stm.sciencemag.org/cgi/content/full/11/493/eaav7325/DC1

Supplementary Materials for

Phagocytosis-shielded lentiviral vectors improve liver gene therapy in

nonhuman primates

Michela Milani, Andrea Annoni, Federica Moalli, Tongyao Liu, Daniela Cesana, Andrea Calabria, Sara Bartolaccini, Mauro Biffi, Fabio Russo, Ilaria Visigalli, Andrea Raimondi, Susannah Patarroyo-White, Douglas Drager, Patrizia Cristofori,

Eduard Ayuso, Eugenio Montini, Robert Peters, Matteo Iannacone, Alessio Cantore*, Luigi Naldini*

*Corresponding author. Email: cantore.alessio@hsr.it (A.C.); naldini.luigi@hsr.it (L.N.)

Published 22 May 2019, Sci. Transl. Med. 11, eaav7325 (2019)

DOI: 10.1126/scitranslmed.aav7325

The PDF file includes:

Materials and Methods Fig. S1. Fractionation and sorting of liver cell subpopulations. Fig. S2. LV biodistribution within the liver cell subpopulations. Fig. S3. Generation of CD47-negative cells. Fig. S4. Generation of CD47-overexpressing cells. Fig. S5. Cytokine and chemokine response to LV, CD47hi LV, or CD47-free LV administration in NOD mice. Fig. S6. Cytokine and chemokine response to LV or CD47hi LV administration in NHPs. Fig. S7. LV gene therapy in NHPs. Fig. S8. IS analysis in CD47hi LV– or LV-treated NHP spleen. Table S1. Large-scale LV batches used in NHP study. Table S2. Clinical biochemistry, hematology, and hemostasis of vehicle NHP. Table S3. Clinical biochemistry, hematology, and hemostasis of LV1. Table S4. Clinical biochemistry, hematology, and hemostasis of LV2. Table S5. Clinical biochemistry, hematology, and hemostasis of LV3. Table S6. Clinical biochemistry, hematology, and hemostasis of CD47hi LV1. Table S7. Clinical biochemistry, hematology, and hemostasis of CD47hi LV2. Table S8. Clinical biochemistry, hematology, and hemostasis of CD47hi LV3. Table S9. LV IS in NHPs. Table S10. LV IS in cancer genes. Table S11. LV CIS. Legend for movie S1 References (46–53)

Other Supplementary Material for this manuscript includes the following: (available at stm.sciencemag.org/cgi/content/full/11/493/eaav7325/DC1)

Movie S1 (.mov format). IV2PM of LVs, CD47hi LVs, or CD47-free LVs upon administration.

Materials and Methods

Plasmid construction

The LV constructs expressing human FIX were previously described (8). The expression cassette

contains an engineered hepatocyte-specific promoter (Enhanced Transthyretin, GenBank

accession number AY661265) and target sequences for the hematopoietic-lineage specific

microRNA 142, abrogating off-target transgene expression in antigen-presenting cells (APC) in

the liver and spleen (mature human microRNA 142 sequence – miR-142-3p:

uguaguguuuccuacuuuaugga). The Cas9 and sgRNA expressing plasmids were previously

described (46). The sequences of the CRISPR used to generate the sgRNA are: CD47 A

(CTACTGAAGTATACGTAAAGTGG), B (CTTGTTTAGAGCTCCATCAAAGG), C

(ATCGAGCTAAAATATCGTGTTGG). To generate SIN RV genome transfer PGK.CD47, the

gene synthesized human codon-optimized version of the CD47 cDNA (Genewiz) was exchanged

with GFP into pRT43.3.PGK.GFP (BamHI-NotI)(44). GFP-pp60Src

fusion construct was

generated by cloning the gene synthesized sequence encoding for the first 15 amino acids of

pp60Src

and the poly-glutamine spacer (26) upstream the GFP encoding sequence into

pMAX.GFP.

LV and RV titration

For LV titration, 1x105

293T cells were transduced with serial LV dilutions in the presence of

polybrene (8 μg/ml). For LV-GFP, cells were analyzed by flow cytometry 3-7 days after

transduction and infectious titer, expressed as transducing units293T (TU)/mL, was calculated

using the formula TU/mL = ((% GFP+ cells/100)x100,000x(1/dilution factor)). For all other LV,

genomic DNA (gDNA) was extracted 14 days after transduction, using Maxwell 16 Cell DNA

Purification Kit (Promega), following manufacturer’s instructions. VCN was determined by

quantitative PCR (qPCR) starting from 100 ng of template gDNA using primers (HIV fw: 5’-T

ACTGACGCTCTCGCACC-3’; HIV rv: 5’-TCTCGACGCAGGACTCG-3’) and a probe (FAM

5’-ATCTCTCTCCTTCTAGCCTC-3’) designed on the primer binding site region of LV. The

amount of endogenous DNA was quantified by a primers/probe set designed on the human

telomerase gene (Telo fw: 5’-GGCACACGTGGCTTTTCG-3’; Telo rv: 5’-

GGTGAACCTCGTAAGTTTATGCAA-3’; Telo probe: VIC 5’-

TCAGGACGTCGAGTGGACACGGTG-3’ TAMRA) or the human GAPDH gene (Applied

Biosystems HS00483111_cm) VCN was calculated by the formula = (ng LV/ng endogenous

