ENZYMES FOR MOLECULAR BIOLOGY - GeneCraft · 2013-04-11 · Agarose S 18000 81 Agarose S-IM 18500...

E N Z Y M E S F O R M O L E C U L A R B I O L O G Y

Nun ist es vollbracht. GeneCraft firmiert unter einerneuen Adresse. Das großräumige Gebäude in Lüding-hausen eröffnet unzählige Möglichkeiten die umfang-reiche Produktpalette den Anforderungen unsererKunden anzupassen.Stellen Sie uns auf die Probe. Sollten Sie Fragen zuunseren Produkten oder Anregungen zur Erweiterungunseres Kataloges haben, so stehen wir ihnen gernezur Verfügung.

GENECRAFT GmbHRaiffeisenstr. 12 [email protected] Lüdinghausen www.genecraft.de

More space,more products

3

TABLE OF CONTENTS

SP6 RNA polymerase 54T7 RNA polymerase 54Restriction enzymes 55Random prime labeling kit 58dNTP set 59DNA polymerization mix 20 & 10 60dNTPs 60dNTP custom service 61Biotin-4-dUTP 61Biotin-11-dUTP 61Uracil-DNA glycosylase 62λ DNA 62T-Vector System 63pBS-KS-EcoRV 66BstE II-λ-DNA marker 66Hpa II-pBS-DNA marker 67EcoRI-λ-DNA marker 68HindIII-λ-DNA marker 69EcoRI+HindIII-λ-DNA marker 70100 bp ladder 711 kb ladder 72MegaPure™ DNA purification kit 73Treponema pallidum

recombinant antigen-™pA 74Monoclonal IgG to Thermus

aquaticus DNA-polymerase 74IPTG (Isopropyl-ß-D-thiogalactoside) 75Acrylamid solutions 76Laemmli puffer 78TBE buffer 78TEMED 79Amoniumpersulfate 79Agarose LSL 8100 80Agarose S 18000 81Agarose S-IM 18500 82Bounded ethidium bromide agarose 83Magnetic particles 84MagicTubes™ for perfect PCR 85Laboratory consumables 88Index 89Order-form 90That´s new 91

Summary of our thermostable polymerases 4BioTherm™ DNA polymerase 5First description of Taq polymerase 7BioThermMix™ 8NeoTherm™ DNA polymerase 10SupraTherm™ DNA polymerase 11CoverIt™ overlay for PCR 12PCR-Grade H2O 12Crystal violet buffer 13BioThermRed™ DNA polymerase 14BioThermT™ DNA polymerase 15BioThermBio™ DNA polymerase 17BioThermStar™ DNA polymerase 18BioThermStarMix™ DNA polymerase 20BioThermAB™ DNA polymerase 22Hot Start Taq monoclonal antibody 23Hot Start PCR compound 24KlenTherm™ DNA polymerase 25KlenThermN™ DNA polymerase 28KlenThermPlatinum™ DNA polymerase 29KlenThermase™ DNA polymerase 31KlenThermaseN™ DNA polymerase 32DNA cycle sequencing kit 32Tth inorganic pyrophosphatase 34Sequencing and pyrophosphatase 35AccuTherm™ DNA polymerase 36Comparison of some

thermostable polymerases 37Synergy™ DNA polymerase 38SynergyN™ DNA polymerase 39SynergyT™ DNA polymerase 40SynergyPlus™ DNA polymerase 41TthPlus™ DNA polymerase 42Comparison of TthPlus ™ and

GeneScript ™ RT 44GeneScript™ reverse transcriptase 48RT-PCR using GeneScript™

reverse transcriptase 48RNase-Inhibitor 49Klenow fragment 50T4 polynucleotide kinase 51T4 DNA ligase 52Tth DNA ligase 53

4

SUMMARY OF OUR THERMOSTABLE POLYMERASESCAT. NO. NAME ORGANISM DESCRIPTION APPLICATION REACTION BUFFERS

GC-004 AccuTherm™ P. furiosis DNA polymerase with high fidelity PCRDNA polymerase „proof-reading“ activity

GC-002 BioTherm™ * T. aquaticus DNA polymerase for PCRDNA polymerase robust amplifications

GC-008 BioThermAB™ T. aquaticus mixture of BioTherm™ and Hot-Start PCRDNA polymerase Hot-Start Antibody PCR with high specificity

GC-047 BioThermMix™ T. aquaticus ready-mix for High through-put PCR amplifications routine diagnostic PCR

GC-041 BioThermStarMix™T. aquaticus Hot-Start ready-mix for Hot-Start highamplifications through-put PCR

GC-021 BioThermRed™ T. aquaticus red-dyed BioTherm™ PCRDNA polymerase

GC-045 BioThermStar™ T. aquaticus chemically modified form Hot-Start PCRDNA polymerase of BioTherm™

GC-001 KlenTherm™ T. aquaticus Klenow fragment Specific PCRDNA polymerase of BioTherm™

GC-018 KlenThermase™ T. aquaticus modified KlenTherm™ DNA dideoxysequencingDNA polymerase

GC-023 KlenThermN™ T. aquaticus modified KlenTherm™ PCR of long and DNA polymerase GC-rich fragments

GC-043 KlenThermaseN™ T. aquaticus modified KlenThermase™ Sequencing of long DNA polymerase and GC-rich fragments

GC-046 KlenThermPlatinum T. aquaticus modified KlenTherm™ PCR with excellentDNA polymerase specificity

GC-031 NeoTherm™* T. aquaticus DNA polymerase for PCRDNA polymerase robust amplifications

GC-022 SupraTherm™* T. aquaticus DNA polymerase for PCRDNA polymerase standard amplifications

GC-005 Synergy™ Mixture mixture of KlenTherm™ Long and accurate DNA polymerase and AccuTherm™ PCR

GC-028 SynergyN™ Mixture mixture of KlenThermN™ Long and accurate DNA polymerase and AccuTherm™ fragments PCR of GC-rich

GC-048 SynergyPlus™ Mixture Taq- and pyrophospha- Very long-range PCRDNA polymerase tase based mixture

GC-049 SynergyT™ Mixture mixture of Synergy™ Low-specificity PCR forDNA polymerase with TthPlus™ degenerated primer

GC-003 TthPlus™ T.thermophilus Tth DNA polymerase with RT-PCRDNA polymerase reverse transcriptase activity

5x improved buffer: 350 Tris-HCl pH 8,8 83 mM (NH)4SO4,100 mM KCl 22 mM MgCl2 0,75% Triton X100, 10x buffer:200 Tris-HCl pH 8,5 100 mM (NH)4SO4 20mM MgCl2 1% TritonX100,10 x buffer can be modified by adding KCl and MgCl2

10x buffer: 160 mM (NH)4SO4 670 mM Tris-HCl pH 8,80,1%Tween 20, 15 mM MgCl210x reaction buffer without MgCl2 is available

10x buffer: 160 mM (NH)4SO4 670 mM Tris-HCl pH 8,80,1%Tween20, 15 mM MgCl2,10x reaction bufferwithout MgCl2 is available upon request

BioThermMix™ contains already 2,5x reaction buffer,dNTPs and BioTherm™ DNA polymerase ready forPCR

BioThermStarMix™ contains already 2.5x reactionbuffer, dNTPs and BioThermStar™ DNA polymeraseready for Hot-Start PCR

10x buffer: 160 mM (NH)4SO4 670 mM Tris-HCl pH 8,30,1%Tween20, 15 mM MgCl210x reaction buffer without MgCl2 is available uponrequest

10x buffer: 500 mM KCl, 100 mM Tris-HCl pH 9 1% Triton X100add MgCl2 to a final concentration of 3,5 mM






10x buffer: 160 mM (NH)4SO4 670 mM Tris-HCl pH 9,18% glycerol, 2% DMSO, 35 mM MgCl2

10x buffer: 160 mM (NH)4SO4 670 mM Tris-HCl pH 9,18% glycerol, 2% DMSO, 35mM MgCl2


10x one-tube buffer: 500 mM bicine-KOH pH 8,31 M KOAc pH7,5 30% glycerol (v/v); extra solution:50 mM Mn(OAc)2,10x RT buffer: 166 mM (NH)4SO4 670 mM Tris-HCl

pH 8,8 0,1%Tween20; extra solution: 25 mM MnCl25x PCR buffer: 83 mM (NH)4SO4 335 mM Tris-HCl pH 8,8 0,1%Tween20, 3,75 mM EGTA, 25% glycerol(v/v); extra solution: 50 mM MgCl2



*BioTherm™, NeoTherm™ and SupraTherm™ are comparable TaqDNA polymerases isolated by slightly different procedures

5

BioTherm™ DNA POLYMERASE

DESCRIPTIONBioTherm™ DNA polymerase is a thermostable DNA -polymerase purified from the Thermus aquaticus strainin accordance with the procedures developed by Kale-din (1,2,3) for the isolation of thermostable enzymesprocessing DNA polymerase activity from thermophilicbacteria. Amplification of DNA fragments (100 bp to10kb) can be achieved with this enzyme. The enzymehas both 5'-3' polymerase- and 5'-3' exonuclease acti-vities. BioTherm™ can add a single template-directeddeoxyadenosin (A) residue to the 3’ end of duplex PCRproducts. This property allows easy and efficient liga-tion of PCR products in TA cloning vectors.

BESCHREIBUNGBioTherm™ DNA-Polymerase ist eine hitzestabile DNA-Polymerase, welche nach dem Protokoll von Kaledin(1,2,3) zur Reinigung von hitzestabilen Enzymen mitPolymerase-Aktivität aus thermophilen Bakterien ausThermus aquaticus isoliert wurde. Diese Polymerase istin der Lage DNA-Fragmente mit einer Länge von 100bp bis 10 kb zu amplifizieren. BioTherm™ DNA-Poly-merase besitzt sowohl eine 5´-3´ Polymerase- als aucheine 5´-3´ Exonuklease-Aktivität. Das Enzym kanneinen einzelnen, Template-abhängigen Deoxyadenosin(A) –Rest an das 3´ -Ende doppelsträngiger PCR-Pro-dukte anhängen. Diese Eigenschaft erlaubt die einfa-che und effiziente Ligation von PCR-Produkten in TA-Klonierungs-Vektoren.

APPLICATION5 units/µl

UNIT DEFINITIONOne unit is defined as the amount of enzyme thatincorporates 10 nmoles of dNTPs into acidinsolubleform in 30 minutes at 72ºC under the assay conditions(25 mM TAPS (tris-(hydroxy-methyl)-methyl-amino-propanesulfonic acid, sodium salt) pH 9.3 (at 25ºC);50 mM KCl; 2 mM MgCl2; 1 mM ß-mercaptoethanol)and activated calf thymus DNA as substrate.

STORAGE BUFFER10 mM K-phosphate buffer pH 7.0, 100 mM NaCl, 0.5mM EDTA, 1 mM DTT, 0.01% Tween 20, 50% glycerol(v/v)

STORAGE TEMPERATUREStore BioTherm™ DNA polymerase below 0ºC, prefer-ably at -20ºC, in a constant temperature freezer.

STORAGE TEMPERATURE160 mM (NH4)2SO4, 670 mM Tris-HCl pH 8.8 (at25ºC), 15 mM MgCl2, 0.1% Tween 20The 10x reaction buffer (on request with or withoutMgCl2) is delivered free of charge.

10X REACTION BUFFER

1.5 ml 10x reaction buffer (contains 15 mM MgCl2)Cat. No. GC-002-006

1.5 ml 10x reaction buffer without MgCl2 plus 50 mM MgCl2 separatelyCat. No. GC-002-007

ASSOCIATED ACTIVITIESEndonuclease- and exonuclease activities were notdetectable after 2 and 1 hours incubation, respecti-vely, of 1 µg lambda DNA and 0.22 µg of EcoRIdigested lambda DNA, respectively, at 72ºC in thepresence of 15-20 units of BioTherm™ DNA poly-merase.

COMPANION PRODUCTSBioThermRed™ DNA polymerase, SupraTherm™DNA polymerase, dNTPs, T-Vector

GC-002-0100 GC-002-0250 GC-002-0500 GC-002-1000 GC-002-5000100 u 250 u 500 u 1000 u 5000 u

CATALOG NO.

6

680 bp

240 bp

COMPARISON OF DIFFERENT TAQ DNA POLYMERASES

58ºC 0.5 min72ºC 4 min93ºC 20 sec30 cycles

AMPLIFICATION CONDITIONS10x reaction buffer 3 µldNTPs (200 µM each) 5 µlhuman genomic DNA (300-600 ng) 1 µlforward primer (25 pM) 2 µlreverse primer (25 pM) 2 µlBioTherm™ (0.2-1 units/µl) 1 µlH2O 16 µl

total 30 µl

REFERENCES1 Kaledin, A.S., et al. (1980) Biokhimiya 45, 4942 Kaledin, A.S., et al. (1981) Biokhimiya 46, 15763 Kaledin, A.S., et al. (1982) Biokhimiya 47, 1785

1 2 3 4 5 6 7 8 9

MIXTURETemplate 1 µl (IN4/TNOMF5-product)Buffer 4 µl dNTPs 8 µl => 200 µMMgCl2 2.4 µl (lanes 3-6) => 1.5 mMIN4 2 µl TNOMF5 2 µl (lanes 1,3,5,7)TNOMF6 2 µl (lanes 2,4,6,8)Polymerase 2 µl H2O added to 30 µl

Program

1 94°C 2 min

2 94°C 30 sec65°C 30 sec 30 cycles72°C 30 sec (75°C by Eurogentec HA DNA polymerase)

3 72°C 7 min4 4°C

POLYMERASESLane 1+2 Sigma, 1 u

3+4 Promega, 1 u5+6 Eurogentec HA, 0.3 u7+8 BioTherm, 1 u

Marker 9 Marker

GEL1.5% Agarose-TAE-Gel, 85V10 µl of each mixture per lane

7

Kaledin, A.S, at al. (1980) Biokhimia 45, 494

THE FIRST DESCRIPTION OF TAQ POLYMERASE by the Russian scientist Kaledin

8

BioThermMix™

DESCRIPTIONBioTherm™Mix is a 2.5x concentrated reagent mixfor PCR comprising BioTherm™ DNA polymerase(0.06 u/µl), 2.5x PCR-Buffer with 3.75 mM MgCl2,500 µM of each dNTP and stabilizers. The 2.5x con-centration of the Mix provides high versatility for sett-ting-up PCR reactions. Up to 60% of the final reactionvolume can be used for the addition of primer andtemplate DNA solutions, co-solvents or otheradditives, if necessary.

BESCHREIBUNG BioThermMix™ ist ein 2.5x konzentrierter Reagen-zien-Mix für PCR-Reaktionen. Der Mix enthält Bio-Therm™ DNA-Polymerase (0.06 u/µl), 2.5x PCR-Puffer mit 3.75 mM MgCl2, 500 µM von jedem dNTPund stabilisierende Substanzen. Die 2.5x Konzentra-tion des BioThermMix™ ermöglicht einen flexiblenEinsatz in den PCR-Reaktionen. Auf diese Weise kannbis zu 60 % des endgültigen Reaktion-Volumens fürdie Zugabe von Primern, Template-DNA, sowie ande-ren Reaktionssubstanzen genutzt werden.

APPLICATIONBioTherm™Mix is suitable and tested for amplifica-tion of genomic targets ranging from l00 bp to 4 kband of episomal targets (lambda phage; plasmids) upto 10 kb under various reaction conditions.

high through-put PCRroutine diagnostic PCR requiring high reproducibilityDNA sequencing template preparation

STORAGE CONDITIONSBioTherm™Mix can be stored at either -20°C in afreezer or at 2-8°C in a usual refrigerator. Shipment atambient temperature is possible without reduction ofPCR performance and activity. Storage at 2-8°C is con-venient for easy and time-saving assembling of thePCR assays. Storage of BioTherm™Mix at -20°C isrecommended for long-term storage after the mix hasbeen used once under non-sterile conditions. Multiplefreezing and thawing do not affect the performance oractivity of the Mix.

At 2-8°C the BioTherm™Mix is at least stable for 12months, in frozen state for 2 years.

NOTE Do not contaminate the BioTherm™Mix with primersand template DNA used in individual reactions. Thaw

and mix all components thoroughly, spin down short-ly and chill on ice.It is very important to mix the BioTherm™Mix befo-re use to avoid localized concentration!

PROTOCOL 1 Place the PCR tubes on ice.2 Prepare first a template/primer mix according to the

volumes given in the table below for different reac-tion volumes. Mix the template/primer mix and chillon ice.

3 Dispense now the corresponding volume of Bio-Therm™Mix (20 µl for a 50 µl reaction) followed bythe template/primer mix into each reaction tube.Close tubes and mix well. Spin down shortly, ifnecessary, and chill the tubes on ice.

4 Start the program on the thermal cycler. Transfer thetubes directly from ice into the thermal cycler whenthe temperature of the block has reached 90°C.

IMPORTANT NOTEThe stabilizers in the BioTherm™Mix are potentialgrowth substrates for bacterial contaminations! If theMix has been opened and used under non-sterile con-ditions, the residual moiety should be used during thenext 2 weeks with intermediate storage at 2-8°C orshould be frozen at -20°C for longer storage!

9

PCR Sterile redi- Sense Antisense Template 2.5x PCRVolume stilled H2O Primer Primer DNA Mix

100 µl up to 60 µl x µl y µl z µl 40 µl50 µl up to 30 µl x µl y µl z µl 20 µl25 µl up to 15 µl x µl y µl z µl 10 µl20 µl up to 12 µl x µl y µl z µl 8 µl

Final concentrations: 200 nM 200 nM 1-100 ng 1x

Other variable reaction conditions (temperatures,cycling times, concentrations of template, primers,magnesium and polymerase) have to be optimizedempirically for each template/primers combination.Most PCR applications work at the standard concen-tration of 1,5 mM Mg2+ provided with 1x diluted PCRMix. Optimal Mg2+ concentration higher than 1,5 mM

can be adjusted using a separate magnesium solutionor by increasing stepwise (5 µl increments) the amountof BioThermMix™ added to the reaction assay. Thisapproach can also be used to improve the productyield in amplification of difficult targets on complextemplate DNA (see table below).

Optimization by adding variable amounts of concentrated BioThermMix™ to a 50 µl-assay:

Volume of Volume of Final Mg2+ Final dNTP- Taq units Final 2,5x PCR template/ Concen- Concen- per concen-Mix primer mix tration tration reaction trations

20 µl 30 µl 1.5 mM 200 µM 1.25 u 1x25 µl 25 µl 2.0 mM 250 µM 1.6 u 1.25x30 µl 20 µl 2.25 mM 300 µM 1.9 u 1.5x

BioThermMix™

GC-047-10001 ml

CATALOG NO.

10

NeoTherm™ DNA POLYMERASE

DESCRIPTIONNeoTherm™ is a thermostable DNA polymerase puri-fied from the Thermus aquaticus strain in accordancewith the procedures developed by Kaledin for the iso-lation from thermophilic bacteria of thermostableenzymes processing DNA polymerase activity.It is a highly processive 5'-3' DNA polymerase lacking3'-5'-exonuclease activity. The enzyme is highly puri-fied and is free of nonspecific endo- or exonucleases.This polymerase has a template-dependent activitywhich adds a single deoxyadenosine (A) to the 3' endsof PCR products (3'-A-overhangs). This property allowseasy and efficient ligation of PCR products in TA clo-ning vectors.

APPLICATIONPCRDNA labelling

CONCENTRATION 5 units/µl

UNIT DEFINITIONOne unit is defined as the amount of enzyme thatincorporates 10 nmoles of dNTPs into acid-insolubleform in 30 min at 72°C.

STORAGE BUFFER20 mM Tris-HCl pH 8.0, 100 mM KCl, 0.1 mM EDTA,5 mM DTT, 50% glycerol, 1% Triton X-100

STORAGE TEMPERATURE-20°C

10X REACTION BUFFER160 mM (NH4)2SO4, 670 mM Tris-HCl pH 8.8 (at25ºC), 15 mM MgCl2, 0.1% Tween 20The 10x reaction buffer (on request with or withoutMgCl2) is delivered free of charge.

QUALITY CONTROLActivity, SDS-PAGE purity, absence of endonuclea-ses/nickases and exonucleases

The enzyme is also tested to verify that less than 10copies of bacterial 16S ribosomal RNA gene sequen-ces are present in a standard 2.5 unit aliquot.


CATALOG NO.

BESCHREIBUNGNeoTherm™ DNA-Polymerase ist eine hitzestabileDNA-Polymerase, welche nach dem Protokoll vonKaledin (1,2,3) zur Reinigung von hitzestabilen Enzy-men mit Polymerase-Aktivität aus thermophilen Bak-terien aus Thermus aquaticus isoliert wurde.Dies ist eine äußerst aktive 5´-3´ DNA-Polymeraseohne 3´-5´ Exonuklease-Aktivität. Das Enzym weisteinen sehr hohen Reinheitsgrad auf und enthält daherkeinerlei unspezifische Endo- oder Exonukleasen.Die Polymerase besitzt eine Template-abhängige Akti-vität, welche einen einzelnen Deoxyadenosin (A) -Restan das 3´ -Ende von PCR-Produkten anhängt (3´-A-Überhänge).Diese Eigenschaft erlaubt die einfache und effizienteLigation von PCR-Produkten in TA-Klonierungs- Vekto-ren.

11

SupraTherm™ DNA POLYMERASE

DESCRIPTION SupraTherm™ DNA polymerase is a thermostableDNA polymerase purified from the Thermus aquaticusstrain by several rounds of liquid chromatography. Thepurity of SupraTherm™ DNA polymerase is more than90% of the total protein in the preparation. Amplifica-tion of DNA fragments (100 bp to 5 kb) can be achie-ved with it. The enzyme has both, 5'-3' polymerase-and 5'-3'exonuclease activities. SupraTherm™ canadd a single template-directed deoxyadenosin (A) resi-due to the 3’ end of duplex PCR products. This pro-perty allows easy and efficient ligation of PCR pro-ducts in TA cloning vectors.

BESCHREIBUNG SupraTherm™ DNA-Polymerase ist eine hitzestabileDNA-Polymerase, die in mehreren Durchläufen mittelsFlüssigkeits-Chromatographie aus Thermus aquaticusisoliert wurde. Der Reinheitsgrad der SupraTherm™DNA-Polymerase beträgt mehr als 90 % bezogen aufden Gesamt-Proteingehalt. Das Enzym ist in der LageDNA-Fragmente mit einer Länge von 100 bp bis 5 kb zuamplifizieren. SupraTherm™ DNA-Polymerase besitztsowohl eine 5´-3´ Polymerase- als auch eine 5´-3´ Exo-nuklease-Aktivität. Das Enzym kann einen einzelnen,Template-abhängigen Deoxyadenosin (A) –Rest an das3´ -Ende doppelsträngiger PCR-Produkte anhängen.

APPLICATIONThe enzyme may be used for PCR, thermosequencingand for other research and diagnostic applications.

SupraTherm™ DNA polymerase is the best enzyme foreveryday routine applications. The enzyme has limitedapplication for PCR with low-abundance template(less then 100 DNA molecules of template). Please usefor PCR of low-abundance templates and for othermore sophisticated techniques BioTherm™ DNA poly-merase.


UNIT DEFINITIONOne unit is defined as the amount of enzyme thatincorporates 10 nmoles of dNTPs into acid-insolubleform in 30 minutes at 72ºC under the assay conditions(25 mM TAPS (tris-(hydroxy-methyl)-methyl-amino-propanesulfonic acid, sodium salt) pH 9.3 (at 25ºC),50 mM KCl, 2 mM MgCl2, 1 mM ß-mercaptoethanol)and activated calf thymus DNA as substrate.

STORAGE BUFFER 10 mM K-phosphate buffer pH 7.0, 100 mM NaCl, 0.5mM EDTA, 1 mM DTT, 0.01% Tween 20;50% glycerol (v/v)

STORAGE TEMPERATUREStore SupraTherm™ DNA polymerase below 0ºC, pre-ferably at -20ºC, in a constant temperature freezer.

10X REACTION BUFFER160 mM (NH4)2SO4, 670 mM Tris-HCl pH 8.8 (at25ºC), 15 mM MgCl2, 0.1% Tween 20The 10x reaction buffer(on request with or withoutMgCl2) is delivered free of charge.

1.5 ml 10x reaction buffer (contains 15 mM MgCl2)Cat. No. GC-002-006

1.5 ml 10x reaction buffer without MgCl2 plus 50mM MgCl2 separatelyCat. No. GC-002-007

QUALITY CONTROLSupraTherm™ DNA polymerase was tested for theabsence of unspecific endo- and exonucIeases activi-ties.

COMPANION PRODUCTSBioThermRed™ DNA polymerase, BioTherm™ DNApolymerase, dNTPs, T-Vector


CATALOG NO.

12BESCHREIBUNG CoverIt™ kann als Proben-Überschichtung in PCRReaktions-Gefäßen verwendet werden. Die Verwendungvon CoverIt™ verhindert die Verdunstung und anschlie-ßende Kondensation des Reaktionsansatzes im Reak-tionsgefäß. Nach Kühlung auf +4 °C wird CoverIt™fest, so dass man mit einer Pipettenspitze durchstechenkann, um den Reaktionsansatz heraus zu pipettieren.

STORAGE TEMPERATUREstore at room temperature

PROTOCOLFor 10-100 µl PCR mix use 60 µl (two drops) CoverIt™.

CoverIT™ OVERLAY FOR PCR REACTIONS

DESCRIPTION CoverIt™ can be used as a sample overlay in PCRreaction tubes. The use of CoverIt™ prevents evapo-ration and subsequent condensation of the reactionmixture in the reaction tube. Upon cooling to +4oCCoverIt™ becomes solid allowing convenient recove-ring of the reaction mix by sticking through it with apipet tip.

GC-026 1.5 ml

CATALOG NO.

GC-0581,5 ml

CATALOG NO.

