Anglicheau, D., Muthukumar, T. and Suthanthiran, M. (2010) MicroRNAs: small RNAs with big effects. Transplantation, 90, 105-112.

60. Weigand, J.E. and Suess, B. (2009) Aptamers and riboswitches: perspectives in biotechnology. Appl Microbiol Biotechnol, 85, 229-236.

61. Saito, H. and Inoue, T. (2009) Synthetic biology with RNA motifs. Int J Biochem Cell Biol, 41, 398-404.

62. Dixon, N., Duncan, J.N., Geerlings, T., Dunstan, M.S., McCarthy, J.E., Leys, D. and Micklefield, J. (2010) Reengineering orthogonally selective riboswitches. Proc Natl Acad Sci U S A, 107, 2830-2835.

63. Altuvia, S., Kornitzer, D., Kobi, S. and Oppenheim, A.B. (1991) Functional and structural elements of the mRNA of the cIII gene of bacteriophage lambda. J Mol Biol, 218, 723-733.

64. Flamm, C., Hofacker, I.L., Maurer-Stroh, S., Stadler, P.F. and Zehl, M. (2001) Design of multistable RNA molecules. Rna, 7, 254-265.

65. Hofacker, I.L. (2003) Vienna RNA secondary structure server. Nucleic Acids Res, 31, 3429-3431.

66. Woese, C.R. (1968) The fundamental nature of the genetic code: prebiotic interactions between polynucleotides and polyamino acids or their derivatives. Proc Natl Acad Sci U S A, 59, 110-117.

67. Ma, B.G. (2007) How to describe genes: enlightenment from the quaternary number system. Biosystems, 90, 20-27.

68. Powner, M.W., Gerland, B. and Sutherland, J.D. (2009) Synthesis of activated pyrimidine ribonucleotides in prebiotically plausible conditions. Nature, 459, 239-242.

69. Budin, I. and Szostak, J.W. (2010) Expanding roles for diverse physical phenomena during the origin of life. Annu Rev Biophys, 39, 245-263.

70. Neupert, J., Karcher, D. and Bock, R. (2008) Design of simple synthetic RNA thermometers for temperature-controlled gene expression in Escherichia coli. Nucleic Acids Res., 36, e124.

71. Neupert, J. and Bock, R. (2009) Designing and using synthetic RNA thermometers for temperature-controlled gene expression in bacteria. Nat Protoc, 4, 1262-1273.

I. References

40

72. Vega, Y., Dickneite, C., Ripio, M.T., Bockmann, R., Gonzalez-Zorn, B., Novella, S., Dominguez-Bernal, G., Goebel, W. and Vazquez-Boland, J.A. (1998) Functional similarities between the Listeria monocytogenes virulence regulator PrfA and cyclic AMP receptor protein: the PrfA* (Gly145Ser) mutation increases binding affinity for target DNA. J Bacteriol, 180, 6655-6660.

73. Yu, R.R. and DiRita, V.J. (1999) Analysis of an autoregulatory loop controlling ToxT, cholera toxin, and toxin-coregulated pilus production in Vibrio cholerae. J Bacteriol, 181, 2584-2592.

74. Mandal, M., Lee, M., Barrick, J.E., Weinberg, Z., Emilsson, G.M., Ruzzo, W.L. and Breaker, R.R. (2004) A glycine-dependent riboswitch that uses cooperative binding to control gene expression. Science, 306, 275-279.

75. Verhounig, A., Karcher, D. and Bock, R. (2010) Inducible gene expression from the plastid genome by a synthetic riboswitch. Proc Natl Acad Sci U S A, 107, 6204-6209.

76. Lutz, R. and Bujard, H. (1997) Independent and tight regulation of transcriptional units in Escherichia coli via the LacR/O, the TetR/O and AraC/I1-I2 regulatory elements. Nucleic Acids Res., 25, 1203-1210.

