www.sciencemag.org/cgi/content/full/339/6120/704/DC1

Supplementary Materials for

Regulation of Flowering by Trehalose-6-Phosphate Signaling in Arabidopsis

thaliana

Vanessa Wahl,* Jathish Ponnu, Armin Schlereth, Stéphanie Arrivault, Tobias Langenecker,

Annika Franke, Regina Feil, John E. Lunn, Mark Stitt, Markus Schmid*

*To whom correspondence should be addressed. E-mail: vanessa.wahl@mpimp-golm.mpg.de (V.W.);

maschmid@tuebingen.mpg.de (M.S.)

Published 8 February 2013, Science 339, 704 (2013)

DOI: 10.1126/science.1230406

This PDF file includes:

Materials and Methods

Supplementary Text

Figs. S1 to S15

Tables S1 and S2

References

1

Materials and Methods

Plant material and growth conditions

All plants used in this work are of the Columbia (Col-0) accession. The tps1-2

GVG:TPS1 (referred to as ind-TPS1 #201 in the original publication) (18), ft-10, 35S:FT,

SUC2:FT, 35S:miR156, and 35:MIM156 lines have been described elsewhere

(Supplementary Text and Table S1). Genotypes were confirmed by PCR (Table S2). Plants

were grown in chambers at either 23°C, 65% relative humidity under a 2:1 mixture of Cool

White and Gro-Lux Wide Spectrum fluorescent lights, with a fluence rate of 125 to 175

μmol m-2

s-1

, or at 22°C, 65% relative humidity under Philips Fluors fluorescent lights

(F17T8/TL741), with a fluence rate of 130 to 160 µmol m-2

s-1

. Long-day (LD) and short-

day (SD) are defined as 16h light/8h dark and 8h light/16h dark, respectively.

Cloning

The generation of the amiRNA targeting TPS1 (amiR-TPS1) was done according to

the method described by Schwab and colleagues (31). Oligonucleotides that were used for

this purpose are listed in Table S2. The resulting EcoRI/BamHI fragment was introduced

into the Gateway® entry vector pJLBlue reverse to create pVW229 and recombined into a

pGREEN-II-based destination vector with a 35S promoter (pFK209)(10) using the

Gateway® LR clonase II Enzyme mix (Invitrogen, Carlsbad, CA) (pVW241). For

CLV3:TPS1 transgenic plants TPS1 was amplified from cDNA by a Pfu based PCR

reaction using gene specific oligonucleotides (Table S2), whereas an E. coli TPP, otsB SpeI

fragment was isolated from pDRIVE-otsB (15) to generate the CLV3:otsB transgenic line.

Both fragments were cloned into the Gateway® entry vector pJLBlue reverse to create

pVW099 and pVW406, respectively, and subsequently recombined into a destination

vector that harbors a CLV3 promoter (pFK202) resulting in pVW407 and pVW410.

RNA extraction, cDNA synthesis and qRT-PCR analysis

For the gene expression data reported in Fig. 1, Fig. 3, and figs. S3, S4, S6 and S12,

total RNA was isolated by phenol/chloroform extraction using TRIzol® Reagent (Life

Technologies, Darmstadt, Germany), followed by sodium acetate/glycogen-assisted ethanol

precipitation to improve RNA purity. First strand cDNA synthesis was carried out from

1µg of total RNA primed with oligo-(dT)18 using the RevertAid kit (Fermentas/Thermo

Scientific, St. Leon-Rot, Germany) in 20 µl reaction volume. The resulting single stranded

cDNA was diluted 5-fold and 4 µl were used as a template per reaction.

For the quantification of small RNAs (Fig. 3G), total RNA was reverse-transcribed

using a RevertAid kit (Fermentas/Thermo Scientific, St. Leon-Rot, Germany) following

the manufacturer’s protocol except that 1 µl of a 1:1 mixture of oligo-(dT)18 and the

miR156-specific stem-loop RT primer (G-30607;

GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACGTGCTC) was

used in the priming step. The stem-loop RT primer and the oligonucleotide pair used for

qRT-PCR analysis were designed according to Varkonyi-Gasic et al., 2007 (32).

qRT-PCR was performed using SYBR®

Green I (Life Technologies) reaction mixture

on an Opticon DNA engine (MJ Research/Biozym, Hessisch Oldendorf, Germany). The

thermal profile for the reaction was: 95°C for 5 min, 40 cycles of 95°C for 30 sec, 60°C for

30 sec and 72°C 20 sec, followed by 72°C for 7 min. Expression values were calculated by

2

the 2^- Cq method using TUBULIN (TUB2, AT5g62690) as a reference gene. Errors are

given as the lower (2^-( Cq-SD)) and upper (2^-( Cq+SD)) limit of the standard

deviation around the mean.

For the gene expression data reported in figs. S5 and S13, total RNA was isolated

using a modified phenol/chloroform extraction method according to Wan and Wilkins (33).