PCR-GRADE H2O

13DESCRIPTIONBy including crystal violet in the gel and loading buff-fer it is possible to visualize DNA bands as they sepa-rate during agarose gel electrophoresis. This is particu-larly useful for isolating DNA fragments for cloningwork. The advantage of this method is that the DNA isnot exposed to the damaging effects of ultraviolet(UV) light, as occurs when ethidium bromide is usedfor staining. The improvement in cloning efficiencyobserved when crystal violet is used is threefold whencompared with ethidium bromide and a transillumina-tor with max. 320 nm and tenfold in comparison witha shorter wavelength (302 nm).

BESCHREIBUNG Mit Hilfe des Crystal Violet in Gel und Puffer ist es mög-lich die DNA-Banden sichtbar zu machen, während siesich in einer Agarose-Gel-Elektrophorese trennen. Diesist besonders nützlich bei DNA-Fragmenten, die für Klo-nierungen isoliert werden. Der Vorteil dieser Methodeist, dass die DNA nicht den schädigenden Einflüssenultravioletten (UV) Lichts ausgesetzt werden muss, wasnötig ist, wenn Ethidiumbromid für die Färbung ver-wendet wird. Der Erfolg einer Klonierung ist nach Ver-wendung von Crystal Violet dreimal höher als bei Ver-wendung von Ethidiumbromid oder einem Transillumi-nator mit max. 320 nm, sowie zehnmal höher bei einerkürzeren Wellenlänge (302 nm).

APPLICATIONCloning of DNA fragments (PCR products and DNAmolecules digested by restriction enzymes)

STORAGE TEMPERATURE+4° C to -20° C

REFERENCES Rand, K. N. (1996) Crystal violet can be used to visu-alize DNA bands during gel electrophoresis and to im-prove cloning efficiency. Elsevier Trends Journals Tech-nical Tips Online, T40022.

PROTOCOL Crystal violet has a lower sensitivity than ethidiumbromide. Load as much as 1 to 3 µg DNA in a slot. Ifless than 100 ng of the required fragment is loadedonto the gel it may be necessary to make a controlwith ethidium bromide by running a second minigel atthe same time. Agarose should be prepared by adding100 µl Crystal violet gel buffer to 100 ml gel. Add 3-5µl Crystal Violet loading buffer to 30 µl digest or PCRaliquot and load that into the slot. For maximum sen-sitivity the running buffer should only just cover thegel. After electrophoresis, place the gel on a light boxto visualize separated fragments. Crystal violet is runn-ning in opposite direction as DNA, so do not run thegel for a too long time.

GC-030500 µl loading buffer,10 ml gel buffer (100 rxns).

CATALOG NO.

CRYSTAL VIOLET BUFFER

14

BioThermRed™ DNA POLYMERASE

DESCRIPTION BioThermRed™ DNA polymerase is a mixture of Bio-Therm™ DNA polymerase and red pigment thatworks like BioTherm™. After addition of BioTherm-Red™ a thin red layer on the bottom of the tubeappears. So you have a visible pipetting control. Fur-thermore you can see, if your reaction is alreadymixed, when the color of your reaction becomes uni-form.

BESCHREIBUNG BioThermRed™ ist eine neue, mit rotem Farbstoff ver-sehene Variante der BioTherm™ DNA Polymerase. Siefunktioniert genauso wie BioTherm™ DNA Polymera-se. Nach Zugabe von BioThermRed™ erscheint einedünne rote Schicht am Boden des Reaktionsgefäßes.Dadurch haben Sie eine deutlich sichere Pipettierkon-trolle. Weiterhin können Sie anhand der roten Farbeerkennen, ob ihr Ansatz gut durchmischt ist. Gleich-mäßige Farbverteilung deutet auf eine vollkommeneDurchmischung der Probe hin.


UNIT DEFINITIONOne unit is defined as the amount of enzyme thatincorporates 10 nmoles of dNTPs into acidinsolubleform in 30 minutes at 72ºC under the assay conditions(25 mM TAPS (tris-(hydroxy-methyl)-methyl-amino-propanesulfonic acid, sodium salt) pH 9.3 (at 25ºC),50 mM KCl, 2 mM MgCl2, 1 mM ß-mercaptoethanol)and activated calf thymus DNA as substrate.

STORAGE BUFFER10 mM K-phosphate buffer pH 7.0, 100 mM NaCl, 0.5mM EDTA, 1 mM DTT, 0.01% Tween 20,0.2%indicator red dye, 50% glycerol (v/v)The 10x reaction buffer (on request with or withoutMgCl2) is delivered free of charge.

STORAGE TEMPERATUREStore BioThermRed™ DNA polymerase below 0ºC,preferably at -20ºC, in a constant temperature freezer.

10X REACTION BUFFER160 mM (NH4)2SO4, 670 mM Tris-HCl pH 8.8 (at25ºC), 15 mM MgCl2, 0.1% Tween 20

1.5 ml 10x reaction buffer (contains 15 mM MgCl2) Cat. No. GC-002-006

1.5 ml 10x reaction buffer without MgCl2 plus 50 mM MgCl2 separately Cat. No. GC-002-007

ASSOCIATED ACTIVITIESEndonuclease- and exonuclease activities were notdetectable after 2 and 1 hours incubation, respective-ly, of 1 µg lambda DNA and 0.22 µg of EcoRI digestedlambda DNA, respectively, at 72ºC in the presence of15-20 units of BioThermRed™ DNA polymerase.

COMPANION PRODUCTSBioTherm™ DNA polymerase, SupraTherm™ DNApolymerase, dNTPs


CATALOG NO.

15


UNIT DEFINITIONOne unit is defined as the amount of enzyme thatincorporates 10 nmoles of dNTPs into acidinsolubleform in 30 minutes at 72ºC under the assay conditions(25 mM TAPS (tris-(hydroxy-methyl)-methyl-amino-propanesulfonic acid, sodium salt) pH 9.3 (at 25ºC),50 mM KCl, 2 mM MgCl2, 1 mM ß-mercaptoethanol)and activated calf thymus DNA as substrate.

STORAGE BUFFER10 mM K-phosphate buffer pH 7.0, 100 mM NaCl,0.5 mM EDTA, 1 mM DTT, 0.01% Tween 20,0.2%indicator red dye, 50% glycerol (v/v)The 10x reaction buffer (on request with or withoutMgCl2) is delivered free of charge.

STORAGE TEMPERATUREStore BioThermT™ DNA polymerase below 0ºC, pre-ferably at -20ºC, in a constant temperature freezer.

10X REACTION BUFFER160 mM (NH4)2SO4, 670 mM Tris-HCl pH 8.8 (at25ºC), 15 mM MgCl2, 0.1% Tween 20

1.5 ml 10x reaction buffer (contains 15 mM MgCl2) Cat. No. GC-002-006

1.5 ml 10x reaction buffer without MgCl2 plus 50 mM MgCl2 separately Cat. No. GC-002-007

ASSOCIATED ACTIVITIESEndonuclease- and exonuclease activities were notdetectable after 2 and 1 hours incubation, respective-ly, of 1 µg lambda DNA and 0.22 µg of EcoRI digestedlambda DNA, respectively, at 72ºC in the presence of15-20 units of BioThermT™ DNA polymerase.

COMPANION PRODUCTSBioTherm, BioThermBio

BioThermT™ DNA POLYMERASE

DESCRIPTIONBioThermT™ is a modified BioTherm DNA polymeraseto facilitate incorporation of Biotin-dUTP and Digoxi-genin-dUTP in DNA.

BESCHREIBUNGBioThermT™ ist eine modifizierte BioTherm DNA-Polymerase, die es ermöglicht Biotin-dUTP und Digoxi-genin-dUTP in DNA einzubringen.

A 700 bp DNA fragment of a single copy gene wasamplified without (lane 1) and with the addition ofbiotin-11-dUTP using different concentrations (lanes2-4, MW = molecular weight standard). PCR reactionswere run for 40 cycles, 10 sec at 92°C,15 sec at 65°C,and 2 min at 72°C in a volume of 25 µL, including 10x amplification buffer (Genecraft), 2 mM MgCl2, 5pmol of each forward and reverse primers, 1 ng ofDNA, 1 unit of BioTherm T Taq polymerase (Genecraft)and 0.1 mM of each dNTPs, whereas dTTP was pro-portionally substituted with increasing concentrationsof biotin-11-dUTP: 20% (lane 2), 50% (lane 3), and70% (lane 4). The incorporation of biotin-11-dUTPcorrelates with a size shifting of the amplified product.Note, the decrease of PCR efficiency at a proportion of70% biotin -11-dUTP (lane 4) compared to the lowerconcentrations.

MW 1 2 3 4 MW

16

GC-055-0100 GC-055-0250 GC-055-0500 GC-055-1000100 u 250 u 500 u 1000 u

CATALOG NO.

A 700 bp DNA fragment was internally labeled by PCRmediated incorporation of biotin-11-dUTP (biotin-11-dUTP/dTTP = 1/4, 1/1, and 2.3, respectively; see figu-re 1). The PCR products were diluted to 500 pg, 50 pg,and 5 pg and dot blotted onto nylon membrane. TheDNA was cross linked to the membrane by UV radia-tion and visualized by colorimetric detection by meansof Streptavidin/alkaline phosphatase conjugate incu-bation in the presence of BCIP and XPhosphat for 3hours at 37°C. Signal intensity was strongest at 1/1concentration (50%) of biotin-11-dUTP.

The efficiency of PCR mediated incorporation of biotin-11-dUTP into a DNA fragment of 900 bp was assesedquantitatively and by comparing different Taq polyme-rases using a ratio of biotin-11-dUTP/dTTP of 1/1(amplification conditions as described in figure 1).Lane 1 shows the unincorporated PCR product, lanes2-4 show the biotinylated products using 0.1, 1, and10 ng of starting DNA template and BioTherm T poly-merase (Gencraft), lane 5 and 6 depicts biotinylatedproducts using regular BioTherm polymerase (Gene-craft) and an enzyme from a competitor, respectively.Note, the template dependent increase of PCR productyield, and the high efficiency of both BioTherm poly-merases compared to a competitor’s polymerase.

BioThermT™ DNA POLYMERASE

20% bio-dUTP

50% bio-dUTP

70% bio-dUTP

500pg 50pg 5pg

MW 1 2 3 4 5 6 MW

17

BioThermBio™ DNA POLYMERASE

DESCRIPTIONBioThermBio™ is a novel thermostable DNA polyme-rase that dramatically improves incorporation of Bio-tin- and Digoxigenin-dUTPs as compared to Taq DNApolymerase.

BESCHREIBUNGBioThermBio™ ist eine neue hitzestabile DNA-Poly-merase, welche das Einbringen von Biotin- und Digo-xigenin-dUTPs in DNA grundlegend verbessert.

GC-057-0100 GC-057-0250 GC-057-0500 GC-057-1000100 u 250 u 500 u 1000 u

CATALOG NO.

900 dp

800 dp

700 dp

600 dp

Biotine-11-dUTP labelling of PCR DNA fragment (650bp) by thermophilic DNA polymerases.

Lane 1 Amplification by Taq polymerase, dNTPs200mM each, no Biotine-11-dUTPLane 2 Amplification by Taq polymerase, dATP, dGTP,dCTP 200 mM each, dTTP 130 mM, Biotin-11-dUTP70 mM.Lane 3 Amplification by NEW polymerase BioTherm-Bio, dATP, dGTP, dCTP 200 mM each, dTTP 130 mM,Biotin-11-dUTP 70 mM. Analysis with streptavidin/-alcalic phosphatase conjugates shows that specificincorporation of Biotin-11-dUTP was 20 times higherwith NEW polymerase.

M 1 2 3

18

BioThermStarunits

pre-heating-time

AmpliTaqGold

BioThermStar™ DNA POLYMERASE

DESCRIPTION BioThermStar™ is a thermostable DNA polymerasepurified from the Thermus aquaticus strain in accor-dance with the procedures developed by Kaledin forthe isolation of thermostable enzymes processing DNApolymerase activity from thermophilic bacteria. Bio-ThermStar™ is a modified form of the enzyme desi-gned for Hot-Start-PCR. It is a highly processive 5'-3'DNA polymerase lacking 3'-5'-exonuclease activity.The enzyme is highly purified and is free of nonspeci-fic endo- or exonucleases.

BESCHREIBUNG BioThermStar™ ist eine hitzestabile DNA-Polymerase,welche nach dem Protokoll von Kaledin (1,2,3) - zurReinigung von hitzestabilen Enzymen mit Polymerase-Aktivität aus thermophilen Bakterien - aus Thermusaquaticus isoliert wurde. Diese 5´-3´ DNA-Polymeraseist eine modifizierte Form des Enzyms und für Hot-Start-PCR-Reaktionen entwickelt worden. Sie besitztkeine 3´-5´ Exonuklease-Aktivität. Das Enzym weisteinen sehr hohen Reinheitsgrad auf und enthält daherkeinerlei unspezifische Endo- oder Exonukleasen.

ACTIVATION This polymerase is inactive until incubated 7-10 min at 95°C! These activation conditions areextremely important! The activation completelyprevents nonspecific primer annealing and the forma-tion of primer-dimers during setup.

REACTION TEMPERATUREIt is also very important to pay great attention tothe actual temperature (95°C) inside the tube!

APPLICATION Hot-Start-PCRPCR with high specificity


UNIT DEFINITIONOne unit of activity is the amount of enzyme requiredto incorporate 10 nmoles of dNTP into acid-insolublematerial in 30 min at 72°C.

STORAGE BUFFER10 mM K-phosphate buffer pH 7.0, 100 mM NaCl,0.5 mM EDTA, 1 mM DTT, 0.01% Tween 20,50% glycerol (v/v)


10X REACTION BUFFER160 mM (NH4)2SO4, 670 mM Tris-HCl pH 8.3 (at25°C), 15 mM MgCl2, 0.1% Tween 20The 10x reaction buffer (on request with or withoutMgCl2) is delivered free of charge.Please note the difference between BioTherm™ andBioThermStar™ buffers!

QUALITY CONTROLActivity, SDS-PAGE purity, absence of endonuclea-ses/nickases and exonucleases.

COMPANION PRODUCTSBioThermAB™, MagicTubes™

Comparison of BioThermStar (GeneCraft) with AmpliTaqGold (PE)

BUFFER PHWe strongly recomm-mend to use bufferswith pH 8.3!

19

BioThermStar™ DNA POLYMERASE

BioThermStar IN A TAQMAN ASSAY200 nM dNTP´s500 nM Primer1.25 u BioTherm Star/0.25 µl3 mM MgCl2300 nM passive reference dye (Rox)100 nM TaqMan-probe


CATALOG NO.

APPLICATIONBioThermStarMix™ is suitable and tested for amplifi-cation of genomic targets ranging from l00 bp to 4 kband of episomal targets (lambda phage; plasmids) upto 10 kb under various reaction conditions.

high through-put Hot Start PCRroutine diagnostic Hot Start PCR requiring highreproducibilityDNA sequencing template preparation

STORAGE CONDITIONSBioThermStarMix™ can be stored at either -20°C in afreezer or at 2-8°C in a usual refrigerator. Shipment atambient temperature is possible without reduction ofHot Start PCR performance and activity. Storage at 2-8°C is convenient for easy and time-saving assemblingof the Hot Start PCR assays. Storage of BioThermStar-Mix™ at -20°C is recommended for long-termstorage after the mix has been used once under non-sterile conditions. Multiple freezing and thawing donot affect the performance or activity of the Mix.

At 2-8°C the BioThermStarMix™ is at least stable for12 months, in frozen state for 2 years.

NOTE Do not contaminate the BioThermStarMix™ with pri-mers and template DNA used in individual reactions.

Thaw and mix all components thoroughly, spin downshortly and chill on ice.It is very important to mix the BioThermStarMix™before use to avoid localized concentration!

PROTOCOL 1 Place the Hot Start PCR tubes on ice.2 Prepare first a template/primer mix according to the

volumes given in the table below for different reac-tion volumes. Mix the template/primer mix and chillon ice.

3 Dispense now the corresponding volume ofBioThermStarMix™ (20 µl for a 50 µl reaction) foll-lowed by the template/primer mix into each reactiontube. Close tubes and mix well. Spin down shortly, ifnecessary, and chill the tubes on ice.

4 Start the Hot Start program. Transfer the tubesdirectly from ice into the thermal cycler when thetemperature of the block has reached 95°C. Incuba-te ca. 7 min. at 95°C before cycling.

IMPORTANT NOTEThe stabilizers in the BioThermStarMix™ are potenti-al growth substrates for bacterial contaminations! Ifthe Mix has been opened and used under non-sterileconditions, the residual moiety should be used duringthe next 2 weeks with intermediate storage at 2-8°Cor should be frozen at -20°C for longer storage!

20

BioThermStarMix™

DESCRIPTIONBioThermStarMix™ is a 2.5x concentrated reagentmix for Hot Start PCR comprising BioThermStar™DNA polymerase (0.06 u/µl), 2.5x PCR-Buffer with3.75 mM MgCl2, 500 µM of each dNTP and stabilizers.The 2.5x concentration of the Mix provides high ver-satility for setting-up Hot Start PCR reactions. Up to60% of the final reaction volume can be used for theaddition of primer and template DNA solutions, co-sol-vents or other additives, if necessary.

BESCHREIBUNG BioThermStarMix™ ist ein 2.5x konzentrierter Rea-genzien-Mix für Hot Start PCR-Reaktionen. Der Mixenthält BioThermStar™ DNA-Polymerase (0.06 u/µl),2.5x PCR-Puffer mit 3.75 mM MgCl2, 500 µM vonjedem dNTP und stabilisierende Substanzen. Die 2.5xKonzentration des BioThermStarMix™ermöglichteinen flexiblen Einsatz in den Hot Start PCR-Reaktio-nen. Auf diese Weise kann bis zu 60 % des endgülti-gen Reaktion-Volumens für die Zugabe von Primern,Template-DNA, sowie anderen Reaktionssubstanzengenutzt werden.

21

BioThermStarMix™

GC-041-10001ml

CATALOG NO.

PCR Sterile redi- Sense Antisense Template 2.5x PCRVolume stilled H2O Primer Primer DNA Mix

100 µl up to 60 µl x µl y µl z µl 40 µl50 µl up to 30 µl x µl y µl z µl 20 µl25 µl up to 15 µl x µl y µl z µl 10 µl20 µl up to 12 µl x µl y µl z µl 8 µl

Final concentrations: 200 nM 200 nM 1-100 ng 1x

Other variable reaction conditions (temperatures,cycling times, concentrations of template, primers,magnesium and polymerase) have to be optimizedempirically for each template/primers combination.Most PCR applications work at the standard concen-tration of 1,5 mM Mg2+ provided with 1x diluted PCRMix. Optimal Mg2+ concentration higher than 1,5 mM

can be adjusted using a separate magnesium solutionor by increasing stepwise (5 µl increments) the amountof BioThermStarMix™ added to the reaction assay.This approach can also be used to improve the productyield in amplification of difficult targets on complextemplate DNA (see table below).

Optimization by adding variable amounts of concentrated BioThermStarMix™ to a 50 µl-assay:

Volume of Volume of Final Mg2+ Final dNTP- Taq units Final 2,5x PCR template/ Concen- Concen- per concen-Mix primer mix tration tration reaction trations

20 µl 30 µl 1.5 mM 200 µM 1.25 u 1x25 µl 25 µl 2.0 mM 250 µM 1.6 u 1.25x30 µl 20 µl 2.25 mM 300 µM 1.9 u 1.5x

22

BioThermAB™ DNA POLYMERASE

DESCRIPTION BioThermAB™ polymerase offers all the benefits ofBioTherm™ DNA polymerase plus an antibody-based,built-in hot start. The BioThermAB™ polymerase mixcontains Hot Start Taq Monoclonal Antibody, whichblocks polymerase activity prior to the onset of ther-mal cycling. This prevents primer-dimers and other arti-facts resulting from low-level synthesis from nonspeci-fically primed sites. The antibodies are quickly inactiva-ted by the increased temperature of thermal cycling.BioThermAB™ polymerase requires no prolongedheating or denaturing step as do other hot-startmethods, making BioThermAB™ polymerase moreconvenient and easy to use.

BESCHREIBUNG BioThermAB™ weist neben allen Vorteilen einer Bio-Therm™ DNA-Polymerase die Möglichkeit auf, diesein Hot-Start-PCR-Reaktionen einzusetzen. Zusätzlichenthält dieser BioThermAB™ Polymerase-Mix Hot-Start-Taq monoklonale Antikörper, welche die Polyme-rase-Aktivität vor dem Beginn der PCR-Zyklen blok-kiert. Dies soll Primer-Dimere und andere Artefakteaufgrund unspezifischer low-level Synthesen verhin-dern. Die Antikörper werden dann durch die steigendeTemperatur der PCR-Zyklen rasch inaktiviert.BioThermAB™ Polymerase benötigt keine anhalten-den Heiz- oder Denaturierungsphasen wie in anderenHot-Start Protokollen, was diese Polymerase komfor-tabler und leichter zu Handhaben macht.

APPLICATION Hot-Start-PCRPCR with high specificity


UNIT DEFINITIONOne unit is defined as the amount of enzyme thatincorporates 10 nmoles of dNTPs into acid-insolubleform in 30 min at 72°C.

STORAGE BUFFER10 mM K-phosphate buffer pH 7.0, 100 mM NaCl, 0.5mM EDTA, 1 mM DTT, 0.01% Tween 20;50% glycerol (v/v)


10X REACTION BUFFER160 mM (NH4)2SO4, 670 mM Tris-HCl pH 8.8 (at 25°C),15 mM MgCl2, 0.1% Tween 20The 10x reaction buffer (on request with or withoutMgCl2) is delivered free of charge.

QUALITY CONTROLActivity, SDS-PAGE purity, absence of endonuclea-ses/nickases and exonucleases

COMPANION PRODUCTSBioThermStar™, MagicTubes™


CATALOG NO.

23CLONE8C1

DESCRIPTION The Hot Start Taq Monoclonal Antibodies were derivedfrom a hybridoma (fusion of mouse myeloma cell andthe cells after mouse immunization with Taq DNAPolymerase). Hot Start Taq Monoclonal Antibody ismouse IgG 2b isotype.Hot Start Taq Monoclonal Antibody inhibits polymera-se activity before the onset of thermal cycling, preven-ting nonspecific amplification and primer-dimer forma-tion. When the temperature is raised, the antibody isquickly inactivated and PCR proceeds.Hot Start Taq Monoclonal Antibody is effective with avariety of commercially available Taq DNA polymerases(native or recombinant). The use of Hot Start TaqMonoclonal Antibody significantly improves the speci-ficity of PCR amplification what is especially importantfor PCR-based diagnostics.

HOT START TAQ MONOCLONAL ANTIBODY

REACTION BUFFERThe Hot Start Taq Monoclonal Antibody reaction bufferis the same buffer used for the thermostable DNApolymerase.

PURITY More than 90% in SDS electrophoresis in 15% PAAG.

ASSOCIATE ACTIVITIESNo conversion to the covalently closed circular DNA tothe nicked or linear form was observed after incuba-tion of 1 µg of pUC19 with antibodies in final concen-tration of 6 u/µl in 20 µl of reaction mixture containing25 mM Tris-HCl (pH 7.9), 100 mM NaCl, 10 mM MgCl2after 16 hours at 37°C.

PROTOCOLAdd 5 u (1µl) Hot Start Taq Monoclonal Antibody to100 u enzyme.

APPLICATIONHot Start PCRPCR diagnostics

CONCENTRATION5 units/µl

UNIT DEFINITIONOne unit is defined as the amount of Hot Start TaqMonoclonal Antibody required to block 50% of activityof 1 µg of Taq DNA Polymerase at 37°C.

STORAGE BUFFER10 mM Tris-HCl (pH 7.0 at 22°C), 50 mM KCl,0.1 mM EDTA, 50% glycerol


BESCHREIBUNG Die Hot Start Taq Monoklonalen Antikörper erhält manaus einer murinen, hybriden Zelle (Fusion einer murinen Myelom-Zelle und murinen Zell-len nach Immunisierung der Maus mit Taq DNA-Poly-merase). Die Antikörper haben den Isotyp IgG 2b.Hot Start Taq Monoklonale Antikörper blockieren diePolymerase-Aktivität vor dem Beginn der PCR-Zyklen,was Primer-Dimere und andere Artefakte aufgrundunspezifischer Amplifikationen verhindert. Die Antikör-per werden dann durch die steigende Temperatur derPCR-Zyklen rasch inaktiviert.Die Hot Start Taq Monoklonalen Antikörper funktio-nieren mit einer Reihe von kommerziell erhältlichenTaq-DNA-Polymerasen (nativ oder rekombinant). DieVerwendung dieser Antikörper verbessert signifikantdie Spezifität der DNA-Amplifikation, was speziell inder Diagnostik mit PCR sehr wichtig ist.


CATALOG NO.

24

HOT START PCR COMPOUNDTYPEHSplus

DESCRIPTION Hot Start (HS) PCR is commonly used to enhance thespecificity and sensitivity of PCR amplification. In manycases, HS-PCR has yielded single products in a greateryield than it has been possible with conventional PCR.Usually HS-PCR is inconvenient, time-consuming andincurs a risk of cross contamination. This inconven-iences are overcome by HSplus compound.HSplus is used to block Taq polymerase activity duringset-up of the PCR reaction at ambient temperatures(20-25°C). The inhibition of Taq polymerase is comple-tely reversed when the temperature is raised above48°C.HSplus is effective with a variety of commercially avai-lable Taq DNA polymerases (native or recombinant).The use of HSplus significantly improves the specificityof PCR amplification what is especially important forPCR-based diagnostics.

APPLICATIONHot Start PCRPCR diagnostics

CONCENTRATION1 unit/µl

UNIT DEFINITIONOne unit of activity is the amount of HSplus requiredfor 2 units Taq polymerase per reaction.

STORAGE BUFFER20mM Tris-HCl; pH 8,0; 0,1 mM EDTA


REACTION BUFFERThe HSplus reaction buffer is the same buffer used forthe thermostable DNA polymerase.

QUALITY CONTROLActivity, PAGE purity, absence of any enzyme contam-ination.

IMPOTRANT NOTEDo not use HSplus when the PCR annealing cycletemperature is below 48°C.

PROTOCOLMix 1 unit of HSplus with 2 units of Taq polymerase inthe PCR reaction buffer in presence of all componentswith the exception of the DNA template investigated.Incubate 10 min at room temperature, then add DNAand start PCR. Add in the same manner HSplus in thepositive control reaction.