DNA)xVCN of sample used for the standard curve. The standard curve was generated, by using

a CEM cell line stably carrying 1 vector integrant, which was previously determined by Southern

blot and fluorescent in situ hybridization (FISH). All reactions were carried out in duplicate or

triplicate in a Viia7 Real Time PCR thermal cycler (Applied Biosystems). Each qPCR run

carried an internal control generated by using a CEM cell line stably carrying 4 vector integrants,

which were previously determined by Southern blot and FISH analysis. Infectious titer,

expressed as TU/mL, was calculated using the formula TU/mL = (VCNx100,000x(1/dilution

factor). LV physical particles were measured by HIV-1 Gag p24 antigen immunocapture assay

(Perkin Elmer) following manufacturer’s instructions. LV specific infectivity was calculated as

the ratio between infectious titer and physical particles. RV titration was performed as for LV,

except that RV VCN was determined by droplet digital PCR (ddPCR) starting from 5-20 ng of

template gDNA using primers (sinRV fw: 5’-ACCTATCTGTGTCTGTCCGA-3’; sinRV rv: 5’-

CAGAACTCGTCAGTTCCACC-3’) and a probe (FAM 5’-

ACTAGCTCTGTATCTGGCGGACCCGT-3’) designed on the packaging signal of RV. The

amount of endogenous DNA was quantified by a primers/probe set designed on the human

telomerase gene, as above. The PCR reaction was performed with each primer (900 nM) and the

probe (250 nM, 500 nM for Telo) following manufacturer’s instructions (Biorad), read with

QX200 reader and analyzed with QuantaSoft software (Biorad).

Fractionation and sorting of liver cell sub-populations

The liver was perfused (2.5 mL/min) via the inferior vena cava with 12.5 mL of the following

solutions at subsequent steps: 1) PBS EDTA (0.5 mM), 2) HBSS (Hank’s balanced salt solution,

Gibco) and HEPES (10 mM), 3) HBSS-HEPES 0.03% Collagenase IV (Sigma). The digested

liver tissue was harvested, passed through a 70 μm cell strainer (BD Biosciences) and processed

into a single-cell suspension. This suspension was subsequently centrifuged three times (30, 25

and 20 g, for 3 minutes, at room temperature) to obtain PC-containing pellets. The nPC-

containing supernatant was centrifuged (650 g, 7 minutes, at room temperature) and recovered

cells were loaded onto a 30/60% Percoll (Sigma) gradient (1800 g, for 20 minutes at room

temperature). nPC interface was collected and washed twice. The nPC were subsequently

incubated with the following monoclonal antibodies: e-fluor 450-conjugated anti-CD45 (30-F11,

e-Bioscience), Allophycocyanin (APC)-conjugated anti-CD31 (MEC13.3, BD Biosciences),

phycoerythrin (PE)-conjugated F4/80 (CI:A3-1, Biorad), PE-Cy5-conjugated anti-CD45R/B220

(from BD Biosciences), PE-Cy7-conjugated anti-CD11c (N418, e-Bioscience), purified anti-

CD16/32 (2.4G2, BD Biosciences). nPC subpopulations (LSEC, KC, pDC) were sorted by

FACS, MOFLO-DAKO-Beckman-Coulter; the nPC contaminating the PC suspension, were

removed by FACS excluding cells labeled by APC-conjugated anti-CD31/anti-CD45 cocktail,

thus obtaining sorted hepatocytes (Hep).

Immune-fluorescence analysis and RNA ISH

For immune-fluorescence analysis, the liver was fixed in 4% paraformaldehyde, embedded in

optimal cutting temperature (OCT) and frozen in liquid nitrogen. Cryostat sections (10 μm thick)

were blocked with 5% FBS (Euroclone), 1% BSA, 0.1% Triton X-100 in PBS, incubated with

rabbit anti-GFP (1:200, Molecular Probes) washed and incubated with (FITC)-conjugated goat

anti-rabbit IgG (1:500, Molecular Probes). Sections were analyzed under a 3-laser confocal

microscope (Radiance 2100, Bio-Rad). Sections form untreated mice were used as negative

controls. Nuclei were stained with TOPRO-3 (1:1000, Molecular Probes). For RNA ISH, the

liver was fixed in formalin for 24 hours then embedded in paraffin and sectioned. A RNAscope

probe was designed to target the WPRE sequence and the signal was detected using BOND RX

system (Leica Biosystem) with RNAscope

2.5 HD Reagent Kit-RED (Advanced Cell

Diagnostics, Inc., 322360) following manufacturer’s instructions. Nuclei were stained with

DAPI.

Cell cultures and in vitro experiments

293T and LV producer cell lines were maintained in Iscove's modified Dulbecco's medium

(IMDM, Sigma) supplemented with 10% fetal bovine serum (FBS, Euroclone), 4 mM glutamine

(Lonza), penicillin and streptomycin 100 IU/mL (Lonza). THP-1 cell line was maintained in

Roswell Park Memorial Institute medium (RPMI, Corning) supplemented with 20% FBS, 4 mM

glutamine, penicillin and streptomycin 100 IU/mL. Primary human macrophages were obtained

from CD14-positive cells isolated by negative selection (Pan Monocyte Isolation Kit, Miltenyi

Biotec), from buffy coats of healthy donors (obtained according to a protocol approved by the

San Raffaele Scientific Institute Ethical Committee) and differentiated in IMDM, supplemented

with 5% human serum, 4 mM glutamine, penicillin and streptomycin 100 IU/mL for 7 days. The

purity of CD14-positive cells was determined by flow cytometry and was >90%. All cells were

maintained in a 5% CO2 humidified atmosphere at 37° C. All cell lines were routinely tested for

mycoplasma contamination. THP-1 cell line was differentiated with PMA (100 ng/mL) for 24

hours, before transduction. Human primary macrophages, differentiated THP-1 and 293T were

transduced for 1 hour with spinoculation (at 1,100 g, at 37° C), then washed with PBS and

cultured for 3 days.

