1

RESEARCH ARTICLE 1 2

Thylakoid Membrane Architecture in Synechocystis Depends on CurT a 3 Homolog of the Granal CURVATURE THYLAKOID1 Proteins 4

5 Steffen Heinza Anna Rasta Lin Shaoa1 Andrian Gutub Irene L Guumlgelcd Eiri Heynoef 6 Mathias Labsg2 Birgit Rengstla Stefania Violag3 Marc M Nowaczyke Dario Leisterg 7 Joumlrg Nickelsena4 8

9 aMolekulare Pflanzenwissenschaften cBiochemie und Physiologie der Pflanzen and 10 gMolekularbiologie der Pflanzen Ludwig-Maximilians-Universitaumlt Muumlnchen Biozentrum 11 Groszlighaderner Str 2-4 82152 Planegg-Martinsried Germany 12 bDepartment of Molecular and Cellular Biology FAS Center for Systems Biology Harvard 13 University 52 Oxford Street Cambridge MA 02138 USA 14 dMunich Centre for Integrated Protein Science CiPSM Ludwig-Maximilians-Universitaumlt 15 Muumlnchen Department of Chemistry and Biochemistry Butenandtstr 5 ndash 13 81377 Munich 16 Germany 17 eBiochemie der Pflanzen Ruhr-Universitaumlt Bochum Universitaumltsstr 150 44801 Bochum 18 Germany 19 fMax-Planck-Institut fuumlr Chemische Energiekonversion Stiftstrasse 34-36 45470 Muumllheim an 20 der Ruhr Germany 21

22 Short title CurT shapes cyanobacterial thylakoids 23

24 One-sentence summary 25 CurT is required for shaping the thylakoid membrane architecture in Synechocystis and 26 mediates osmotic stress responses 27

28 29

The author responsible for distribution of materials integral to the findings presented in this 30 article in accordance with the policy described in the Instructions for Authors 31 (wwwplantcellorg) is Joumlrg Nickelsen (joergnickelsenlrzuni-muenchende) 32

33 34

1 Current address National Key Laboratory of Crop Genetic Improvement Huazhong Agricultural University Wuhan 430070 China 2 Current address KWS SAAT SE Gateway Research Center St Louis MO USA 3 Current address UMR7141 CNRSUniversiteacute Pierre et Marie Curie Institut de Biologie Physico-Chimique 13 Rue Pierre et Marie Curie 75005 Paris France 4 Address correspondence to Joumlrg Nickelsen Biozentrum LMU Muumlnchen Groszlighaderner Str 2-4 82152 Planegg-Martinsried Germany Tel +49 89 2180 74773 Fax +49 89 2180 9974773 e-mail joergnickelsenlrzuni-muenchende

Plant Cell Advance Publication Published on August 19 2016 doi101105tpc1600491

copy2016 American Society of Plant Biologists All Rights Reserved

2

Abstract 35 36

Photosynthesis occurs in thylakoids a highly specialized membrane system In the 37 cyanobacterium Synechocystis sp PCC 6803 (hereafter Synechocystis 6803) the thylakoids 38 are arranged parallel to the plasma membrane and occasionally converge towards it to form 39 biogenesis centers The initial steps in photosystem II (PSII) assembly are thought to take 40 place in these regions which contain a membrane subcompartment harboring the early 41 assembly factor PratA and are referred to as PratA-defined membranes (PDMs) Loss of 42 CurT the Synechocystis 6803 homolog of Arabidopsis thaliana grana-shaping proteins of the 43 CURVATURE THYLAKOID1 family results in disrupted thylakoid organization and the 44 absence of biogenesis centers As a consequence PSII is less efficiently assembled and 45 accumulates to only 50 of wild-type levels CurT induces membrane curvature in vitro and 46 is distributed all over the thylakoids with local concentrations at biogenesis centers There it 47 forms a sophisticated tubular network at the cell periphery as revealed by live-cell imaging 48 CurT is part of several high molecular-weight complexes and Blue NativeSDS-PAGE and 49 isoelectric focusing demonstrated that different isoforms associate with PDMs and thylakoids 50 Moreover CurT deficiency enhances sensitivity to osmotic stress adding a level of 51 complexity to CurT function We propose that CurT is crucial for the differentiation of 52 membrane architecture including the formation of PSII-related biogenesis centers in 53 Synechocystis 6803 54

55 Introduction 56 57

Oxygenic photosynthesis originated in cyanobacteria more than 24 billion years ago 58

and went on to transform Earthrsquos atmosphere and biosphere The underlying process of light-59

driven photosynthetic electron transport is mediated by multiproteinpigment complexes 60

which are located within a specialized system of membrane sheets termed thylakoids During 61

the evolutionary transition from cyanobacteria to present-day chloroplasts this system has 62

undergone substantial diversification (Mullineaux 2005 Allen et al 2011) Contemporary 63

forms range from undifferentiated thylakoids in cyanobacteria to elaborate systems that are 64

differentiated into grana and stroma regions in plant chloroplasts (Mullineaux 2005) 65

Despite this increase in complexity over the course of evolution even ldquosimplerdquo 66

cyanobacterial systems exhibit compositional and functional membrane heterogeneity 67

(Nickelsen and Rengstl 2013) Perhaps the most striking example is the cyanobacterium 68

Gloeobacter violaceus which lacks internal thylakoids and organizes its photosynthetic 69

complexes in distinct patches within the plasma membrane (Rexroth et al 2011) Moreover 70

spatial separation between developing and functional thylakoids has been observed in the 71

model cyanobacterium Synechocystis sp PCC 6803 (hereafter Synechocystis 6803) 72

Immunolocalization of the photosystem II (PSII) assembly factor PratA (for processing-73

associated TPR protein) in fractionated membranes and examination of ultrathin sections by 74

immunogold electron microscopy have revealed specialized PratA-defined membrane (PDM) 75

3

regions forming biogenic centers at peripheral sites in cells where thylakoids converge 76

(Schottkowski et al 2009b Stengel et al 2012) 77

Some details of the ultrastructure of these centers have begun to emerge (Stengel et al 78

2012) Some of the convergence areas are composed of a rod-like structure ndash previously 79

named the ldquothylakoid centerrdquo ndash which is in turn surrounded by membranous material within 80

which thylakoid lamellae appear to originate (van de Meene et al 2006 Stengel et al 2012 81

Nickelsen and Zerges 2013 Ruumltgers and Schroda 2013) A current working model for these 82

biogenesis centers postulates that the initial steps in the assembly of photosynthetic complexes 83

ndash and in particular photosystem II (PSII) ndash take place at the biogenic PDMs Subsequently 84

pre-complexes migrate laterally into thylakoid lamellae where their assembly is completed 85