77. Cimdins, A. (2009) Strukturelle und funktionelle Analyse eines putativen RNA-Thermometers aus dem thermophilen Cyanobakterium Thermosynechococcus elongatus. Ruhr-Universität, Bochum.

78. Gibson, D.G., Glass, J.I., Lartigue, C., Noskov, V.N., Chuang, R.Y., Algire, M.A., Benders, G.A., Montague, M.G., Ma, L., Moodie, M.M. et al. (2010) Creation of a bacterial cell controlled by a chemically synthesized genome. Science, 329, 52-56.

79. Klasson, L. and Andersson, S.G. (2010) Research on small genomes: implications for synthetic biology. Bioessays, 32, 288-295.

80. Connor, M.R. and Atsumi, S. (2010) Synthetic biology guides biofuel production. J Biomed Biotechnol, 2010.

81. Kobayashi, H., Kærn, M., Araki, M., Chung, K., Gardner, T.S., Cantor, C.R. and Collins, J.J. (2004) Programmable cells: Interfacing natural and engineered gene networks. PNAS, 101, 8414-8419.

82. Guisbert, E., Yura, T., Rhodius, V.A. and Gross, C.A. (2008) Convergence of molecular, modeling, and systems approaches for an understanding of the Escherichia coli heat shock response. Microbiol Mol Biol Rev, 72, 545-554.

83. Wuchty, S., Fontana, W., Hofacker, I.L. and Schuster, P. (1999) Complete suboptimal folding of RNA and the stability of secondary structures. Biopolymers, 49, 145-165.

84. Marchisio, M.A. and Stelling, J. (2009) Computational design tools for synthetic biology. Curr Opin Biotechnol, 20, 479-485.

85. Waldminghaus, T., Gaubig, L.C. and Narberhaus, F. (2007) Genome-wide bioinformatic prediction and experimental evaluation of potential RNA thermometers. Mol. Genet. Genomics, 278, 555-564.

86. Bernhart, S.H., Hofacker, I.L., Will, S., Gruber, A.R. and Stadler, P.F. (2008) RNAalifold: improved consensus structure prediction for RNA alignments. BMC Bioinformatics, 9, 474.


I. References

41

88. McCaskill, J.S. (1990) The equilibrium partition function and base pair binding probabilities for RNA secondary structure. Biopolymers, 29, 1105-1119.

89. Nawrocki, E.P., Kolbe, D.L. and Eddy, S.R. (2009) Infernal 1.0: inference of RNA alignments. Bioinformatics, 25, 1335-1337.

90. Mathews, D.H., Sabina, J., Zuker, M. and Turner, D.H. (1999) Expanded sequence dependence of thermodynamic parameters improves prediction of RNA secondary structure. J Mol Biol, 288, 911-940.

91. Arteni, A.A., Ajlani, G. and Boekema, E.J. (2009) Structural organisation of phycobilisomes from Synechocystis sp. strain PCC6803 and their interaction with the membrane. Biochim Biophys Acta, 1787, 272-279.

92. Nelson, N. and Yocum, C.F. (2006) Structure and function of photosystems I and II. Annu Rev Plant Biol, 57, 521-565.

93. Sakthivel, K., Watanabe, T. and Nakamoto, H. (2009) A small heat-shock protein confers stress tolerance and stabilizes thylakoid membrane proteins in cyanobacteria under oxidative stress. Arch. Microbiol., 191, 319-328.

94. Nakamoto, H. and Honma, D. (2006) Interaction of a small heat shock protein with light-harvesting cyanobacterial phycocyanins under stress conditions. FEBS Lett., 580, 3029-3034.

95. Horvath, I., Glatz, A., Varvasovszki, V., Torok, Z., Pali, T., Balogh, G., Kovacs, E., Nadasdi, L., Benko, S., Joo, F. et al. (1998) Membrane physical state controls the signaling mechanism of the heat shock response in Synechocystis PCC 6803: identification of hsp17 as a "fluidity gene". Proc. Natl. Acad. Sci. U S A, 95, 3513-3518.