DNA digestion was performed on 9 µg RNA in a total reaction volume of 50 µl using 2

units of TURBO DNA-free™ (Ambion/Life Technologies, Darmstadt, Germany) according

to the manufacturer’s instructions. Reactions were incubated at 37°C for 45 min and

inactivated by addition of 0.2 volume of DNase inactivation reagent and incubation for 5

min at room temperature. The reactions were centrifuged at 10000 x g for 2 min, and the

supernatants were transferred to new tubes. Completeness of DNA digestion was confirmed

by qRT-PCR using primers for an intronic region of the At5g65080 gene. cDNA was

synthesized from the entire DNase digested RNA (50 µl) using SuperScript™III Reverse

Transcriptase (Invitrogen/Life Technologies, Darmstadt, Germany). The RNA was

denaturated at 65°C for 5 min, followed by incubation on ice for at least 1 min prior to

adding the remaining reagents. Reactions were incubated at 50°C for 45 min, then at 55°C

for 15 min, before being deactivated by heating at 70°C for 15 min. The relative cDNA

concentration and quality were determined using primers against POLYUBIQUITIN10

(UBI10, At4g05320) (34) and primers against the 3´ and 5´ regions of GAPDH

(At1g13440), respectively. Samples with Cq 5´GAPDH - Cq 3´GAPDH values > 2 were

excluded from further analyses. qRT-PCR was performed on two to four biological

replicates with four technical replicates each. TUBULIN (TUB2, At5g62690), SAND

family protein (SAND, At2g28390), POLYUBIQUITIN10 (UBI10, At4g05320) and

PROTEIN PHOSPHATASE 2A (PDF2, At1g13320) were used as reference genes

(reference gene index, RGI) (34). qRT-PCR was performed on an ABI Prism 7900 HT fast

real time PCR system (Applied Biosystems/Life Technologies, Darmstadt, Germany) in

384 well PCR plates with a total reaction volume of 5 µl (1 µl forward primer, 1 µl reverse

primer (0.5 µM, each), 0.5 µl cDNA and 2.5 µl Power SYBR® Green-PCR Master Mix

(Applied Biosystems/Life Technologies, Darmstadt, Germany) using the following

program: 50°C for 2 min, 95°C for 5 min, 40 cycles of 95°C for 15 sec and 60°C for 60 sec,

followed by 95°C for 15 sec, 60°C for 15 sec, 95°C for 15 sec. Steps 5, 6 and 7 were

introduced to record a dissociation or melting curve of each product in order to detect non-

specific amplification. Expression values were calculated by the 2^- Cq method using the

geometric mean of the Cq-values of the RGI as a reference. Deviation from the mean is

given as the lower (2^-( Cq-SD)) and upper (2^-( Cq+SD)) limit of the standard

deviation.

RNA in situ hybridization and histological staining

For RNA in situ hybridization plants were grown under LD or SD at 22°C. Meristem

samples were collected by removing all but the smallest leaves (vegetative and transition

meristem) or flowers (inflorescence meristem), fixed, dehydrated and embedded into wax

using an automated embedding system (ASP300S, Leica, Wetzlar, Germany). Sections of

8-10 µm thickness were prepared using a rotary microtome (Leica RM2265; Leica,

Wetzlar, Germany). Probes were synthesized with the DIG RNA Labeling Kit (Roche,

Mannheim, Germany) on PCR products of whole ORFs of the target genes, which had been

cloned into the pGEM®-T Easy vector (Promega, Madison, WI; Table S2 for oligo

3

sequences). For the otsB and the LFY probes the pDRIVE-otsB and a cloned LFY cDNA

were used as templates (15, 35). RNA in situ hybridizations were carried out as described

(36). Briefly, sections were incubated with Histoclear (Biozym Scientific GmbH, Hessisch

Oldendorf, Germany) and processed through an ethanol series. Proteinase K (Roche,

Mannheim, Germany) treated slides were hybridized at 55°C overnight. Slides were

blocked with 1% blocking reagent (Roche, Mannheim, Germany) in 1×TBS/0.1% Triton

X-100. Anti-DIG antibody (Roche, Mannheim, Germany) was used for immunological

detection and an NBT/BCIP stock solution (Roche, Mannheim, Germany) was diluted 1:50

in 10% polyvinyl alcohol (PVA) in TNM-50 for the colorimetric detection. For toluidine

blue staining reactions the sections were incubated with Histoclear and processed through

an ethanol series. The slides were then incubated in a 0.01% toluidine blue/sodium borate

solution for 1 min before they were briefly washed with water and incubated in 80%

ethanol for 2 min. Histological sections were imaged with an Olympus BX-51 microscope

equipped with a DC View III digital camera.

Microarray hybridization and analysis

RNA was extracted from dissected apices from Col-0 and tps1-2 GVG:TPS1 plants

grown for 20 days in SD and plants that had been induced to flower by shifting them to LD

for 5 days. All samples were collected at zeitgeber (ZT) 0-2 h to minimize differences in

expression of circadian or diurnally regulated genes. Apices were snap frozen in liquid

nitrogen and were stored at -80°C prior to total RNA extraction using the Plant RNeasy

Mini kit (Qiagen, Hilden, Germany). The MessageAmpTm

II-Biotin Enhanced, Single

Round aRNA Amplification Kit (Ambion/Life Technologies, Darmstadt, Germany) was

used in all subsequent steps to synthesize biotinylated cRNA according to the

manufacturer’s instructions. A total of 15 μg biotinylated cRNA was fragmented and the

quality was assessed by gel electrophoresis, using 2 μl of the fragmented cRNA.