The concentration of HSplus can be 2-10 timesdecreased in case of absence of its positive action.

BESCHREIBUNGHot Start (HS) PCR wird üblicherweise verwendet, umdie Spezifität und Sensitivität der PCR-Amplifikationzu steigern. In vielen Fällen erhält man mit der HS-PCRdie einzelnen Produkte in einer größeren Ausbeute alses mit einer herkömmlichen PCR möglich ist.Normalerweise ist eine HS-PCR relativ unbequem,zeitintensiv und beinhaltet das Risiko von Kreuz-Kon-taminationen. Diese Nachteile kann man bei Verwen-dung von Hsplus Compound umgehen.HSplus wird verwendet, um die Taq-Polymerase-Akti-vität während des Ansetzens der Reaktion bei Umge-bungstemperaturen von 20-25°C zu blockieren. Wenndie Temperatur dann über 48°C steigt, stellt sich dievolle Aktivität der Polymerase wieder ein.HSplus funktionieren mit einer Reihe von kommerziellerhältlichen Taq-DNA-Polymerasen (nativ oder rekom-binant). Die Verwendung von HSplus verbessert signi-fikant die Spezifität der DNA-Amplifikation, wasspeziell in der Diagnostik mit PCR sehr wichtig ist.


CATALOG NO.

25

KlenTherm™ DNA POLYMERASE

BESCHREIBUNG KlenTherm™ DNA polymerase ist eine thermostabilePolymerase, welche der von W. M. Barnes beschriebe-nen KlenTaq Polymerase entspricht. Bei der Expressiondes Genkonstrukts in E.coli beginnt die Translationerst bei Met236, wodurch die 5’-3’ Exonucleasedomäneam N-Terminus wegfällt. Diese Deletion führt zuerhöhter Genauigkeit und Aktivität. Ausserdem machtsie die Polymerase hitzestabiler.Wiederholtes Erhitzen auf 98°C im entsprechendenReaktionspuffer beeinträchtigt nicht die Aktivität!Selbst nach Erhitzung auf 99°C behält KlenTherm ihreAktivität! Solch eine Hitzebeständigkeit besitzt norma-le Taq Polymerase nicht.Dadurch ist sie auch für die thermale DNA Sequenzie-rung eine hervorragende Alternative zu modifiziertenT7 DNA Polymerasen. Besonders problematische DNATemplates mit Sekundärstrukturen und hohen GC-Gehalten können mit KlenTherm™ DNA Polymerasebei 70°C optimal sequenziert werden.Weiterhin ist die KlenTherm™ DNA Polymerase inKombination mit einer thermostabilen „proof-reading“-DNA Polymerase (AccuTherm™) für dieAmplifikation von besonders langen DNA Fragmentenbis 35 kb geeignet. GeneCraft bietet solche Mischun-gen unter dem Namen Synergy™ an.In bestimmten Applikationen kann KlenTherm™ DNAPolymerase eine optimalere Spezifität als herkömmli-che Taq Polymerasen aufweisen, was zur Minimierungvon unspezifischen DNA-Amplifikationsprodukten bei-tragen kann. Gerade bei kurzen Fragmenten genomi-scher DNA ist KlenTherm™ DNA Polymerase sehr zuempfehlen.KlenTherm™ DNA polymerase ist vergleichbar mit

Taq (USB) und Stoffel fragment (Cetus). Wir emp-fehlen, bei Fragmenten über 500 bp mehr Units vonKlenTherm™ DNA Polymerase einzusetzen als beigewöhnlicher Taq Polymerase. Aus diesem Grund lie-fern wir Ihnen KlenTherm™ DNA polymerase in einerKonzentration von 10 u/µl.KlenTherm™ DNA Polymerase wird mit einem 10xReaktionspuffer (auf Wunsch auch mit MgCl2 als sepa-rater Lösung) ohne Aufpreis geliefert. KlenTherm™zeigt eine sehr niedrige Aktivität 3´-A-Überhängeanzuhängen.

DESCRIPTION KlenTherm™ DNA polymerase is thermostable poly-merase corresponding to the KlenTaq polymerase des-cribed by W. M. Barnes. It is a N-terminally truncatedTaq DNA polymerase. As expressed from a gene con-struct in E.coli, translation initiates at Met236, bypass-sing the 5'-3' exonuclease domain of the DNA poly-merase-encoding gene. This deletion leaves a highlyactive and even more heat-stable DNA polymeraseactivity. Repeated exposure to 98ºC, in the recommen-ded reaction buffer, does not seem to diminish theenzyme activity. Significant activity remains even afterexposure to 99ºC. The full length enzyme does nottolerate these treatments.Therefore KlenTherm™ DNA polymerase is an excell-lent alternative to modified T7 RNA polymerase inthermal sequencing methods. Even problematic DNAtemplates with secondary structures and GC-richregions can be sequenced at 70°C.You can use KlenTherm™ DNA polymerase also forLong-PCR up to 35 kb in combination with thermos-table „proof-reading“ polymerases (e.g. Accu-Therm™). GeneCraft offers several mixtures of Klen-Therm™ DNA polymerase called Synergy™.In special applications KlenTherm™ DNA polymerasehas proven better specificity than regular Taq polyme-rase. This results in minimising of unspecific DNAamplification products.KlenTherm™ DNA polymerase is similar to, yet disi-tinct from, USB Taq and Cetus Stoffel fragment. Youwill need more KlenTherm than Taq protein if thenucleic acid incorporation is more than 500 bp. Klen-Therm™ DNA polymerase is shipped at higher (10u/µl) concentration, so that it can easily incorporate 2kb, if the same quantity is used as for full-length Taq.The use of KlenTherm™ is espacially recomended foramplifications of small fragments from genomic DNA.The 10x reaction buffer (on request with or withoutMgCl2) is delivered free of charge. KlenTherm has avery low 3’-A-Overhang-adding activity.

26

APPLICATIONSFidelity

The relative mutation rate during polymerization istwofold lower for KlenTherm as compared to the full-length Taq DNA polymerase.

Cycle sequencing The absence of the 5'-3' exonuclease activity makesKlenTerm™ especially suitable for cycle sequencing. Itgives higher sequence intensity and very low back-grounds.

Long PCR KlenTherm™ in combination with a Pfu DNA polyme-rase (AccuTherm™) exhibiting a proof-reading activi-ty can amplify up to 35 kb DNA fragments.

Mutation analysisKlenTherm™ has a reduced tendency to extend a mis-matched 3'-oligonucleotide end making it suitable formutation analysis with mutationspecific oligos (ARMSanalysis).


UNIT DEFINITIONOne unit is defined as the amount of enzyme thatincorporates 10 nmoles of dNTPs into acidinsolubleform in 30 min at 72ºC under the assay conditions 25mM TAPS (tris-(hydroxy-methyl)-methyl-amino-propa-nesulfonic acid, sodium salt) pH 9.3 (at 25ºC), 50 mMKCl, 2 mM MgCl2, 1 mM ß-mercaptoethanol) andactivated calf thymus DNA as substrate.

STORAGE BUFFER10 mM K-phosphate buffer pH 7,0; 100 mM NaCl; 0,5mM EDTA; 1 mM DTT; 0,01% Tween 20;50% glycerol (v/v)

STORAGE TEMPERATUREStore KlenTherm™ DNA polymerase below 0°C, pre-ferably at -20°C, in a constant temperature freezer.

10X REACTION BUFFER500 mM KCl, 100 mM Tris-HCl (pH 9 at 25°C), 1%Triton X100, 35 mM MgCl2

1.5 ml 10x reaction buffer Cat. No GC-001-006

Please note the difference between KlenTherm™and BioTherm™ reaction buffers!

COMPANION PRODUCTSKlenThermN™ DNA polymerase, KlenThermase™,KlenThermaseN™, Synergy™ DNA polymerase, Syn-ergyN™ DNA polymerase, SynergyT™ DNA polyme-rase, dNTPs

58ºC 0.5 min72ºC 4 min93ºC 20 sec30 cycles

AMPLIFICATION CONDITIONS

10x reaction buffer 3 µl50 mM MgCl2 2.1 µldNTP Mix10 (end concentration 200 µM) 0.6 µlhuman genomic DNA (300-600 ng) 1 µlforward primer (25 pM) 2 µlreverse primer (25 pM) 2 µlKlenTherm™ (10 units/µl) 0.5 µlH2O 18.8 µl

total 30 µl

Fragment is about 1,5 kb



CATALOG NO.

27

REFERENCES 1 Barnes W.M. 1992. The fidelity of Taq polymerase

catalyzing PCR is improved by an N-terminal dele-tion. Gene 112: 29-35

„PCR conditions efficient enough to allow theamplification of a 5-kb fragment result in less thanhalf as many mutations, when KlenTaq is the DNApolymerase, compared to AmpliTaq.“

2 Barnes W.M. 1994. PCR amplification of up to 35-kbDNA with high fidelity and high yield from bacterio-phage templates. Proc. Natl. Acad. Sci. USA 91:2216-2220„A target length limitation to PCR amplification ofDNA has been idientified and addressed. Concomit-antly, the base-pair fidelity, the ability to use PCRproducts as primers and the maximum yield of tar-get fragment were increased. These improvementswere achieved by the combination of a high level ofan exonuclease-free, N-terminal deletion mutant ofTaq DNA polymerase, Klentaq1, with a very low levelof a thermostable DNA polymerase exhibiting a 3'-exonuclease activity (Pfu, Vent, or Deep Vent). Atleast 35 kb can be amplified to high yields from 1 ngof DNA template.Amplification of DNA spans by the polymerase chainreaction (PCR) has become an important and wides-pread tool of genetic analysis since the introductionof thermostabile Taq (Thermus aquaticus) DNA poly-merase for its catalysis. Two limitations to themethod are the fidelity of the final product and thesize of the product span, that can be amplified. Thefidelity problem has been partially addressed by thereplacement of Taq DNA polymerase by Pfu (Pyro-

coccus furiosus) DNA polymerase, which exhibits anintegral 3'-(editing)-exonuclease, that apparentlyreduces the mutations per base per cycle from about10-4 to about 10-5. It was found, that this enzymeis unable to amplify certain DNA sequences in thesize range of 1.5-2 kb, that Klentaq1 (N-terminaldeletion mutant of Taq DNA polymerase analogousto the Klenow fragment of Escherichia coli DNApolymerase I) or AmpliTaq (fullength Taq DNA poly-merase) can amplify handily, and Pfu is no more able(i.e., is not able) to amplify DNA product spans inexcess of 5-7 kb than is any form of Taq DNA poly-merase. For full-length Taq DNA Polymerase and itsN-terminally truncated variants Klentaq1, Klentaq5and Stoffel fragment, PCR amplification rapidlybecomes inefficient or nonexistent as the length ofthe target span exceeds 5-6 kb. This is true even if30 min (10 times longer than seemingly necessary)is used during the extension step of each cycle. Alt-hough there are several reports of inefficient butdetectable amplification at 9- to 10-kb target lengthand one at 15 kb, most general applications are limi-ted to 5 kb. Apparently something has been blok-king extension to longer lengths.“

3 Newton C.R. et al. 1989. Analysis of any point muta-tion in DNA. The amplification refractory mutationsystem (ARMS). Nucl. Acids. Res. 17:2503-2516.

„The basis of the invention is that unexpectedly, oli-gonucleotides with a mismatched 3'-residue will notfunction as primers in the PCR under appropriateconditions.“

PURITY OF THE KlenTherm™ FRAGMENT AND FULL-LENGTH BioTherm™

3.75

U

7.5U

15U

30U

3.75

U

7.5U

15U

30U

mar

ker

BioTherm™KlenTherm™

Indicated dilutions of the KlenTherm™ and BioTherm™ preparation have been analyzed via 10% SDS-PAGErunning gel and stained with Coomassie Brilliant Blue.


28

KlenThermN™DNA POLYMERASE


UNIT DEFINITIONOne unit is defined as the amount of enzyme thatincorporates 10 nmoles of dNTPs into acid-insolubleform in 30 min at 73ºC under the assay conditions 25mM TAPS (tris-(hydroxy-methyl)-methyl-amino-propa-nesulfonic acid, sodium salt) pH 9.3 (at 25ºC), 50 mMKCl, 3.5 mM MgCl2, 1 mM ß-mercaptoethanol) andactivated salmon sperm DNA as substrate.

STORAGE BUFFER10 mM K-phosphate buffer pH 7.0, 100 mM NaCl,0.5 mM EDTA, 1 mM DTT, 0.01% Tween 20;50% glycerol (v/v)

STORAGE TEMPERATUREStore KlenThermN™ DNA polymerase, preferably at -20°C, in a constant temperature freezer.

DESCRIPTION Substitution of Asn for the conserved Ser543 in thethumb subdomain of the Taq DNA polymerase largefragment (KlenTherm™ DNA polymerase) preventspausing during DNA synthesis and allows the enzymeto overcome template regions with a complex second-ary structure. The mutant enzyme, KlenThermN™ DNApolymerase (patent pending), provides specific PCRamplification and sequencing of difficult templates,e.g. those with a high GC content or complex second-ary structure. Furthermore this substitution increasesseveral times the efficiency of synthesis of long (over 2 kb) DNA molecules. The difference in the DNA syn-thesis efficiencies by the mutant and native enzymesincreases with the increase in the DNA fragmentlength.

BESCHREIBUNG Der Austausch von Asn gegen die konservierte Ser543 inder „Daumen“-Untereinheit des großen Fragmentes(KlenTherm™ DNA Polymerase) der Taq-DNA-Polyme-rase verhindert ein Pausieren während der DNA-Syn-these und erlaubt es dem Enzym Template-Regionenmit einer komplexen Sekundärstruktur zu bewältigen.Das modifizierte Enzym, KlenThermN™ DNA Polyme-rase, zeigt eine spezifische DNA-Amplifikation undsequenziert auch schwierige Templates, besonders sol-che mit einem hohen GC-Gehalt oder komplexenSekundärstrukturen. Außerdem erhöht der Austauschvon Asn gegen Ser543 die Syntheseeffizienz langerDNA-Moleküle (über 2 kb). Je länger das DNA-Frag-ment, desto stärker zeigt sich der Unterschied in derEffizienz der Synthese zwischen dem modifizierten unddem nativen Enzym.

10X REACTION BUFFER500 mM KCl, 100 mM Tris-HCl (pH 9 at 25°C), 1% Tri-ton X100

Please note the difference between KlenTherm™ andBioTherm™ reaction buffers!

Extra solution: 50 mM MgCl2, add MgCl2 to a finalconcentration of 3.5 mM


COMPANION PRODUCTSKlenTherm™ DNA polymerase, Synergy™ DNA poly-merase, SynergyN™ DNA polymerase, dNTPs

REFERENCESIgnatov, K.B., Miroshnikov, A.I., Kramarov, V.M. (1998)FEBS Lett. 425, 249-250. Substitution of Asn forSer543 in the large fragment of Taq DNA polymeraseincreases the efficiency of synthesis of long DNA mole-cules.


CATALOG NO.

29

KlenThermPlatinum™ DNA POLYMERASE

DESCRIPTION KlenThermPlatinum™ DNA polymerase is a modifiedform of KlenTherm™ DNA polymerase, that offersexcellent specificity. It is designed for PCR with difficulttemplates such as GC-rich fragments and microsatell-lites. KlenThermPlatinum™ is particularly well suitedto primer extension of Single Nucleotide Polymor-phism (SNP) markers.

KlenThermPlatinum™ maintains excellent specificityand minimal background even in conditions designedfor high yield (high Mg2+/primer concentrations). Infact, even on genomic templates, the enzyme can beused with MgCl2+ concentrations as high as 10 mM.

KlenThermPlatinum™ has an extrem low signal/noiseratio. In addition, it has an extremely high recognitionof base mis-matches which results in a very low rate ofmis-match extension.

KlenThermPlatinum™ is capable of extending throughdifficult regions, e.g. regions, which include invertedtandem repeats and those with high amounts of sec-ondary structure.

KlenThermPlatinum™ works in a totally unique way,involving improved nucleotide selection at the activesite, and a much lower rate of mis-match extension,meaning that only perfectly aligned primers will beextended. As a result, the enzyme can give even hig-her specificity than hot-start (manual or automatic)techniques without the need for inconvenient pre-incubation steps.

KlenThermPlatinum™ has a very weak terminal trans-ferase activity, and products can be assumed to beblunt-ended. However, this is sequence dependent,and some sequences may be tailed with a singlenucleotide.

BESCHREIBUNG KlenThermPlatinum™ DNA Polymerase ist eine modifi-zierte Form der KlenTherm™ DNA Polymerase, welcheeine exzellente Spezifität zeigt. Diese DNA-Polymeraseist für PCR-Reaktionen mit einem komplizierten Tem-plate, wie z.B. GC-reiche Fragmente und Microsatelli-ten-DNA, entwickelt worden. KlenThermPlatinum™ istbesonders gut für die Primer-Verlängerung von Single-Nucleotide-Polymorphism (SNP) Markern geeignet.

KlenThermPlatinum™ ermöglicht eine exzellente Spei-fität und einen minimalen Hintergrund, sogar bei Reak-tionsbedingungen für eine möglichst große Ausbeute(hohe Mg2+/Primer Konzentrationen). Tatsächlich kanndas Enzym, sogar bei genomischen Templates, beiMgCl2+-Konzentrationen von 10 mM verwendet wer-den.

KlenThermPlatinum™ zeigt ein extrem niedriges Sig-nal/Hintergrund-Verhältnis. Zudem besitzt das Enzymeine extrem hohe Erkennungsrate für „mis-Matches“,woraus eine sehr niedrige Rate für „mis-match“-Ver-längerungen resultiert.

KlenThermPlatinum™ ist auch für komplizierte Regio-nen geeignet, wie z.B. seitenverkehrte Tandem-Wieder-holungen oder Regionen mit einem hohen Anteil anSekundärstrukturen.

KlenThermPlatinum™ arbeitet auf eine einzigartigeWeise, einschließlich einer verbesserten Nukleotid-Aus-wahl im aktiven Zentrum, und zeigt eine deutlich nie-drigere Rate von „mis-match“-Verlängerungen, d.h.nur perfekt gebundene Primer werden auch verlängert.Daraus resultiert eine sogar noch höhere Spezifität alsbei einer Hot-Start-PCR (manuell oder automatisch)abzüglich des Bedarfes für lästige Vor-Inkubationen.

KlenThermPlatinum™ zeigt eine sehr schwache termi-nale Transferase-Aktivität, sodass die Produkte vermut-lich „blunt-ended“ sind. Dies ist jedoch von derSequenz abhängig, und einige können auch mit einemeinzelnen Nukleotid enden.

30

APPLICATIONS PCR requiring high specificityPCR with GC-rich regions or repeats (e.g. microsa-tellites)


UNIT DEFINITIONOne unit is defined as the amount of enzyme, thatincorporates 10 nmoles of dNTP into acid-insolubleform in 30 min at 73°C under the assay conditions (25mM TAPS pH 9.3 at 25°C, 50 mM KCl, 2 mM MgCl2,1 mM ß-mercaptoethanol) and activated calf thymusDNA as substrate.



10X REACTION BUFFER500 mM KCl, 100 mM Tris-HCl (pH 9 at 25°C), 1% Tri-ton X100

Please note the difference between KlenTherm™ andBioTherm™ reaction buffers!


QUALITY CONTROLActivity, non-specific endonucleases/nickases and exo-nucleases.

KlenThermPlatinum™ DNA POLYMERASE


CATALOG NO.

31

APPLICATIONS Fidelity

The relative mutation rate during polymerisation istwofold lower for KlenThermase™as compared to thefull-length Taq DNA polymerase.

Cycle sequencingThe absence of the 5'-3' exonuclease activity makesKlenThermase™ especially suitable for cycle sequen-cing. It gives higher sequence intensity and very lowbackgrounds. The mutational optimization improvesthe uniformity of band intensities. Combination ofKlenThermase™ with Tth inorganic pyrophospatasegenerates uniform bands that improve sequencingaccuracy and give long read lengths.


UNIT DEFINITIONOne unit is defined as the amount of enzyme thatincorporates 10 nmoles of dNTPs into acid-insolubleform in 30 minutes at 72°C under the assay conditions(25 mM TAPS (tris-(hydroxymethyl)-methyl-amino-propanesulfonic acid, sodium salt) pH 9.3 (at 25°C),

KlenThermase™ DNA POLYMERASE

DESCRIPTION KlenThermase™ DNA polymerase is an optimised ver-sion of KlenTherm™ DNA polymerase designed forcycle sequencing with dideoxynucleotides. This enzymeis recommended both for manual DNA sequencingwith 35S label and for automated fluorescent DNAsequencing. Mutations have been introduced into theKlenTherm™ DNA polymerase that confer on thisenzyme enhanced properties for cycle sequencing ofdouble-stranded PCR products. KlenThermase™ issimilar to, yet distinct from, USB ThermoSequenase.We recommend to use KlenThermase™ with our ther-mostable Tth inorganic pyrophosphatase (1 unit of Tthinorganic pyrophosphatase added to 10 units of Klen-Thermase™) for further improvement of uniformity ofband intensities.

BESCHREIBUNG KlenThermase™ DNA Polymerase ist eine optimierteVersion der KlenTherm™ DNA Polymerase und ist fürdie zyklische Sequenzierung mit Dideoxynukleotidenentwickelt worden. Dieses Enzym ist sowohl fürmanuelle DNA-Sequenzierungen mit 35S als auch fürautomatisierte, fluoreszenzmarkierte DNA-Sequenzie-rungen zu empfehlen. In die KlenTherm™ DNA-Poly-merase sind Mutationen eingeführt worden, welchedem Enzym eine verstärkte Wirksamkeit für die zykli-sche Sequenzierung von doppelsträngigen PCR-Pro-dukten verleihen. KlenThermase™ ist ähnlich der USBThermoSequenase, aber dennoch deutlich anders. Wirempfehlen KlenThermase™ mit unserer hitzestabilenTth inorganic Pyrophosphatase zu verwenden ( 1 Unitder Tth inorganic Pyrophosphatase zu 10 Unit Klen-Thermase™ geben), um eine noch gleichmäßigereBandenintensität zu gewährleisten.

50 mM KCI, 2 mM MgCl2, 1 mM ß-mercaptoethanoland activated calf thymus DNA as substrate.

STORAGE BUFFER10 mM K-phosphate buffer pH 7.0, 100 mM NaCI,0.5 mM EDTA, 1 mM DTT, 0.01% Tween 20;50% glycerol (v/v)

STORAGE TEMPERATUREStore KlenThermase™ DNA polymerase below 0°C,preferably at -20°C, in a constant temperature freezer.

10X REACTION BUFFER260 mM Tris-HCl (pH 9.5), 65 mM MgCl2

COMPANION PRODUCTSKlenThermaseN™, KlenTherm™ DNA polymerase,KlenThermNT™DNA polymerase, Tth pyrophosphatase

REFERENCESTabor, S. and Richardson, C.C. I995. A single residuein DNA polymerase of the Escherichia coli DNApolymerase 1 family is critical for distinguishing bet-ween deoxy- and dideoxyribonucleotides. Proc. Natl.Acad. Scf. USA 92: 6339-6343


CATALOG NO.

32

BESCHREIBUNG KlenThermaseN™ DNA Polymerase ist für lange DNA-Sequenzierungen entwickelt worden und eine opti-mierte Version der KlenThermase™. Diese Polymerasebeinhaltet alle Mutationen und Vorteile von KlenTher-mase™ und KlenThermN™ in einem Enzym.

KlenThermaseN™ DNA POLYMERASE

DNA CYCLE SEQUENCING KIT

DESCRIPTION KlenThermaseN™ DNA polymerase is an optimizedversion of KlenThermase™ for long-range DNAsequencing. This polymerase comprises mutations andbenefits of both KlenThermase™ and KlenThermN™in one enzyme.

BESCHREIBUNG Dieses Kit enthält, ausgenommen markierter dNTPs, allenotwendigen Komponenten für 100 Sequenzier-Reak-tionen mit einem doppelsträngigen DNA-Template. DieAnwendung der KlenThermase™ für effektive DNA-Verlängerung gibt die Möglichkeit mit der absolut exak-ten Menge an Template-DNA zu arbeiten. Die vorge-schlagene Sequenzier-Technik kombiniert die Amplifika-tion der DNA mit einer Kettenabschluss-Sequenzier-Reaktion. Die Reaktion sollte in einem handelsüblichenThermocycler für PCR durchgeführt werden. Das Kit ent-hält keine radioaktiv-markierten dNTPs. Alle Arten von32P, 33P oder 35S-dNTPs (2000-8000 Ci/mmol) können fürradioaktive Markierungen verwendet werden.

DESCRIPTION The kit contains all necessary components except labe-led dNTPs for 100 dideoxy chain terminator-sequen-cing reactions on double stranded DNA template.Application of KlenThermase™ for effective DNAelongation provides the possibility to work with theminute amount of template DNA. The suggestedsequencing technique combines amplification DNAwith chain-terminator sequencing reaction. Thesequencing reaction should be performed in thermo-cycling device routinely used for PCR. The kit does notcontain radioactive dNTPs. Any type of 32,33P or 35S-dNTP (2000-8000 Ci/mmol) may be used for radioac-tive labeling.



CATALOG NO.

CONTENTSKlenThermase™5x annealing buffer (260 mM Tris-HCl, pH 9.5) Labeling Nucleotide Mixture (for use with radiola-beled dATP) 1.5 µM dGTP,1.5 µM dCTP, 1.5 µM dTTP (Note: To use labeleddCTP this mixture should contain 1.5 µM each ofdATP, dGTP, dTTP)Termination Nucleotide Mix (one for each dideoxy-nucleotide). Each mixture contains 15 µM dATP, 15µM dGTP, 15 µM dCTP,15 µM dTTP. In addition the„A” mixture contains 0.2 µM ddATP; the „G“ mix0.4 µM ddGTP; the „C“ mix 0.2 µM ddCTP andthe „T“ mix 0.4 µM ddTTP

NOTE For better reading sequence close to primer (30-100nt), use higher dideoxy nucleotides concentrations: the„A“- 1 µM ddATP, the „G“- 2 µM ddGTP, the „C“- 1µM ddCTP and the „T“- 1 µM ddTTP.