96. Torok, Z., Goloubinoff, P., Horvath, I., Tsvetkova, N.M., Glatz, A., Balogh, G., Varvasovszki, V., Los, D.A., Vierling, E., Crowe, J.H. et al. (2001) Synechocystis HSP17 is an amphitropic protein that stabilizes heat-stressed membranes and binds denatured proteins for subsequent chaperone-mediated refolding. Proc. Natl. Acad. Sci. U S A, 98, 3098-3103.

97. Tsvetkova, N.M., Horvath, I., Torok, Z., Wolkers, W.F., Balogi, Z., Shigapova, N., Crowe, L.M., Tablin, F., Vierling, E., Crowe, J.H. et al. (2002) Small heat-shock proteins regulate membrane lipid polymorphism. Proc. Natl. Acad. Sci. U S A, 99, 13504-13509.

98. Balogi, Z., Torok, Z., Balogh, G., Josvay, K., Shigapova, N., Vierling, E., Vígh, L. and Horvath, I. (2005) "Heat shock lipid" in cyanobacteria during heat/light-acclimation. Arch. Biochem. Biophys., 436, 346-354.

99. Balogi, Z., Cheregi, O., Giese, K.C., Juhasz, K., Vierling, E., Vass, I., Vígh, L. and Horvath, I. (2008) A mutant small heat shock protein with increased thylakoid association provides an elevated resistance against UV-B damage in Synechocystis 6803. J. Biol. Chem., 283, 22983-22991.

100. Horvath, I. and Vigh, L. (2010) Cell biology: Stability in times of stress. Nature, 463, 436-438.

101. Zhang, L., Paakkarinen, V., van Wijk, K.J. and Aro, E.M. (1999) Co-translational assembly of the D1 protein into photosystem II. J Biol Chem, 274, 16062-16067.

102. Ossenbuhl, F., Hartmann, K. and Nickelsen, J. (2002) A chloroplast RNA binding protein from stromal thylakoid membranes specifically binds to the 5' untranslated region of the psbA mRNA. Eur J Biochem, 269, 3912-3919.

I. References

42

103. Schwarz, C., Elles, I., Kortmann, J., Piotrowski, M. and Nickelsen, J. (2007) Synthesis of the D2 protein of photosystem II in Chlamydomonas is controlled by a high molecular mass complex containing the RNA stabilization factor Nac2 and the translational activator RBP40. Plant Cell, 19, 3627-3639.

104. Kojima, K. and Nakamoto, H. (2002) Specific binding of a protein to a novel DNA element in the cyanobacterial small heat-shock protein gene. Biochem Biophys Res Commun, 297, 616-624.

105. Fang, F. and Barnum, S.R. (2004) Expression of the heat shock gene hsp16.6 and promoter analysis in the cyanobacterium, Synechocystis sp. PCC 6803. Curr. Microbiol., 49, 192-198.

106. Duhring, U., Axmann, I.M., Hess, W.R. and Wilde, A. (2006) An internal antisense RNA regulates expression of the photosynthesis gene isiA. Proc Natl Acad Sci U S A, 103, 7054-7058.

107. Napoli, C., Lemieux, C. and Jorgensen, R. (1990) Introduction of a Chimeric Chalcone Synthase Gene into Petunia Results in Reversible Co-Suppression of Homologous Genes in trans. Plant Cell, 2, 279-289.

108. Elbashir, S.M., Harborth, J., Weber, K. and Tuschl, T. (2002) Analysis of gene function in somatic mammalian cells using small interfering RNAs. Methods, 26, 199-213.

109. Fire, A., Xu, S., Montgomery, M.K., Kostas, S.A., Driver, S.E. and Mello, C.C. (1998) Potent and specific genetic interference by double-stranded RNA in Caenorhabditis elegans. Nature, 391, 806-811.