Fragmented cRNA samples were hybridized to GeneChip Arabidopsis ATH1 arrays

(Affymetrix, Santa Clara, USA) according to the manufacturer's instructions. Washing and

staining of the GeneChip arrays were done following the EukGe-WS2_v4 protocol on an

Affymetrix GenChip Fluidics Station 450. The array chips were scanned using an

Affymetrix GeneChip Scanner 3000. Array data (.CEL files) were normalized using the

gcRMA package (37) implemented in R and differentially expressed transcripts were

identified by RankProducts analysis (38).

Metabolite measurements

For metabolite measurements whole rosettes of LD- or SD-grown plants were

harvested at the end of the night (EN) and/or at the end of the day (ED). Meristems were

manually excised using diamond knives (Scimed, Isselburg, Germany). T6P was extracted

with methanol/chloroform and measured using enzymatically authenticated standards and a

[2H]T6P internal standard to correct for ion suppression and matrix effects as previously

described (15). Sucrose was measured as described in (39) using an assay adapted to

microtitre plates (40).

For protein measurements the residual non-aqueous phase from the

methanol/chloroform extraction was evaporated to dryness in vacuo and the pellet

resuspended in 400 µl of 0.1 M NaOH. Protein content was assayed using the Bradford

method (41) with BSA as standard. At least two different volumes of extract (ranging

4

between 3-20 µl) were assayed, with duplicate aliquots for each volume, and the total

protein content in the extract was calculated by linear regression through zero.

Supplementary Text

Mutant alleles and transgenic lines used in this work

Two independent TPS1 mutant alleles (tps1-1 and tps1-2) have been isolated from a

transposon tagged mutant population by Eastmond and colleagues (16). Both mutants

displayed homozygous embryo lethality late during seed development, indicating that

functional TPS1 is required for embryogenesis (16). However, using a rescue construct that

facilitates dexamethasone-inducible overexpression of TPS1 from the constitutive

UBIQUITIN10 promoter, homozygous tps1-2 mutants could be recovered (18). Four

independent tps1-2 rescue lines (#201, #202, #211 and #213) that all carried single copies

of the inducible TPS1 (ind-TPS1) rescue construct were isolated and studied in more detail

(18). The homozygous mutant plants displayed retarded growth and did not initiate

flowering, unless dexamethasone was applied to induce TPS1 expression (18). In this work

we used progeny of the stable line ind-TPS1 #201, to which we refer as tps1-2 GVG:TPS1.

Later three weak tps1 alleles (tps1-11, tps1-12, and tps1-13) were isolated that were all late

flowering (17). Since also the 35S:amiR-TPS1 lines we have established in this work show

a similar phenotype we can safely conclude, that reduction of TPS1 function delays

flowering.

FT is a potent promoter of flowering (1) and loss of FT function has been shown to

delay flowering. ft-10 is a strong loss-of-function allele isolated from the GABI-Kat

collections of T-DNA insertion mutants (42, 43). Plants homozygous for the T-DNA

insertion in the FT gene flower late under LD (43). The late flowering phenotype of ft-10

could be rescued using a construct containing 5.7-kb of the FT upstream sequence fused to

the FT cDNA (44), indicating that loss of FT function was causing the delay in flowering.

The previously published transgenic lines used in this work (Table S1) originate from

large populations of independent T1 plants that all showed the same phenotype.

Furthermore, all these transgenes behave dominantly in genetic cross, making it unlikely

that the phenotypes observed are due to inadvertently knocking out genes by the T-DNA

insertion. The 35S:FT and SUC2:FT lines used in this work originate from populations of

29 independently obtained T1 plants each that were all early flowering (10). Early

flowering in response to FT misexpression from either the constitutive 35S promoter or the

phloem companion cell-specific SUC2 promoter has also been demonstrated by several

other laboratories (Table S1, Supporting references). Delayed flowering and changes in the

plastochron in response to miR156 overexpression have been described by two laboratories

independently of each other (45, 46). The 35S:miR156 line used in this work has been

selected from a population of more than 60 independently obtained T1 lines (45) that all

showed the typical miR156 overexpression phenotype. Conversely, early flowering can be

induced by overexpression of miR156 mimicry constructs from the 35S promoter (28, 29).

Examples of publications using these lines are listed in Table S1 (Supporting references).

5

Fig. S1.

Flowering time of transgenic lines established in this study. Histograms of flowering time

of (A) Col-0 wild-type and of independent (B) 35S:amiR-TPS1, (C) CLV3:TPS1, and (D)

CLV3:otsB T1 lines are shown. Flowering time is given as the number of leaves on the

main shoot. Total leaf number of individual plants used to generate the stable transgenic

lines analyzed in subsequent generations (Table 1) is indicated. Shaded areas indicate the

range of leaf number of Col-0.

6

Fig. S2.

Effect of 35:amiR-TPS1 on TPS1 mRNA levels in Arabidopsis thaliana rosettes.