Gene disruption and mismatch-selective endonuclease assay

Gene disruption was performed by calcium phosphate-mediated transient transfection of the

indicated amount of the desired sgRNA-expressing plasmid and the Cas9-expressing plasmid.

The mismatch-selective endonuclease assay was used to measure the extent of mutations

consequent to non-homologous end joining (NHEJ) at the Cas9 target sites, as described (47).

PCR was performed using primers flanking the sgRNA binding site in in the CD47 gene (fw: 5’-

TTCCTTTCCAGGATCAGCTCAGC-3’; rv: 5’-TTGATTCAAAGGAGTACCTATCCC -3’).

The PCR product was denatured, allowed to re-anneal and digested with Surveyor nuclease assay

(Transgenomic). Because this enzyme cuts DNA at sites of duplex distortions, the products of re-

annealing between wild type and mutant alleles (carrying mutations or deletions consequent to

the nuclease activity) are specifically digested. The reaction products were separated on a

Spreadex EL1200 Wide Mini gel (Elchrom Scientific), stained by ethidium bromide or GelRed

(Biotium) and the intensity of the bands was quantified by ImageQuant TL 5 software. The ratio

of the uncleaved parental fragment to the two lower migrating cleaved products was calculated

using the formula (1-(parental fraction)1/2

)x100.

Flow cytometry

Flow cytometry analyses were performed using a FACSCanto analyzer (BD Biosciences),

equipped with DIVA Software. Between 100,000-500,000 cells were harvested, washed with

PBS or MACS buffer (PBS pH 7.2 0.5% BSA, 2Mm EDTA), treated with Fc Receptor-Block

(Miltenyi Biotec) when antibody stained and then re-suspended in the buffer used for washing.

Staining was performed in MACS buffer, incubating cells with antibodies (in the proportion

indicated in the table below) for 20 minutes at 4° C in the dark. Anti-murine IgG beads were

used for single-staining controls (BD Biosciences).

CD14 PE-Vio770 clone TÜK4 (Miltenyi Biotec, 1:20)

CD19 PE clone SJ25C1 (BD Biosciences, 1:50)

CD3 APC clone UCHT1 (BD Biosciences, 1:50)

CD16 Pacific Blue clone 3G8 (BD Biosciences, 1:50)

CD47 Pacific Blue clone B6H12 (BD Biosciences, 1:20)

Electron microscopy

Few microliters of concentrated LV batches were adsorbed on glow discharged carbon coated

formvar copper grids and fixed for 20 minutes with 8% paraforlmadehyde in PBS. After several

washes in 50 mM glycine in PBS grids were blocked in 1% BSA in PBS and incubated with

primary antibodies diluted in blocking buffer for 30-90 minutes (Anti-VSV.G, KeraFAST, 1:50,

Anti-CD47, BD Biosciences, 1:10). After several washes in 0.1% BSA in PBS, samples were

incubated for 30 minutes with Protein A-gold (10 nm), fixed with 1% glutaraldehyde, stained

with 2% uranyl acetate and air-dried. Grids were observed with a Zeiss LEO 512 transmission

electron microscope. Images were acquired by a 2k x 2k bottom-mounted slow-scan Proscan

camera controlled by EsivisionPro 3.2 software. For quantification of labeling density, random

images of viral particles were taken at nominal magnification of 16k and gold particles

associated to virions were manually counted using ImageJ. Virions were defined based on

expected size (approximately 120 nm) and an electron-dense core.

Cytokine and anti-VSV.G Abs ELISA

The concentrations of cytokines and chemokines were determined in mouse or NHP serum by a

magnetic-based multiplex ELISA 23 analytes (Bio-Plex 23-Plex, Group I, Biorad or Milliplex

NHP Cytokine Magnetic Beads Kit, Millipore, respectively), following manufacturer’s

instructions.

The concentrations of anti-VSV.G Abs were determined in NHP serum by ELISA, coating with

recombinant VSV.G (Alpha Diagnostic Intl.) 1 µg/mL and and developing with a HRP-

conjugated mouse anti-monkey IgG Ab (Southern Biotech 1:10,000).

RNA extraction and qRT-PCR

RNA extraction was performed using the RNeasy Plus mini Kit (Qiagen) according to

manufacturer’s instructions and reverse transcribed using the SuperScript Vilo kit (11754250;

Invitrogen). All q-PCR analyses were done using TaqMan probes from Applied Biosystems

(WPRE: primer fw 5’-GGCTGTTGGGCACTGACAAT-3’; primer rv 5’-

ACGTCCCGCGCAGAATC-3’; probe FAM 5’-TTTCCTTGGCTGCTCGCCTGTGT-3’ NGB).

Q-PCR was run for 40 cycles using the Viia 7 instrument and raw data (Ct) were analyzed as

follows: to determine gene expression, the difference (ΔCt) between the threshold cycle (Ct) of

WPRE and that of the reference gene TAF7 was calculated by applying an equal threshold. The

lower the ΔCt, the higher the gene expression level.