110. Hamilton, A.J. and Baulcombe, D.C. (1999) A species of small antisense RNA in posttranscriptional gene silencing in plants. Science, 286, 950-952.

111. Nguyen, T.A. and Fruehauf, J.H. (2009) Transkingdom RNA interference (tkRNAi): a novel method to induce therapeutic gene silencing. Methods Mol Biol, 514, 27-34.

112. Vicens, Q. and Westhof, E. (2003) RNA as a drug target: the case of aminoglycosides. Chembiochem, 4, 1018-1023.

113. Recht, M.I., Douthwaite, S. and Puglisi, J.D. (1999) Basis for prokaryotic specificity of action of aminoglycoside antibiotics. Embo J, 18, 3133-3138.

114. Hermann, T. and Westhof, E. (1998) RNA as a drug target: chemical, modelling, and evolutionary tools. Curr Opin Biotechnol, 9, 66-73.

115. Theuretzbacher, U. and Toney, J.H. (2006) Nature's clarion call of antibacterial resistance: are we listening? Curr Opin Investig Drugs, 7, 158-166.

116. Winkler, W.C., Cohen-Chalamish, S. and Breaker, R.R. (2002) An mRNA structure that controls gene expression by binding FMN. Proc Natl Acad Sci U S A, 99, 15908-15913.

117. Winkler, W., Nahvi, A. and Breaker, R.R. (2002) Thiamine derivatives bind messenger RNAs directly to regulate bacterial gene expression. Nature, 419, 952-956.

118. Mironov, A.S., Gusarov, I., Rafikov, R., Lopez, L.E., Shatalin, K., Kreneva, R.A., Perumov, D.A. and Nudler, E. (2002) Sensing small molecules by nascent RNA: a mechanism to control transcription in bacteria. Cell, 111, 747-756.

119. Shiota, T., Folk, J.E. and Tietze, F. (1958) Inhibition of lysine utilization in bacteria by S-(beta-aminoethyl) cysteine and its reversal by lysine peptides. Arch Biochem Biophys, 77, 372-377.

I. References

43

120. Blount, K.F., Wang, J.X., Lim, J., Sudarsan, N. and Breaker, R.R. (2007) Antibacterial lysine analogs that target lysine riboswitches. Nat Chem Biol, 3, 44-49.

121. Lee, E.R., Blount, K.F. and Breaker, R.R. (2009) Roseoflavin is a natural antibacterial compound that binds to FMN riboswitches and regulates gene expression. RNA Biol, 6, 187-194.

122. Heidelberg, J.F., Eisen, J.A., Nelson, W.C., Clayton, R.A., Gwinn, M.L., Dodson, R.J., Haft, D.H., Hickey, E.K., Peterson, J.D., Umayam, L. et al. (2000) DNA sequence of both chromosomes of the cholera pathogen Vibrio cholerae. Nature, 406, 477-483.

123. Chain, P.S., Carniel, E., Larimer, F.W., Lamerdin, J., Stoutland, P.O., Regala, W.M., Georgescu, A.M., Vergez, L.M., Land, M.L., Motin, V.L. et al. (2004) Insights into the evolution of Yersinia pestis through whole-genome comparison with Yersinia pseudotuberculosis. Proc Natl Acad Sci U S A, 101, 13826-13831.

124. Urban, J.H. and Vogel, J. (2007) Translational control and target recognition by Escherichia coli small RNAs in vivo. Nucleic Acids Res., 35, 1018-1037.

125. Leontis, N.B. and Westhof, E. (1998) A common motif organizes the structure of multi-helix loops in 16 S and 23 S ribosomal RNAs. J Mol Biol, 283, 571-583.