Expression of TPS1 is strongly reduced in Col-0 (light grey) and 35S:amiR-TPS1 #6 (dark

grey) plants grown in LD. qRT-PCR was performed on whole rosettes harvested at ZT = 16

h (end of day, ED) 4, 6, 8, 10, 12, 14, 19 and 24 days after germination (DAG). Error bars,

upper and lower limit of the S.D. of four biological replicates with four technical repetitions

each.

7

Fig. S3.

T6P and sucrose content in the 35S:amiR-TPS1 line. (A and B) T6P and (C and D) sucrose

content in whole rosettes of Col-0 and 35S:amiR-TPS1 plants grown on MS medium

without sucrose under LD (16h light / 8h dark) conditions harvested 14 days after

germination at ZT = 4 h (4 h after lights on), normalized to (A and C) total protein

concentration or (B and D) fresh weight. Error bars, S.D.; significance was calculated using

Student’s t-test: ** p<0.01, *** p<0.001 based on four biological replicates.

8

Fig. S4.

Floral transition is delayed in the 35S:amiR-TPS1 lines. Emergence of flower primordia

was scored by RNA in situ hybridization with a LFY probe on longitudinal sections of wild-

type (Col-0) and in three independent 35S:amiR-TPS1 lines (#2, #5 and #6). Sections were

prepared from apices of plants grown under LD and harvested every second day from 4 to

14 days after germination (DAG) and every fifth day thereafter. Black stars indicate

meristem summit. Size bar, 100 µm.

9

Fig. S5.

Diurnal expression of GIGANTEA (GI) and TWIN SISTER OF FT (TSF) in tps1-2

GVG:TPS1. (A) Expression of GI and (B) TSF in 12- to 14-day-old LD grown Col-0

(closed circles) and tps1-2 GVG:TPS1 (open diamonds) rosettes. Expression was

determined by qRT-PCR using three biological replicates with three technical repetitions

for each sample. Shaded areas indicate dark periods. Error bars, upper and lower limit of

the S.D.

10

Fig. S6.

Photoperiod pathway genes in 35S:amiR-TPS1 #6 throughout development. Expression of

(A) GIGANTEA (GI), (B) CONSTANS (CO), (C) FLOWERING LOCUS T (FT), and (D)

TWIN SISTER OF FT (TSF) was determined by qRT-PCR in LD-grown Col-0 (light grey)

and 35S:amiR-TPS1 (dark grey). Whole rosettes were harvested at ZT = 16 h (end of day,

ED) 4, 6, 8, 10, 12, 14, 19 and 24 days after germination (DAG). Error bars indicate the

upper and lower limit of the S.D. of four biological replicates with four technical repetitions

each.

11

Fig. S7.

FLOWERING LOCUS T (FT) expression upon dexamethasone (DEX) application. 13-days-

old LD-grown Col-0 and tps1-2 GVG:TPS1 plants were treated with 1 µM dexamethasone

(+DEX) or mock treated (-DEX) and FT expression was measured (A) 24 h and (B) 48 h

after induction in rosettes leaves harvested at ZT=16 h (end of day, ED). Error bars indicate

the upper and lower limit of S.D. of three biological replicates with three technical

repetitions each.

12

Fig. S8.

TREHALOSE 6-PHOSPHATE SYNTHASE 1 (TPS1) expression at the shoot apex.

Toluidine blue staining of shoot apices (A-D). RNA in situ hybridization of LFY (E-H) and

TPS1 (I-L). Longitudinal sections were prepared from tissue of plants grown under SD

conditions for 30 days and then transferred to LD to synchronously induce flowering.

Samples were harvested 0 (A, E, I), 3 (B, F, J), 5 (C, G, K) and 7 (D, H, L) days after the

shift. Black stars indicate meristem summit; scale bar, 100 µm.

13

Fig. S9.

CLV3:TPS1 grown under SD conditions. (A) Wild-type (Col-0). (B) CLV3:TPS1 #7. (C)

CLV3:TPS1 #15. Pictures were taken 50 days after germination. Scale bar, 1 cm.

14

Fig. S10.

Mean expression of photoperiod pathway genes at the shoot meristem. Total RNA was

isolated from manually dissected shoot apical meristems of 21-day-old SD-grown Col-0

(light grey) and tps1-2 GVG:TPS1 (dark grey) plants, converted into biotinlyated cRNA

and hybridized to Affymetrix Arabidopsis Genome ATH1 arrays. The transcripts for two

important photoperiod pathway genes, FT and SOC1, were not detectable by microarray in

meristems of SD-grown plants. Minimum and maximum values obtained by hybridization

of two biological replicates, from which the mean expression was calculated, are indicated.

15

Fig. S11.

Mean expression of flowering regulators: ambient temperature and vernalization. RNA was

isolated from manually dissected meristems of 21-day-old SD-grown Col-0 (light grey) and

tps1-2 GVG:TPS1 (dark grey) plants, converted into biotinylated cRNA and hybridized to

Affymetrix Arabidopsis Genome ATH1 arrays. The maximum and minimum values of two

biological replicates, from which the mean expression was calculated, are indicated.

16

Fig. S12.

Mean expression of gibberellic acid biosynthesis and signaling genes at the shoot apical

meristem of 21-day-old SD-grown Col-0 (light grey) and tps1-2 GVG:TPS1 (dark grey)

plants. Expression was determined by hybridization to Affymetrix Arabidopsis Genome

ATH1 arrays. The minimum and maximum values obtained by hybridization biological

duplicate, from which the mean expression was calculated, are indicated.