(Nickelsen and Rengstl 2013) Recently evidence based on the subcellular distribution of the 86

D1 degradation-related FtsH protease and the PSII repair factor Slr0151 (Yang et al 2014 87

Sacharz et al 2015 Rast et al 2016) has been obtained that maintenance ie the repair of 88

PSII is also localized at or near these areas However whether or not plasma and thylakoid 89

membranes fuse at these sites has not yet been resolved (Liberton et al 2006 van de Meene 90

et al 2006 van de Meene et al 2012) 91

Only limited information is available on the spatial organization of thylakoid 92

membrane biogenesis in land plants Their chloroplasts harbor a dynamic thylakoid membrane 93

system which is comprised of non-appressed stromal thylakoids and appressed grana regions 94

Stromal thylakoids are likely to represent sites where membrane proteins are synthesized and 95

assembled within the membrane (Yamamoto et al 1981 Danielsson et al 2006) while the 96

physicochemical forces driving grana formation are still a matter of debate (Nevo et al 2012 97

Kirchhoff 2013 Pribil et al 2014) It has however been proposed that stromal moieties of 98

LHCII determine membrane stacking of adjacent thylakoid disks (Fristedt et al 2009 Daum 99

et al 2010 Anderson et al 2012) Moreover a family of thylakoid-shaping proteins with 100

four members named CURVATURE THYLAKOID1A-D (CURT1A-D) has been identified 101

in Arabidopsis thaliana (Armbruster et al 2013) CURT1 proteins localize to grana margins 102

where they induce membrane bending thereby determining the architecture of the thylakoid 103

network (Pribil et al 2014) Intriguingly cyanobacteria whose thylakoids do not differentiate 104

into grana regions also contain a single CURT1 homolog (Armbruster et al 2013) Here we 105

report on the characterization of this homolog CurT from Synechocystis 6803 Our data 106

reveal that the cyanobacterial protein is essential for the shaping of thylakoid membranes and 107

thereby promotes efficient assembly of PSII at the cell periphery Our data argue for an 108

ancient membrane-curving activity of CURT1-like proteins which are necessary to form an 109

4

efficient thylakoid system in cyanobacteria as well as having a critical role in the response to 110

osmotic stress 111

112

Results 113

Inactivation of curT affects membrane architecture 114

The open reading frame slr0483 encodes the only CURT1-like protein expressed in the 115

cyanobacterium Synechocystis 6803 The corresponding cyanobacterial gene was previously 116

named synCURT1 to emphasize its homology to CURT1 from Arabidopsis thaliana 117

(Armbruster et al 2013 Luque and Ochoa de Alda 2014) However in conformity with 118

conventional nomenclature for bacterial genes we adopt the name lsquocurTrsquo The CurT protein is 119

predicted to comprise 149 amino acids and contains within its C-terminal half two putative 120

transmembrane domains (TMDs) which exhibit a high degree of sequence similarity with the 121

Arabidopsis CURT1A-D proteins The N-terminal half shows less similarity to its 122

Arabidopsis counterparts but it harbors a predicted amphipathic α-helix (amino acids 46-62) 123

that has been implicated in membrane bending (Figure 1A and 1B Armbruster et al 2013) 124

Interestingly the TMDs of CURT homologs share sequence and structural features with a 125

domain that is found in some thylakoid-associated cyanobacterial aminoacyl-tRNA 126

synthetases and has been hypothesized to be involved in mediating the unusual membrane 127

attachment of these enzymes (Luque and Ochoa de Alda 2014) 128

To verify the predicted membrane association of CurT total membranes from wild-129

type cells were exposed to various agents and the solubility of CurT was assessed using an 130

antibody directed against a fragment comprising its first 58 N-terminal amino acids (Figure 131

1A) We first confirmed that CurT can be detected in the membrane fractions of cell lysates 132

and exposure to 01 M Na2CO3 4 M urea or 1 M NaCl failed to extract it as would be 133

expected for a membrane-bound protein (Figure 1C) Indeed treatment of the cell lysate with 134

the non-ionic detergent Triton X-100 rendered CurT soluble as was the case for the PSII 135

inner antenna protein CP47 ndash an integral membrane protein with six transmembrane α-helices 136

(Figure 1C) Thus CurT like its Arabidopsis counterparts is likely to be an integral 137

membrane protein 138

To test whether the cyanobacterial CurT has similar membrane-tubulating properties to 139

CURT1A of A thaliana we used the same liposome-based assay to probe its ability to form 140

tubules (Armbruster et al 2013) We expressed CurT in vitro using a cell-free extract 141

supplemented with liposomes similar in composition to the thylakoid membrane 142

Subsequently liposome topology was visualized by transmission electron microscopy (TEM 143

5

Figure 1D) Like the grana-forming CURT1A its Synechocystis 6803 homolog efficiently 144

induced localized ldquocompressionrdquo of liposomes into thin tubule-like segments revealing its 145

strong membrane-curving activity (Figure 1D) Hence the membrane-shaping function of 146

members of the CURT1 family is conserved from cyanobacteria to plants Nevertheless 147

liposome shapes caused by either CurT or CURT1A displayed some differences in the degree 148

of membrane tubulation These might be due to the variable N-termini of both proteins 149

(Figure 1D) 150

To dissect the function of CurT in vivo we generated a knock-out mutant by inserting 151

a kanamycin-resistance cassette into the unique AgeI site in the slr0483 reading frame 152

(Supplemental Figure 1A Methods) Complete segregation of the mutation was confirmed by 153

PCR and immunoblot analyses (Supplemental Figure 1B and 1C) Progressively higher levels 154

of antibiotic (up to 400 microg kanamycinml) were used for mutant selection as previous 155

attempts to select a fully segregated curT- mutant had been unsuccessful probably due to 156

application of insufficient selection pressure (Armbruster et al 2013) When growth rates of 157

wild-type and mutant cells were compared 20- and 15-fold increases in doubling time were 158

observed for curT- grown under photoauto- and photoheterotrophic conditions respectively 159

(Table 1 Supplemental Figure 2) 160

Strikingly curT inactivation also led to loss of competence for DNA uptake during 161

both transformation and conjugation-based experiments Hence attempts to complement the 162

curT- mutant were not applicable However in the course of the work four independent 163

rounds of transformation of wild-type cells were carried out to generate fresh curT- mutants 164

All mutant strains obtained the same phenotype strongly suggesting that no secondary sites 165

were involved in its establishment To rule out the possibility that read-through transcription 166

from the resistance marker gene affects the upstream reading frame slr0482 (of unknown 167

function) in the mutant RT-PCR with appropriate primers was performed (Supplemental 168