I. References

44

J. Conference contributions

1. Posters

L.C. Gaubig, J. Kortmann, T. Waldminghaus, F. Narberhaus (2007). Enterobacterial RNA thermometers. Kick-off Meeting Sensory and Regulatory RNAs in Prokaryotes (DFG priority program SPP1258), Bochum, Germany, Book of abstracts p.7 and International Symposium on RNA Ligand Interactions (SFB 579), Frankfurt a.M., Germany, Book of abstracts p.47.

J. Kortmann, F. Narberhaus (2008). Control of Vibrio cholerae virulence gene expression by an RNA thermometer. Progress Meeting Sensory and Regulatory RNAs in Prokaryotes (DFG priority program SPP1258), Kassel, Germany, Book of abstracts p.48.

J. Kortmann, S.D. Sczodrok, F. Narberhaus (2009). Control of Synechocystis heat shock gene expression by an RNA thermometer. Jahrestagung der Vereinigung für Allgemeine und Angewandte Mikrobiologie (VAAM), Bochum, Germany, Book of abstracts (BIOspektrum) p.185.

J. Kortmann, F. Narberhaus (2009). A novel RNA thermometer controls Vibrio cholerae virulence gene expression. Metabolism Meets Virulence (International Symposium on Metabolism and Bacterial Pathogenesis), Munich, Germany, Book of abstracts p.113.

J. Kortmann, S.D. Sczodrok, F. Narberhaus (2009). A novel RNA thermometer controls expression of small heat shock genes in Synechocystis. International Meeting Sensory and Regulatory RNAs in Prokaryotes (DFG priority program SPP1258), Berlin, Germany, Book of abstracts PP 30.

J. Kortmann, F. Narberhaus (2009). Adjusting Virulence: A novel RNA thermometer controls Vibrio cholerae virulence gene expression. International Meeting Sensory and Regulatory RNAs in Prokaryotes (DFG priority program SPP1258), Berlin, Germany, Book of abstracts PP 31.

K. Böhme, A.K. Heroven, R. Steinmann, W. Opitz, J. Kortmann, F. Narberhaus, P. Dersch (2010). The synthesis of important virulence factors in Yersinia pseudotuberculosis underlies the control of a complex regulatory network during the infection process. Jahrestagung der Vereinigung für Allgemeine und Angewandte Mikrobiologie (VAAM), Kassel, Germany, Book of abstracts (BIOspektrum) p.116.


45

J. Kortmann, S.D. Sczodrok, F. Narberhaus (2010). Translation on demand: A simple cyanobacterial RNA-based thermosensor is critical for stress management. Jahrestagung der Vereinigung für Allgemeine und Angewandte Mikrobiologie (VAAM), Kassel, Germany, Book of abstracts (BIOspektrum) p.123.

K. Böhme, R. Steinmann, J. Kortmann, A.K. Heroven, F. Narberhaus, P. Dersch (2010). Regulatory RNAs coordinate expression of important virulence factors in Yersinia pseudotuberculosis. Kick-off Meeting Sensory and Regulatory RNAs in Prokaryotes (DFG priority program SPP1258), Kassel, Germany, Book of abstracts p.40.

2. Talks

J. Kortmann, F. Narberhaus (2008). Adjusting Virulence: RNA thermometers in pathogens. Jahrestagung der Vereinigung für Allgemeine und Angewandte Mikrobiologie (VAAM), Frankfurt a.M., Germany, Book of abstracts (BIOspektrum) p.82.

J. Kortmann, S.D. Sczodrok, J. Rinnenthal, H. Schwalbe, F. Narberhaus (2010). Translation on demand by a simple cyanobacterial RNA-based thermosensor. Jacques Monod at 100 - Commemorative Symposium (Institut Pasteur), Paris, France, no book of abstracts.

J. Kortmann, S.D. Sczodrok, J. Rinnenthal, H. Schwalbe, F. Narberhaus (2010). Translation on demand: A simple cyanobacterial RNA-based thermosensor is critical for stress management. Kick-off Meeting Sensory and Regulatory RNAs in Prokaryotes (DFG priority program SPP1258), Kassel, Germany, Book of abstracts p.24.