17

Fig. S13.

Expression of integrator genes in tps1-2 GVG:TPS1. Expression of (A) SOC1 and (B) FUL

was determined by qRT-PCR in RNA extracted from 10-day-old whole rosettes and leaves

of 20- to 40-day-old LD-grown Col-0 (light grey) and tps1-2 GVG:TPS1 (dark grey) plants

(DAG, days after germination). Note that flowering in wild-type Col-0 occurs at about 10

days in LD (fig. S4). Error bars, upper and lower limit of the S.D. of the mean of three

biological replicates with two technical repetitions each.

18

Fig. S14.

Expression of integrator genes in 35S:amiR-TPS1. Expression of (A) SOC1 and (B) FUL

was determined by qRT-PCR in LD-grown Col-0 (light grey) and 35S:amiR-TPS1 (dark

grey). Whole rosettes were harvested at ED at 4, 6, 8, 10, 12, 14, 19 and 24 days after

germination (DAG). Note that flowering in wild-type Col-0 occurs at about 10 days in LD

(fig. S4). Error bars indicate the upper and lower limit of the S.D. of four biological

replicates with four technical repetitions each.

19

Fig. S15.

A minimal model of the dual role of TPS1/T6P in the regulation of flowering time.

Signaling from the T6P pathway is absolutely essential for expression of FT and TSF in the

phloem companion cells even under otherwise inductive photoperiod. In addition,

TPS1/T6P signaling regulates the expression of SPL genes at the shoot apical meristem

both directly and via miR156. Together, these events ensure that plants make the transition

to flowering only after day length exceeds a certain threshold and carbohydrates are

available to support the energy-demanding processes of flowering and seed production.

Solid lines, direct interactions; dashed line, indirect interactions; transport of FT protein

(florigen) and sucrose from leaves to the shoot apical meristem is indicated.

20

Table S1.

Mutants and transgenic lines used in this study.

Line Source Supporting References Comment

tps1-2 GVG:TPS1 (18) ind-TPS1 #201 (18)

ft-10 (42, 43) (9, 10, 44, 47-49)

35S:FT (10) (4, 5, 48, 49)

SUC2:FT (10) (8, 9, 47, 49)

35S:miR156 (45) (25, 27, 46, 48, 49)

35S:MIM156 (28, 29) (25, 27, 49)

35S:amiR-TPS1 this study

CLV3:TPS1 this study

CLV3:otsB this study

21

Table S2.

Oligonucleotides used in this study.

Gene (AGI) Oligo Sequence (5’ -> 3’) Comment

Oligonucleotides used for cloning

amiR-TPS1

G-6761

G-6762

G-6763

G-6764

GATCTTCGGGGACCTCAAGTGGTTCTCTCTTTTGTATTCC

GAACCACTTGAGGTCCCCGAAGATCAAAGAGAATCAATGA

GAACAACTTGAGGTCGCCGAAGTTCACAGGTCGTGATATG

GAACTTCGGCGACCTCAAGTTGTTCTACATATATATTCCT

TPS1

At1g78580

G-3908

G-3909

GCGGGTACCATGCCTGGAAATAAGTACAACTG

CGCTCTAGATTAAGGTGAGGAAGTGGTGTCAG

Oligonucleotides used for genotyping

TPS1

At1g78580

G-22756

G-22758

GACACTTGGTTTCTTGATATGTCCTG

GCTGTCTTGGATACTGAACCAGT

tps1-2

At1g78580

G-19968

G-22758

GAGCGTCGGTCCCCACACTTCTATAC

GCTGTCTTGGATACTGAACCAGT

35S:MIM156 G-0474

G-2225

AGAACACGGGGGACGAGCT

CGCATATCTCATTAAAGCAGG

FT

At1g65480

P-0230

P-0231

AGGGTTGCTAGGACTTGGAACA

ATATTGATGAATCTCTGTTGTGG

ft-10

At1g65480

P-0230

G-2081

AGGGTTGCTAGGACTTGGAACA

CCCATTTGGACGTGAATGTAGACAC

Oligonucleotides used for qRT-PCR (Figs. 1, 3; Figs. S5, S7, S13)