Stop solution 95% formamide; 20 mM EDTA;0.05% bromphenol blue; 0.05% xylene cyanol FF

protocol

COMPANION PRODUCTKlenThermase™, KlenThermaseN™, Tth pyrophos-phatase, Acrylamid 4K -Fertiglösungen für denaturie-rende DNA

GC-024-0100100 reactions

CATALOG NO.

33

SEQUENCING REACTION PROTOCOL

ANNEALING TEMPLATE AND PRIMERThe template (3-5 µg of a plasmid), mixed with the pri-mer (10 pmol), is denatured in 0.2 M NaOH, 0.2 mMEDTA (30 min at 37°C). Mixture is neutralized byadding 0.1 volumes of 3 M sodium acetate (pH 4.5-5.5) and the DNA is precipitated with 2-4 volumes ofethanol (-70°C, 15 min). After washing the pelletedDNA with 70% ethanol, it is redissolved in 12 µl ofditilled water and 2 µl of 5x Annealing buffer.

LABELING REACTIONTo the annealed template-primer (14 µl) add the foll-lowing:

Labeling Nucleotide Mix2µl

[α-35S], [α-33P] or [α-32P] 5µCi(typically 0.5µl)

KlenThermase™1 µl (25 units)

Mix thoroughly and incubate for 5 min at 45°C.

TERMINATION REFERENCES 1 Label 4 tubes „G“, „A“, „T“ and „C“. Fill each with

4 µl of the appropriate dideoxy termination mixture.Keep on ice until ready for use.

2 When the labeling reaction is complete, transfer 4 µlof it to the tube labeled „G“. Similarly transfer 4 µlof the labeling reaction to each of the other threetubes („A“, „T“ and „C“). Place the tubes in a70°C bath.

3 After 5-10 min incubation at 70°C, cool to roomtemperature and add 4 µl of Stop Solution to eachtermination reaction, mix and store on ice.

4 To load the gel, heat the samples to 70°C for 5 min(or more) and load 2-3 µl in each lane.

34

APPLICATIONS Enhanced DNA amplification

The addition of Tth inorganic pyrophosphatase greatlyenhances amplification reactions and provides super-ior results. The PCR is inhibited by the presence ofpyrophosphate even at very low concentrations.Thisinhibition may be prevented by introducing Tth pyro-phosphatase, capable of removing contaminatingpyrophosphate, to the reaction mixture. The additionof 1 unit Tth inorganic pyrophosphatase to 10 units ofthermostable DNA polymerase (BioTherm™,SubTherm™ or KlenTherm™) may double the level ofPCR amplification.

Long fragmentsTth inorganic pyrophosphatase enables longer DNAfragments to be processed successfully.

DNA SequencingTth inorganic pyrophosphatase is recommended forhigh-temperature cycle sequencing with thermostableDNA polymerases (BioTherm™or KlenTherm™).

In vitro mutagenesisTth inorganic pyrophosphatase provides increasedfidelity.

Tth INORGANIC PYROPHOSPHATASE (thermostable)

DESCRIPTIONNative, thermostable Tth inorganic pyrophosphatase(pyrophosphate phosphohydrolase: E.C. 3.6.1.1.) ispurified from Thermus thermophilus and is a hydrola-se. Tth inorganic pyrophosphatase catalyses the con-version of inorganic pyrophosphate to orthophospha-te in reactions, where pyrophosphate is accumulated,like DNA synthesis and amplification.Tth inorganicpyrophosphatase provides enhanced polymerisationby removing inhibitive pyrophosphates in reactions.

BESCHREIBUNGTth anorganische Pyrophosphatase (pyrophosphatephosphohydrolase: E.C. 3.6.1.1.) ist aus Thermus ther-mophilus isoliert worden und eine native, hitzestabileHydrolase. Das Enzym katalysiert die Umwandlung vonanorganischem Pyrophosphat in Orthophosphat. Diesempfiehlt sich in Reaktionen, in denen sich Pyrophos-phat ansammelt, wie z.B. DNA-Synthesen und –Ampli-fikationen. Durch Zusatz Tth anorganischer Pyrophos-phatase erhält man aufgrund der Entfernung des inhi-bierenden Pyrophosphates aus den Reaktionen eineverstärkte Polymerisation.


UNIT DEFINITIONOne unit is defined as the amount of enzyme which isrequired to convert 1 µmole of pyrophosphate into 2 µmoles of orthophosphate in one minute at 75ºCunder the following conditions: 1 mM K4P2O7, 2 mMMgCl2, 50 mM Tris-HCl pH 9.0 (at 75ºC).


STORAGE TEMPERATUREStore at -20°C in a constant temperature freezer.

QUALITY CONTROL TESTATP-ase and P-Klen are not detectable.

COMPANION PRODUCTSKlenThermase™, KlenThermaseN™


CATALOG NO.

35SEQUENCE-SPECIFIC PYROPHOSPHOROLYSISCAN RESULT IN SEQUENCING ARTIFACTS. PYRO-PHOSPHATASE CAN PREVENT THIS.

In dideoxy-sequencing DNA synthesis is initiated at aunique priming site and terminated by the incorpora-tion of dideoxynucleoside monophosphates. Tabor andRichardson noted that, under certain conditions, theintensities of some of the bands on resulting sequen-cing gels can be weak. This phenomenon is particular-ly apparent when the reactions are run for 30 minutesor longer and when dITP is used in place of dGTP.These weak bands are the result of pyrophosphoroly-

SEQUENCING AND PYROPHOSPHATASE

sis. This is the reversal of the polymerisation reactioncatalysed by the DNA polymerase wherein DNA andpyrophosphate (PPi) react to form a deoxynucleoside-triphosphate, leaving the DNA chain one base shorter.Pyrophosphorolysis can be prevented using inorganicpyrophosphatase to hydrolyse the pyrophosphate. Thepyrophosphorolysis of terminated chains during DNAsequencing can be summarized as follows:

Pyrophosphatase

ddNTP

ddN

PPi

5’

2Pi

dN5’

All known DNA polymerases catalyse the template-dependent incorporation of a deoxynucleotide ontothe 3' hydroxyl terminus of a primer, with the releaseof inorganic pyrophosphate. Catalysis requires the pre-sence of a bivalent cation, either Mg2+ or Mn2+. Underthe conditions normally used for DNA synthesis (i.e.high dNTP concentrations and low pyrophosphateconcentration), the forward reaction (polymerization)

is greatly favoured over the reverse reaction (pyro-phosphorolysis). Many DNA polymerases also catalysethe hydrolysis of nucleotides from the 3' terminus ofDNA through a seperate exonuclease activity. Thisreaction is unlike pyrophosphorolysis because the sub-strate is H2O and the product is a nucleoside mono-phosphate.

REFERENCES1 Tabor S. and Richardson C. 1987. DNA sequence

analysis with a modified bacteriophage T7 DNApolymerase. Proc. Natl. Acad. Sci. USA 84:4767-4771

2 Tabor S. and Richardson C. 1990. DNA sequenceanalysis with a modified bacteriophage T7 DNApolymerase. Effect of pyrophosphorolysis and metalions. J. Biol. Chem.265:8322-8328

terminated chain extendible chain

36

AccuTherm™ DNA POLYMERASE


UNIT DEFINITIONOne unit is defined as the amount of enzyme thatincorporates 10 nmoles of dNTPs into acid-insolubleform in 30 minutes at 72°C under the assay conditions(25 mM TAPS (tris-(hydroxymethyl)methyl-amino-pro-panesulphonic acid, sodium salt) pH 9.3 (at 25°C),50 mM KCI, 2 mM MgCl2, 1 mM ß-mercaptoethanol)and activated calf thymus DNA as substrate.

STORAGE BUFFER10 mM K-phosphate buffer pH 7.0, 100 mM NaCI,0.5 mM EDTA; 1 mM DTT, 0.01% Tween 20;50% glycerol (v/v)

DESCRIPTION AccuTherm™ is a thermostable enzyme possessing5'-3' DNA polymerase and 3'-5' proof reading exonu-clease activities. It is isolated from the hyperthermo-philic marine archae Pyrococcus furiosis (Pfu). Accu-Therm™ provides extremely high fidelity. Whereas theenzyme is not able to amplify long fragments as effi-ciently as BioTherm™ or KlenTherm™ because of itsvery high exonuclease activity, a mixture of eitherKlenTherm™ or BioTherm™ with AccuTherm™ pro-vides more robust synthesis of longer amplificationproducts (Barnes, 1994. Proc. Natl. Acad. Sci. USA91:2216-2220).

BESCHREIBUNG AccuTherm™ ist ein hitzestabiles Enzym, das eine 5´-3´-DNA-Polymerase- und eine 3´-5´-proof-reading-Exo-nuklease-Aktivität besitzt. Diese Polymerase ist ausdem hyperthermophilen, marinen ArchaebakteriumPyrococcus furiosis (Pfu) isoliert worden. AccuTherm™zeigt eine extrem hohe Genauigkeit. Man muß jedochsagen, dass AccuTherm™ aufgrund seiner sehr hohenExonuklease-Aktivität lange DNA-Fragmente nicht soeffizient amplifiziert wie BioTherm™ oder Klen-Therm™. Die Mischung von entweder BioTherm™oder KlenTherm™ mit AccuTherm™ zeigt jedoch wie-der eine sehr stabile Synthese auch längerer DNA-Fragmente (Barnes, 1994; Proc.Natl.Acad.Sci. USA91:2216-2220).

STORAGE TEMPERATUREStore AccuTherm™ polymerase below 0°C, preferablyat -20°C, in a constant temperature freezer.

5X REACTION BUFFER350 Tris-HCl pH 8,8; 83 mM (NH)4SO4, 100 mM KCl 22 mM MgCl2 0,75% Triton X100

COMPANION PRODUCTSSynergy™ DNA polymerase, SynergyN™ DNA poly-merase


CATALOG NO.

37

40000

35000

30000

25000

20000

15000

10000

5000

0

BioT

herm

Neo

Ther

m

Supr

aThe

rm

Syne

rgy

Syne

rgyN

Syne

rgyT

Acc

uThe

rm

SynergyPlus

SynergyN

Synergy

BioTherm

NeoTherm

SupraTherm

AccuTherm

Acc

urac

y (N

ucle

otid

es)

Comparison of some thermostable DNA polymerases

ACCURACY OF THERMOSTABLE DNA POLYMERASES

PROCESSIVITY OF THERMOSTABLE DNA POLYMERASES ON GENOMIC- AND λ-DNA

0 5 10 15 20 25 30 35

Processivity (kb)genomic DNA

λ DNA

38


UNIT DEFINITIONOne unit is defined as the amount of enzyme thatincorporates 10 nmoles of dNTPs into acid-insoluble form in 30 minutes at 72°C under the assay conditions(25 mM TAPS (tris-(hydroxymethyl)-methyl-amino-propanesulfonic acid, sodium salt) pH 9.3 (at 25°C),50 mM KCI, 2 mM MgCl2, 1 mM ß-mercaptoethanol)and activated calf thymus DNA as substrate.

STORAGE BUFFER10 mM K-phosphate buffer pH 7,0; 100 mM NaCI; 0,5mM EDTA; 1 mM DTT; 0,01% Tween 20;50% glycerol (v/v)

Synergy™ DNA POLYMERASE

DESCRIPTION Synergy is a mix of thermostable components possess-sing 5'-3' DNA polymerase activivity (KlenTherm™)and 3'-5' proof-reading activity (AccuTherm™). Thesecomponents are optimized to achieve amplification of35 kb or 10 kb products from lambda templates orgenomic DNA, respectively. A mixture of KlenTherm™with AccuTherm™ provides more robust synthesis oflonger amplification products (Barnes, 1994. Proc.Natl. Acad. Sci. USA 91:2216-2220).

DESCRIPTION Synergy ist ein Mix hitzestabiler Komponenten, welchereine 5´-3´-DNA-Polymerase-Aktivität (KlenTherm™)und eine 3´-5´-proof-reading-Aktivität (AccuTherm™)beinhaltet. Diese Komponenten sind für die Synthesevon 35 kb oder 10 kb großen Produkten anhand vonLambda-Templates bzw. genomischer DNA optimiertworden. Diese Mischung zeigt eine besonders stabileSynthese längerer Amplifikations-Produkte (Barnes,1994; Proc.Natl.Acad.Sci. USA 91:2216-2220).

STORAGE TEMPERATUREStore Synergy™ DNA polymerase below 0°C, prefer-ably at -20°C, in a constant temperature freezer.

10X REACTION BUFFER160 mM (NH)4SO4, 670 mM Tris-HCl pH 9,1;8 % Glycerol, 2 % DMSO, 35 mM MgCl2

Please note the difference between Synergy™ andBioTherm™ reaction buffers.

COMPANION PRODUCTSSynergyN™ DNA polymerase, AccuTherm™ DNApolymerase.

58°C 30 sec72°C 15 min93°C 30 sec30 cycles

TYPICAL REACTION CONDITIONS

10x Synergy™ reaction buffer 3 µl 10 mM dNTP mix 2 µl DNA template 2 µl primer mix 1 µl Synergy™ DNA polymerase 0.5 µl H2O 21,5µl

Total 30 µl

GC-005-0100 GC-005-0250 GC-005-0500 GC-005-1000 GC-005-5000100 u 250 u 500 u 1.000 u 5.000 u

CATALOG NO.

39


UNIT DEFINITIONOne unit is defined as the amount of enzyme thatincorporates 10 nmoles of dNTPs into acid-insolubleform in 30 minutes at 72°C under the assay conditions(25 mM TAPS (tris-(hydroxymethyl)-methyl-amino-propanesulfonic acid, sodium salt) pH 9.3 (at 25°C),50 mM KCI, 2 mM MgCl2, 1 mM ß-mercaptoethanol)and activated calf thymus DNA as substrate.

STORAGE BUFFER10 mM K-phosphate buffer pH 7.0, 100 mM NaCI, 0.5mM EDTA; 1 mM DTT, 0.01% Tween 20;50% glycerol (v/v)

SynergyN™ DNA POLYMERASE

DESCRIPTION SynergyN™ is a mix of thermostable polymerasespossessing 5'-3' DNA polymerase activity that is opti-mized to amplify longer GC-rich fragments (Klen-ThermN™) and 3'-5' proof-reading activity (Accu-Therm™). These components are optimized to achie-ve amplification of 15 kb products from genomic DNA.A mixture of KlenThermN™ with AccuTherm™ provi-des more robust synthesis of longer GC-rich amplifica-tion products.

BESCHREIBUNG SynergyN™ ist eine Mischung hitzestabiler DNA-Poly-merasen, welche zum einen eine 5´-3´-DNA-Polymera-se-Aktivität beinhaltet (KlenThermN™), die optimiertwurde, um lange, GC-reiche Fragmente zu amplifizie-ren. Zum anderen zeigt SynergyN™ eine 3´-5´-proof-reading-Aktivität (AccuTherm™). Diese Komponentensind optimal um 15 kb große Fragmente anhand geno-mischer DNA zu erhalten. Eine Mischung von Klen-ThermN™ mit AccuTherm™ zeigt außerdem eine sta-bilere Synthese längerer, GC-reicher Fragmente.

STORAGE TEMPERATUREStore SynergyN™ DNA polymerase below 0°C, prefer-ably at -20°C, in a constant temperature freezer.


Please note the difference between SynergyN™ andBioTherm™ reaction buffers.

COMPANION PRODUCTSSynergy™ DNA polymerase, dNTPs


CATALOG NO.

40

SynergyT™ DNA POLYMERASE

APPLICATIONS Low specificity PCR for degenerated primers


UNIT DEFINITIONOne unit is defined as the amount of enzyme thatincorporates 10 nmoles of dNTPs into acid-insoluble form in 30 minutes at 72°C under the assay conditions(25 mM TAPS (tris-(hydroxymethyl)methyl-amino-propanesulphonic acid, sodium salt) pH 9.3 (at 25°C),50 mM KCI, 2 mM MgCl2, 1 mM ß-mercaptoethanol)and activated calf thymus DNA as substrate.


1831 bp

DESCRIPTION Synergy mixture with addition of TthPlus DNA polyme-rase especially suited for low specificity PCR withdegenerated primers.

BESCHREIBUNG Dieses Produkt entspricht Synergy™ mit dem Zusatzeiner TthPlus DNA-Polymerase, welche sich besondersfür PCR-Reaktionen mit niedriger Spezifität und feh-lerhaften Primern eignet.

STORAGE TEMPERATUREStore SynergyT™ DNA polymerase below 0ºC, prefer-ably at -20ºC, in a constant temperature freezer.


Please note the difference between SynergyT™ andBioTherm™ reaction buffers.

QUALITY CONTROLActivity, SDS-PAGE purity, absence of endonucleases/nickases and exonucleases.

REFERENCEBarnes W.M. 1994. PCR amplification of up to 35-kbDNA with high fidelity and high yield from bacterio-phage templates. Proc. Natl. Acad. Sci. USA 91: 2216-2220

COMPARISON OFSynergy™ AND SynergyT™ UNDERSPECIAL REACTIONCONDITIONS Synergy SynergyT

Elektrophorese in 1,5% agarose gel of PCR products obtained by detection of LTR in human locus 7p22.3 and hig-her primates. The presence of LTR in this locus was detected by a PCR product of 1831 bp using either Synergy orSynergyT. As templates were used DNA from human(1), chimpanzee(2), gorilla(3), orang-utan(4) and gibbon(5).

M 1 2 3 4 5 M 1 2 3 4 5


CATALOG NO.

41

APPLICATIONS Very Long and accurate PCR


UNIT DEFINITIONOne unit is defined as the amount of enzyme thatincorporates 10 nmoles of dNTPs into acid-insolubleform in 30 minutes at 72°C under the assay conditions(25 mM TAPS (tris-(hydroxymethyl)methyl-amino-propanesulphonic acid, sodium salt) pH 9.3 (at 25°C),50 mM KCI, 2 mM MgCl2, 1 mM ß-mercaptoethanol)and activated calf thymus DNA as substrate.

10 mM K-phosphate buffer pH 7.0, 100 mM NaCl, 0.5mM EDTA, 1 mM DTT, 0.01% Tween 20;50% glycerol (v/v)

SynergyPlus™ DNA POLYMERASE

DESCRIPTIONTaq-based mixture with addition of pyrophosphatasefor the amplification of long fragments. SynergyPlus™DNA polymerase can amplify up to 20 kb from geno-mic DNA.

BESCHREIBUNGDies ist eine Mischung von Taq-Polymerasen mit demZusatz einer Pyrophosphatase zur Amplifikation langerFragmente. SynergyPlus™ DNA-Polymerase amplifi-ziert bis zu 20 kb lange Fragmente anhand genomi-scher DNA.

STORAGE TEMPERATUREStore SynergyPlus™ DNA polymerase below 0ºC, pre-ferably at -20ºC, in a constant temperature freezer.


Please note the difference between SynergyPlus™and BioTherm™ reaction buffers.

QUALITY CONTROLActivity, SDS-PAGE purity, absence of endonucleases/nickases and exonucleases.

REFERENCEBarnes W.M. 1994. PCR amplification of up to 35-kbDNA with high fidelity and high yield from bacterio-phage templates. Proc. Natl. Acad. Sci. USA 91: 2216-2220


CATALOG NO.

42

TthPlus™ DNA POLYMERASE

FEATURES thermostableDNA polymerase activity in the presence of MgCl2reverse transcriptase activity in the presence ofMnCl2reverse transcription at elevated temperature mini-mising secondary structure problems


STORAGE BUFFER10 mM K-phosphate buffer pH 7.0 (25°C), 100 mMNaCl, 0.5 mM EDTA, 1 mM DTT, 50% glycerol (v/v),0,1 mg/ml BSA

DESCRIPTION TthPlus™ DNA polymerase is isolated from the Ther-mus thermophilus strain. TthPlus™ DNA polymerase isa single 92 kDa polypeptide showing a 5'-3' exonu-clease activity but lacking 3'-5' exonuclease activity. Itcatalyzes the polymerization of nucleotides into dou-ble-stranded DNA in the presence of MgCl2. Its effici-ancy has been shown more particularly on large DNAfragments up to 12 kb (using lambda phage DNA as atemplate). TthPlus™ DNA polymerase is also capableof catalyzing the polymerization of DNA using a RNAtemplate in the presence of MnCl2. The ability ofTthPlus™ DNA polymerase to reverse transcribe atelevated temperatures (70°C) minimizes the problemsencountered with strong secondary structures in RNAsince they are unstable at higher reaction temperatu-res. Higher temperatures also result in increased spe-cificy of primer hybridization and extension. In coupledRT/PCR assays, TthPlus™ is about 50-100 times moreefficient than Taq DNA polymerase.TthPlus™ DNA polymerase is delivered with 10x RT-buffer, 5x amplification-buffer and separate MnCl2(25 mM) and MgCl2 (50 mM) solutions. The 5x ampli-fication-buffer contains EGTA, which binds/neutalizesMn2+ from the RT-reaction. Therefore after RT it is notnecessary to change the buffers. For subsequentamplification we recommend to use BioTherm™ orKlenTherm™ DNA polymerase.

BESCHREIBUNG TthPlus™ DNA-Polymerase ist aus dem Stamm Ther-mus thermophilus isoliert worden. TthPlus™ ist ein ein-zelnes 92 kDa großes Polypeptid mit einer 5´-3´-Exonu-klease-Aktivität, jedoch ohne eine 3´-5´-Exonuklease-Aktivität. Das Enzym katalysiert die Polymerisation vonNukleotiden in doppelsträngige DNA in Anwesenheitvon MgCl2. Die Effizienz dieser Polymerase zeigt sich ins-besondere bei langen DNA-Fragmenten bis zu 12 kb (unter Verwendung einer Lambda-Phagen-DNA als Tem-plate).TthPlus™ DNA-Polymerase ist ebenso dazu geeignet diePolymerisation von DNA mit Hilfe eines RNA-Templatesin Anwesenheit von MnCl2 zu katalysieren. Die Fähigkeitder TthPlus™ auch bei höheren Temperaturen (70°C)ihre Reverse Transkriptase-Aktivität zu behalten, mini-miert die Probleme mit ausgeprägten Sekundärstruktu-ren in RNA-Molekülen, da diese bei diesen hohen Tem-peraturen nicht stabil sind. Höhere Temperaturen erhö-hen außerdem noch die Spezifität der Primerbindungund -verlängerung. In gekoppelten RT-PCR-Reaktionenist die TthPlusT™ zudem ungefähr 50-100 mal effizien-ter als eine Taq-Polymerase.TthPlus™ DNA-Polymerase wird mit 10x RT-Puffer, 5xAmplifikations-Puffer und separatem MnCl2 (25 mM)und MgCl2 (50 mM) geliefert. Der 5x Amplifikations-Puffer enthält EGTA, welches Mn2+ aus der RT-Reaktionbindet und damit neutralisiert. Daher ist es nach der RT-Reaktion nicht nötig den Puffer zu wechseln. Für nach-folgende Amplifikationen empfehlen wir BioTherm™oder KlenTherm™ DNA-Polymerase.

UNIT DEFINITIONOne unit is defined as the amount of enzyme thatincorporates 10 nmoles of dNTPs into acid-insolubleform in 30 minutes at 72°C under the following reac-tion conditions: 25 mM TAPS buffer (Tris-(hydroxyme-thyl)-methyl-amino-propanesulfonic acid, sodium salt)pH 9.3 (25°C), 50 mM KCl, 2 mM MgCl2, 1 mM ß-mercaptoethanol, 200 µM dNTPs and 10 µg of calfthymus DNA in a final reaction volume of 50 µl.

STORAGE TEMPERATUREStore TthPlusTM DNA polymerase, preferably at -20°C,in a constant temperature freezer.

43

10x RT BUFFER670 mM Tris-HCl pH 8.8 (25°C), 166 mM (NH4)2SO4,0.1% Tween 20

VARIOUS CONDITIONS FOR RT-PCRTwo different buffer systems can be used for RT-PCRwith TthPlus DNA polymerase. The first system for TthDNA polymerase consists of 4 buffers: 1. reverse trans-cription (RT) buffer, 2. PCR (amplification buffer), 3.MnCl2, (supplement for RT buffer) 4. MgCl2 (supple-ment for PCR buffer). The reaction has to be carriedout in two steps: RT and PCR in two different vials. Thesecond buffer system is a so-called one-tube buffer(10x) for one-step RT-PCR. Both reactions (RT andPCR) are carried out in the same buffer and the samevial. The one tube buffer does not contain Mn(OAc).Mn(OAc) is provided extra and have to be added tothe one-tube buffer before the experiment. The proto-col to use our TthPlus DNA polymerase is described inone-tube buffer below (buffer and polymerase con-centrations and cycle conditiones). It was worked outfor real-time RT-PCR by our customer RoboscreenGmbH.

5x AMPLIFICATION BUFFER335 mM Tris-HCl pH 8.8 (25°C), 83 mM (NH4)2SO4,3.75 mM EGTA, 25% glycerol (v/v), 0.1% Tween 20

EXTRA SOLUTIONS25 mM MnCl250 mM MgCl2

The optimal experimental conditions depend on thesystem used and they should be individually determi-ned. The Mg2+ or Mn2+ concentrations and the enzymeamount are the limiting factors for an accurate result.Traditionally 5 units of enzyme and a MnCl2 concen-tration of 1 mM are used for the reverse transcriptionin a final 50 µl reaction volume. For the amplificationMgCl2 concentration of 1.5 mM are used for a finalreaction volume of 50 µl.

10X ONE-TUBE BUFFER500 mM bicine-KOH pH 8,3; 1 M KOAc pH 7,5 30% glycerol (v/v);

EXTRA SOLUTION50 mM Mn(OAc)2

COMPANION PRODUCTSGeneScript™ reverse transcriptase, BioTherm™ DNApolymerase, KlenTherm™ DNA Polymerase, dNTPs

REFERENCES 1 Ruttiman C. Cotara S.M., Zaldivar J. and Vicuna R.