Figure 3) No change in slr0482 mRNA accumulation was observed confirming that the curT- 169

phenotype is caused by disruption of the curT gene In agreement with this finding recent 170

transcriptome analyses of Synechocystis 6803 have clearly shown that the curT mRNA is 171

monocistronic (Kopf et al 2014) 172

In view of CurTrsquos in vitro membrane-tubulating activity the ultrastructure of the curT- 173

mutant was examined by TEM As shown in Figure 2A the wild-type strain exhibits the 174

typical thylakoid organization with ordered thylakoid sheets at the cell periphery and 175

convergence zones next to the plasma membrane In contrast massive disorganization of the 176

thylakoid membrane system was observed in curT- In all cells analyzed the mutant 177

6

thylakoids appeared as disordered sheets that traversed the cytoplasm and completely lacked 178

the typical convergence zones with the corresponding biogenesis centers at the periphery 179

(Figures 2B-D) This indicates a strict requirement of CurT for the establishment of normal 180

thylakoid membrane architecture in Synechocystis 6803 181

182

Inactivation of curT affects photosynthetic performance 183

The severely altered morphology of the thylakoid membrane system in curT- cells and 184

in particular the lack of PSII-related biogenesis centers prompted us to investigate the 185

photosynthetic performance of the mutant (Stengel et al 2012) The chlorophyll content was 186

reduced by ~20 and absorption spectroscopy also revealed a reduction in phycobilisomes 187

as well as an increase in carotenoid levels (Table 1 Supplemental Figure 4) Despite changes 188

in ultrastructure and pigment levels size and number of curT- cells at OD750 were not 189

significantly different as judged by t-test-based statistical analysis (Table 1) 190

To explore the photosynthetic defects of the mutant in detail immunoblot analyses 191

were performed using antibodies raised against specific subunits of photosynthetic complexes 192

and some of their biogenesis factors In curT- PSII reaction-center subunits including D1 D2 193

CP47 and CP43 were found to be present at 44 42 56 and 45 of the wild-type level 194

respectively (Figure 3) Interestingly amounts of the PSII assemblyrepair factors PratA and 195

Slr0151 as well as the light-dependent protochlorophyllide oxidoreductase (POR) enzyme 196

were also reduced (Figure 3 Yang et al 2014 Rast et al 2016) Levels of the Pitt protein 197

which interacts with POR (Schottkowski et al 2009a) and the Oxa homolog YidC 198

(Ossenbuumlhl et al 2006) were slightly increased in curT- (Figure 3) On the other hand 199

Sll0933 the homolog of the PSII assembly factor PAM68 in A thaliana accumulated to 200

250 of the wild-type level (Armbruster et al 2010) In contrast amounts of both Cytf and 201

PsaA which serve as markers for the Cyt(b6f) and PSI complexes respectively the RbcL 202

subunit of the Rubisco enzyme the PSII assembly factor Ycf48 (Komenda et al 2008) and 203

VIPP1 remained unaltered in curT- (Figure 3) Overall the alterations in protein accumulation 204

indicate that loss of CurT preferentially affects the accumulation of PSII 205

This result was further corroborated by analysis of the photosynthetic performance of 206

curT- The rate of light-dependent oxygen evolution was reduced by approximately 50 in the 207

mutant (Table 1) and analysis of P700+ reduction kinetics revealed impaired electron donation 208

by PSII (Figure 4A) PSII-driven P700+ reduction is slowed down by a factor of three in curT-209

whereas the residual cyclic electron transfer activity in the presence of DCMU is less than 210

5 in both wild-type and curT- (Figure 4B) In contrast the light intensity-dependent electron 211

7

transfer capacity which was measured as relative electron transfer rate (rETR) did not differ 212

significantly between wild-type and curT- (Figure 4C) Both wild-type and curT- cells reach a 213

capacity limit at ~ 250 micromol photons m-2s-1 and the decay of rETR beyond the capacity limit 214

is very similar These results indicate that the point of onset of PSII-related photoinhibition is 215

the same in both strains which in turn implies that electron flow downstream of PSII is 216

unchanged in the mutant 217

Low PSII levels in curT- could be caused either by reduced synthesisbiogenesis or its 218

enhanced degradation To measure the rates of D1 repair the kinetics of D1 accumulation 219

upon induction of photoinhibition by high-light treatment (800 micromol photons m-2s-1) was 220

assayed by immunological means (Figure 4D) In wild-type cells the D1 level decreased to 221

60 (relative to the initial time point) after 90 min of treatment As previously shown the 222

drop is much more pronounced (~35 left) when repair synthesis of D1 is inhibited by the 223

addition of lincomycin (Figure 4D Komenda et al 2008) Surprisingly in curT- the level of 224

residual D1 is rather stable over the same time period and lincomycin treatment induces a 225

more modest decrease to 60 relative to the initial time point (Figure 4D) These data clearly 226

indicate that in absence of CurT residual D1 is less susceptible to degradation even though 227

its absolute amount is reduced In line with this no effect on growth rates was observed when 228

either wild-type or curT- cells were cultivated for two days at 200 micromol photons m-2s-1 229

(Supplemental Figure 5) 230

To assess the role of CurT in the assembly of PSII we compared the two-dimensional 231

profiles of thylakoid membrane proteins from wild-type and mutant cells by Blue-Native 232

(BN)SDS-PAGE PSII assembly intermediates were subsequently visualized via 233

immunodetection of PSII core subunits As shown in Figure 5A dimeric PSII core complexes 234

(RCCII) are drastically underrepresented in curT- whereas relative levels of earlier assembly 235

intermediates including the monomeric CP43-less RC47 complex and non-assembled CP43 236

increase Parallel detection of CurT itself revealed a ldquosmearedrdquo signal in the size range from 237

15 up to 500 kDa suggesting that CurT forms part of high-molecular-weight complexes 238

(Figure 5A) Finally in vivo 35S protein pulse-labeling experiments confirmed that RC and 239

RC47 complexes in particular are efficiently formed in curT- but the transition to RCCI 240

complexes is severely delayed (Figure 5B) As a consequence dimeric RCCII complexes do 241

not incorporate any radioactive label over the experimentrsquos time course of 25 min (Figure 5B) 242

Taken together these data show that curT inactivation has a severe impact on PSII biogenesis 243

but little or no effect on the degradation of the complex 244

8

The data presented so far suggest a PSII-related phenotype for curT- so we explored 245

the effects of curT disruption on photosynthesis further by comparing the low-temperature 246

(77K) fluorescence emission spectra in cell suspensions following excitation of chlorophyll at 247

440 nm (Figure 6A) The signals were normalized to the emission maximum at 514 nm of the 248

external standard fluorescein (Figure 6A) In curT- the PSI emission peak amplitude was 249

similar to that of the wild-type (Figure 6A) The spectra differed however around 685 nm 250