TUB2

AT5g62690

N-0078

N-0079

GAGCCTTACAACGCTACTCTGTCTGTC

CACCAGACATAGTAGCAGAAATCAAG

165 bp

E = 2.014

GI

At1g22770

G-30970

G-30971

AGCAGTGGTCGACGGTTTATC

ATGGGTATGGAGCTTTGGTTC

141 bp

E = 1.936

CO

At5g15840

G-30962

G-30963

CACTACAACGACAATGGTTCC

GGTCAGGTTGTTGCTCTACTG

142 bp

E = 1.988

FT

At1G65480

G-30966

G-30967

CCCTGCTACAACTGGAACAAC

CACCCTGGTGCATACACTG

135 bp

E = 1.980

TSF

At4g20370

G-33510

G-33511

TGCCACCACTGGAAATGCC

CGTTTGTCTTCCGAGTTGCC

113 bp

E = 2.056

SPL3

At2g33810

G-30976

G-30977

CTCATGTTCGGATCTCTGGTC

TTTCCGCCTTCTCTCGTTGTG

134 bp

E = 1.917

SPL4

At1g53160

G-30978

G-30979

CTCTCAGGACTTAACCAACGC

CAGAGCTCTTCCTTCTTCGC

130 bp

E = 2.120

SPL5

At3g15270

G-31000

G-31001

AAGGCATCTGCTGCGACTGTTG

TCCTCCTCCTCTCATTGTGTCC

139 bp

E = 2.027

miR156 G-30606

G-30608 GTGCAGGGTCCGAGGT

GCGGCGGTGACAGAAGAGAGT 60 bp

E = 1.917

SOC1 At2g45660

G-30998

G-30999

AAACGAGAAGCTCTCTGAAAAG

AAGAACAAGGTAACCCAATGAAC

145 bp

E = 2.035

FUL

At5g60910

G-00654

G-00655

TTGCAAGATCACAACAATTCGCTTCTC

GAGAGTTTGGTTCCGTCAACGACGATG

204 bp

E = 1.926

Oligonucleotides used for qRT-PCR (Figs. S2, S6, S14)

UBI

At4g05320

P-0348

P-0349

CACACTCCACTTGGTCTTGCGT

TGGTCTTTCCGGTGAGAGTCTTCA

71 bp

E = 1.982

22

TUB2

At5g62690

P-0344

P-0345

GAGCCTTACAACGCTACTCTGTCTGTC

ACACCAGACATAGTAGCAGAAATCAAG

167 bp

E = 1.965

SAND

At2g28390

P-0346

P-0347

AACTCTATGCAGCATTTGATCCACT

TGATTGCATATCTTTATCGCCATC

61 bp

E = 1.976

PDF2

At1g13320

P-0350

P-0351

TAACGTGGCCAAAATGATGC

GTTCTCCACAACCGCTTGGT

61 bp

E = 1.982

TPS1

At1g78580

P-0596

P-0597

GAAACTCAAGACGTCCTTCACCAG

TCTAGCATTGGTGCGAGTACGAC

107 bp

E = 1.989

GI

At1g22770

P-0422

P-0423

AACCAAAGCTCCATACCCATCA

GCGTTGAAGAATCGATAGGACG

92 bp

E = 1.976

CO

At5g15840

P-370

P-371

AACAGCTTCACACCCAAGAACG

GGTCAGGTTGTTGCTCTACTGTCC

53 bp

E = 1.968

FT

At1G65480

P-414

P-415

TGGAACAACCTTTGGCAATGAG

CGACACGATGAATTCCTGCAG

71 bp

E = 1.954

TSF

At4g20370

P-570

P-571

GAAATGCCTTTGGCAATGAGGT

CCGGAACAATACCAACACAATACG

86 bp

E = 1.958

SOC1

At2g45660

P-532

P-533

TTGAGCAGCTCAAGCAAAAGGA

TCCCCACTTTTCAGAGAGCTTCTC

68 bp

E = 1.975

FUL

At5g60910

P-416

P-417

GTAACCTCCTCCAGAGATGGCTTT

ACGTAACATCCAAGCCGGAAG

105 bp

E = 1.970

E, primer pair efficiency.

References

1. A. Srikanth, M. Schmid, Regulation of flowering time: All roads lead to Rome. Cell. Mol. Life

Sci. 68, 2013 (2011). doi:10.1007/s00018-011-0673-y Medline

2. M. Abe et al., FD, a bZIP protein mediating signals from the floral pathway integrator FT at

the shoot apex. Science 309, 1052 (2005). doi:10.1126/science.1115983 Medline

3. L. Corbesier, I. Gadisseur, G. Silvestre, A. Jacqmard, G. Bernier, Design in Arabidopsis

thaliana of a synchronous system of floral induction by one long day. Plant J. 9, 947

(1996). doi:10.1046/j.1365-313X.1996.9060947.x Medline

4. I. Kardailsky et al., Activation tagging of the floral inducer FT. Science 286, 1962 (1999).

doi:10.1126/science.286.5446.1962 Medline

5. Y. Kobayashi, H. Kaya, K. Goto, M. Iwabuchi, T. Araki, A pair of related genes with

antagonistic roles in mediating flowering signals. Science 286, 1960 (1999).

doi:10.1126/science.286.5446.1960 Medline

6. P. Suárez-López et al., CONSTANS mediates between the circadian clock and the control of

flowering in Arabidopsis. Nature 410, 1116 (2001). doi:10.1038/35074138 Medline

7. P. A. Wigge et al., Integration of spatial and temporal information during floral induction in

Arabidopsis. Science 309, 1056 (2005). doi:10.1126/science.1114358 Medline

8. L. Corbesier et al., FT protein movement contributes to long-distance signaling in floral

induction of Arabidopsis. Science 316, 1030 (2007). doi:10.1126/science.1141752

Medline

9. K. E. Jaeger, P. A. Wigge, FT protein acts as a long-range signal in Arabidopsis. Curr. Biol.

17, 1050 (2007). doi:10.1016/j.cub.2007.05.008 Medline

10. J. Mathieu, N. Warthmann, F. Küttner, M. Schmid, Export of FT protein from phloem

companion cells is sufficient for floral induction in Arabidopsis. Curr. Biol. 17, 1055

(2007). doi:10.1016/j.cub.2007.05.009 Medline

11. S. Tamaki, S. Matsuo, H. L. Wong, S. Yokoi, K. Shimamoto, Hd3a protein is a mobile

flowering signal in rice. Science 316, 1033 (2007). doi:10.1126/science.1141753 Medline

12. L. Corbesier, P. Lejeune, G. Bernier, The role of carbohydrates in the induction of flowering

in Arabidopsis thaliana: Comparison between the wild type and a starchless mutant.