(1985) DNA polymerase from the extremlythermophylic bacterium Thermus thermophilus HB-8. Eur. J. Biochemistry, 149, 41-46

2 Myers T.W. and Gelfand D.H. (1991)Reverse trans-cription and DNA amplification by a Thermusthermo-philus DNA polymerase. Biochemistry, 30,7661-7666

TthPlus™ DNA POLYMERASE


CATALOG NO.

44

1100 bp

A

B

M W 1 2 3 4 5 6 7 W B

MW 1 2 3 4 5 6 7 8 9 WB

Comparison of sensitivity of RT-PCR withTthPlus™ DNA polymerase and MMLV-RT

A) MMLV-RT 100 u/µl,Taq-pol. 5 u/µl

B) TthPlus 5 u/µl

MW - molecular weight marker (λ PstI)

1 - MMLV RT (100 u), RNA 1 µg 5 - TthPlus™ (5 u), RNA 10-2 µg2 - MMLV RT + HS 21-9, RNA 1 µg 6 - TthPlus™ (5 u), RNA 10-3 µg3 - TthPlus™ (5 u), RNA 1 µg 7 - TthPlus™ (5 u), RNA 10-4 µg4 - TthPlus™ (5 u), RNA 10-1 µg WB - water blank

Comparison of RT-PCR with TthPlus™ DNA polymerase and MMLV-RT in 16S-rRNA system

MW - molecular weight markers (530 bp)

1 - RNA 1 µg 6 - RNA 10-5 µg2 - RNA 10-1 µg 7 - RNA 10-6 µg3 - RNA 10-2 µg 8 - RNA 10-7 µg4 - RNA 10-3 µg 9 - RNA 10-8 µg5 - RNA 10-4 µg WB - water blank

45EXPERIMENTAL PROTOCOLMaterial

HCV Control cRNA (10,000,000;1,000,000; 100,000; 10,000; 1,000;100; 50; and 10 molecules per 8-well Control strip [8 tubes/strip or0.1 ml tubes, respectively]), Lot 008 rTth DNA Polymerase, 2.5 U/µl (App-lied Biosystems; supplier ABI) plus:5x EZ-buffer (Roboscreen) Mn-acetate-solution, 25 mM (Robo-screen) TthPlus DNA Polymerase, 5 U/µl(supplier Genecraft) plus:10x One-Tube RT-PCR-buffer (supplier Genecraft) Mn-acetate-solution, 50 mM (supplier Genecraft)

InstrumentsABI PRISM 7000 Sequence DetectionSystem (Applied Biosystems) Rotor-Gene 2000 (Corbett Research)

Quantification of HCV Control RNA using twodifferent Tth DNA Polymerases

Reaction component Final concentration (25 µl-Assay)

10x/5x buffer 1x Mn-acetate solution 3.5 mM Nucleotide mix 0.3 mM dATP, dCTP and dGTP,

0.6 mM dUTP Forward and reverse primer 7.5 pmol each TaqMan® probe (FAM/TAMRA) 3.4 pmol Tth DNA Polymerase 1.5 U

REACTION CONDITIONS (BOTH INSTRUMENTS)

CYCLER PROGRAM

Rotor-Gene RT Hold Cycle Hold

Temperature (°C) 59 95 95 59 25Time (min:s) Cycles 60 10:00 00:15 01:00 ∞

45

7000 SDS RT Hold Cycle Hold

shut off “9600 emulation” (window “instrument”) Temperature (°C) 59 95 95 59 25Time (min:s) Cycles 60 10:00 00:30 01:30 ∞

40

RESULTSSaturation curves

Enzyme

rTth DNA Polymerase(Applied Biosystems,supplier ABI); instru-ment: 7000SDS

46


Enzyme

rTth DNA Polymerase(Applied Biosystems,supplier ABI); instru-ment: Rotor-Gene

Enzyme

TthPlus DNA Polymerase(supplier Genecraft);instrument: Rotor-Gene

Enzyme

TthPlus DNA Polymerase(supplier Genecraft);instrument: 7000SDS

47


SUMMARY The use of the TthPlus DNA Polymerase (supplierGenecraft) improved the sensitivity of the HCV RNAquantification significantly.

REFERENCE CURVES

Instrument 7000SDS RG, 0,1 ml Enzyme supplier ABI supplier GC supplier ABI supplier GC

16.10.2002 17.10.2002 16.10.2002 17.10.2002Tube No. Molecules 161002_HCV_1 171002_HCV_1 161002_HCV_2RG 171002_HCV_2RG

per tube 1 10.000.000 17,55 15,04 16,83 14,762 1.000.000 21,08 18,85 20,43 17,773 100.000 24,16 22,48 23,94 21,944 10.000 27,56 25,35 27,27 25,495 1.000 29,77 28,97 30,61 29,296 100 34,34 32,59 33,72 32,527 50 34,4 33,05 34,52 33,078 10 38,31 35,89 37,21 36,15

Molecules reference RNA per assay

48


UNIT DEFINITIONOne unit is the amount of enzyme required to incor-porate 1 nmol of dTTP into an acid insoluble form in10 minutes at 37ºC using poly(rA)-oligo(dt) 10-20 astemplate primer.

STORAGE BUFFER50 mM Tris-HCl pH 8.3, 1 mM EDTA, 0.1 mM DTT, 0.1mM NaCI, 0.1% Triton X-100, 50% glycerol

5X REACTION BUFFER250 mM Tris-HCI pH 8.3, 15 mM MgCl2, 400 mM KClAdd to buffer: dNTPs (end concentration 2 mM),MnCl2 (end concentration 2-4 mM) and DTT (end con-centration 10 mM). Incubate at 37ºC.

EXTRA SOLUTIONS25 mM MnCl2 100 mM DTT

UNIT ASSAY CONDITIONS20 mM Tris-HCI pH 8.0, 2 mM MnCl2, 100 mM KCl, 1mM DTT, 0.6 mM poly rA, 0.1 mM poly(dT)10-20;0.5 mM dTTP(3H) - 0.5-5 units of enzyme

GeneScript™ REVERSE TRANSCRIPTASE

SOURCEE.coli strain that carries a plasmid with the cloned andmodified M-MuLVRT gene with deleted RNAseHcoding part.

DESCRIPTION Moloney Murine Leukemia Virus (M-MuLV) reversetranscriptase is a RNA-dependent DNA polymerase.This enzyme can synthesize a complementary DNAstrand initiating from a primer using either single-stranded RNA or DNA template. The enzyme lacksRNaseH activity.

BESCHREIBUNG Moloney Murine Leukemia Virus (M-MuLV) ReverseTranskriptase ist eine RNA-abhängige DNA-Polymera-se. Das Enzym synthetisiert einen komplementärenDNA-Strang ausgehend von einem Primer, der entwe-der einzelsträngige RNA oder DNA als Templatebenutzt. Das Enzym besitzt keine RNaseH-Aktivität.

QUALITY ASSURANCEGeneScript™ reverse transcriptase is tested for itsability to synthesize full length cDNA from 4kb RNA.

RT-PCR using GeneScript™ reverse transcriptase

PROTOCOLSet up a 20 µl reaction mixture as follows:total RNA 2-5 µg; RT-buffer; primer; 1 mM each dNTP;optional: 1 U/µl RNasin

incubate at 70°C for 2 min, chill to 23°C to annealprimer to RNAadd 200 units GeneScript™ and incubate 10 minat 23°C followed by 30 min at 42°Coptional: incubate with RNaseHheat the reaction at 95°C for 5 min and chill on ice

Store the RT-reaction by -20°C and use 2 µl for subse-quent PCR.

The addition of 2 mM MnCl2 in the 1x RT buffer isoptional.


CATALOG NO.

49

APPLICATION Any application where eukaryotic RNase contamina-tion is a potential problem

RNA transcriptionIn vitro RNA translationcDNA synthesisDNA and RNA sequencingRT-PCR


UNIT DEFINITIONOne unit inhibits 5 ng of RNase A by 50% using cyti-dine 2',3'-cyclic monophosphate (cCMP) as a substrat.

RNase-Inhibitor

DESCRIPTION Native RNase-Inhibitor from human placenta exerts itsinhibitory effect by binding non-covalently to RNasesin a 1:1 ratio with an association constant of 1014. Itis a protein with molecular weight of 51 kDa and inhi-bits common eukaryotic RNases including RNase A,RNase B, RNase C.It does not inhibit RNase H, S1 Nuclease, SP6, T7 or T3RNA polymerase, AMV or M-MLV Reverse Transcripta-se, Taq DNA polymerase and RNase T1.The enzyme is active over a broad pH range between5 and 8, with a maximum activity at pH 7-8.

BESCHREIBUNG Dieser native RNase-Inhibitor aus der menschlichenPlazenta übt seinen hemmenden Effekt aus, indem erin einem 1:1 Verhältnis und einer Asoziations-Kon-stante von 1014 eine nicht-kovalente Bindung zuRNasen ausbildet. Das Protein besitzt ein Molekular-gewicht von 51 kDa und inhibiert alle herkömmlicheneukaryotischen RNasen einschließlich RNaseA, RNa-seB, RNaseC.Allerdings hemmt es folgende Enzyme nicht: RNaseH,S1 Nuklease, SP6, T7 oder T3 RNA- Polymerase, AMVoder M-MLV Reverse Transkriptase, Taq-DNA-Polyme-rase und RNase T1.Dieser RNase-Inhibitor behält seine Aktivität übereinen weiten pH-Bereich, der zwischen 5 und 8 liegt,mit einer maximalen Aktivität bei pH 7-8.

STORAGE BUFFER20 mM Hepes-KOH, 50 mM KCl, 8 mM DTT, 50% gly-cerol



REFERENCEBlackburn, P. (1979) J. Biol. Chem. 254:12484


CATALOG NO.

50


UNIT DEFINITIONOne unit is the amount of enzyme that incorporates10 nmoles of deoxynucleotides into acid-insolubleform in 30 minutes at 37ºC.

STORAGE BUFFER20 mM Tris-HCl pH 7.5, 100 mM NaCl, 0.1 mM EDTA,2 mM DTT, 0.1 mg/ml BSA; 50% glycerol (v/v)

KLENOW FRAGMENT

DESCRIPTION Klenow fragment is a DNA-dependent polymerasewith 3'-5' exonuclease activity. It lacks 5'-3' exonucle-ase activity of the native enzyme and is suited for ran-dom-primed labelling of DNA with randomoligonucleotides and for filling-in of 5' protrudingends to blunt-ends.

BESCHREIBUNG Klenow Fragment ist eine DNA-abhängige Polymerasemit einer 3´-5´-Exonuklease-Aktivität.Dem nativen Enzym fehlt eine 5´-3´-Exonuklease-Akti-vität und ist für Amplifikationen mit willkürlichgewähltem Primer und Oligonukleotiden, sowie fürdas Auffüllen von hervorstehenden 5´-Enden zu„Blunt-Ends“ geeignet.

STORAGE TEMPERATUREStore Klenow Enzyme below 0ºC, preferably at -20ºC,in a constant temperature freezer.

10X REACTION BUFFER100 mM Tris-HCl pH 7.5, 100 mM MgCl2, 10 mM DTE(= buffer L for restriction endonucleases!)

COMPANION PRODUCTST4 DNA Ligase, dNTP

GC-009-0100 GC-009-0250 GC-009-0500 GC-009-1000 GC-009-5000100u 250 u 500 u 1000 u 5000 u

CATALOG NO.

51


UNIT DEFINITIONOne unit is the amount of enzyme that incorporates 1nmol of acid-insoluble 32P in 30 minutes at 37ºC.

STORAGE BUFFER10 mM K-phosphate buffer pH 7.0; 100 mM NaCl; 0.5mM EDTA; 1 mM DTT; 0.01% Tween 20;50% glycerol (v/v)

T4 POLYNUCLEOTIDE KINASE

DESCRIPTION Isolated from a recombinant E. coli strain this enzymecatalyzes the transfer of the terminal phosphate groupof ATP to 5'-OH ends of DNA. T4 polynucleotide kina-se is suited for labelling of 5'-OH ends of DNA with γ32P-ATP.

BESCHREIBUNG Dieses aus einem rekombinanten E. coli-Stamm iso-lierte Enzym katalysiert den Transfer der terminalenPhosphat-Gruppe von ATP an das 5´-OH-Ende derDNA. Die T4 Polynukleotid-Kinase ist ebenfalls dazugeeignet an das 5´-OH-Ende der DNA γ32P-ATP anzu-hängen

STORAGE TEMPERATUREStore T4 polynucleotide kinase below 0ºC, preferablyat -20ºC, in a constant temperature freezer.

5X REACTION BUFFER350 mM Tris-HCl pH 7,6; 50 mM MgCl2; 25 mM DTT


CATALOG NO.

52

T4 DNA LIGASE

CONCENTRATION 10 Weiss units/µl

UNIT DEFINITIONOne unit (Weiss unit) is the amount of enzyme thatcatalyses the conversation of one nanomol 32P-ATP in 20 minutes at 37ºC. 1 ligation unit = 0,015 Weissunit.

STORAGE BUFFER20 mM Tris-HCI buffer pH 7.5; 100 mM NaCI; 0.1 mMEDTA; 2 mM DTT; 0.1 mg/ml BSA; 50% glycerol (v/v)

efficiency of T4 DNA ligase

DESCRIPTION T4 DNA ligase is isolated from a recombinant E. colistrain and is suitable for ligation of sticky- and bluntended DNA fragments.

BESCHREIBUNG T4 DNA-Ligase ist aus einem rekombinanten E. coliStamm isoliert worden und für die Ligation von DNA-Fragmenten mit sowohl sticky- als auch blunt-endsgeeignet.

STORAGE TEMPERATUREStore T4 DNA ligase below 0ºC, preferably at -20ºC, ina constant temperature freezer.

10X REACTION BUFFER660 mM Tris-HCI pH 7.5; 50 mM MgCI2; 10 mM DTE;10 mM ATP

REACTION CONDITIONoptimal ligation occurs at 15ºC

lane 1: λ DNA BstEII marker

lane 2: 2 Weiss units of ligase

lane 3: 0.2 Weiss units of ligase

lane 4: 0.02 Weiss units of ligase

lane 5: no ligase added

lane 6: λ DNA BstEII marker

0.8 µg of pBS digested with Hind III were incubatedovernight at +15ºC with indicated amounts of ligase.

1 2 3 4 5 6


CATALOG NO.

53

APPLICATION LCRDNA ligation


UNIT DEFINITIONOne unit is defined as the amount of the enzymerequired to give 50% (cohesive end unit) ligation ofthe 12-base pair cohesive ends of 1 µg of BstE II-dige-sted λ−DNA in 15 minutes at 45°C in a total reactionvolume of 50 µl. One cohesive end ligation unit equals0,015 Weiss units.

STORAGE BUFFER10 mM Tris-HCl pH 7.5; 50 mM KCl; 0.1 mM EDTA; 1mM DTT; 0.2% Triton X-100; 50% glycerol

Tth DNA LIGASE

DESCRIPTION Thermus thermophilus DNA ligase (recombinant formof the enzyme; cloned from strain HB27) catalyses theformation of a phosphodiester bond between the 5`-phosphate and 3`-hydroxil groups of adjacentnucleotides which are hybridized to a complementarytarget DNA.The ligation will occur only if the oligonucleotides areperfectly paired to the complementary target DNA andhave no gaps between them. There fore, a single-basesubstitution can be detected.

BESCHREIBUNG Thermus thermophilus DNA Ligase (rekombinanteForm des Enzyms; kloniert aus dem Stamm HB27)katalysiert die Bildung von Phosphodiester-Bindungenzwischen dem 5´-Phosphat-Ende und der 3´-Hydroxil-Gruppe benachbarter Nukleotide, welche mit einemkomplementären Strang der Ziel-DNA hybridisieren.Die Ligation kann jedoch nur erfolgreich sein, wenndie Oligonukleotide vollkommen an den komplemen-tären DNA-Strang gebunden sind und keine Lückenzwischen den Nukleotiden bestehen. Auf diese Weisekann der Austausch einzelner Basen ermittelt werden.


10X REACTION BUFFER200 mM Tris-HCl pH 7.6; 250 mM KCl; 100 mMMgCl2, 100 mM DTT; 10 mM NAD, 1% Triton X-100

Optimal ligation occurs at 45°C.

QUALITY CONTROLActivity, SDS-PAGE purity, absence of RNases, ssDNa-ses, endonucleases and phosphatases.


CATALOG NO.

54CONCENTRATION 60 units/µl

UNIT DEFINITIONOne unit is the amount of enzyme that incorporates 1 nmol of labelled nucleoside triphosphates into acid-precipitable RNA in 60 minutes at 37ºC.

STORAGE BUFFER20 mM Tris-HCl pH 7.5; 100 mM NaCl; 0,1 mM EDTA;2 mM DTT; 0,1 mg/ml BSA; 50% glycerol (v/v)

DESCRIPTION Isolated from a recombinant E. coli strain this DNA-dependent RNA polymerase is strictly specific for itspromoter. It is used to transcribe RNA from DNA tem-plates, cloned into vectors containing SP6 promoter.

BESCHREIBUNG Diese DNA-abhängige RNA-Polymerase ist aus einemrekombinanten E. coli Stamm isoliert worden undabsolut spezifisch für den eigenen Promoter. DasEnzym wird verwendet, um RNA von DNA-Templateszu transkribieren, welche in Vektoren kloniert wurden,die den SP6-Promoter enthalten.


UNIT DEFINITIONOne unit is the amount of enzyme that incorporates 1 nmol of labelled nucleoside triphosphates into acid-precipitable RNA in 60 minutes at 37ºC.

STORAGE BUFFER20 mM Tris-HCl pH 7.5; 100 mM NaCl; 0,1 mM EDTA;2 mM DTT; 0,1 mg/ml BSA; 50% glycerol (v/v)

DESCRIPTION Isolated from a recombinant E. coli strain this DNA-dependent RNA polymerase is strictly specific for itspromoter. It is used to transcribe RNA from DNA tem-plates, cloned into vectors containing T7 promoter.


CATALOG NO.

T7 RNA POLYMERASE


CATALOG NO.

STORAGE TEMPERATUREStore SP6 RNA polymerase below 0ºC, preferably at -20ºC, in a constant temperature freezer.

5X REACTION BUFFER200 mM Tris-HCl pH 7.9; 30 mM MgCl2; 50 mM DTT

SP6 RNA POLYMERASE

STORAGE TEMPERATUREStore T7 RNA polymerase below 0ºC, preferably at -20ºC, in a constant temperature freezer.

5X REACTION BUFFER200 mM Tris-HCl pH 7.9; 30 mM MgCl2; 50 mM DTT

BESCHREIBUNG Diese DNA-abhängige RNA-Polymerase ist aus einemrekombinanten E. coli Stamm isoliert worden undabsolut spezifisch für den eigenen Promoter. DasEnzym wird verwendet, um RNA von DNA-Templateszu transkribieren, welche in Vektoren kloniert wurden,die den T7-Promoter enthalten.

55DESCRIPTION GeneCraft offers most restriction enzymes from pBSpolylinker. Reaction buffers are supplied together withenzymes free of charge.

BESCHREIBUNG GeneCraft bietet die meisten Restriktionsenzyme despBS polylinker an. Die jeweiligen Reaktions-Pufferwerden zu den Enzymen kostenlos mitgeliefert.

RESTRICTION ENDONUCLEASES

A B L M H

Tris-Acetat 330 mM – – – –

Tris-HCl – 100 mM 100 mM 100 mM 100 mM

pH at 37°C 7.9 8.0 7.5 7.5 7.5

Mg-(Acetat)2 100 mM – – – –

MgCl2 – 50 mM 100 mM 100 mM 100 mM

K-Acetat 660 mM – – – –

NaCl – 1 M – 500 mM 1 M

Dithioerythriol (DTE) – – 10 mM 10 mM 10 mM

Dithiothreitol (DTT) 5 mM 10 mM – – –

ß-Mercaptoethanol – 10 mM – – –

UNIT DEFINITION & CONCENTRATIONOne unit of the enzyme is the amount required tohydrolyze 1 µg of DNA in 1 hour in a total reactionvolume of 50 µl. Most restriction enzymes are normall-ly delivered at the concentration of 20 units/µl.

STORAGE BUFFER20 mM Tris-HCI pH 7.5; 100 mM NaCI; 0.1 mM EDTA;2 mM DTT; 0.1 mg/ml BSA; 50% glycerol (v/v)

STORAGE TEMPERATUREStore restriction enzymes below 0°C, preferably at -20°C, in a constant temperature freezer.

56

GeneCraft Schnittmuster activity [%] in buffer optimal heat in-Cat. No. restriction 5’ —-> 3’ reaction activable

enzyme 3’ —-> 5’ A B L M H temp. 20’ at

GC-RE-017 Acs I R/AATTY 0 - 25 100 25 - 50 50 - 75 50 - 75 50°CYTTAA/R

GC-RE-001 Alu I AC/GT 100 50 - 75 25 - 50 25 - 50 0 - 10 37°C 65°CAC/GT

GC-RE-018 Apa I GGGCC/C 100 10 - 25 50 - 75 50 - 75 0 - 10 30°C 65°CC/CCGGG

GC-RE-043 AspLE I GCG/C 25 - 50 50 - 75 0 - 25 75 - 100 100 37°C 65°CC/GCG

GC-RE-044 AsuNH I G/CTAGC 75 - 100 0 - 10 100 50 - 75 0 - 10 37°C 65°CGCTAG/C

GC-RE-002 Bam H I G/GATCC 100 100 75 - 100 100 25 - 50 37°C 80°CCCTAG/G

GC-RE-003 Bgl I GCCNNNN/NGGC 25 - 50 50 - 75 10 - 25 25 - 50 100 37°C 65°CCGGN/NNNNCCG

GC-RE-057 Bgl II A/GATCT 100 100 25 - 50 100 100 37°C 80°C - NOTCTAG/A

GC-RE-056 Bsc4 I CCNNNNN/NNGG 100 55°CGGNN/NNNNNCC

GC-RE-039 Bse21 I CC/TNAGG 100 37°CGGANT/CC

GC-RE-019 Bsp19 I C/CATGG 0 - 10 100 0 - 10 25 - 50 100 37°C 65°CGGTAC/C

GC-RE-048 BstH2 I RGCGC/Y 100 0 - 10 0 - 10 0 - 10 0 - 10 37°C 80°C - NOY/CGCGR

GC-RE-049 BstHP I GTT/AAC 100 25 - 50 0 - 10 50 - 75 0 - 10 37°C 65°CCAA/TTG

GC-RE-020 BsuR I GG/CC CC/GG 50 - 75 50 - 75 75 - 100 100 25 - 50 37°CCC/GG

GC-RE-052 Btr I CAC/GTC 75 - 100 75 - 100 75 - 100 75 - 100 100 60°C 80°CGTG/CAG

GC-RE-036 CciN I GC/GGCCGC 100 75 - 100 25 - 50 50 - 75 75 - 100 37°C 65°CCGCCGG/CG

GC-RE-004 Cla I AT/CGAT 100 100 75 - 100 100 100 37°C 65°CTAGC/TA

GC-RE-026 Dra I TTT/AAA 100 75 - 100 100 100 50 - 75 37°C 65°CAAA/TTT

GC-RE-005 EcoR I G/AATTC 100 100 25 - 50 50 - 75 100 37°C 65°CCTTAA/G

GC-RE-028 EcoR V GAT/ATC 25 - 50 100 0 - 10 25 - 50 50 - 75 37°C 80°CCTA/TAG

GC-RE-047 Erh I C/CWWGG 0 - 10 100 0 - 10 25 - 50 25 - 50 37°C 65°CGGWWC/C

GC-RE-058 FauND I CA/TATG 100 37°CGTAT/AC

GC-RE-027 Fok I GGATG (9/13) 100 50 - 75 75 - 100 100 25 - 50 37°C 65°CCCTAC

GC-RE-006 Hae III GG/CC 50 - 75 50 - 75 75 - 100 100 25 - 50 37°C 80°CCC/GG

GC-RE-007 Hind III A/AGCTT 50 - 75 100 25 - 50 100 50 -75 37°C 65°CTTCGA/A

GC-RE-038 Hinf I G/ANTC 100 100 50 - 75 75 - 100 100 37°C 80°CCTNA/G

GC-RE-041 Hpa II C/CGG 50 - 75 25 - 50 100 50 - 75 10 - 25 37°C 80°C - NOGGC/C

GC-RE-008 Kpn I GGTAC/C 75 - 100 10 - 25 100 25 - 50 0 - 10 37°C 80°C - NOC/CATGG

GC-RE-021 Ksp22 I T/GATCA 25 - 50 50 - 75 50 - 75 100 50 - 75 37°C 65°CACTAG/T

57

GeneCraft Schnittmuster activity [%] in buffer optimal heat in-Cat. No restriction 5’ —-> 3’ reaction activable

enzyme 3’ —-> 5’ A B L M H temp. 20’ at

GC-RE-051 Kzo9 I /GATC 50 - 75 50 - 75 50 - 75 100 50 - 75 37°C 65°CCTAG/

GC-RE-022 Mlu I A/CGCGT 10 - 25 25 - 50 0 - 10 10 - 25 100 37°C 65°CTGCGC/A

GC-RE-046 MroX I GAANN/NNTTC 25 - 50 100 50 - 75 50 - 75 50 - 75 37°C 65°CCTTNN/NNAAG

GC-RE-009 Msp I C/CGG 100 100 100 100 50 - 75 37°C 65°CGGC/C

GC-RE-029 Nco I C/CATGG 50 - 75 50 - 75 50 - 75 50 - 50 100 37°C 65°CGGTAC/C

GC-RE-010 Not I GC/GGCCGC 10 - 25 50 - 75 0 - 10 25 - 50 100 37°C 65°CCGCCGG/CG

GC-RE-011 Nru I TCG/CGA 10 - 25 100 0 - 10 10 - 25 75 - 100 37°C 65°CAGC/GCT

GC-RE-053 Pci I A/CATGT 50 - 75 75 - 100 50 - 75 75 - 100 100 50°C 80°CTGTAC/A

GC-RE-054 Psi I TTA/TAA 75 - 100 25 - 50 100 25 - 50 10 - 25 37°C 65°CAAT/ATT

GC-RE-023 Psp124B I GAGCT/C 75 - 100 0 - 10 75 - 100 100 75 - 100 37°C 65°CC/TCGAG

GC-RE-030 PspE I G/GTNACC 50 - 75 50 - 75 100 50 - 75 25 - 50 37°C 65°CCCANTG/G

GC-RE-012 Pst I CTGCA/G 25 - 50 25 - 50 10 - 25 25 - 50 100 37°C 80°CG/ACGTC

GC-RE-035 Pvu II CAG/CTG 25 - 50 25 - 50 25 - 50 100 25 - 50 37°C 80°C - NOGTC/GAC

GC-RE-031 Rsa I GT/AC 100 50 - 75 100 50 - 75 0 - 10 37°C 65°CCA/TG

GC-RE-013 Sal I G/TCGAC 0 - 10 25 - 50 0 - 10 10 - 25 100 37°C 65°CCAGCT/G

GC-RE-032 Sbf I CCTGCA/GG 100 0 - 10 75 - 100 50 - 75 0 - 10 37°C 80°C - NOGG/ACGTCC

GC-RE-050 SfaN I GCATCN5/NNNN 0 - 10 75 - 100 45931 25 - 50 100 37°C 65°CCGTAGNNNNN5 /

GC-RE-024 Sfi l GGCCN4/NGGCC 25 - 50 25 - 50 75 - 100 100 25 - 50 50°C 80°C - NOCCGGN/N4CCGG

GC-RE-045 Sfr303 I CCGC/GG 75 - 100 0 - 10 100 50 - 75 0 - 10 37°C 65°CGG/CGCC

GC-RE-025 Sma I CCC/GGG 100 0 - 10 1 - 10 2 - 10 3 - 10 25°CGGG/CCC

GC-RE-033 Sph I GCATG/C 50 - 75 75 - 100 25 - 50 100 75 - 100 37°C 65°CC/GTACG

GC-RE-037 Ssp l AAT/ATT 75 - 100 75 - 100 10 - 25 75 - 100 100 37°C 65°CTTA/TAA

GC-RE-014 Taq I T/CGA 50 - 75 100 25 - 50 50 - 75 50 - 75 65°C 80°CAGC/A

GC-RE-042 Tru9 I T/TAA 100 25 - 50 100 100 25 - 50 65°C 80°C - NOAAT/T

GC-RE-015 Xba l T/CTAGA 100 75 - 100 75 - 100 75 - 100 100 37°C 65°CAGATC/T

GC-RE-016 Xho l C/TCGAG 25 - 50 75 - 100 10 - 25 25 - 50 100 37°C 65°CGAGCT/C

GC-RE-034 Xma I C/CCGGG 100 0 - 10 75 - 100 50 - 75 0 37°C 65°CGGGCC/C

GC-RE-055 Zsp2 I ATGCA/T 100 37°CT/ACGTA

58

RANDOM PRIME LABELING KIT

APPLICATIONS Generation of high specific activity DNA hybridizationprobes from 10 ng to 3 µg of DNA in a standardreaction. Supercoiled or linearized DNA may be usedfor labeling DNA of different lengths. Probes can beproduced from fragments purified from a variety ofsources.