Here we observed an increase in fluorescence in the mutant strain an emission signature that 251

is probably related to the inner antenna protein CP43 (Figure 6A Nilsson et al 1992) 252

Increased chlorophyll fluorescence at 685 nm has previously been shown to be characteristic 253

for cells that are accumulating the stress-induced IsiA protein which shares structural 254

similarities with CP43 (Odom et al 1993 Yeremenko et al 2004 Wilson et al 2007) A 255

second indication for accumulation of IsiA is a diagnostic blue shift of the 725 nm 256

fluorescence peak by approximately 5 nm which is indeed observed in the curT- spectrum 257

(Figure 6A Sandstroumlm et al 2001) We therefore determined the level of IsiA in both wild-258

type and curT- by immunoblot analysis As expected IsiA was strongly induced in curT- 259

suggesting that the mutant suffers from severe stress (Figure 6C) When fluorescence at 77K 260

was recorded after excitation at 580 nm which mainly excites the phycobiliproteins the 261

signal at 685 nm (PSII related) was enhanced in the curT- mutant most likely reflecting IsiA 262

emission andor the presence of uncoupled phycobilisomes (Figure 6B Wilson et al 2007) 263

In contrast the 725 nm peak (PSI related) was reduced in curT- relative to the wild-type 264

suggesting less coupling of phycobilisomes to PSI (Figure 6B) The increase in uncoupled 265

phycobilisomes can be directly attributed to the reduction in RCCII levels found in the curT- 266

mutant (Figure 5A) since phycobilisomes are attached to PSII dimers for efficient light 267

harvesting (Watanabe and Ikeuchi 2013 Chang et al 2015) 268

Thus the curT- mutant exhibits a characteristic set of photosynthetic defects The 269

primary target of the CurT membrane-shaping function appears to be PSII in particular in its 270

biogenic phase However the reduction in PSII content cannot be responsible for the lack of 271

thylakoid convergence zones at the plasma membrane because these structures can still be 272

observed in the psbA- mutant TD41 which is lacking D1 and therefore unable to assemble any 273

PSII complexes (Supplemental Figure 6 Nilsson et al 1992) 274

275

Subcellular localization of CurT 276

We have previously proposed that the initial steps in PSII assembly take place in 277

biogenesis centers located at the interface between plasma and thylakoid membranes (Stengel 278

9

et al 2012) These biogenic membranes (PDMs) are marked by the PSII Mn2+ delivery factor 279

PratA and can be separated from thylakoids by a two-step sucrose-gradient centrifugation 280

procedure (Schottkowski et al 2009b Rengstl et al 2011) When the distributions of various 281

proteins within such membrane fractions from the wild-type and curT- were compared two 282

striking changes were detected in the mutant First the precursor of the D1 subunit of PSII 283

(pD1) is absent from PDMs in the mutant and secondly the inner antenna protein CP47 ndash but 284

not CP43 ndash of PSII shifts towards fractions of lower density (Figure 7) Hence the 285

organization of PDMs appears to be perturbed in curT- In wild-type cells most of the CurT 286

protein was found in thylakoid membranes only a minor fraction similar in amount to that of 287

the PSII assembly factors Ycf48 Pitt and YidC as well as the VIPP1 protein comigrated with 288

PDMs (Figure 7) According to rough estimates based on densitometric signal analysis 25 289

of total cellular CurT is normally found in the PDMs and 75 in the thylakoids (Figure 7) 290

To further analyze the localization of CurT in its cellular context in vivo we 291

constructed a translational fusion in which the monomeric enhanced cyan fluorescent protein 292

(CFP) mTurquoise2 (Goedhart et al 2012) is attached to the C-terminus of CurT and is 293

expressed under the control of the native curT promoter The resulting strain curT-CFP 294

showed a fully restored wild-type growth phenotype indicating that the CFP tag does not 295

affect CurTrsquos function (Supplemental Figure 7A) In agreement with this the fusion protein 296

accumulated to wild-type levels (96 plusmn 16 Supplemental Figure 7B) and localized to the 297

same membrane sub-fractions as does native CurT (Supplemental Figure 7C) The CurT-CFP 298

fluorescence signal was distinctly discernible above the wild-type autofluorescence 299

background (Supplemental Figure 8A) and was distributed in a network-like pattern with 300

concentrated areas at the cell periphery at mid-plane Analysis of CurT-CFP fluorescence in 301

Z-axis montages revealed that these signals often appeared as rod-like structures which 302

seemed to follow the spherical inner surface of the cell (Figure 8A B Supplemental Movie 1 303

and 2) In some cases these structures also appear to extend through the cytoplasm (Figure 304

8A and 8B Supplemental Movie 3) 305

When chlorophyll autofluorescence indicative of thylakoid membranes was visualized 306

in the same cell only a partial overlap with the CurT-CFP signal was observed (Figure 8 307

Supplemental Movie 1-3) Strikingly the peripheral CurT-CFP signals frequently reached 308

their maximal intensity in those areas where chlorophyll fluorescence was low ie where 309

thylakoid convergence zones are expected to form (Sacharz et al 2015) This becomes even 310

clearer when the intensity of a circumferential profile that follows the thylakoidrsquos 311

10

fluorescence signal is quantified separately for each of the two fluorescent channels (Figure 312

8C) 313

In contrast the chlorophyll autofluorescence in the curT- mutant seems to be evenly 314

distributed (Supplemental Figure 9) Following the fluorescence in an intensity profile as in 315

curT-CFP no regions with a similar decline in fluorescence were found most likely due to 316

the absence of biogenesis centers In addition some circular structures presenting chlorophyll 317

autofluorescence were detected in the interior of the cells Hence the disturbed curT- 318

ultrastructure is also reflected in the distribution of chlorophyll pigments (Supplemental 319

Figure 9) 320

To confirm the network-like distribution of CurT-CFP in the cell we used 321

immunofluorescence to detect CurT in the wild-type in situ Synechocystis 6803 cells were 322

fixed and treated with the αCurT antibody and an Oregon Green-conjugated secondary 323

antibody As shown in Figure 9A and B both techniques revealed similar network-like 324

patterns of the CurT signal which coalesced into rod-like structures at the cell surface and 325

essentially filled up the gaps between the autofluorescent thylakoid regions (negative controls 326

shown in Supplemental Figure 8B and 8C) Again regions of low chlorophyll fluorescence 327

typical of biogenesis centers generally exhibited stronger CurT-related fluorescence (Figure 328

8C) Occasionally CurT-CFP signals were also observed near traversing thylakoid lamellae 329

(when these were present in the cell analyzed) but the autofluorescence intensity of such 330

thylakoids is much weaker (see Figure 8B cell b in slice 6 and Supplemental Movie 3) 331