Planta 206, 131 (1998). doi:10.1007/s004250050383 Medline

13. M. J. Paul, L. F. Primavesi, D. Jhurreea, Y. Zhang, Trehalose metabolism and signaling.

Annu. Rev. Plant Biol. 59, 417 (2008). doi:10.1146/annurev.arplant.59.032607.092945

Medline

14. J. Ponnu, V. Wahl, M. Schmid, Trehalose-6-phosphate: Connecting plant metabolism and

development. Front. Plant Physiol. 2, 70 (2011). doi:10.3389/fpls.2011.00070

15. J. E. Lunn et al., Sugar-induced increases in trehalose 6-phosphate are correlated with redox

activation of ADPglucose pyrophosphorylase and higher rates of starch synthesis in

Arabidopsis thaliana. Biochem. J. 397, 139 (2006). doi:10.1042/BJ20060083 Medline

16. P. J. Eastmond et al., Trehalose-6-phosphate synthase 1, which catalyses the first step in

trehalose synthesis, is essential for Arabidopsis embryo maturation. Plant J. 29, 225

(2002). doi:10.1046/j.1365-313x.2002.01220.x Medline

17. L. D. Gómez, A. Gilday, R. Feil, J. E. Lunn, I. A. Graham, AtTPS1-mediated trehalose 6-

phosphate synthesis is essential for embryogenic and vegetative growth and

responsiveness to ABA in germinating seeds and stomatal guard cells. Plant J. 64, 1

(2010). Medline

18. A. J. H. van Dijken, H. Schluepmann, S. C. Smeekens, Arabidopsis trehalose-6-phosphate

synthase 1 is essential for normal vegetative growth and transition to flowering. Plant

Physiol. 135, 969 (2004). doi:10.1104/pp.104.039743 Medline

19. See supplementary materials on Science Online.

20. T. Imaizumi, T. F. Schultz, F. G. Harmon, L. A. Ho, S. A. Kay, FKF1 F-box protein

mediates cyclic degradation of a repressor of CONSTANS in Arabidopsis. Science 309,

293 (2005). doi:10.1126/science.1110586 Medline

21. F. Valverde et al., Photoreceptor regulation of CONSTANS protein in photoperiodic

flowering. Science 303, 1003 (2004). doi:10.1126/science.1091761 Medline

22. A. Yamaguchi, Y. Kobayashi, K. Goto, M. Abe, T. Araki, TWIN SISTER OF FT (TSF) acts

as a floral pathway integrator redundantly with FT. Plant Cell Physiol. 46, 1175 (2005).

doi:10.1093/pcp/pci151 Medline

23. G. Cardon et al., Molecular characterisation of the Arabidopsis SBP-box genes. Gene 237, 91

(1999). doi:10.1016/S0378-1119(99)00308-X Medline

24. G. H. Cardon, S. Höhmann, K. Nettesheim, H. Saedler, P. Huijser, Functional analysis of the

Arabidopsis thaliana SBP-box gene SPL3: A novel gene involved in the floral transition.

Plant J. 12, 367 (1997). doi:10.1046/j.1365-313X.1997.12020367.x Medline

25. J. W. Wang, B. Czech, D. Weigel, miR156-regulated SPL transcription factors define an

endogenous flowering pathway in Arabidopsis thaliana. Cell 138, 738 (2009).

doi:10.1016/j.cell.2009.06.014 Medline

26. Z. Yang et al., Comparative study of SBP-box gene family in Arabidopsis and rice. Gene

407, 1 (2008). doi:10.1016/j.gene.2007.02.034 Medline

27. G. Wu et al., The sequential action of miR156 and miR172 regulates developmental timing

in Arabidopsis. Cell 138, 750 (2009). doi:10.1016/j.cell.2009.06.031 Medline

28. J. M. Franco-Zorrilla et al., Target mimicry provides a new mechanism for regulation of

microRNA activity. Nat. Genet. 39, 1033 (2007). doi:10.1038/ng2079 Medline

29. M. Todesco, I. Rubio-Somoza, J. Paz-Ares, D. Weigel, A collection of target mimics for

comprehensive analysis of microRNA function in Arabidopsis thaliana. PLoS Genet. 6,

e1001031 (2010). doi:10.1371/journal.pgen.1001031 Medline

30. A. Yamaguchi et al., The microRNA-regulated SBP-Box transcription factor SPL3 is a direct

upstream activator of LEAFY, FRUITFULL, and APETALA1. Dev. Cell 17, 268 (2009).