VCN determination

For human macrophage experiments, DNA was extracted using QIAamp DNA Micro Kit

(Qiagen), following manufacturer’s instructions. For mice experiments, DNA was extracted from

whole liver or whole spleen samples using Maxwell 16 Tissue DNA Purification Kit (Promega),

DNA was extracted from fractionated/sorted liver cells using DNeasy Blood & Tissue Kit

(Qiagen) or QIAamp DNA Micro Kit (Qiagen), according to cell number. VCN was determined

in human macrophages as described above (see “LV and RV titration”). For THP1 experiments,

because cells were collected three days after LV transduction, VCN was determined using an ad

hoc qPCR (SYBR, Applied Biosystems), which selectively amplifies the reverse transcribed

vector genome (both integrated and non-integrated) discriminating it from plasmid carried over

from the transient transfection (RT-LV; ΔU3 fw: 5’-TCACTCCCAACGAAGACAAGATC-3’,

gag rv: 5’-GAGTCCTGCGTCGAGAGAG-3’) (48). The amount of endogenous DNA was

quantified by a primers/probe set designed on the human telomerase gene, as above. Human

primary macrophages were transduced with LV produced by stable LV-producer cell lines, thus

lacking plasmid contamination. VCN in murine DNA was determined by ddPCR, starting from

5-20 ng of template gDNA using a primers/probe set designed on the primer binding site region

of LV (see “LV and RV titration” above). The amount of endogenous murine DNA was

quantified by a primers/probe set designed on the murine sema3a gene (Sema3A fw: 5’-

ACCGATTCCAGATGATTGGC-3’; Sema3A rv: 5’-TCCATATTAATGCAGTGCTTGC-3’;

Sema3A probe: HEX 5’-AGAGGCCTGTCCTGCAGCTCATGG-3’ BHQ1). The PCR reaction

was performed with each primer (900 nM) and the probe (250 nM) following manufacturer’s

instructions (Biorad), read with QX200 reader and analyzed with QuantaSoft software (Biorad).

VCN in NHP DNA was determined by qPCR starting from 50 ng of template DNA using

primers and a probe designed on the primer binding site region of LV (see “LV and RV titration”

above). The amount of endogenous DNA was quantified by a primers/probe set designed on the

TATA-Box Binding Protein Associated Factor 7 (TAF7) gene, (Applied Biosystems RH

02916247_s1), amplifying both the human and NHP TAF7 genes. Transduced CEM clones

described above (see “LV and RV titration”) were used as standard and internal control. This

analytical method was validated in compliance with the Organization for Economic Co-operation

and Development (OECD) Principles of Good Laboratory Practice (GLP) in terms of accuracy

(deviation vs. nominal VCN ≤ 30%), specificity, intra-assay precision (coefficient of variation ≤

5%), inter-assay precision (coefficient of variation ≤ 11%) and linearity (R2 ≥ 0.99) within the

range of 0.02 ng/reaction – 257.11 ng/reaction for TAF7 and 0.22 ng/reaction – 1568.4

ng/reaction for HIV. The lower limit of VCN quantification was 0.006, which resulted within the

accuracy criteria (deviation vs. nominal VCN ≤ 30%). The lower limit of VCN detection was

0.0004, calculated based on the lower limit of detection of the HIV system.

Vector IS retrieval and analysis

For the retrieval of vector IS we adopted a sonication-based linker-mediated PCR method

previously described (49, 50). Briefly, genomic DNA (1 µg for spleen tissue and 1 µg for each

liver lobe) was sheared using a Covaris E220 Ultrasonicator (Covaris Inc.), generating fragments

with an average size of 1,000 bp. The fragmented DNA was then split in 3 technical replicates

and subjected to end repair and 3’ adenylation using the NEBNext® Ultra™ DNA Library Prep

Kit for Illumina® (New England Biolabs), and then ligated (DNA Technologies ligation kit) to

linker cassettes (LC) containing: i) 8 nucleotide sequence barcode, used for sample

identification, ii) 12 random nucleotide sequence, used for quantification purposes and iii) all the

sequences required for the Read 2 Illumina paired end sequencing. Ligation products were then

subjected to 35 cycles of exponential PCR with primers complementary to LV LTR and the LC,

next 10 additional PCR cycles were done to add sequences required for sequencing. Finally, the

amplification products were sequenced using the Illumina HiSeq platform (Illumina).

Sequencing reads were processed by a dedicated bioinformatics pipeline (VISPA2) as previously

described (51). Briefly, paired sequence reads are filtered for quality standards, barcodes

identified for sample demultiplexing of the sequence reads, the cellular genomic sequence

mapped on the genome of Crab-eating macaque (Macaca_fascicularis_5.0/macFas5, Jun. 2013)

and the nearest RefSeq gene assigned to each unambiguously mapped IS. The abundance of each

LV IS was estimated as described previously by (49, 50), where the number of genomes with the

same IS is calculated by counting the different number of fragments generated by sonication-

mediated shearing. Then, the relative abundance of each LV IS is calculated as the percentage of

genomes with a specific IS over the total genomes. CIS were identified by combining the results

obtained from the algorithm based on Montecarlo simulations described by Abel et al (52) and

the Grubbs test for outliers (34, 53). Human genomic intervals (GRCh37/hg19) syntenic with the

CIS regions mapped in the Crab-eating macaque assembly (Macaca_fascicularis_5.0/macFas5)

were extracted using the UCSC Genome Browser comparative genomics alignment tool.

Supplementary Figures

Fig. S1. Fractionation and sorting of liver cell subpopulations. Schematic diagram of

fractionation of PC, nPCs and sorting strategy of Hepatocytes (Hep), LSEC, KC, pDC from total

liver. The liver was perfused through the inferior vena with a collagenase IV solution. The

digested tissue was centrifuged at low speed to obtain PC-containing pellets. PC purity was

determined by flow cytometry, quantifying as 4.8%±0.5 the proportion of CD45-positive and

CD31-positive events (mean with SEM of three independent procedures). Cells contained in the

supernatant fractions were loaded on density gradient to collect nPC at the interface. Hep were

further purified from PC by FACS; LSEC, KC and pDC were separated from nPC by FACS.