Finally CurT was localized by immunogold labeling experiments on ultrathin sections 332

of wild-type Synechocystis 6803 cells Almost no signals were detected when wild-type and 333

curT- sections were processed in the absence of the primary antibody as a negative control 334

(Figure 10A and Supplemental Figure 10A respectively) When mutant curT- cells were 335

processed in the presence of the αCurT antiserum a low level of randomly distributed 336

background signals was observed (Supplemental Figure 10B Supplemental Table 1) 337

However the number of signals located at the thylakoid membrane was clearly reduced 338

relative to the wild-type Therefore these signals were treated as non-specific background 339

Upon incubation of wild-type cell sections with antibodies directed against the N-terminus of 340

CurT (Figure 1A) the antigen was detected on the cytoplasmic surface of thylakoid 341

membranes (Figure 10B and 10C) This strongly suggests that its N-terminus is oriented 342

towards the cytoplasm Overall CurT signals appeared to be distributed along both thylakoids 343

and PDMs This agrees with the broad distribution of CurT across various fractions in the 344

membrane fractionation experiments (Figure 7) In only a few cases (12 ) however was 345

11

some clustering of immunogold signals at thylakoid convergence regions found (Figure 10D 346

and 10E) Thus the high local concentration of CurT at biogenic centers seen in the 347

fluorescence-based approaches (Figures 8 and 9) was not quantitatively reflected in the 348

immunogold labeling data This is likely due to the fact that immunogold electron microscopy 349

can only detect antigens on the surface of the section This issue is further complicated by the 350

heterogeneity of the CurT assemblies (see below and Discussion section) 351

Nevertheless closer inspection of the immunogold signals revealed an asymmetric 352

distribution of CurT signals with regard to the two faces of thylakoid sheets As illustrated in 353

Figure 10G curved thylakoid sheets possess a longer convex and a shorter concave face 354

When we analyzed a total of approximately 1500 CurT immunogold signals (from a total of 355

95 cells) which were unambiguously located to one side of the thylakoid membrane (for a 356

representative example see Supplemental Figure 11) 561 were found to be located at the 357

convex face while the other 439 localized to the concave side (Figure 10G Supplemental 358

Table 2) When differently curved regions (Figure 10F) including thylakoid lamellae (i) that 359

follow the overall shape of the cell (green) (ii) bend away from the plasma membrane (red) or 360

(iii) towards it ie where thylakoids converge to form biogenesis centers (yellow) were 361

examined separately red and green regions showed a CurT distribution in the range of 55 362

convex to 45 concave (Figure 10G Supplemental Table 2) However at the biogenesis 363

centers (the regions highlighted in yellow in Figure 10F) the uneven distribution of the 364

immunogold signals was more pronounced 61 of signals were found on the convex side 365

and 39 on the concave face of thylakoid lamellae (Figure 10G Supplemental Table 2) 366

Statistical analyses confirmed the significance of these differences in signal distributions 367

along the thylakoid membrane types (Supplemental Table 3) 368

Taken together with the finding that CurT is required for the formation of the 369

convergence sites forming biogenesis centers these data are consistent with the idea that the 370

thylakoid sheets are shaped by CurT which induces membrane curvature via asymmetric 371

intercalation on the two sides of thylakoid sheet 372

373

Different forms of CurT are found in PDMs and thylakoids 374

CurT was found to localize to both highly curved PDMs and less bent thylakoids Its 375

high local concentration at biogenic centers as seen in the fluorescence-based approaches 376

suggests a dosage-dependent effect of CurT on membrane shaping An alternative possibility 377

is that different CurT variants might exist in the two membrane types which could potentially 378

serve different functions To explore this possibility we asked whether CurT is found in 379

12

different complexes by using 2D BNSDS-PAGE to characterize membrane material isolated 380

via two-step sucrose gradient centrifugation (see Figure 7) In accordance with the data in 381

Figure 5A we find several low-molecular-weight complexes containing CurT (Figure 11A) 382

Smaller complexes of ~80 (complex I) and ~100 kDa (complex II) accumulate in membrane 383

fraction 5 (representing PDMs) but these are far less prevalent in fraction 9 representing 384

thylakoids (Figure 11A) In addition CurT-containing sub-complexes of ~140 (complex III) 385

and ~200 kDa (complex IV) are more prominently represented in thylakoids together with 386

even larger complexes ranging up to 670 kDa (Figure 11A) 387

Even more strikingly PDMs and thylakoids also differ with respect to the forms of 388

CurT they contain Thus isoelectric focusing (IEF) analysis of both membrane fractions 389

revealed at least four different CurT isoforms (a-d Figure 11B) PDMs contain mainly forms 390

b and d as well as trace amounts of a while thylakoids apparently possess very low levels of 391

form d and accumulate forms a b and c (Figure 11B) The nature of the underlying CurT 392

modifications still has to be determined Interestingly however CurT has recently been 393

identified as a phosphoprotein in a proteomic study (Spaumlt et al 2015) and the CurT variants 394

in Figure 11B may differ in their phosphorylation states At all events PDMs and thylakoids 395

can be distinguished by their complement of CurT isoforms which potentially play a role in 396

formation of the CurT sub-complexes that define the two membrane fractions 397

398

CurT is involved in the osmotic stress response 399

To further explore the stress-related role of CurT (Figure 6) and its link to IsiA 400

induction the effect of other potential stressors on curT- cells was tested High light levels had 401

a minor effect on curT- growth and its photosynthetic performance (Figure 4 Supplemental 402

Figure 5 and section above) suggesting that other environmental factors induced isiA 403

expression Our search was also motivated by a previous proteomic survey of plasma 404

membrane proteins of Synechocystis 6803 in high salt conditions in which CurT and VIPP1 405

were found among the most highly induced targets (Huang et al 2006) First we cultured 406

wild-type and curT- cells in different salt concentrations and found that growth of curT- was 407

severely affected in high salt (Figure 12A) Wild-type cells were only slightly affected by the 408

addition of salt to the medium The deleterious effect of the loss of curT on growth was even 409

more pronounced when maltose an osmotically active compound was present in the medium 410