46

K. Appendix

1. Curriculum vitae

Dipl.-Biol. Jens Frank Kortmann

Date of birth: 25.03.1980Nationality: GermanFamily status: not married

Scientific education

2001 - 2003 Elementary studies in biology, Ruhr-University Bochum

2003 - 2005 Main studies in biology, Ruhr-University Bochum

2005 - 2006 Diploma project („Molekulare Analyse der Interaktion von Nac2 und RBP40, zweier posttranskriptioneller Regulatoren der plastidären Genexpression in Chlamydomonas reinhardtii”) at the Department of General and Molecular botany (Prof. Dr. Jörg Nickelsen), Bochum

since 2007 PhD project (“Structure and function of novel RNA thermometers”) at the Department of Microbial biology (Prof. Dr. Franz Narberhaus), Bochum

Fellowships

2007 - today PhD fellowship from the “Studienstiftung des Deutschen Volkes”

2009 FEMS supported young scientist (FEMS young scientists meeting grant)

Other relevant activities

2009 - 2010 -Doctoral representative of the Ruhr-University Research School -Board member of the Research School Executive Board -Organisation committee: Science College, Section Day, Business College

Publications2007 “Synthesis of the D2 protein of photosystem II in Chlamydomonas is

controlled by a high molecular mass complex containing the RNA stabilization factor Nac2 and the transcriptional activator RBP40.” (Schwarz C, Elles I, Kortmann J, Piotrowski M, Nickelsen J) Plant Cell

2008 “Generation of synthetic RNA-based thermosensors.” (Waldminghaus T, Kortmann J, Gesing S, Narberhaus F) Biol Chem

2010 “Translation on demand by a simple RNA-based thermosensor” (Kortmann J, Sczodrok S, Rinnenthal J, Schwalbe H, Narberhaus F) submitted

K. Appendix

47

2. Erklärung

Hiermit erkläre ich, dass ich die Arbeit selbstständig verfasst und bei keiner anderen Fakultät

eingereicht und dass ich keine anderen als die angegebenen Hilfsmittel verwendet habe. Es

handelt sich bei der heute von mir eingereichten Dissertation um sechs in Wort und Bild völlig

übereinstimmende Exemplare.

Weiterhin erkläre ich, dass digitale Abbildungen nur die originalen Daten enthalten und in keinem

Fall inhaltsverändernde Bildbearbeitung vorgenommen wurde.

Bochum, den

(Jens Kortmann)

K. Appendix

48

L. Eigenanteil an den Publikationen (Manuskripten)

„Struktur und Funktion neuartiger RNA-Thermometer“

Dissertation, Jens Frank Kortmann, Lehrstuhl für Biologie der MikroorganismenReferent: Prof. Dr. Franz NarberhausKorreferent: Prof. Dr. Ulrich KückBochum, den 15. Oktober 2010


30% Planung, Durchführung und Auswertung der Experimente; 25% Verfassen des Manuskripts

2. Kortmann, J., Sczodrok, S., Rinnenthal, J., Schwalbe, H. and Narberhaus, F. (2010) Translation on demand by a simple RNA-based thermosensor. submitted.

90% Planung; 70% Durchführung und 80% Auswertung der Experimente; 100% Verfassen des Manuskripts

3. Kortmann, J., Weber, G., Klose, KE. and Narberhaus, F. (2010) Temperature-mediated translational regulation by the Vibrio cholerae toxT 5‘ mRNA leader is based on nucleotide slippage and pseudoknot formation. in preparation.

100% Planung; 90% Durchführung und 90% Auswertung der Experimente; 100% Verfassen des Manuskripts

L. Eigenanteil an den Publikationen

49

Struktur und Funktion neuartiger RNA-Thermometer = STructure and ...

Documents

Transcript of Struktur und Funktion neuartiger RNA-Thermometer = STructure and ...