FACS-sorted population highlighted in the red boxes were >98% pure.

Fig. S2. LV biodistribution within the liver cell subpopulations. (A) Stacked bar plot of

retrieved LV VCN (%) in PC or nPC at the indicated LV doses shown in Fig. 1B, based on the

formula VCNtotal = (VCNPCx0.7) + (VCNNPCx0.3). (B) Correlation of liver VCN calculated

based on the relative contributions of VCN in fractionated PC and total nPC (X axis) and liver

VCN calculated based on the relative contributions of fractionated PC, FACS-sorted LSEC and

KC (Y axis). (C,D) Correlations between VCN measured in whole liver (X axis) and liver VCN

calculated based on the relative contributions of (C) VCN in fractionated PC and nPC, or (D)

based on the relative contributions of VCN in fractionated PC and FACS-sorted LSEC and KC

(Y axis). Formula VCNtotal = (VCNPCx0.7) + (VCNNPCx0.3) or (VCNPCx0.7) + (VCNLSECx0.15)

+ (VCNKCx0.06). (E,F) Correlations between the percentage of GFP-positive PC (Y axis) and

(E) VCN in whole liver (X axis) or (F) VCN in fractionated PC (X axis). Data are shown as

mean with SEM (n=4 at each point). (G) Correlation between human FIX antigen (Y axis) and

VCN in FACS-sorted Hep (X axis) of C57BL/6 and NOD mice, 2 months after LV

administration (1.2-2x1010

TU/kg) shown in Fig. 1E,F. (H) Stacked bar plot of retrieved LV

VCN (%) in Hep, KC or LSEC in C57BL/6 or NOD mice shown in Fig. 1F, based on the

formula VCNtotal = (VCNHepx0.7) + (VCNLSECx0.15) + (VCNKCx0.06). (I) Single values and

mean with SEM of VCN measured in total liver samples of C57BL/6 (n=15, black squares) or

NOD mice (n=13, red circles), 2 months after LV administration (1x1010

TU/kg). For

comparison, the VCN calculated based on the relative contribution of the VCN of sorted

hepatocytes and KC from Fig. 1F (formula VCNtotal = (VCNHepx0.7) + (VCNKCx0.06)) are

shown. Mann-Whitney test. (J) Single values and mean with SEM of VCN in liver FACS-sorted

Hep, LSEC, KC or pDC, and whole spleen, as indicated, of NOD mice, 2 months after

administration of LV (n=6-7, black circles) or CD47-free LV (n=7-11, light blue circles) (1.2-

2x1010

TU/kg); same data sets shown in Fig. 1F (LV-treated NOD mice) and Fig. 1I (CD47-free

LV treated NOD mice) but plotted here together for direct comparison of LV and CD47-free LV

in the same mouse strain. Mann-Whitney test.

Fig. S3. Generation of CD47-negative cells. (A) Flow cytometry analysis (contour plots with

outliers) of 293T unstained, untreated, CRISPR/Cas9 treated, CD47-negative or CD47-positive

sorted, as indicated, performed 3 days after sorting. (B) Percentage of CD47-negative cells

(white bars) and of alleles bearing indels (NHEJ, black bars) in 293T cells transiently transfected

with the 3 different sgRNAs (A, B or C) with the indicated quantities of Cas9 and sgRNA

expressing plasmids, 1 week after transfection. (C-E) Mean with SEM of (C) infectious titer

(TU/mL), (D) physical particles (ng HIV Gag p24/mL) and (E) specific infectivity (TU/ng p24)

of LV produced by CD47-positive (black bars, n=3) or by CD47-negative (white bars, n=3)

293T as indicated. No significant differences by Mann-Whitney test.

Fig. S4. Generation of CD47-overexpressing cells. (A) Flow cytometry analysis (histograms)

of 293T (left panel), LV-GFP producer cell line (middle panel) and LV-FIX producer cell line

(right panel), unstained (filled black line), untreated (black line), or transduced with CD47-

expressing self-inactivating (SIN) RV (yellow line), as indicated, performed 2-4 weeks after

transduction. Note that almost all the cells show basal CD47 expression (black lines). (B) DNA

copies of SIN RV per diploid genome (SIN-RV VCN), determined in untreated (UNT) 293T,

CD47hi 293T, beta-2 microglobulin (B2M)-negative 293T, LV-GFP or LV-FIX producer cell

lines, as indicated. B2M-negative cells are used to produce MHC-free LV as reported in (24)

(C,D) SIN-RV VCN (C) or mean fluorescence intensity (MFI) of CD47, fold to basal (D),

determined in CD47hi 293T (yellow bars) or CD47hi B2M-negative 293T (blue bars), at the

indicated time (days) upon continuous culture, showing no counter-selection of SIN-RV

transduced CD47hi cells. (E) Percentage of CD47hi 293T cells (yellow bars) and untreated 293T

cells (white bars) determined at the indicated time (days) upon continuous co-culture. (F-K)

Mean with SEM of (F,I) infectious titer (TU/mL), (G,J) physical particles (ng p24/mL) and

(H,K) specific infectivity (TU/ng p24) of LV produced by untreated (black bars, n=3), CD47hi

(yellow bars, n=3) B2M-negative (orange bars, n=3), B2M-negative CD47hi (blue bars) 293T,

LV-GFP or LV-FIX producer cell lines, as indicated. No significant differences by Mann-

Whitney test. B2M-negative CD47hi cells were used to produce MHCfree/CD47hi LV batches

then used in NHP.