STANDARD REACTIONThaw all reagents on ice, keep the Klenow fragment at-20ºC until required. Double-stranded template DNAmust be denatured by heating in a microcentrifugetube at 95ºC for 2 minutes and rapidly chilled on ice.Assemble the reaction in a microcentrifuge tube, onice, in the following order:Add water to achieve a final volume of 50 µl.

10x Primer mix 5 µl10x dNTP mix 5 µldenatured DNA template 25 ng[32P]dCTP, 50 µCi 5 µlKlenow fragment 1 µl

Incubate the reaction at room temperature for 60minutes, remove unincorporated dCTP using a Sepha-dex G-50 spin column.

DESCRIPTIONThe random prime labeling kit can be used for rapidrandom-primed labeling of DNA with [32P], [32S] or [3H]dCTP to a specific activity.The kit is based on themethod described by Feinberg and Vogelstein (1, 2), inwhich a mixture of random hexamers is used to primeDNA synthesis from any DNA template. In particularthis kit may be used to label DNA fragments directlyafter isolation from agarose gels using the MegaPureTM

DNA purification kit.

BESCHREIBUNGDer Random Prime Labeling Kit kann für die schnellewillkürliche Bindung der DNA mit [32P], [32S] oder [3H]dCTP bis zu einer bestimmten Aktivität verwendetwerden. Der Kit basiert auf der Methode beschriebenvon Feinberg und Vogelstein (1, 2), in der eineMischung zufälliger Hexamere verwendet wird, umDNA von jedem beliebigen Template zu synthetisieren.Dieser Kit kann insbesondere direkt für DNA-Fragmen-te verwendet werden, die gerade frisch mit Hilfe desMegaPure™ DNA Purification Kit aus einem Agarose-Gel isoliert wurden.

STORAGE TEMPERATUREStore at -20ºC in a constant temperature freezer.

MIXES10x primer mix: 100 mM Tris-HCl pH 7.5; 100 mMMgCl2; 4.5 µM hexamers10x dNTP mix: 5 mM each dATP, dGTP, dTTP, 10 mMDTE

COMPANION PRODUCTSKlenow fragment, MegaPure™ DNA purification kit

REFERENCES 1 Feinberg A.P. and Vogelstein B. (1983) Anal. Bio-

chem. 132, 6

2 Feinberg A.P. and Vogelstein B. (1984) Anal. Bio-chem. 137, 266

GC-025

PACK SIZE20 labeling reactions: 25 µl Klenow fragment (125 u), 100 µl primer mix, 100 µl dNTP mix

CATALOG NO.

59

GC-013-001 GC-013-005dGTP, dATP, dTTP, dCTP dGTP, dATP, dUTP, dCTP

PACK SIZE100 mM each solution, 4 x 25 µmol each, 250 µl each vial

CATALOG NO.

dTTP Na4*3H2OMW 624.2Deoxythymidine 5’-triphos-phate, tetrasodium saltPurity: UV - 96%, columnchromatograohy (polysil) -99.5%Integral spectral ratio:250/260 - 0.693;270/260 - 1.082;280/260 - 0.755;290/260 - 0.292PCR reaction is successfulfor the template up to 10kb length.

dGTP Na4*3H2OMW 649.2Deoxyguanosine 5'-tri-phosphate tetrasodiumsaltPurity: UV - 98%, columnchromatography (polysil) -98.8%Integral spectral ratio:250/260 - 1.127;270/260 - 0.793;280/260 - 0.635;290/260 - 0.278PCR reaction is successfulfor the template up to 10kb length.

dCTP Na4*3H2OMW 591,2Deoxycytidine 3'-tri-phosphate, tetrasodiumsaltPurity: UV - 99%,column chromatography(polysil) - 98.5%Integral spectral ratio:250/260 - 0.861;270/260 - 1.179;280/260 - 0.972;290/260 - 0.352PCR reaction is success-ful for the template upto 10 kb length.

dATP Na4*3H2O MW 634.2Deoxyadenosine 5'-triphosphate, tetraso-dium saltPurity: UV - 95%,column chromatography(polysil) - 96.3%Integral spectral ratio:250/260 - 0.865;270/260 - 0.696;280/260 - 0.144PCR reaction is success-ful for the template upto 10 kb length.

BESCHREIBUNG Das dNTP Set besteht aus dNTP-Lösungen, die direktverwendet werden können und als Tetrasodium-Salzeerhältlich sind, um in DNA-Polymerisations-Reaktio-nen, allen DNA-Labellings und Sequenzierungen ihrenEinsatz zu finden.

dNTP SET

DESCRIPTION Ready-to-use dNTP solutions are available as tetraso-dium salts for use in DNA polymerization reactionsand all DNA labelling and sequencing processes.

60

DNA POLYMERIZATION MIX 20/10

dNTPs

DESCRIPTION Contains all four dNTPs in a pre-mixed solution, readyfor immediate use. For procedures requiring unlabeledmixtures of all four dNTPs such as PCR or cDNA syn-thesis.

BECHREIBUNG Dieser Mix enthält alle vier dNTPs in einer vorge-mischten Lösung, welche zur sorfortigen Verwendunggedacht ist. Er ist für alle Verfahren geeignet, für dieman unmarkierte Mischungen aller vier dNTPs benö-tigt, wie z.B. PCR oder cDNA-Synthese.

PURITY 97-99% by UV and polysil column chromotography.PCR reaction is successful for the template up to 10 kblength indicating high purity and absence of delete-rious terminators

GC-013-002 GC-013-00420 mM each dNTP, each 10 µmol, 500 µl 10 mM each dNTP, each 5 µmol, 500 µl

CATALOG NO.

GC-013-006 GC-013-007 GC-013-008 GC-013-009 GC-013-010 dGTP dATP dTTP dCTP dUTP

PACK SIZE100 mM solution, 25 µmol, 250 µl

CATALOG NO.

Supplied in a convenient solution at pH 7,0

PURITY 95% purity by HPLC.

STORAGE CONDITIONSdNTPs are stable at -20ºC in a constant-temperaturefreezer. Avoid multiple freeze/thawing. For long termusage it is recommended to aliquote the nucleotides.

QUALITY CONTROLQuality controlled by HPLC for maximum purity andminimal di- and monophosphate content. All batchestested in standard labelling reactions.

61

BENEFITS Fast efficient service (normally next day)Meeting your precise custom requiremnts for allnucleotide combinationsCost-effective service

STORAGE CONDITIONSdNTPs are stable at -20ºC in a constant-temperaturefreezer. Avoid multiple freeze/thawing. For long termusage it is recommended to aliquote the nucleotides.

BIOTIN-4-dUTP

BIOTIN-11-dUTP

BECHREIBUNG Alle unsere beschriebenen Nukleotid-Produkte könnenauch nach Ihren ganz persönlichen Wünschengemischt werden; wie z.B. die Konzentration, Volu-men, verschiedene dNTP Kombinationen etc.

dNTP CUSTOM SERVICE

DESCRIPTION Any of the nucleotide products described can be pre-pared to your custom specifications; i.e. concentration,volume, various dNTP combinations for labelling, etc.

QUALITY CONTROLQuality controlled by HPLC for maximum purity andminimal di- and monophosphate content. All batchestested in standard labelling reactions.

CONCENTRATION 1 mM

CONCENTRATION 1 mM

GC-013-003-0050 GC-013-003-100050 µl (50 nmol) 1 ml (1 µmol)

CATALOG NO.

GC-013-011-0050 GC-013-003-100050 µl (50 nmol) 1 ml (1 µmol)

CATALOG NO.

62

SOURCEWild-type λ-phage

STORAGE TEMPERATUREstore at -20°C

APPLICATIONS PCRRT-PCRsite-directed mutagenesisas a probe for protein-DNA interaction studies pro-ducing highly labeled oligonucleotide probes


UNIT DEFINITIONOne unit of enzyme activity is the amount that cataly-zes the degradation of 1 µg single-stranded uracil-containing DNA at 37°C in 60 minutes.

URACIL-DNA GLYCOSYLASE

DESCRIPTION E. coli uracil-DNA glycosylase (UDG) is the recombi-nant form of the enzyme, which catalyzes the releaseof free uracil from uracil-containing DNA (U-DNA) andcreates an alkali-sensitive apyrimidinic site in the DNA.UDG efficiently hydrolyzes uracil from single-strandedor double-stranded U-DNA, but not from oligomers (6or fewer bases).

BESCHREIBUNG E. coli Uracil-DNA-Glycosylase (UDG) ist die rekombi-nante Form des Enzyms, das die Freisetzung vonfreiem Uracil aus Uracil-haltiger DNA (U-DNA) kataly-siert und für hohe pH-Werte empfindliche, Pyrimidin-freie Orte in der DNA erzeugt. UDG hydrolysiert effi-zient Uracil aus einzel- oder doppelsträngiger U-DNA,jedoch nicht aus Oligomeren (6 Basen oder weniger).

STORAGE BUFFER20 mM Tris-HCl pH 8.0; 100 mM NaCl; 0.1 mM EDTA;1 mM DTT; 0.1 mg/ml BSA; 50% glycerol

STORAGE TEMPERATUREstore at -20°C

10X REACTION BUFFER500 mM Tricine pH 8.5, 10 mM MgCl2 or buffer forPCR or RT-PCR protocol



CATALOG NO.

λλ-DNA

GC-015-005-0500500 µg

CATALOG NO.

COMPANION PRODUCTSBstE II-λ-DNA marker

63

T-VECTOR SYSTEM

BESCHREIBUNGDas Klonieren von PCR-Produkten mit Hilfe eines Plas-mid-T-Vectors ist eine einfache und etablierte Metho-de (1-4). Diese Methode nutzt den Vorteil der termi-nalen Transferaseaktivität einer Taq-Polymerase (5).Dieses Enzym hängt eine einzelne Deoxyadenosin-Base an das 3´-Ende ihrer Reaktionsprodukte. DiesePCR-Produkte können direkt in einen Vector einge-bracht werden, welcher einzelne kompatible T-Nukleo-tid-Überhänge enthält. Der BS-SK-T-Vector ist mit Hilfeeiner sehr effizienten Methode mittels terminaler Deo-xynucleotidyl-Transferase und ddTTP hergestellt wor-den. Der T-Vector ist aus dem 2961-bp Vector pBlues-cript II SK(+) angefertigt worden, indem dieser mitEcoRI geschnitten, die vertieften 3´-Enden aufgefülltund ein 3´-terminaler Thymidin-Rest an beide Endenangehängt wurde. Diese einzelnen 3´-T-Überhänge ander Einfügestelle verbessern die Effizienz der Ligationeines PCR-Produktes in das Plasmid drastisch, indemdie Recirculation des Vectors verhindert wird und dieÜberhänge eine kompatible Ansatzstelle für PCR-Pro-dukte darstellen, welche mit Hilfe von herkömmlichenhitzestabilen Polymerasen erzeugt wurden. Diese Poly-merasen hängen oft in einer Template-unabhängigenArt und Weise einen einzelnen Deoxyadenosin-Rest andas 3´-Ende der amplifizierten Fragmente. Der T-Vectorenthält Promotoren für die T7 und T3 RNA-Polymera-sen, welche eine Multiple-Cloning-Site flankieren.Zusätzlich enthält der T-Vector die kodierende Regionfür das α-Peptid des Enzyms β-Galactosidase. Durchdie Inaktivierung dieses α-Peptids erhält man rekom-binante Klone, die direkt anhand eines Farb-Scree-nings auf speziellen Indikator-Platten identifiziert wer-den können. Um die Effizienz des Vectors zu steigern,ist das End-Produkt religiert und die lineare Form auseinem Agarose-Gel gereinigt worden. Dieser Vectorkann nicht für die Klonierung von PCR-Produkten ver-wendet werden, die mit bestimmten DNA-Polymera-sen wie z.B. der Pfu-DNA-Polymerase erzeugt wurden,da diese keine terminale Transferase-Aktivität aufwei-sen. Jedoch kann man mit einer einfachen Inkubationdieser PCR-Produkte mit einer Taq-Polymerase einen3´-Nukleotid-Überhang anhängen, was die Klonierungdieser PCR-Produkte in den T-Vector ermöglicht.

DESCRIPTIONCloning of PCR products using plasmid T-vectors is aneasy and well established method (1-4). This methodtakes advantage of the terminal transferase activity ofTaq polymerase (5). This enzyme adds a single deoxy-adenosine base to the 3´end of their reaction products.These PCR products can be ligated directly into a vec-tor containing compatible single T-nucleotide over-hangs. The BS-SK-T-vector was produced by a very effi-cient procedure using terminal deoxynucleotidyl trans-ferase and ddTTP (4). The T-vector is prepared from2961-bp vector pBluescript II SK(+) by cutting withEcoR I, filling recessed 3’ termini and adding a 3´ ter-minal thymidine to both ends. These single 3´-T over-hangs at the insertion site greatly improve the effi-ciency of ligation of a PCR product into the plasmidsby preventing recircularization of the vector and provi-ding a compatible overhang for PCR products genera-ted by certain thermostable polymerases. These poly-merases often add a single deoxyadenosine, in a tem-plate-independent fashion, to the 3´-ends of theamplified fragments.The T-vector contain T7 and T3 RNA polymerase pro-moters flanking a multiple cloning region within theα-peptide coding region of the enzyme β-galactosida-se. Insertional inactivation of the α-peptide allowsrecombinant clones to be directly identified by colorscreening on indicator plates. To increase the efficien-cy of the vector the tailed product was religated andthe linear form was purified from an agarose gel. Thisvector cannot be used for cloning of PCR productsgenerated with some DNA polymerases like Pfu DNApolymerase that does not exhibit any terminal transfe-rase activity (for cloning of such PCR products use ourpBS-EcoRV vector, page 66). However a simple incu-bation of such PCR products with Taq polymerase willadd 3´ nucleotide overhang, enabling the cloning ofthese products into T-vector.

64

T-VECTOR SYSTEM

NOTES1. Use GeneCraft’s T4 DNA Ligase in performing T-

Vector ligations. Other commercial preparations ofT4 DNA ligase may contain exonuclease activitiesthat may remove the terminal deoxythymidinesfrom the vector.

2. 5X Ligation Buffer (without ATP) contains: 250 mMTris-HCl (pH 7.8); 50 mM MgCl2; 50 mM dithio-threitol.

3. It is important to vortex the 5X Ligation Buffer befo-re each use.

4. Longer incubation times will increase the number oftransformants. Generally, incubation overnight at4°C will produce the maximum number of transfor-mants.

5 Use 0.5ml tubes known to have low DNA-bindingcapacity

OPTIMIZING INSERT: VECTOR MOLAR RATIOSThe T-Vector have been optimized using a 1:1 molarratio of the Control Insert DNA to the Vector. However,ratios of 8:1 to 1:8 have been successfully used. Ifinitial experiments with your PCR product are subopti-mal, ratio optimization may be necessary. Ratios from3:1 to 1:3 provide good initial parameters. The con-centration of PCR product should be estimated bycomparison to DNA mass standards on a gel. The T-Vector is approximately 3kb and is supplied at50ng/µl.

Standard Reaction Background Control

5X Ligation Buffer 2µl 2µlT-Vector (50ng) 1µl 1µlPCR product Xµl* –T4 DNA Ligase (2 Weiss units/µl) 1µl 1µlATP (5 mM) 2µl 2µldeionized water to a final volume of 10µl a final volume of 10µl

PROTOCOLLigations Using the T-Vector

1. Briefly centrifuge the T-Vector and Insert DNA tubesto collect contents at the bottom of the tube.

2. Set up ligation reactions as described below.

*Molar ratio of PCR product:vector may require opti-mization as described below

3. Mix the reactions by pipetting. Incubate the reac-tions 1 hour at room temperature.

Alternatively, if the maximum number of transformantsis required, incubate the reactions overnight at 4°C.

T-VECTOR MULTIPLE CLONING SITE REGION (sequence shown 828 - 600)

M13 Reverse primer BssH II T3 promoter –>5’ CAGGAAACAGCTATGACCATGATTACGCCAAGCGCGCAATTAACCCTCACTAAAGGGAAC3’ GTCCTTTGTCGATACTGGTACTAATGCGGTTCGCGCGTTAATTGGGAGTGATTTCCCTTG

| Met ß-galactosidase –>820

BstX I Eag ISac I Sac II Not I Xba I Spe I BamH I Sma I Pst I

AAAAGCTGGAGCTCCACCGCGGTGGCGGCCGCTCTAGAACTAGTGGATCCCCCGGGCTGCAGTTTTCGACCTCGAGGTGGCGCCACCGCCGGCGAGATCTTGATCACCTAGGGGGCCCGACGTC

Cla I Hinc II Dra IIEcoR V Hind III Sal I Xho I Apa I Kpn I

GAATTT-3’ AATTCGATATCAAGCTTATCGATACCGTCGACCTCGAGGGGGGGCCCGGTACCCTTAA 3’-TTTAAGCTATAGTTCGAATAGCTATGGCAGCTGGAGCTCCCCCCCGGGCCATGG

BssH IICAATTCGCCCTATAGTGAGTCGTATTACGCGCGCTCACTGGCCGTCGTTTTAC 3’GTTAAGCGGGATATCACTCAGCATAATGCGCGCGAGTGACCGGCAGCAAAATG 5’

<– T7 promoter | M13 17-base primer620

pBluescript II SK (+)3.0 kb

T7

Kpn IXho ISal IHind IIIEco R V

T

T

Pst IBamH IXba INot ISac I

T3

65

T-VECTOR SYSTEM

CONCENTRATION50 ng/µl

GC-050-0011 µg (ca. 20 reactions)

CATALOG NO.


REFERENCES1. Trower, M.K. and Elgar G.S. PCR cloning using T-

vectors. Methods in Molecular Biology, Vol. 31: Pro-tocols for Gene Analysis, 1994 Humana Press Inc.,Totowa, NJ

2. Mead, D.A. etal. (1991) A universal method for thedirect cloning of PCR amplified nucleic acid. Bio-techniques 9: 657- 663

3. Marchuk, D.A. et al. (1991) Construction of T-vec-tors, a rapid and general system for direct cloning ofunmodified PCR products. Nucleic Acids Res. 19:1154

4. Holton, T.A. and Graham, M.W. (1991) A simple andefficient method for direct cloning of PCR productsusing ddT-tailed vectors. Nucleic Acids Res. 19:1156

5. Clark, J.M. (1988) Novel non-templated nucleotidereactions catalyzed by procaryotic and eucaryoticDNA polymerases. Nucleic Acids Res. 18:L 9677-9686

GC-050-0021 µg (ca. 20 reactions)

CATALOG NO.

66

pBS-KS-EcoRV

DESCRIPTION BstE II-λ-DNA Marker consists of 15 fragments ran-ging in size from 117 to 14140 bp. Their asymmetricdistribution makes determination of molecular weighteasier.

Two fragments containing the cos sites hybridize toeach other resulting in additional band of 14140 bp atthe top. This can be avoided by heating the marker to80ºC for 15 minutes and cooling it on ice.

STORAGE TEMPERATUREStore at +4°C to -20°C.

DNA MOLECULAR WEIGHT MARKER

BESCHREIBUNGBstE II-λ-DNA Marker besteht aus 15 Fragmentenmit einer Größe von 117 bis 14140 bp.Die ungleichmäßige Verteilung der Banden macht dieBestimmung des Molekulargewichtes einfacher.

Zwei Fragmente tragen eine cos-site, so daß diese zueinem Fragment von 14140 bp hybridisieren. Dieskann durch Erhitzen des Markers für 15 min. auf 80 °Cund anschließendem auf Eis halten verhindert werden.

GC-015-002

PACK SIZE100 µg in 1 ml (100 rxns) loading buffer (0.25% bromphenol blue, 0.25% xylene cyanol FF, 40% sucrose inwater), the marker is ready to use. Load 10 µl in one lane.

CATALOG NO.

BSTE II-λ-DNA MARKER

CONCENTRATION50 ng/µl

DESCRIPTIONThe pBS-KS-EcoRV vector was produced by digestionof pBS-KS plasmid with EcoRV and the linear form waspurified from an agarose gel. This vector is a ready-to-use product, designed for cloning of PCR productscontaining blunt ends and amplified with a class ofSynergy DNA polymerases containing Pfu-DNA poly-merase. For protocol see T-Vector System (page 64).

BESCHREIBUNG:Der pBS-KS-EcoRV Vector entsteht durch den Verdaueines pBS-KS Plasmids mit EcoRV, und die lineare Formist aus einem Agarosegel gereinigt worden. Der Vectorkann sofort verwendet werden. Er ist für die Klonierungvon PCR-Produkten mit blunt ends hergestellt und miteiner Klasse von Synergy DNA-Polymerasen, welche einePfu-DNA-Polymerase enthalten, erweitert worden. DasProtokoll finden Sie auf der Seite des T-Vectors (S. 64).


67

BOTH MARKERS LOA-DED SIMULTANEOUS-LY IN ONE LANE ANDRUN ABOUT 1 HOURON 1% AGAROSEGEL.

BSTE II-λ-DNA MARKER Hpa II-pBS-DNA MARKER

DNA MOLECULAR WEIGHT MARKER

BESCHREIBUNGHpa II-pBS-DNA Marker besteht aus 13 Fragmen-ten mit einer Größe von 26 bis 712 bp. Die ungleich-mäßige Verteilung der Banden macht die Bestimmungdes Molekulargewichtes einfacher.

GC-015-001

PACK SIZE50 µg in 500 µl (100 rxns) loading buffer (0.25% bromphenol blue, 0.25% xylene cyanol FF, 40% sucrose inwater), the marker is ready to use. Load 5-10 µl in one lane.

CATALOG NO.

DESCRIPTION Hpa II-pBS-DNA Marker consists of 13 fragmentsranging in size from 26 to 712 bp. Their asymmetricdistribution makes determination of molecular weighteasier.

STORAGE TEMPERATUREStore at +4°C to -20°C.

Hpa II-pBS-DNA MARKER

68

EcoRI-λ-DNA MARKER

DESCRIPTIONEcoRI-λ-DNA marker consists of 6 fragments rangingin size from 3530 to 21226 bp.Their asymmetric distribution makes determination ofmolecular weight easier.Two fragments (3530 bp and 21226 bp) containingthe cos sites of bacteriophage lambda may hybridiseto each other resulting in an additional band at 24756bp. This can be avoided by heating the marker to 80°Cfor 15 minutes and cooling it on ice.

BESCHREIBUNGEcoRI-λ-DNA Marker besteht aus 6 Fragmenten mieiner Größe von 3530 bis 21226 bp.Die ungleichmäßige Verteilung der Banden macht dieBestimmung des Molekulargewichtes einfacher.Zwei Fragmente (3530 bp und 21226 bp) enthaltendie cos-sites des Bakteriophagen Lambda und könnensich deshalb zu einer Bande von 24756 bp addieren.Dies kann durch Erhitzen des Markers für 15 min. auf80 °C und anschließendem auf Eis halten verhindertwerden.

STORAGE TEMPERATUREStore at +4 °C to -20 °C

The marker is ready to use.Load 10 µl in one lane.