doi:10.1016/j.devcel.2009.06.007 Medline

31. R. Schwab, S. Ossowski, M. Riester, N. Warthmann, D. Weigel, Highly specific gene

silencing by artificial microRNAs in Arabidopsis. Plant Cell 18, 1121 (2006).

doi:10.1105/tpc.105.039834 Medline

32. E. Varkonyi-Gasic, R. Wu, M. Wood, E. F. Walton, R. P. Hellens, Protocol: A highly

sensitive RT-PCR method for detection and quantification of microRNAs. Plant Methods

3, 12 (2007). doi:10.1186/1746-4811-3-12 Medline

33. C. Y. Wan, T. A. Wilkins, A modified hot borate method significantly enhances the yield of

high-quality RNA from cotton (Gossypium hirsutum L.). Anal. Biochem. 223, 7 (1994).

doi:10.1006/abio.1994.1538 Medline

34. T. Czechowski, M. Stitt, T. Altmann, M. K. Udvardi, W. R. Scheible, Genome-wide

identification and testing of superior reference genes for transcript normalization in

Arabidopsis. Plant Physiol. 139, 5 (2005). doi:10.1104/pp.105.063743 Medline

35. D. Weigel, J. Alvarez, D. R. Smyth, M. F. Yanofsky, E. M. Meyerowitz, LEAFY controls

floral meristem identity in Arabidopsis. Cell 69, 843 (1992). doi:10.1016/0092-

8674(92)90295-N Medline

36. D. Weigel, J. Glazebrook, Arabidopsis: A Laboratory Manual (Cold Spring Harbor

Laboratory Press, Cold Spring Harbor, NY, 2002).

37. Z. Wu, R. A. Irizarry, R. Gentleman, F. Martinez-Murillo, F. Spencer, A model-based

background adjustment for oligonucleotide expression arrays. J. Am. Stat. Assoc. 99, 909

(2004). doi:10.1198/016214504000000683

38. R. Breitling, P. Armengaud, A. Amtmann, P. Herzyk, Rank products: A simple, yet

powerful, new method to detect differentially regulated genes in replicated microarray

experiments. FEBS Lett. 573, 83 (2004). doi:10.1016/j.febslet.2004.07.055 Medline

39. M. G. Jones, W. H. Outlaw, O. H. Lowry, Enzymic assay of 10 to 10 moles of sucrose in

plant tissues. Plant Physiol. 60, 379 (1977). doi:10.1104/pp.60.3.379 Medline

40. Y. Gibon, H. Vigeolas, A. Tiessen, P. Geigenberger, M. Stitt, Sensitive and high throughput

metabolite assays for inorganic pyrophosphate, ADPGlc, nucleotide phosphates, and

glycolytic intermediates based on a novel enzymic cycling system. Plant J. 30, 221

(2002). doi:10.1046/j.1365-313X.2001.01278.x Medline

41. M. M. Bradford, A rapid and sensitive method for the quantitation of microgram quantities of

protein utilizing the principle of protein-dye binding. Anal. Biochem. 72, 248 (1976).

doi:10.1016/0003-2697(76)90527-3 Medline

42. M. G. Rosso et al., An Arabidopsis thaliana T-DNA mutagenized population (GABI-Kat) for

flanking sequence tag-based reverse genetics. Plant Mol. Biol. 53, 247 (2003).

doi:10.1023/B:PLAN.0000009297.37235.4a Medline

43. S. K. Yoo et al., CONSTANS activates SUPPRESSOR OF OVEREXPRESSION OF

CONSTANS 1 through FLOWERING LOCUS T to promote flowering in Arabidopsis.

Plant Physiol. 139, 770 (2005). doi:10.1104/pp.105.066928 Medline

44. J. Adrian et al., cis-Regulatory elements and chromatin state coordinately control temporal

and spatial expression of FLOWERING LOCUS T in Arabidopsis. Plant Cell 22, 1425

(2010). doi:10.1105/tpc.110.074682 Medline

45. R. Schwab et al., Specific effects of microRNAs on the plant transcriptome. Dev. Cell 8, 517

(2005). doi:10.1016/j.devcel.2005.01.018 Medline

46. G. Wu, R. S. Poethig, Temporal regulation of shoot development in Arabidopsis thaliana by

miR156 and its target SPL3. Development 133, 3539 (2006). doi:10.1242/dev.02521

Medline

47. S. Jang, S. Torti, G. Coupland, Genetic and spatial interactions between FT, TSF and SVP

during the early stages of floral induction in Arabidopsis. Plant J. 60, 614 (2009).

doi:10.1111/j.1365-313X.2009.03986.x Medline

48. J. H. Jung, Y. Ju, P. J. Seo, J. H. Lee, C. M. Park, The SOC1-SPL module integrates

photoperiod and gibberellic acid signals to control flowering time in Arabidopsis. Plant J.

69, 577 (2012). doi:10.1111/j.1365-313X.2011.04813.x Medline

49. J. J. Kim et al., The microRNA156-SQUAMOSA PROMOTER BINDING PROTEIN-

LIKE3 module regulates ambient temperature-responsive flowering via FLOWERING

LOCUS T in Arabidopsis. Plant Physiol. 159, 461 (2012). doi:10.1104/pp.111.192369

Medline