(Figure 12B) Indeed curT- cells failed to survive exposure to 150 mM maltose whereas 411

growth of the wild-type was only slightly compromised These findings assign an additional 412

function to CurT ie a protective role during osmotic stress 413

13

When the curT-CFP strain was analyzed under these stress conditions enhanced 414

accumulation of CurT at the cell periphery was found mostly outside the autofluorescent 415

thylakoids and consistent with accumulation at the plasma membrane (Figure 12C) This was 416

further substantiated by membrane fractionation experiments which also revealed an 417

increased relative abundance of CurT in the plasma membrane fraction in the first sucrose 418

gradient (Figure 12E) Determination of total cellular CurT levels demonstrated that its 419

absolute amount did not increase under stress (Figure 12D) Therefore its higher abundance 420

in the plasma membrane under osmotic stress is likely to be due to CurT trafficking towards 421

the plasma membrane instead of increased synthesis 422

The same appears to hold true for VIPP1 which has been implicated in membrane 423

maintenance in both cyanobacteria and chloroplasts (Zhang and Sakamoto 2015) At stress 424

conditions an increase of the VIPP1 signal in the plasma membrane can be monitored in 425

wild-type (Figure 12E) However enhanced accumulation of VIPP1 in plasma membranes is 426

unaffected in the curT- mutant suggesting that thylakoid convergence zones are not strictly 427

required for the localization of VIPP1 428

429

Discussion 430

CurT determines thylakoid architecture 431

This study demonstrates that the protein CurT a homolog of the grana-forming 432

CURT1 proteins in plants is essential for establishing the proper thylakoid membrane 433

architecture in the cyanobacterium Synechocystis 6803 In particular CurTrsquos membrane-434

bending activity is likely to be required for the formation of thylakoid biogenesis centers at 435

points on the cell periphery where thylakoids converge towards the plasma membrane Here 436

PratA-mediated preloading of early PSII assembly intermediates with Mn2+ ions has been 437

proposed to take place together with PSII repair (Stengel et al 2012 Sacharz et al 2015) 438

This idea is supported by the following lines of evidence (i) The curT- mutant is devoid of 439

any thylakoid sectors that have convergence zones at their distal ends instead thylakoid 440

membranes are displaced and disposed as disordered or continuous rings (ii) CurT similarly 441

to CURT1A possesses a membrane-curving activity in vitro and intercalates asymmetrically 442

into thylakoids (iii) A high local concentration of CurT is observed at regions of high 443

curvature where biogenesis centers are found (iv) Lack of CurT affects the formation and 444

accumulation of PSII complexes as well as the abundance of some of its assembly factors 445

The drastic effects of CurT inactivation indicate an important role for this factor in membrane 446

shaping In contrast to the situation for CURT1A from Arabidopsis attempts to stably 447

14

overexpress CurT in Synechocystis 6803 failed Although short-lived transient increases in 448

CurT levels were observed when curT was expressed via strong heterologous promoters 449

wild-type levels of the protein were restored during subsequent rounds of cultivation of 450

transgenic lines Apparently Synechocystis 6803 cells do not tolerate substantial alterations in 451

CurT dosage and counter-select against these 452

This is in agreement with a dosage-dependent membrane-curving activity of CurT 453

which is suggested by its high local concentration at the edges of thylakoid autofluorescent 454

regions which mark the sites of the highly curved thylakoid convergence zones (Figures 8 9 455

and 13 Supplemental Movie 1 2 and 3) In addition some CurT was detected in structures 456

extending through the cytoplasm which most likely represent thylakoid sheets traversing the 457

cell from one thylakoid convergence zone to another (Figures 2A and 8) CurT might be 458

involved in the formation and stabilization of these structures 459

Members of the CURT1 family contain an N-terminal amphipathic α-helix that may 460

be involved in the membrane-bending activity of CurT (Armbruster et al 2013) Several 461

eukaryotic membrane-shaping proteins possess amphipathic helices as part of either an ENTH 462

(epsin N-terminal homology) or an N-BAR (Bin amphiphysin Rvs with N-terminal 463

amphipathic helix) domain (Ford et al 2002 Gallop and McMahon 2005 Zimmerberg and 464

Kozlov 2006) ENTH and N-BAR domains are rather large (~200 amino acids) and it has 465

been shown that amphipatic helices present in those domains insert into one leaflet of the lipid 466

bilayer and thereby induce curvature of the membrane (reviewed by Gallop and McMahon 467

2005 Zimmerberg and Kozlov 2006) However CurT itself is a small protein (149 amino 468

acids) that contains two transmembrane domains which insert into both leaflets of the lipid 469

bilayer (Figure 1A) as already suggested by Armbruster et al (2013) The amphipathic helix 470

faces the cytoplasm in Synechocystis 6803 or the stroma in A thaliana and most likely it 471

fine-tunes the degree of membrane bending mediated by CurT (Armbruster et al 2013) 472

In addition the increase in curvature correlated with CurT accumulation at convex 473

sides of thylakoid lamella (Figure 10 and 13) Hence curving might be mediated by 474

asymmetric integration of CurT into the lipid bilayers forming opposite faces of thylakoid 475

membrane sheets (Figure 13) However the mechanism causing this asymmetry remains 476

elusive 477

The presence of different CurT isoforms and complexes in PDMs and thylakoids adds 478

a further level of complexity and most likely reflects the dynamic regulation of this system 479

(Figure 11) The formation of different complexes might be primed by the phosphorylation of 480

CurT within its N-terminal cytoplasmic part (Spaumlt et al 2015) It seems likely that these 481

15

complexes play distinct roles in mediating the different CurT functions ie membrane 482

bending and maintenance 483

However it remains to be seen how exactly curvature is established maintained and 484

fine-tuned In addition other determinants of membrane topology and their putative interplay 485

with CurT have to be considered eg lipid and protein (complex) composition of 486

membranes cellular turgor pressure and other factors required for membrane 487

biogenesismaintenance eg the VIPP1 protein before precise molecular models of CurTrsquos 488

mode of action can be constructed (Rast et al 2015 and see below) That these other factors 489

can be crucial for membrane architecture is documented by the fact that some marine 490

cyanobacteria such as Prochlorococcus and Synechococcus contain curved thylakoids (but 491

no thylakoid convergence zones at the plasma membrane) although they lack a curT gene 492

493

The role of biogenesis centers 494

The absence of biogenesis centers in the curT- mutant now enables one to answer some 495

questions relating to the role of these thylakoid sub-structures which form in some but not all 496

cyanobacteria (Kunkel 1982 van de Meene et al 2006) First they are not essential since 497

even the curT- mutant still accumulates PSII to ~50 of wild-type levels On the other hand 498

in the mutant assembly of PSII is impaired as revealed by the increased accumulation of early 499

assembly intermediates In addition PSII dimers are almost completely absent in curT- 500