To demonstrate the mobility of the DNA fragments,1µg of marker was loaded onto a 0.7% agarose gel.

21226*

7421

58045642

4878

3530*

GC-015-006100 µg in 1 ml (100 rxns) loading buffer(0.25 % bromphenol blue, 0.25 % xylene cyanol FF, 40 % sucrose in water).

CATALOG NO.

69BESCHREIBUNGHindIII-λ-DNA Marker besteht aus 7 Fragmenten mieiner Größe von 564 bis 23130 bp. Die ungleichmäßi-ge Verteilung der Banden macht die Bestimmung desMolekulargewichtes einfacher.Zwei Fragmente (4361 bp und 23130 bp) enthaltendie cos-sites des Bakteriophagen Lambda und könnensich deshalb zu einer Bande von 24756 bp addieren.Dies kann durch Erhitzen des Markers für 15 min. auf80 °C und anschließendem auf Eis halten verhindertwerden.

DESCRIPTIONHindIII-λ-DNA marker consists of 7 fragments rangingin size from 564 to 23130 bp.Their asymmetric distribution makes determination ofmolecular weight easier.Two fragments (4361 bp and 23130 bp) containingthe cos sites of bacteriophage lambda may hybridiseto each other resulting in an additional band at 24756bp. This can be avoided by heating the marker to 80 °Cfor 15 minutes and cooling it on ice.



To demonstrate the mobility of the DNA fragments,1µg of marker was loaded onto a 1 % agarose gel.

HindIII-λ-DNA MARKER

23130*941665574361*

23222027

564

GC-015-008100 µg in 1 ml (100 rxns) loading buffer (0.25 % bromphenol blue, 0.25 % xylene cyanol FF,40 % sucrose in water).

CATALOG NO.

70BeschreibungEcoRI+HindIII-λ-DNA Marker besteht aus 13 Frag-menten mit einer Größe von 564 bis 21226 bp. Dieungleichmäßige Verteilung der Banden macht dieBestimmung des Molekulargewichtes einfacher.Zwei Fragmente (3530 bp und 21226 bp) enthaltendie cos-sites des Bakteriophagen Lambda und könnensich deshalb zu einer Bande von 24756 bp addieren.Dies kann durch Erhitzen des Markers für 15 min. auf80 °C und anschließendem auf Eis halten verhindertwerden.

DESCRIPTIONEcoRI+HindIII-λ-DNA marker consists of 13 fragmentsranging in size from 564 to 21226 bp.Their asymmetric distribution makes determination ofmolecular weight easier.Two fragments (3530 bp and 21226 bp) containingthe cos sites of bacteriophage lambda may hybridiseto each other resulting in an additional band at 24756bp. This can be avoided by heating the marker to 80 °C for 15 minutes and cooling it on ice.



To demonstrate the mobility of the DNA fragments,1µg of marker was loaded onto a 1 % agarose gel.

EcoRI+HindIII-λ-DNA MARKER

21226*

5148497342683530*

2027190415841375947831

564

GC-015-007100 µg in 1 ml (100 rxns) loading buffer (0.25 % bromphenol blue, 0.25 % xylene cyanol FF, 40 % sucrose in water).

CATALOG NO.

71

TO DEMONSTRATETHE MOBILITY OF THEDNA FRAGMENTS,1 µg OF MARKERWERE LOADED ONTOA 1% AGAROSE GEL.

CONCENTRATION 1 µg/10 µl

DESCRIPTION The 100 bp DNA ladder is suitable for sizing lineardouble-stranded DNA fragments from 100 to 1000 bp.The 10 bands of the ladder contain fragments with thefollowing sizes:100, 200, 300, 400, 500, 600, 700, 800, 900 and1000 bp

BESCHREIBUNG Die 100 bp DNA Ladder ist für die Größenbestimmunglinearer, doppelsträngiger DNA-Fragmente von 100 bis1000 bp geeignet. Der Einsatz dieser Ladder ergibt 10Banden folgender Größe:100, 200, 300, 400, 500, 600, 700, 800, 900 und1000 bp

100 bp DNA LADDER

The recommended amount of size marker to load onan agarose gel is 0.5-1 µg per lane (5-10 µl).

GC-015-00450 µg in 500 µl (100 rxns) loading buffer (0.25% bromphenoblue, 0.25% xylene cyanol FF, 40% sucrose in water).

CATALOG NO.

72DESCRIPTION The 1 kb DNA ladder is suitable for sizing linear dou-ble-stranded DNA fragments from 0.25 to 10 kb. The13 bands of the ladder contain fragments with thefollowing sizes:250, 500, 750, 1000, 1500, 2000, 2500, 3000, 4000,5000, 6000, 8000 and 10000 bpFor easy reference on agarose gels, the 1000 and3000 bp bands are three times brighter than the otherbands in the ladder.

CONCENTRATION 1 µg/10 µl

BESCHREIBUNG Die 1 kb DNA Ladder ist für die Größenbestimmunglinearer, doppelsträngiger DNA-Fragmente von 0.25bis 10 kb geeignet. Der Einsatz dieser Ladder ergibt 13Banden folgender Größe:250, 500, 750, 1000, 1500, 2000, 2500, 3000, 4000,5000, 6000, 8000 und 10000 bpFür die bessere Vergleichbarkeit auf dem Gel sind die1000 bp und die 3000 bp Bande dreimal stärker alsdie anderen.

1 kb DNA LADDER

TO DEMONSTRATETHE MOBILITY OF THEDNA FRAGMENTS,1 µg OF MARKERWERE LOADED ONTOA 1% AGAROSE GEL.

The recommended amount of size marker to load onan agarose gel is 0.5-1 µg per lane (5-10 µl).

GC-015-003100 µg in 1 ml (200 rxns) in loading buffer (0.25% bromphenol blue, 0.25% xylene cyanol FF, 40% sucrose in water).

CATALOG NO.

73

COMPONENTS OF THE STANDARD KIT15 ml MELT solution1 ml BIND solution3 ml 40x WASH solution(for 120 ml WASH solution mix with 60 ml ethanol and 57 ml H2O)

COMPONENTS OF THE SAMPLE KIT1 ml MELT solution20 µl BIND solution100 µl WASH solution, 40x concentrate

SOLUTIONS MELT solution: 6 M NaIBIND solution: DNA-binding silica matrixWASH solution: 50 mM NaCI 10 mM Tris-HCI

pH 7.5; 2,5 mM EDTA;50% v/v ethanol

STORAGE TEMPERATUREStore the components of the DNA purification kit at+4ºC in the dark.

PROTOCOL1 Add water to MELT powder to obtain 15 ml solution.2 Mix 60 ml ethanol and 57 ml water with 3 ml of

40x WASH concentrate. For sample kit, mix 2 mlethanol and 1,9 ml wate with 100 µl of 40x WASHconcentrate

MegaPure™ DNA PURIFICATION KIT

DESCRIPTION The kit is based on the defined size silica matrix usedfor purification of DNA from agarose gels.

BESCHREIBUNG Dieser Kit basiert auf der definierten Größe der Silica-Matrix, die für die Reinigung von DNA in Agarose-Gelen verwendet wird.

3 Excise the DNA fragment from agarose gel and addone volume of MELT (300-500 µl)

4 Melt the gel slice at 65 °C for 5 min. Cool down5 Add 5-15 µl of BIND (will bind up to 4 µg DNA) and

incubate 5 min. at room temperature6 Centrifuge 1 min. at 7000 rpm, remove the super-

natant7 Add 500 µl of WASH solution to the pellet and vor-

tex. Centrifuge 1 min. at 7000 rpm. Repeat was-hing.

8 Dry pellet at room temperature. Speedvac and air-drying are admissible.

9 Elute DNA by resuspending the pellet in 50-100 µlwater and incubate 5 min. at 55 °C. Centrifuge 5min. at maximum speed.

10Transfer the supernatant in another tube. If necess-sary, repeat centrifugation step to clean you samplefrom the remaining BIND. Keep this DNA probe at+4 °C or –20 °C. If necessary, concentrate or dryDNA in Speedvac.

The DNA purified by this protocol can be used fordigestion with restriction enzymes, for ligation, trans-formation and labeling with Klenow enzyme. This kitcan also be used for purification of PCR products. DNAfragments from 20 bp up to 10 kb length can be succ-cessfully purified with this kit.

GC-017-020050-100 preps

CATALOG NO.

74

SOURCEThe protein is purified from E. coli strain harboring theplasmid with the tmpA gene.

CONCENTRATION2.6 mg/ml

TREPONEMA PALLIDUM RECOMBINANT ANTIGEN - tmpA

SOURCEClone: 109, mouse astitic fluid

ISOLATIONAmmonium sulphate precipitation, followed by ion-exchange chromatography on DEAE-cellulose

PROTEIN CONCENTRATION1 mg/ml

DESCRIPTION tmpA protein is the main surface protein of Trepone-ma pallidum.The protein is modified by means of genetic enginee-ring, all major epitops are intact, hydrophobic anchoris removed. rec-tmpA was shown to bind effectivelywith Ig from T. pallidum infected patients. The proteinis purified from water-soluble fraction of rec-E.coliproteins.

BESCHREIBUNG tmpA ist das wohl bedeutenste Protein der Zellober-fläche von Treponema pallidumDieses Protein ist mit Hilfe der Gentechnik modifiziertworden, alle wichtigen Epitope sind intakt und hydro-phobe Anker-Sequenzen wurden entfernt. Man konn-te zeigen, daß rec-tmpA effektiv an den entsprechen-den Antikörper, aus mit T. pallidum infizierten Patien-ten, bindet.Das Protein ist aus einer wasserlöslichen Fraktionrekombinanter E. coli-Proteine gereinigt worden.

STORAGE BUFFER10 mM Tris-HCl pH 7.5; 150 mM NaCl; 0.08% sodiumazide

STORAGE TEMPERATURE+4°C. Do not freeze!!!

PURITYMore than 90% by SDS-PAGE. Purified by affinitychromatography.

MONOCLONAL IgG TO THERMUS AQUATICUS DNA POLYMERASE

PRESENTATIONSolution in 100 mM NaCl; 10 mM Na-phosphate;pH 8.0, 50% Glycerol

STORAGE TEMPERATURE2 years at -20°C

For research and manufacturing use only.

GC-AG-0010,52 mg

CATALOG NO.

GC-AG-036-1100 µg

CATALOG NO.

75

APPLICATIONSVery effective inducer of the lac operon for the ß-galactosidase by binding and inactivating the lacrepressor. It is recommended to use 0,1-1 mM IPTG inLB-media. So a stock solution of 100 mM or 500 mM,which should be stored at -20°C after sterilization, isuseful.

CHARACTERISTICSWhite crystalline powder. Soluble in water and metha-nol.

Formula C9H18O5SMolecular weight Mr = 238,3Melting point 110-114°Cα20°/D; 1%, H2O -30° ± 2°Moisture content NMT 1,0%Residue on ignition NMT 0,5%Purity (by TLC) NLT 98,0%

IPTG (ISOPROPYL-ß-D-THIOGALACTOSIDE)

DESCRIPTIONChemical analogue of galactose that cannot be clea-ved by ß-galactosidase.

BESCHREIBUNGDies ist das chemische Analogon von Galactose, wel-ches nicht mit Hilfe der ß-Galactosidase gespaltet wer-den kann

STORAGE TEMPERATURE-20°C, protected from light.

GC-SS-00110 g (or as requested)

CATALOG NO.

76

BESCHREIBUNG Die hier aufgelisteten Acrylamid-Fertiglösungen sindaus der hochreinen „4K-ultrapure“ Qualität und30%igen Stammlösungen hergestellt. Sie bestehenaus Acrylamid/Bisacrylamid im Verhältnis 29:1 mit denjeweils angegebenen Konzentrationen an freiemMonomer und 1X TBE (pH 8,3).

Acrylamid 4K-Fertiglösungen für nicht denaturierende DNA-PAGE

HINWEISDa Sauerstoff die Poly-merisation von Acryla-mid hemmt, sollten Acry-lamidlösungen vor derZugabe von TEMED ent-gast werden. Die emp-fohlene und relativgroße Menge an APSmacht dies in der Regeljedoch überflüssig. Fallsder Harnstoff bei niedri-gen Temperaturen aus-fällt, kann er durchErwärmen der Lösung im37°C-Wasserbad wiedergelöst werden.

Acrylamid 4K-Fertiglösungen für denaturierende DNA-PAGE

wässrige Lösungen HS-Nr.: 38220000 Lagerung: RT R: 45-46-E24/25-E48/24/25 LGK: 6.1 B S: 53-45 / WGK: 3Entsorgung: 9 giftig, krebserzeugend, erbgutverändernd RID/ADR: 6.1/12 c UN 2074 Giftkl. (CH): 2

ACRYLAMID

Kat. Nr. % Acrylamid (4K) Trennbereich (bp)

GC-A0721 3,5 ca. 1000-2000GC-A0722 5 ca. 80-500GC-A0723 6 ca. 70-450GC-A0724 8 ca. 60-400GC-A0725 12 ca. 40-200GC-A0726 15 ca. 25-150GC-A0727 20 ca. 6-100

Kat. Nr. % Acrylamid (4K) WanderungsverhältnisBromphenolblau/Xylencyanol (b)

GC-A0733 4GC-A0734 5 35/130GC-A0735 6 26/106GC-A0736 8 19/76GC-A0738 10 12/55

Für die Polymerisation des Gels müssen pro 100 mlGellösung 1 ml APS (GC-A2941) (aus einer 10%igenStocklösung) und 50 µl TEMED (GC-A1148) zugege-ben werden. Als Elektrophoresepuffer wird TBE-Puffer(GC-A3945) verwendet.

BESCHREIBUNG Die hier aufgelisteten Acrylamid-Fertiglösungen sindaus der hochreinen „4K-ultrapure“ Qualität und40%igen Stammlösungen hergestellt und für dieDNA-Sequenzierung geeignet. Sie bestehen aus Acry-lamid/Bisacrylamid im Verhältnis 19:1 mit den jeweilsangegebenen Konzentrationen an freiem Monomerund 50% Harnstoff und 1X TBE (pH 8,3).

Für die Polymerisation des Gels müssen pro 100 mlGellösung 1 ml APS (GC-A2941) (aus einer 10%igenStocklösung) und 50 µl TEMED (GC-A1148) zugege-ben werden. Als Elektrophoresepuffer wird TBE-Puffer(GC-A3945) verwendet.

LAGERUNG Raumtemperatur

EIGENSCHAFTEN250 ml, 500 ml, 1 L



Acrylamid, TBE, TEMED und APS sind nur für den Verkauf in Deutschland bestimmt. Acrylamides, TBE, TEMED and APS are sold only in Germany.

77

Acrylamid 4K-Fertiglösungen für SDS-PAGE

BESCHREIBUNG Die hier aufgelisteten Acrylamid-Fertiglösungen basie-ren auf der Arbeit von Laemmli (1) und sind aus derhochreinen „4K-ultrapure“ Qualität sowie 30%igenStammlösungen hergestellt. Sie bestehen aus Acryla-mid/Bisacrylamid im Verhältnis 29:1 mit den jeweilsangegebenen Konzentrationen an freiem Monomerund 0.1% SDS sowie 380 mM Tris (pH 8.8).

SAMMELGELZu jeder Packung 250 ml (bzw. 500 ml und 1 Liter)Trenngellösung wird 100 ml (bzw. 125 ml und 250 ml)Sammelgellösung mitgeliefert. Die Konzentration derSammelgellösung (125 mM Tris, pH 6.8) beträgt unab-hängig von der gewählten Trenngellösung 4%.

Für die Polymerisation des Gels müssen pro 100 mlGellösung 1 ml APS (GC-A2941) (aus einer 10%igenStocklösung) und 50 µl TEMED (GC-A1148) zugege-ben werden. Als Elektrophoresepuffer wird derLaemmli (SDS-Tris-Glycin)-Puffer (GC-A1415) verwen-det.



Kat. Nr. % Acrylamid (4K) Trennbereich (bp)

GC-A0709 5 ca. 60-210GC-A0710 7,5 ca. 35-95GC-A0711 10 ca. 15-70GC-A0712 12,5 ca. 14-57GC-A0713 15 ca. 12-45

LITERATUR Laemmli, U.K. (1970) Nature 227, 680-685

HINWEIS Die Länge des Sammelgels sollte ungefähr 1,5fachlänger sein als die Tiefe des Kammes, da bei einemkürzeren Sammelgel die Gefahr besteht, dass beimHerausziehen des Kammes das Sammelgel zerstörtwird. Da Sauerstoff die Polymerisation von Acrylamid

hemmt, sollten Acrylamidlösungen vor der Zugabe vonTEMED entgast werden. Die empfohlene und relativgroße Menge an APS macht dies in der Regel jedochüberflüssig.

ACRYLAMID

78

SPEZIFIKATION Tris 107.81 g/L (0.89 M)EDTA-Na2* 2 H2O 7.44 g/L (0.20 M)Borsäure 55.03 g/L (0.89 M)

TBE (Tris-Borat-EDTA)-Puffer (10x) für die Molekularbiologie

HS-Nr.: 38220000 Lagerung: RT

BESCHREIBUNGTBE-Puffer wird als Elektrophoresepuffer für Polyacry-lamidgele und für Agarose-Gele verwendet. TBE hateine höhere Pufferkapazität als TAE, allerdings wan-dert doppelsträngige, lineare DNA bei gleicher Auflö-sung 10% schneller durch TAE als durch TBE. ‚Super-coiled’ DNA wird jedoch besser in TAE als in TBE auf-getrennt. Normalerweise verwendet man den Puffer in

den Arbeitskonzentrationen 1x für Polyacryamidgeleund 0,5x für Agarose-Gele. Für ‚band shifts’ (gel mobi-lity shift assay) wird ebenfalls 0.5x TBE eingesetzt. TBEwird meist als 10x Konzentrat bei Raumtemperaturgelagert. Bei langer Lagerung bildet sich ein Präzipitat- der Puffer sollte dann theoretisch nicht mehr ver-wendet werden.

DNasen/RNasen nicht nachweisbarpH (20°C, H2O) 8.3 ± 0.2


CATALOG NO.

Laemmli-Puffer, SDS-Tris-Glycin-Puffer, 10fach konzen-triert für die Elektrophorese

BESCHREIBUNG Laemmli hat mit der SDS-Polyacrylamidgelelektropho-rese ein SDS-Tris-Glycin-Puffersystem (pH 8,3) einge-führt. Der Puffer wird als 10fach Konzentrat geliefert.

Laemmli (SDS-Tris-Glycin)-Puffer (10x)

HS-Nr.: 38220000

REAGENZIEN FÜR DIE ELEKTROPHORESE

SPEZIFIKATIONTris 30.29 g/L (0.25 M)Glycin 144.13 g/L (1.92 M)pH (H2O) 8.3 ± 0.1 (25°C)SDS 10 g/L (1%)

GC-A1415-0250 GC-A1415-0500 GC-A1415-1000250 ml 500 ml 1 L

CATALOG NO.

79

SPEZIFIKATION DNasen/RNasen nicht nachweisbar Chlorat max. 0.001%Gehalt (titr.) min. 98% Chlorid max. 0.001%pH (5%, H2O) 1.0 - 2.0 (20°C) Fe max. 0.001%Freie Säure max. 0.1% Mn max. 0.00005%Glührückstand max. 0.05% Pb max. 0.005%

Ammoniumperoxodisulfat, APS H8N2O8S2 Lagerung: RT M = 228.20g/mol LGK: 5.1 HS-Nr.: 28334000R: 8-22-42/43 S:17-22-24-37-43.8 / WGK: 1 Löslichkeit (20°C) 582 g/L (H2O) CAS-Nr.: 7727-54-0 Schmelzpunkt: 120°C (Zers.)RID/ADR: 5.1/18 c Giftkl. (CH): 4 EINECS: 2317865 UN 1444 Entsorgung: 22 gesundheitsschädlich, sensibilisierend

SPEZIFIKATIONGehalt (GC) min. 99%Wasser max. 0.3%

TEMED, N,N,N’,N’-Tetramethylendiamin TMEDA C6H16N2 Lagerung: +4°C R: 11-20/22-34 S: 16-26-36/37/39-45Siedepunkt 121°C M = 116.21 g/mol LGK: 3 A n 20°/D 1.417 CAS-Nr.: 110-18-9HS-Nr.: 29212900 RID/ADR: 3/3 b EINECS : 2037446 UN 2372 Giftkl. (CH): 4Entsorgung: 5 leichtentzündlich, gesundheitsschädlich, ätzend

TEMED, N,N,N’,N’-Tetrametrylendiamin

AMMONIUMPERSULFAT FÜR DIE MOLEKULARBIOLOGIE

BESCHREIBUNGTBE-Puffer wird als Elektrophoresepuffer für Polyacry-lamidgele und für Agarose-Gele verwendet. TBE hateine höhere Pufferkapazität als TAE, allerdings wan-dert doppelsträngige, lineare DNA bei gleicher Auflö-sung 10% schneller durch TAE als durch TBE. ‚Super-coiled’ DNA wird jedoch besser in TAE als in TBE auf-getrennt. Normalerweise verwendet man den Puffer in

den Arbeitskonzentrationen 1x für Polyacryamidgeleund 0,5x für Agarose-Gele. Für ‚band shifts’ (gel mobi-lity shift assay) wird ebenfalls 0.5x TBE eingesetzt. TBEwird meist als 10x Konzentrat bei Raumtemperaturgelagert. Bei langer Lagerung bildet sich ein Präzipitat- der Puffer sollte dann theoretisch nicht mehr ver-wendet werden.

BESCHREIBUNGAmmoniumpersulfat (APS) dient als Initiator der Poly-merisation von Acrylamid. Da APS in wässriger Lösungnicht sehr stabil ist, sollte die Lösung frisch angesetztwerden. Aus Erfahrung kann sie aber bei +4°Cmehrere Wochen gelagert werden.

GC-A1148-0100 GC-A1148-0250 GC-A1148-0500100 ml 250 ml 500 ml

CATALOG NO.

ACHTUNGTEMED ist gesundheitsschädlich. Dämpfe sollten nichteingeatmet werden!

REAGENZIEN FÜR DIE ELEKTROPHORESE

GC-A2941-0100 GC-A2941-0250 GC-A2941-0500100 g 250 g 500 g

CATALOG NO.

80

GeneCraft AGAROSE LSL 8100

SPECIFICATION Gelling temperature 34 - 37°C(dynamic measurement in 1.5% solution)Gel strength (1.5% gel) ≥ 2300 g/cm2

Electroendosmosis (-mr) 0.08 - 0.14Sulphate ≤ 0.05%Loss on drying ≤ 10%Residue on ignition ≤ 1.0%DNase and RNase activity and DNA bindingNone

COMPANION PRODUCTSGeneCraft Agarose S 18000,GeneCraft Agarose S-IM 18500

DESCRIPTIONFor preparative and analytical separation ofnucleic acids.

GeneCraft Agarose LSL 8100 is ideally suited for elec-trophoresis of nucleic acids. It is a high purity agaroseextracted from the Gelidium species of seaweed and ischaracterised by a low sulphate content.

GeneCraft Agarose LSL 8100 is recommended for pre-parative as well as analytical nucleic acid electropho-resis. It provides very firm gels at low concentrations.

GeneCraft Agarose LSL 8100 is quality assured speci-fically to meet the stringent requirement of nucleicacid applications.

GeneCraft Agarose LSL 8100 is manufactured andquality-controlled under very stringent conditions andin accordance with ISO 9000 certified quality systemto ensure conformance with the demanding require-ments of nucleic acid applications.

BESCHREIBUNGFür die präparative und analytische Trennungvon Nukleinsäuren.

GeneCraft Agarose LSL 8100 ist für Elektrophoresenmit Nukleinsäuren ideal geeignet. Diese hochgereinig-te Agarose wird aus der Rotalgengattung Gelidiumgewonnen und zeichnet sich durch einen geringen Sul-fat-Gehalt aus.

GeneCraft Agarose LSL 8100 ist sowohl für die präpa-rative als auch für die analytische Elektrophorese mitNukleinsäuren geeignet. Mit dieser Agarose erhältman auch bei niedrigen Konzentrationen trotzdem sta-bile Gele.

GeneCraft Agarose LSL 8100 steht für eine garantier-te, ganz besondere Qualität, die alle Anforderungen imBereich der Einsatzmöglichkeiten von Nukleinsäurenerfüllt.

GeneCraft Agarose LSL 8100 ist unter äußerst stren-gen Bedingungen nach ISO 9000 hergestellt und kon-trolliert worden, um die Anforderungen im Einsatzbe-reich von Nukleinsäuren voll erfüllen zu können.

GC-BMA-8100500g

CATALOG NO.

81

GeneCraft AGAROSE S 18000

DESCRIPTION For preparative and analytical separation ofnucleic acids < 1000 bp.

GeneCraft Agarose S 18000 offers very fine and con-sistent resolution of nucleic acid fragments below1000 bp. The agarose is capable of separating DNA orRNA fragments, which only differ with few a basepairs.

The fine physical properties of GeneCraft Agarose S18000 provide the opportunity consistently to decidethe perfection and size of amplified fragments, in vitrotranslation, transcriptional mapping and small restric-tion digestion fragments.

In addition, GeneCraft Agarose S 18000 offers highgel strength, which provides easy-to-handle, flexiblegels for electrophoresis of small DNA and RNA frag-ments.

For separation of nucleic acids > 1000 bp we recomm-mend to use GeneCraft Agarose LSL 8100, whichoffers superior resolution of high molecular weightfragments.

GeneCraft Agarose S 18000 is manufactured and qua-lity-controlled under very stringent conditions and inaccordance with ISO 9000 certified quality system toensure conformance with the demanding require-ments of nucleic acid applications.

BESCHREIBUNG Für die präparative und analytische Trennungvon Nukleinsäuren < 1000 bp.

GeneCraft Agarose S 18000 weist eine ausgezeichneteund gleichbleibende Auflösung von Nukleinsäure-Frag-menten unter 1000 bp auf. Die Agarose ist für die Trenn-nung von DNA und RNA geeignet, die sich nur durch einpaar Basenpaare voneinander unterscheiden.