Fig. S5. Cytokine and chemokine response to LV, CD47hi LV, or CD47-free LV

administration in NOD mice. (A) Single values and mean with SEM of VCN measured in KC

of LV- or CD47hi-LV treated mice, as indicated, at 4-8x109 TU/Kg (circles) or 1.2-2x10

10

TU/Kg (triangles) from Fig. 2H,I, reported here for direct comparison. Mann Whitney test. (B-F)

Single values and mean with SEM of the concentration of (B) MIP-1α, C) MIP-1β, (D) MCP1,

(E) CXCL1 and (F) G-CSF in the serum of NOD mice treated with LV, CD47hi LV or CD47-

free LV as indicated, 3 hours after LV administration, or left untreated (Untr). Kruskal-Wallis

test with Dunn’s multiple comparison test.

Fig. S6. Cytokine and chemokine response to LV or CD47hi LV administration in NHPs.

(A) Quantitative analysis of large-scale LV batches compared to lab-grade LV batches (same

dataset shown in Fig. 2D reported here for comparison) produced by control (MHC-free LV or

LV, black circles) or CD47-overexpressing (MHC-free CD47hi LV or CD47hi LV, yellow

circles) immunostained with anti-CD47 antibody, or as staining control without the primary

antibody (ctrl, black triangles) and analyzed by electron microscopy (n=14-66 virions per

sample). (B-H) Mean with SEM of the concentration of (B) IL-2, (C) IL-1RA, (D) IL-18, (E)

MIP-1α, (F) MIP-1β, (G) MCP1 and (H) IL-10 in the serum of NHP, at the indicated time after

administration of vehicle, LV or CD47hi LV.

Fig. S7. LV gene therapy in NHPs. (A) Percentage of the serum concentrations of LV particles

(measured as HIV Gag p24) recovered at the indicated time (hours) after administration of LV

(black symbols) or CD47hi LV (yellow symbols) relative to the total amount of administered LV

particles. (B) Mean with SEM of the concentration of C3a in the serum of NHP treated with LV

(n=3, black squares) or CD47hi LV (n=3, yellow squares) at the indicated time after LV

administration. (C) Concentrations of anti-VSV.G IgG in the serum of NHP at the indicated time

(days) after administration of LV (black symbols) or CD47hi LV (yellow symbols). (D)

Mathematical function (lines) of the distribution of VCN between hepatocytes (Hep) and KC of

NHP treated with LV (solid black line) or CD47hi LV (dashed black line). The grey area

represents the domain of definition of LV-function, while the yellow area represents the domain

of definition of CD47hi LV-function. (E) Equations, on the left, and their solutions, on the right,

describing the mathematical functions depicted in (C). VCN in Hep and KC of LV-treated or

CD47-hi LV treated NHP are referred to as xLV, yLV, xCD47hi-LV and yCD47hi-LV respectively; the

sum of VCN in Hep (x) and in KC (y) weighted for their relative abundance in the liver (70%

and 6% respectively) results in the measured VCN in the total liver, assuming similar

contribution of the VCN of other liver cell populations to the total liver VCN in both LV and

CD47hi LV NHP groups (equations (i) and (ii)). The ratio between the VCN in Hep is

proportional to the ratio of average human FIX output among the LV and CD47hi LV groups

(equation (iii)). Domains of definition for LV and CD47-hi LV groups are derived from the

statement that VCN in Hep and KC must be >0 (equations (iv)). Estimated mean values of VCN

in Hep are 0.65 or 0.29 for CD47hi-LV or LV-treated NHP, respectively. Estimated mean values

of VCN in KC are 7.53 or 14.7 for CD47hi-LV or LV-treated NHP, respectively. Note that

Sparrow, which appears to have cleared FIX-expressing cells (i.e. transduced hepatocytes) by

cellular immune response at the end of the experiment, despite absence of LV FIX RNA

expression and ISH signal (see Fig 5 B-D), showed a residual total liver VCN of 0.5. This value

likely reflects the extent of transduction of non-parenchymal cells, which do not express the FIX

transgene and thus are spared from immune clearance, and well matches the estimated average

VCN in KC calculated using this mathematical model (equation ii). Indeed, yCD47hi-LV=12.08 if

xCD47hi-LV=0, thus residual total VCN in the total liver would be of 0.72, according to this

mathematical model (VCNtotal=12.08x0.06), very close to the measured total liver VCN.

Fig. S8. IS analysis in CD47hi LV– or LV-treated NHP spleen. (A,B) Stacked bar plots

representing the abundance of each LV IS retrieved from the spleen of LV- or CD47hi-LV

treated NHP. In (A) each LV IS is represented by a different color with the height in relative

proportion with the number of retrieved genomes (frequency) over the total. In (B) the frequency

by which individual LV integrations are found in 1 or more genomes are plotted in groups of

increasing number of genomes.

Table S1. Large-scale LV batches used in NHP study. The table shows the results of selected quality control assays performed on the large-scale

purified LV batches used in NHP study. EU: endotoxin units. TU: transducing units.