Whether the reduction in PSII dimers is attributable to an assembly problem linked to the 501

absence of biogenesis centers or to a secondary defect in dimer stabilization caused by 502

changes in overall thylakoid membrane ultrastructure remains to be determined Thus 503

biogenesis centers are more likely to represent evolutionary ldquoadd-onsrdquo that facilitated efficient 504

thylakoid biogenesis This is compatible with the fact that some cyanobacteria are devoid of 505

any biogenesis center-related substructures Second their absence compromises PSII but the 506

accumulation of other photosynthetic complexes ie PSI and the Cyt(b6f) complex is not 507

affected by CurT deficiency (Figure 3) This observation agrees with previous findings that 508

neither the PsaA subunit of PSI nor its assembly factor Ycf37 is detectable in isolated PDM 509

fractions (Rengstl et al 2011) 510

In addition to reduced de novo PSII assembly a higher relative stability of D1 in high-511

light experiments has been detected in curT- which suggests that D1 degradation during PSII 512

repair is less efficient in the mutant Photo-damaged D1 is degraded by the FtsH2FtsH3 513

complex which has previously been shown to partly localize to thylakoid convergence zones 514

at the cell periphery ie biogenesis centers (Boehm et al 2012 Sacharz et al 2015) It 515

16

therefore seems possible that the absence of biogenesis centers in curT- leads to 516

mislocalization of the FtsH2FtsH3 complex and less effective D1 degradation 517

Moreover a PSII related-function for CurT is supported by a meta-analysis of the 518

Synechocystis 6803 transcriptome When the CyanoEXpress 22 database (Hernaacutendez-Prieto 519

and Futschik 2012 Hernaacutendez-Prieto et al 2016) was queried for genes co-expressed with 520

curT (slr0483) genes for five PSII subunits ndash psbE psbO psbF psbL and psb30 ndash were 521

found among the first ten hits (Supplemental Table 4) From this we infer that biogenic 522

centers do not play an essential role in the assembly of all photosynthetic complexes but 523

serve to enhance PSII assemblyrepair possibly through the efficient delivery of Mn2+ 524

Residual PSII in curT- cells is likely to be supplied with cytoplasmic Mn2+ via a second 525

independently operating ABC transporter-based system in the plasma membrane named the 526

Mnt pathway (Bartsevich and Pakrasi 1995 Bartsevich and Pakrasi 1996) 527

Formally we cannot exclude that CurT is directly involved in the PSII assembly 528

process However considering CurTrsquos membrane bending capacity and the mutant phenotype 529

(Figure 1D and Figure 2) it appears more likely that CurT forms cellular substructures for 530

efficient PSII biogenesis ie biogenesis centers 531

As mentioned above some ultrastructural features of biogenesis centers have emerged 532

from studies employing EM-based tomography (van de Meene et al 2006) To date however 533

a high-resolution picture of the precise membrane architecture within these centers remains 534

elusive In particular whether or not a direct connection between plasma membrane and 535

thylakoids exists continues to be debated As recently discussed and in line with this gap in 536

knowledge different membrane fractionation techniques have revealed different distributions 537

of PSII-related subunits and assembly factors between plasma and thylakoid membranes 538

(Heinz et al 2016 Liberton et al 2016 Selatildeo et al 2016) The overall picture that emerges 539

is that the initial hypothesis that PSII biogenesis is initiated at the plasma membrane is no 540

longer tenable whereas a specialized thylakoid sub-fraction like the PDMs that make contact 541

with the plasma membrane could explain many of the available data and thus clarify some 542

aspects of the debate (Zak et al 2001 Pisareva et al 2011 Rast et al 2015) Moreover it 543

has previously been hypothesized that ldquoribosome-decorated membrane-like complexesrdquo 544

forming at the innermost thylakoid sheet might represent biogenic compartments (van de 545

Meene et al 2006 Mullineaux 2008) Whether these structures are affected in curT- cannot 546

be judged based on our TEM analysis but requires ultrastructural data of higher resolution 547

However the accessibility of thylakoids for ribosomes should be increased in the less 548

compressed membrane system of curT- (Figure 2B-D) 549

17

A scenario similar to that of Synechocystis 6803 holds for the situation in chloroplasts 550

of the green alga Chlamydomonas reinhardtii in which de novo PSII biogenesis has been 551

shown to be initiated in punctate regions named T-zones located close to the pyrenoid 552

(Uniacke and Zerges 2007) Unlike the mRNAs for the PSII components neither RNAs for 553

PSI subunits nor PSI assembly factors are localized to T-zones indicating that PSI and PSII 554

assembly processes are spatially separated (Uniacke and Zerges 2009 Nickelsen and Zerges 555

2013 Rast et al 2015) Interestingly a recent cryoelectron tomography study demonstrated 556

that next to T-zones at the chloroplast base-lobe junction the inner chloroplast envelope 557

exhibits invaginationsconnections to thylakoids that structurally resemble the organization of 558

cyanobacterial biogenesis centers (Engel et al 2015) For future investigations it will be 559

interesting to see if a homolog of the CURT1 family is involved in the formation of these 560

structures in C reinhardtii 561

562

Evolution of CURT1 function 563

Homologs of the CURT1 protein family can be found throughout cyanobacteria green 564

algae and plants (Armbruster et al 2013) The Arabidopsis CURT1A-D proteins have 565

recently been shown to induce bending of thylakoid membranes at grana margin regions 566

(Armbruster et al 2013) Interestingly and in contrast to the situation in Synechocystis 6803 567

their inactivation did not result in severe photosynthetic deficiencies although the thylakoids 568

formed lacked defined grana stacks Nevertheless the data available support the idea that the 569

function of thylakoid membrane structures that were regarded as being independent ie 570

cyanobacterial biogenesis centers and grana are closely related Intriguingly both of these 571

thylakoid membrane structures are dedicated to aspects of PSII function but do not involve 572

PSI (Pribil et al 2014) In both the prokaryotic and eukaryotic systems CURT1 homologs 573

appear to bend thylakoid membranes as indicated by (i) the distortion of membrane 574

ultrastructure seen in mutants devoid of curved thylakoids (ii) the localization of CURT1 575

homologs at grana margins and their local concentration at biogenesis centers (iii) the in vitro 576

membrane-curving activity of both CURT forms The phenotypic differences between 577

A thaliana and Synechocystis 6803 mutants may however be attributable to the different 578

functions of the membrane sub-compartments affected in the two model organisms Whereas 579

the role of grana is still under debate one function of the cyanobacterial biogenesis centers is 580

the above-mentioned high-throughput uptake of Mn2+ ions for efficient assembly of PSII 581

(Stengel et al 2012 Nickelsen and Rengstl 2013 Pribil et al 2014) However it appears 582

that in both cases the primary function of CURT1 proteins is to generate curved membrane 583

18

regions These discoveries suggest that until now two independently observed structures ie 584

cyanobacterial thylakoid biogenesis centers and chloroplast grana regions are closely related 585

The degree of curvature is much less pronounced in the cyanobacterial system As previously 586

discussed it was probably the subsequent evolution of a membrane-localized light-harvesting 587

system in chloroplasts that made the formation of tightly curved grana thylakoids possible 588