Die ausgezeichneten physikalischen Eigenschaften derGeneCraft Agarose S 18000 ermöglicht immer wiederdie Bestimmung von Erfolg und Größe amplifizierterFragmente, in-vito Translationen, Transkriptions-Kartie-rungen und kleiner Fragmente nach Restriktions-Ver-daung.

Darüber hinaus bietet GeneCraft Agarose S 18000 einehohe Gel-Festigkeit, was einfach zu handhabende, flexi-ble Gele für die Elektrophorese von kleinen DNA- undRNA-Fragmenten gewährleistet.

Für die Trennung von Nukleinsäuren > 1000 bp emp-fehlen wir GeneCraft Agarose LSL 8100, welche eineäußerst hohe Auflösung von Nukleinsäure-Fragmentenmit hohem Molekulargewicht bietet.

GeneCraft Agarose LSL 8100 ist unter äußerst strengenBedingungen nach ISO 9000 hergestellt und kontrolliertworden, um die Anforderungen im Einsatzbereich vonNukleinsäuren voll erfüllen zu können.

SPECIFICATION Gelling temperature 31 -39°C

(dynamic measurement in 4% solution)Melting temperature (4% solution) ≤ 92°CGel strength (4% geI) ≥ 1200 g/cm2

Electroendosmosis (-mr) 0.06-0.14Sulphate ≤ 0.15%Loss on drying ≤ 10%Residue on ignition ≤ 1.0% DNase and RNase activity and DNA bindingNone

COMPANION PRODUCTSGeneCraft Agarose LSL 8100, GeneCraft Agarose S-IM 18500

GC-BMA-18000100g

CATALOG NO.

82

SPECIFICATION Gelling temperature ≤ 36°C(dynamic measurement in 3% solution)Melting temperature (3% solution) ≤ 75°CGel strength (3% geI) ≥ 400g/cm2

Electroendosmosis (-mr) 0.02-0.05Sulphate ≤ 0.25%Loss on drying ≤ 10%Residue on ignition ≤ 1.0%DNase and RNase activity and DNA bindingNone

COMPANION PRODUCTSGeneCraft Agarose LSL 8100, GeneCraft Agarose S 18000

GeneCraft AGAROSE S-IM 18500

DESCRIPTION For high resolution and analytical separationof nucleic acids < 1000 bp.

GeneCraft agarose S-IM 18500 is an intermediatemelting temperature agarose which offers uniqueresolution capabilities. It is ideally suited for electro-phoretic separation and analysis of nucleic acid frag-ments below 1000 bp.

GeneCraft agarose S-IM 18500 forms a clear andhighly resolving gel which can separate DNA frag-ments down to a 2% difference between 200 bp and800 bp. In addition, it is easy to prepare and cast.

The high resolution capabilities of GeneCraft agaroseS-IM 18500 make a perfect choice for separation ofamplified products as well as STRs and tri- and tetra-nucleotide repeats.

For separation of nucleic acids > 1000 bp, we re-commend GeneCraft agarose LSL 8100 which offerssuperior resolution of high molecular weight DNAfragments.

GeneCraft agarose S-IM 18500 is manufactured andquality-controlled under very stringent conditions andin accordance with ISO 9000 certified quality systemto ensure conformance with the demanding require-ments of nucleic acid applications.

BESCHREIBUNG Für die präparative und analytische Trennungvon Nukleinsäuren < 1000 bp.

GeneCraft Agarose S-IM 18500 ist eine bei mittlerenTemperaturen schmelzende Agarose, die einzigartigeAuflösungseigenschaften besitzt. Diese Agarose ist fürElektrophoresen mit Nukleinsäure-Fragmenten unter1000 bp ideal geeignet.

GeneCraft Agarose S-IM 18500 bildet ein klares undhochauflösendes Gel, welches DNA-Fragmente einerGröße zwischen 200 und 800 bp mit bis zu 2%-igemUnterschied trennt.

Die hochauflösenden Eigenschaften der GeneCraftAgarose S-IM 18500 bietet eine perfekte Auswahl beider Trennung von amplifizierten Produkten, sowieSTRs und Tri- bzw. Tetranukleotid-Wiederholungen.

Für die Trennung von Nukleinsäuren > 1000 bp emp-fehlen wir GeneCraft Agarose LSL 8100, welche eineäußerst hohe Auflösung von Nukleinsäure-Fragmentenmit hohem Molekulargewicht bietet.

GeneCraft Agarose S-IM 18500 ist unter äußerststrengen Bedingungen nach ISO 9000 hergestellt undkontrolliert worden, um die Anforderungen im Einsatz-bereich von Nukleinsäuren voll erfüllen zu können.

GC-BMA-18500100g

CATALOG NO.

83DESCRIPTIONTo avoid usage of hazardous Ethidium bromide andimprove the gel resolution, we introduce the novelEthidium bromide (EtBr) bounded Agarose.

BESCHREIBUNGUm die gesundheitsgefährdende Handhabung mitEthidium Bromid zu verhindern, empfehlen wir dieneue mit Ethidium Bromid gebundene Agarose. Außer-dem verbessert dieses Produkt die Auflösung des Gels.

BOUNDED ETHIDIUM BROMIDE AGAROSE

1% - agarose 1,5% - agarose

A B A B A Chemical bounded EtBr-agarose gelsB Non bounded (standard) agarose gels with EtBr

DNA fragments- 1 kb and 100bp ladders

COMPANION PRODUCTSAgarose LSL 8100, Agarose S 18000, Agarose S-IM18500

GC-EtBrAgarose100 g

CATALOG NO.

84

Covalently-bound Streptavidin Uniform 1 Micron DiameterSuper-Paramagnetic

MAGNETIC STREPTAVIDIN-COATED PARTICLES

CARBOXYLATE-MODIFIED PARTICLES

MAGNETIC CARBOXYLATE-MODIFIED PARTICLES

DESCRIPTION Sera-Mag MG-SA microparticles have a highly uniquesurface. These particles combine the fast magneticresponse time of a 1 µM particle with the high biotinbinding capacities and fast reaction kinetics of a 0.3µM particle. Three levels of biotin binding capacity(low, medium and high) are available. Sera-Mag MG-SA microparticles are colloidally stable in the absenceof a magnetic field. When a magnetic force is applied,the particles are separated from suspension rapidlyand completely.

BESCHREIBUNGSera-Mag MG-SA Mikropartikel besitzen eine absoluteinzigartige Oberfläche. Diese Partikel vereinen dieschnellen magnetischen Reaktionszeiten eines 1 µMPartikels mit dem hohen Biotin-Bindungsvermögensund der schnellen Reaktions-Kinetik eines 0.3 µM Par-tikel. Drei verschiedene Stärken des Biotin-Bindungs-vermögens (niedrig, mittel und hoch) sind erhältlich.Sera-Mag MG-SA Mikropartikel sind außerhalb vonmagnetischen Feldern weiterhin stabil. Wird ein mag-netisches Feld angelegt, so können die Partikel schnellund restlos aus der Suspension entfernt werden.

DESCRIPTION Sera-Mag MG-CM microparticles have a highly uniquesurface. These particles combine the fast magneticresponse time of a 1 µM particle with the high biotinbinding capacities and fast reaction kinetics of a 0.3µM particle. Sera-Mag MG-CM microparticles are coll-loidally stable in the absence of a magnetic field.When a magnetic force is applied, the particles areseparated from suspension rapidly and completely.Covalent coupling to carboxyl groups on the surface iseasily accomplished using the Seradyn standard coup-ling technology.

BESCHREIBUNGSera-Mag MG-CM Mikropartikel besitzen eine absoluteinzigartige Oberfläche. Diese Partikel vereinen dieschnellen magnetischen Reaktionszeiten eines 1 µMPartikels mit dem hohen Biotin-Bindungsvermögensund der schnellen Reaktions-Kinetik eines 0.3 µM Parti-kel. Sera-Mag MG-CM Mikropartikel sind außerhalb vonmagnetischen Feldern weiterhin stabil. Wird ein magne-tisches Feld angelegt, so können die Partikel schnell undrestlos aus der Suspension entfernt werden. KovalenteBindungen an die Carboxyl-Gruppen auf der Oberflächewerden unter Verwendung der Standard-Techniken vonSeradyn perfekt ausgebildet.

Patent GrantedUniform 1 Micron DiameterSuper-Paramagnetic

STREPTAVIDIN-COATED PARTICLES

Cat. No. GC-SER-0011 ml 1%




For detailed technical information visit the Seradynweb page at www.seradyn.com

85DESCRIPTIONIn MagicTubes™ (pending patent) we realize a newapproach to the increase of PCR specificity and reac-tion product yield.The advantages of the MagicTubes™ can be especiall-ly revealed at the PCR amplification of „difficult“ tem-plates (GC-rich DNA sequences, templates with com-plex structure etc.), when performing the multiplexPCR and at the amplification of small quantities of theinitial DNA.MagicTubes™ are very easy to use, crystals of magne-sium salt are fixed on inner walls by a special polymer.This polymer provides conditions for strong „hot start“of PCR by means of magnesium ion diffusion regula-tion. The performing of the „hot start“ in MagicTu-bes™ instead of wax-barrier, manual, or antibody-mediated „hot starts“ to prevent nonspecific amplifi-cation and primer-dimer formation, provides enhan-cing the specifity and sensitivity of PCR. Since no extrareagents (as antibody) are added during setup, there isno risk of contamination of eucariotic DNA traces fromantibody solution or due to re-opening reaction tubesafter heating as in manual „hot start“.

MagicTubes™ FOR PERFECT PCR

BESCHREIBUNGMit den MagicTubes™ (zum Patent angemeldet) sindwir bei den Bemühungen Spezifität und Ausbeute vonPCR-Reaktionen zu erhöhen einen großen Schrittweitergekommen.Die herausragenden Vorteile der MagicTubes™ zeigensich besonders bei der Amplifikation „schwieriger“Templates (GC-reiche DNA-Sequenzen, Templates mitkomplexer Struktur etc.), bei der Durchführung vonMultiplex-PCR und der Amplifikation mit einer sehrgeringen Menge Template-DNA.MagicTubes™ sind in der Handhabung sehr einfach,Kristalle eines Magnesiumsalzes sind mit Hilfe einesspeziellen Polymers an der inneren Wand der Tubesfixiert. Dieses Polymer schafft aufgrund der Regulationmit diffundierenden Magnesium-Ionen stabile Bedin-gungen für eine „hot start“ PCR. Die Durchführungeiner „hot start“ in den MagicTubes™, statt der Ver-wendung von Wachs, einer manuellen oder Antikör-per-vermittelten „hot start“, um unspezifische Ampli-fikationen und die Bildung von Primer-Dimeren zu ver-hindern, verstärkt die Spezifität und Sensitivität derPCR. Da keine zusätzlichen Reagenzien (wie z.B. Anti-körper) zugegeben werden besteht kein Risiko derKontamination mit Spuren eukaryotischer DNA aus derAntikörper-Lösung bzw. aufgrund des nochmaligenÖffnens der Tubes nach dem Heizschritt wie es inmanuellen „hot start“ nötig ist.

APPLICATIONSObtain the „hot start“ effect using ordinary (i.e.unmodified by antibodies or chemically) DNA-polymerasesReduce nonspecific amplification product causedby low-temperature primingIncrease the reaction specifityIncrease the yield of the target PCR product

PROTOCOL1. Prepare the full reaction mixture with MagicBuff-

fer and Taq-polymerase.(If you use another enzyme, you should adjust thereaction buffer to your enzyme by AdjustingBufferapplication.)

2. Add the full reaction mixture into the MagicTube3. Incubate for 5 min. at 92-95 °C

4. Start cycling the PCR reaction:92-95°C – 30 sec.50-60°C – 30-45 sec.70-75°C – ≥ 30 sec.

NOTESIn order to achieve the best results, the PCR with Taq-polymerase should be performed with the 10x reactionMagic-buffer provided with MagicTubes™. This reac-tion-buffer was specially developed for the performingof the PCR with Taq-polymerase in MagicTubes™.MagicTubes™ can be used with various polymerasesand not only with Taq, as the reaction buffer can beeasily adjusted to the properties of the enzymes usedin the PCR.

86

In order to optimize your reaction mixture to the usedenzyme, the 10x Adjusting-buffer should be used withthe Magic-buffer (as shown in the table) for the reac-tion mixture preparation.

Optimization of the reaction mixture to used polyme-rase by 10x AdjustingBuffer application.(Final volume of PCR mixture – 100 mkL)

It is possible to prepare and store the PCR mixture atroom temperature.

ATTENTION! 1. The 10x reaction MagicBuffer provided is optimi-

zed for the application with Taq-polymerases2. The reaction „hot start“ is achieved by the 5-minu-

tes preheating at the temperature of 92-95 °Cduring the first PCR cycle

3. When the 10x MagicBuffer is used, Mg2+ shouldnot be added to the reaction mixture

4. The recommended volume of the reaction mixtureis 20-80 µl

MagicTubes™ FOR PERFECT PCR

OPTIMIZATION EXPERIMENTSWe found that optimization of the amplifications iscritical to get amplification products with the Magic-Tubes. In two optimization experiments we were ableto get amplification when we increased the amount ofTaq DNA Polymerase in each reaction and/or when weoptimized the magnesium level using both the 10xMagic Buffer and 10x Adjusting Buffer. The methodsand results for these two experiments are givenbelow.In these experiments the magnesium concentrationwas titrated using the 10x Magic buffer and 10xAdjusting buffer. The four different levels of magne-sium were generated as recommended in the Magic-Tubes literature: 1.5-2.0mM, 2.0-3.0mM, 3.0-4.0mM,and 4.0-5.0mM. Three levels of Taq DNA Polymerasewere used in the 50ml reactions: 1.25U, 2.5U and 4U.As a positive control, amplifications in Promega’sThermophilic DNA Polymerase buffer with 1.5mMmagnesium in Gene Amp tubes were included.

Amplification of a 1.5kb fragment from plas-mid DNA that requires hot start amplification.

Final concentration of the components:1x buffer200 µM each dNTP (dATP, dCTP, dGTP, dTTP)0.2 µM upstream primer0.2 µM downstream primer20 pg/µl plasmid templatein 50 µl reactions

The reactions were assembled at room temperatureand tubes were put into a room temperature thermalcycler.

THERMAL CYCLING CONDITIONS1 cycle (5 min. at 95 °C)30 cycles (30 sec. at 93 °C, 45 sec. at 60 °C, 1 min. at72 °C)1 cycle (5 min. at 72 °C)

INCREASED SPECIFITY OF PCRIN MAGICTUBESA 180 bp DNA-fragment wasamplified from 50 ng of humangenomic DNA for 30 cycles. „Hotstart“ was performed manually (theenzyme was brought in into the 94°C preheated reaction mixture)(lanes 1, 2) or with the use ofMagicTubes (lanes 3, 4). The PCRwas performed in the volume of 25µl containing 0.5 activity units(lanes 1, 3) or 2.0 activity units(lanes 2, 4) of Taq polymeraseaccordingly. Lane 5: molecularweight marker

Polymerases Mg2+ concentration Volume of 10x Volume of 10xrequired for ordinary PCR MagicBuffer (mkL) AdjustingBuffer (mkL)

Taq, Tth, BioTherm 1.5 – 2.0 mM 10 0Pfu, Pwo, Vent, 2.0 – 3.0 mM 4 6DeepVentKlenTaq, KlenTherm, 3.0 – 4.0 mM 2 8KlenThermN, SynergyAccuTherm 4.0 – 5.0 mM 0 10

1 2 3 4 5

180 bp

87

MAGICTUBES™ FOR PERFECT PCR

Figure 1Hot Start amplification using a template/primer pairthat requires hot start amplificationMagicTubes were used in lanes 1-16 and Gene Amptubes were used in lanes 17-20. Magnesium titrationswere done: lanes 1-4 Magic buffer only to give 1.5-2.0mM magnesium, lanes 5-8 Magic and Adjustingbuffers to give 2.0-3.0mM magnesium, lanes 9-12Magic and Adjusting buffers to give 3.0-4.0mM mag-nesium, lanes 13-16 Adjusting buffer only to give 4.0-5.0mM magnesium, lanes 17-20 Promega Thermophi-lic DNAP buffer with 1.5mM magnesium. Three levelsof Taq DNA Polymerase were used: lanes 1, 5, 9, 13,17 had 1.25U Taq DNA Polymerase/50ml reaction,lanes 2, 4, 6, 8, 10, 12, 14, 16, 18, 20 had 2.5U TaqDNA Polymerase/50ml reaction, lanes 3, 7, 11, 15,19had 4U Taq DNA Polymerase/50ml reaction. No tem-plate control reactions: lanes 4, 8, 12, 16, 20. Lane Mis pGEM DNA Markers.

Amplification of a 1.3kb beta-globin fragmentfrom human genomic DNA that does not requi-re hot start amplificationFinal concentration of the components:1x buffer200 µM each dNTP (dATP, dCTP, dGTP, dTTP)1 µM upstream primer1 µM downstream primer100 ng human genomic DNA template in 50 µl reac-tionsThe reactions were assembled at room temperatureand tubes were put into a room temperature thermalcycler.

THERMAL CYCLING CONDITIONS1 cycle (5 min. at 95 °C)35 cycles (30 sec. at 95 °C, 30 sec. at 60 °C, 1 min. at72 °C)1 cycle (5 min. at 72 °C)

Figure 2Amplification using a template/primer pair that doesnot require hot start amplification. MagicTubes wereused in lanes 1-16 and Gene Amp tubes were used inlanes 17-20. Magnesium titrations were done: lanes 1-4 Magic buffer only to give 1.5-2.0mM magnesium,

lanes 5-8 Magic and Adjusting buffers to give 2.0-3.0mM magnesium, lanes 9-12 Magic and Adjus-ting buffers to give 3.0-4.0mM magnesium, lanes 13-16 Adjusting buffer only to give 4.0-5.0mM magne-sium, lanes 17-20 Promega Thermophilic DNAP bufferwith 1.5mM magnesium. Three levels of Taq DNAPolymerase were used: lanes 1, 5, 9, 13, 17 had 1.25UTaq DNA Polymerase/50ml reaction, lanes 2, 4, 6, 8,10, 12, 14, 16, 18, 20 had 2.5U Taq DNA Polymera-se/50ml reaction, lanes 3, 7, 11, 15, 19 had 4U TaqDNA Polymerase/50ml reaction. No template controlreactions: lanes 4, 8, 12, 16, 20. Lane M is pGEMDNA Markers.

GC-059-02 GC-059-05100 pcs./bulk+buffer, 0,2 ml tube-volume 100 pcs./bulk+buffer, 0,5 ml tube-volume

CATALOG NO.

M 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 M

M 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 M

88GeneCraft distributes products of the companiesAlpha Laboratories Ltd. (UK) and Brand GmbH (Ger-many). If you are interested in closer informations ofthese companies, please contact us and we will bepleased to send you catalogs of our partners.

GeneCraft vertreibt Produkte der Firmen Alpha Labo-ratories Ltd. (UK) und Brand GmbH (Deutschland).Wenn Sie an weiteren Informationen über diese Fir-men interessiert sind, dann setzen Sie sich bitte mituns in Verbindung. Wir werden Ihnen dann gerneKataloge unserer Partnerfirmen zusenden.

LABORATORY CONSUMABLES

89

ALPHABETICAL PRODUCT INDEX

Product Page

LLadder, 100 bp 71Ladder, 1 kb 72Laemmli-buffer 78λ DNA 62

MMagicTubes™ for perfect PCR 85Marker 66-70MegaPure™ DNA purification kit 73Monoclonal IgG to Thermus

aquaticus DNA polymerase 74N

NeoTherm™ DNA polymerase 10Nucleotides 59-61

PParticles 84pBS-KS-EcoRV 66PCR-Grade H2O 12Pyrophosphatase, Tth 34

RRandom Prime labeling kit 58Restriction endonucleases 55Reverse transcriptase 48RNA polymerase, SP6 54RNase Inhibitor 49

SSDS-Tris-Glycin buffer 78SP6 RNA polymerase 54SupraTherm™ DNA polymerase 11Synergy™ DNA polymerase 38SynergyN™ DNA polymerase 39SynergyPlus™ DNA polymerase 41SynergyT™ DNA polymerase 40

TT7 RNA polymerase 54T-Vector System 63TBE buffer 78TEMED 79Treponema pallidum recombinant

antigen - tmpA 74Tth inorganic pyrophosphatase 34TthPlus™ DNA polymerase 42T4 polynucleotide kinase 51T4 DNA ligase 52Tth DNA ligase 53

UUracil-DNA glycosylase 62

Product Page

AAccuTherm™ DNA polymerase 36Acrylamide solutions 76Agarose LSL 8100 80Agarose S 18000 81Agarose S-IM 18500 82Amoniumpersulfate 79

BBioTherm™ DNA polymerase 5BioThermAB™ DNA polymerase 22BioThermBio™ DNA polymerase 17BioThermMix™ 8BioThermRed™ DNA polymerase 14BioThermStar™ DNA polymerase 18BioThermStarMix™ DNA polymerase 20BioThermT™ DNA polymerase 15Biotin-4-dUTP 61Biotin-11-dUTP 61Bounded ethidium bromide agarose 83BstE II-l-DNA marker 66

CCoverIt™ 12Crystal violet buffer 13

DDNA cycle sequencing kit 32DNA marker 66-70DNA polymerization mix 20 & 10 60DNA purification kit 73dNTP custom service 61dNTPs 60dNTP set 59

GGeneScript™ reverse transcriptase 48

HHot Start PCR compound 24Hot Start Taq monoclonal antibody 23Hpa II-pBS-DNA marker 67

IIPTG 75

KKlenow Fragment 50KlenTherm™ DNA polymerase 25KlenThermase™ DNA polymerase 31KlenThermaseN™ DNA polymerase 32KlenThermN™ DNA polymerase 28KlenThermPlatinum™ DNA polymerase 29

90

NAME DATUM

KUNDEN NR.

UNTERNEHMEN/ UNIVERSITÄT

ADRESSE

TEL./ FAX / E-MAIL

Alle Preise gelten zuzüglich der 16% Mehrwertsteuer.Für Bearbeitung, Verpackung, Versand und denumweltfreundlichen Rückholservice werden innerhalbDeutschlands Euro 15,- berechnet. Die Lieferungerfolgt gegen offene Rechnung. Rechnungen sind

FAX-BESTELLUNG

Adresse Raiffeisenstr. 12, 59348 LüdinghausenTel. +49 2591 794990Bestell-Fax +49 2591 8927989E-mail [email protected]

www.genecraft.de

GENECRAFT GmbH

innerhalb von 30 Tagen nach Rechnungsdatum zurZahlung fällig. Preise gemäß der jeweils aktuellenPreisliste (siehe Anlage).Bitte faxen Sie uns Ihre Bestellung zu oder schicken sieper E-mail oder Post an:

POS. BESTELL NR. PAKETGRÖSSE PREIS

GESAMTPREIS

BESTELLUNG

91Ab sofort erhalten Sie bei uns bis auf weiteres auf alleBrand Produkte 5% Rabatt.

Möchten Sie unsere Produkte einmal austesten? KeinProblem! Wir schicken Ihnen gerne von unseren Enzy-men, dNTPs, Markern und Kits kostenlose Proben zu.Selbstverständlich berechnen wir dabei keine Versand-und Verpackungsgebühr.

Bei Ihrer ersten Bestellung erhalten Sie von uns einenEinführungsrabatt von 20% - ganz gleich, was oderwieviel Sie bestellen.

Beim Kauf von insgesamt 5000 u thermostabiler DNAPolymerasen erhalten Sie von uns auf Wunsch kosten-los einen DNA Polymerization Mix 10.

Wir liefern Ihnen alle unsere Produkte in unterschied-lichen Packungsgrößen nach Ihrem Wunsch - selbst-verständlich ohne Preisaufschlag. Bei GeneCraft gibtes keine Mindestbestellmengen! Jede Bestellung iststets willkommen.

Selbstverständlich richten wir Ihnen auch gerne einKonto ein. Sollten Sie daran interessiert sein, so setzenSie sich doch einfach mit uns in Verbindung.

Wir sind ständig darum bemüht, unser Warenangebotzu erweitern. Alle Produkte, die nach Druck unseres

THAT´S NEW

Kataloges hinzugekommen sind, haben wir in derPreisliste mit NEW gekennzeichnet. Beschreibungen zudiesen Waren finden Sie als Beilagen in unserem Kata-log.

Produkte, die Sie vor 14:30 Uhr (Mo-Do) bestellen,werden noch am selben Tag durch UPS abgeholt undsind am nächsten Tag in Ihrem Labor. Für den Versandverwenden wir Kühlakkus, die zuverlässig dienotwendige Kühlung unserer Produkte während desTransports gewährleisten. Die wertvollen Kühl-Verpa-ckungen werden regelmässig wieder abgeholt und anuns retourniert. Das schont auch die Umwelt! Bittestellen Sie aus diesem Grunde die Boxen mit Kühlakk-kus für die Rückführung durch den Fahrer bereit.

Wir bitten Sie um Verständnis, dass wir die realenKosten für Verpackung und Versand nicht in unsererPreisliste verstecken, sondern die tatsächlichen Kostenvon € 15,- berechnen.

Alle Preise gelten zuzüglich der 16% Mehrwertsteuer.Für die Bearbeitung, Verpackung, den UPS-Versandkos-tenanteil und den umweltfreundlichen Rückholservicewerden € 15,- berechnet. Die Lieferung erfolgt gegenoffene Rechnung. Rechnungen sind innerhalb von 30Tagen nach Rechnungsdatum zur Zahlung fällig.

E N Z Y M E S F O R M O L E C U L A R B I O L O G Y

Adresse Raiffeisenstr. 12, 59348 LüdinghausenTel. +49 2591 794990Bestell-Fax +49 2591 8927989E-mail [email protected]

www.genecraft.de

GENECRAFT GmbH

ENZYMES FOR MOLECULAR BIOLOGY - GeneCraft · 2013-04-11 · Agarose S 18000 81 Agarose S-IM 18500...

Documents

Transcript of ENZYMES FOR MOLECULAR BIOLOGY - GeneCraft · 2013-04-11 · Agarose S 18000 81 Agarose S-IM 18500...