LV BATCH code 15140 15148 16106 16094 16098 16104

Particles/ml g p24/mL 23 14 28 48 28 29

Titer TU/mL 4.5x108 2.7x10

8 4.8x10

8 8.2x10

8 5.7x10

8 5.1x10

8

Infectivity TU/ng p24 1.8x104 1.7x10

4 1.4x10

4 2.5x10

4 2.3x10

4 2.4x10

4

Transgene Activity Positive Positive Positive Positive Positive Positive

Total DNA g/mL 6.4 2.4 6.7 8.4 7.0 5.9

Host cell protein ng/mL 565 507 1171 1051 710 798

Endotoxin EU/mL <0.2 <0.5 <0.2 <0.2 <0.2 <0.2

Sterility Sterile Sterile Sterile Sterile Sterile Sterile

Batch Volume Total mL 108 102 105 94 100 99

LV version MHC-free LV MHC-free CD47hi LV

Table S2. Clinical biochemistry, hematology, and hemostasis of vehicle NHP. The tables show the results of clinical biochemistry, hematology

and hemostasis parameters in serum or plasma samples of the indicated NHP analyzed at the indicated time (Days) before or after LV or vehicle

administration. The normal reference values for Macaca fascicularis are shown in the column “Reference” and the mean±3 standard deviations

calculated on 14 pre-treatment samples taken from the same animals are shown in the column “Basal Range”. Values lower than basal range are

shown in blue, values higher than basal range are shown in red. RBC: red blood cells WBC: white blood cells. Gamma GT: gamma-glutamil

transpeptidase.

Table S3. Clinical biochemistry, hematology, and hemostasis of LV1. The tables show the results of clinical biochemistry, hematology and

hemostasis parameters in serum or plasma samples of the indicated NHP analyzed at the indicated time (Days) before or after LV or vehicle

administration. The normal reference values for Macaca fascicularis are shown in the column “Reference” and the mean±3 standard deviations

calculated on 14 pre-treatment samples taken from the same animals are shown in the column “Basal Range”. Values lower than basal range are

shown in blue, values higher than basal range are shown in red. RBC: red blood cells WBC: white blood cells. Gamma GT: gamma-glutamil

transpeptidase.

LV1

Table S4. Clinical biochemistry, hematology, and hemostasis of LV2. The tables show the results of clinical biochemistry, hematology and

hemostasis parameters in serum or plasma samples of the indicated NHP analyzed at the indicated time (Days) before or after LV or vehicle

administration. The normal reference values for Macaca fascicularis are shown in the column “Reference” and the mean±3 standard deviations

calculated on 14 pre-treatment samples taken from the same animals are shown in the column “Basal Range”. Values lower than basal range are

shown in blue, values higher than basal range are shown in red. RBC: red blood cells WBC: white blood cells. Gamma GT: gamma-glutamil

transpeptidase.

LV2

Table S5. Clinical biochemistry, hematology, and hemostasis of LV3. The tables show the results of clinical biochemistry, hematology and

hemostasis parameters in serum or plasma samples of the indicated NHP analyzed at the indicated time (Days) before or after LV or vehicle

administration. The normal reference values for Macaca fascicularis are shown in the column “Reference” and the mean±3 standard deviations

calculated on 14 pre-treatment samples taken from the same animals are shown in the column “Basal Range”. Values lower than basal range are

shown in blue, values higher than basal range are shown in red. RBC: red blood cells WBC: white blood cells. Gamma GT: gamma-glutamil

transpeptidase.

LV3

Table S6. Clinical biochemistry, hematology, and hemostasis of CD47hi LV1. The tables show the results of clinical biochemistry, hematology

and hemostasis parameters in serum or plasma samples of the indicated NHP analyzed at the indicated time (Days) before or after LV or vehicle

administration. The normal reference values for Macaca fascicularis are shown in the column “Reference” and the mean±3 standard deviations

calculated on 14 pre-treatment samples taken from the same animals are shown in the column “Basal Range”. Values lower than basal range are

shown in blue, values higher than basal range are shown in red. RBC: red blood cells WBC: white blood cells. Gamma GT: gamma-glutamil

transpeptidase.

CD47hi-LV1

Table S7. Clinical biochemistry, hematology, and hemostasis of CD47hi LV2. The tables show the results of clinical biochemistry, hematology

and hemostasis parameters in serum or plasma samples of the indicated NHP analyzed at the indicated time (Days) before or after LV or vehicle

administration. The normal reference values for Macaca fascicularis are shown in the column “Reference” and the mean±3 standard deviations

calculated on 14 pre-treatment samples taken from the same animals are shown in the column “Basal Range”. Values lower than basal range are

shown in blue, values higher than basal range are shown in red. RBC: red blood cells WBC: white blood cells. Gamma GT: gamma-glutamil

transpeptidase.

CD47hi-LV2

Table S8. Clinical biochemistry, hematology, and hemostasis of CD47hi LV3. The tables show the results of clinical biochemistry, hematology

and hemostasis parameters in serum or plasma samples of the indicated NHP analyzed at the indicated time (Days) before or after LV or vehicle

administration. The normal reference values for Macaca fascicularis are shown in the column “Reference” and the mean±3 standard deviations

calculated on 14 pre-treatment samples taken from the same animals are shown in the column “Basal Range”. Values lower than basal range are

shown in blue, values higher than basal range are shown in red. RBC: red blood cells WBC: white blood cells. Gamma GT: gamma-glutamil

transpeptidase.

CD47hi-LV3

Table S9. LV IS in NHPs. The table shows the number of IS retrieved in liver and spleen

genomic DNA samples of CD47hi-LV or LV-treated NHPs. Fisher’s exact test was used to

compare the proportions of total IS retrieved in liver and spleen from the two treatment groups

(2x2 comparison indicated by the connecting line). The proportions are significantly different

even when the number of IS compared is reduced by normalizing with the amount of genomic

DNA tested (5 and 1 µg for liver and spleen respectively).

Vector NHP

N

Liver

IS

N

Spleen

IS

Fisher's

exact test

p value

Liver

IS/ng

DNA

(5 µg)

Spleen

IS/ng

DNA

(1 µg)

Fisher's

exact test

p value

LV1 2903 1732 581 1732

LV

LV2 3420 2528 P<0.0001 684 2528 P<0.0001

LV3 2574 3042 515 3042

TOT 8897 7302 1780 7302

CD47hi LV

CD47hi-

LV1 6449 1659 1290 1659

CD47hi-

LV2 4129 1656 826 1656

CD47hi-

LV3 3982 697 796 697

TOT 14560 4012 2912 4012

Table S10. LV IS in cancer genes. The table shows the number and frequency of cancer genes

targeted by LV IS in liver and spleen genomic DNA samples of CD47hi-LV or LV-treated

NHPs. The number of IS targeting cancer genes in liver and spleen tissues was calculated for IS

with an abundance ≤4 genomes and the few IS represented by >4 genomes. Annotation of the

genes was performed as described in the Methods section.

Liver

Vector NHP Tot

IS

N IS

abundance

≤4

genomes

N IS

abundance

>4

genomes

Cancer

genes

targeted by

IS≤4

genomes

Cancer

genes

targeted by

IS>4

genomes

LV

LV1 2903 2796 107 76 (2.7%) 1 (0.93%)

LV2 3420 3381 39 78 (2.30%) 1 (2.56%)

LV3 2574 2511 63 39 (1.55%) 1 (1.58%)

Mean ± SD 2.2±0.5% 1.7±0.7%

CD47hi LV

CD47hi-

LV1 6449 6029 420 109 (1.80%) 10 (2.3%)

CD47hi-

LV2 4129 3966 163 74 (1.86%) 11 (6.7%)

CD47hi-

LV3 3982 3865 117 85 (2.1%) 1 (0.85%)

Mean ± SD

1.9±1.7% 3.3±2.5%

Spleen

Vector NHP Tot

IS

N IS

abundance

≤4

genomes

N IS

abundance

>4

genomes

Cancer

genes

targeted by

IS≤4

genomes

Cancer

genes

targeted by

IS>4

genomes

LV

LV1 1732 1728 4 44 (2.5%) 0

LV2 2528 2509 19 51 (2.03%) 0

LV3 3042 3034 8 41 (1.35%) 0

Mean ± SD 2 ± 2.3% 0

CD47hi LV

CD47hi-

LV1 1659 1658 1 33 (1.99%) 0

CD47hi-

LV2 1656 1655 1 41 (2.47%) 0

CD47hi-

LV3 697 696 1 27 (3.87%) 0

Mean ± SD

2.3 ± 0.7% 0

Table S11. LV CIS. The table shows the CIS identified from liver integration datasets obtained

from each NHP treated with LV or CD47hi-LV

a) NHP ID: Identifier of the different NHPs treated by CD47hi-LV or LV.FIX

b) CIS gene: gene identified as CIS

c) Chr: Chromosome location of the CIS gene

d) N LV IS: number of LV IS targeting the indicated CIS gene

e) Span: Genomic window (in Kb) encompassing all the LV IS that constitute the CIS.

f) P value: Statistical value of the identified CIS (by the Grubbs test for outliers)

g) Synteny NHP LV CIS with human LV CIS: Region syntenic with human genomic regions

that are known to be frequently targeted by LV IS, are indicated with genes included in the

syntenic region (34-36). NHP LV CIS genes LOC102124855, KANK2 and ARSA do not have an

obvious orthologous human LV CIS region.

NHP(a)

CIS Gene(b)

NHP

Chr(c)

N

LV

IS(d)

Span

(kb)(e)

P

value (f)

Synteny NHP LV CIS

to human LV CIS (g)

LV

LV1 LOC102124855 14 6 5 0.004

KANK2 19 6 26 0.029

LV2

LOC102124855 14 10 8 0.000

LOC102137002 14 7 48 0.004

Chr11 region

(PACS1, FRMD8, SF1)

CD

47hi-

LV

CD47hi-

LV1

LOC102137002 14 7 37 0.007

Chr11 region

(PACS1, FRMD8, SF1)

SF3B2 14 6 32 0.032

Chr11 region

(PACS1, FRMD8, SF1)

LOC102140384 4 5 11 0.040

Chr6 region

(TAP1, HLA, BRD2,

BSMB9)

CD47hi-

LV2

SF3B2 14 6 32 0.033

Chr11 region

(PACS1, FRMD8, SF1)

LOC102140384 4 5 27 0.040

Chr6 region

(TAP1, HLA, BRD2,

BSMB9)

CD47hi-

LV3

LOC102124855 14 8 9 0.001

LOC102137002 14 7 14 0.005

Chr11 region

(PACS1, FRMD8, SF1)

KIAA0195 15 7 46 0.029

LOC102140384 4 5 35 0.024

Chr6 region

(TAP1, HLA, BRD2,

BSMB9)

ARSA 10 5 15 0.036

Movie S1. IV2PM of LVs, CD47hi LVs, or CD47-free LVs upon administration. IV2PM

imaging sequences of GFP-labeled LVs, CD47hi or CD47-free LVs (as indicated) uptake by

liver KCs in C57BL/6 or NOD mice. Sinusoids are labeled in white, KCs in red. LV is

administered 2 minutes after starting the recording. Bar, 30 µm; time in minutes and seconds.