(Mullineaux 2005 Nevo et al 2012 Pribil et al 2014) 589

590

CurT is involved in osmotic stress response 591

One unexpected phenotype of the curT- mutant is its sensitivity to osmotic stress 592

These data revealed that in addition to shaping membranes CurT also influences their 593

functional integrity This latter function might be intrinsic to CurT or could be mediated by 594

the VIPP1 protein which has been shown to be required for membrane maintenance in 595

bacteria and chloroplasts probably by acting as a supplier of lipids (for an overview see 596

Zhang and Sakamoto 2015) Both factors accumulate in the plasma membrane upon osmotic 597

stress but VIPP1 localization is not severely affected by CurT inactivation which suggests 598

that VIPP1 operates independently of CurT In agreement with this repeated co-599

immunoprecipitations revealed no interaction between both proteins Therefore it remains to 600

be established whether a direct functional relationship between them exists 601

Previous investigations of osmotic stress in Synechocystis 6803 showed a kidney-602

shaped form of wild-type cells under very high concentrations of osmotically active 603

compounds (Marin et al 2006) The cells were severely deformed indicating changes in the 604

structure of the cellular envelope Since CurT shifts towards the plasma membrane already 605

under lower osmolyte concentrations we suggest a stabilizing function of CurT in the plasma 606

membrane CurT might be necessary to tolerate the forces trying to deform the cells under 607

osmotic stress 608

In conclusion this analysis has identified a crucial determinant for shaping and 609

maintaining the cyanobacterial thylakoid membrane system ie CurT a homolog of the 610

grana-forming CURT1 protein family from A thaliana In particular CurT is involved in the 611

formation of specific thylakoid substructures close to the plasma membrane at which PSII is 612

assembledrepaired Future work will dissect the precise ultrastructure of these centers and 613

enable us to elaborate a molecular model for the spatiotemporal organization of PSII assembly 614

in cyanobacteria 615

616

19

Methods 617

Strains and growth conditions 618

Wild-type and mutant Synechocystis 6803 cells were grown on solid or in liquid BG 619

11 medium (Rippka et al 1979) supplemented with 5 mM glucose (unless indicated 620

otherwise) at 30degC under continuous illumination at a photon irradiance of 30 μmol m-2 s-1 of 621

white light For growth during high-light experiments for investigation of D1 repair cells 622

were cultivated in a FMT150 photobioreactor (Photon Systems Instruments Draacutesov Czech 623

Republic) at 800 micromol photons m-2 s-1 in the presence or absence of lincomycin (100 microgml) 624

Cell density was monitored photometrically at 750 nm Doubling times were determined after 625

two days of growth To generate the insertion mutant curT- the curT gene (slr0483) was first 626

amplified from wild-type genomic DNA by PCR using the primer pair 04835 627

(GAAGCCTATTTAGCTAAGGCCGAAAG) and 04833 628

(TAGTACCTGGTCTTCCATGGCGT) and the resulting fragment was cloned into the 629

Bluescript pKS vector (Stratagene Waldbronn Germany) A kanamycin resistance cassette 630

was then inserted into the single AgeI restriction site (159 bp downstream of the start codon) 631

and this disruption construct was used to replace the wild-type gene as described (Wilde et al 632

2001) 633

634

Bioinformatic and computational analysis 635

CURT1 sequences of Synechocystis 6803 were obtained from CyanoBase 636

(httpgenomekazusaorjpcyanobaseSynechocystis) and CURT1 homologs in other 637

organisms were retrieved from NCBIBLAST (httpblastncbinlmnihgovBlastcgi) 638

Numbers and positions of putative transmembrane domains in the predicted proteins were 639

determined with TMHMM20 (httpwwwcbsdtudkservicesTMHMM) The sequence for 640

the N-terminal amphipathic helix was predicted by Jpred 3 641

(httpwwwcompbiodundeeacukwww-jpred) and plotted using a helical wheel projection 642

script (httprzlabucreduscriptswheelwheelcgi) The programs ClustalW2 643

(httpwwwebiacuktoolsclustalw2) and GeneDoc (httpwwwpscedubiomedgenedoc) 644

were used to generate multiple alignments of amino acid sequences Quantitative analysis of 645

immunoblots was performed with the AIDA Image Analyzer V325 (Raytest 646

Isotopenmessgeraumlte GmbH Straubenhardt Germany) 647

Co-expression patterns of curT were analyzed using the CyanoEXpress 22 database 648

(httpcyanoexpresssysbiolabeu Hernaacutendez-Prieto and Futschik 2012 Hernaacutendez-Prieto et 649

al 2016) 650

20

651

Measurement of chlorophyll concentration and oxygen production 652

Determination of chlorophyll content was carried out according to Wellburn and 653

Lichtenthaler (1984) For oxygen evolution measurements cells were grown in BG-11 654

without glucose harvested in mid-log phase and diluted to an OD750 nm = 05 Oxygen 655

evolution rates were measured with a Clark-type oxygen electrode (Hansatech Instruments 656

Ltd Kingrsquos Lynn Norfolk UK) at 1000 micromol photons m-2 s-1 (cool white light) after 5 min of 657

dark acclimation Oxygen evolution under saturating light conditions was measured without 658

any additives 659

660

Cell size and cell number estimation 661

Synechocystis 6803 strains were grown in liquid BG11 media containing 5 mM 662

glucose For cell size estimation the cells were analyzed with a confocal laser scanning 663

microscope TCS SP5 (Leica Wetzlar Germany) The diameter of the cells was measured 664

with the LAS AF Lite software (Leica Wetzlar Germany) Cells that were about to divide 665

were not taken into account For the determination of cell number cultures were set to an 666

OD750 = 1 and analyzed by using a Neubauer counting chamber (Paul Marienfeld GmbH amp 667

Co KG Lauda-Koumlnigshofen Germany) Statistical significance was determined by Studentrsquos 668

t-test 669

670

Measurements of P700+ reduction kinetics and relative electron transport rates 671

P700+ reduction kinetics and changes in chlorophyll fluorescence yield at different 672

light intensities were measured at a chlorophyll concentration of 5 microgml with a Dual-PAM-673

100 instrument (Heinz Walz GmbH Effeltrich Germany) Complete P700 oxidation was 674

achieved by a 50-ms multiple turnover pulse (10000 micromol photons m-2 s-1) after 2 min of dark 675

incubation P700+ reduction kinetics were recorded without any additions as well as in the 676

presence of 10 microM DCMU Ten technical replicates were averaged and fitted with single 677

exponential functions Data interpretation was done according to Bernaacutet et al (2009) 678

Light saturation measurements were performed according to Xu et al (2008) The 679

actinic light intensity was increased stepwise from 0 to 665 micromol photons m-2 s-1 with 30-s 680

adaptation periods Maximal fluorescence yields were obtained by applying saturating light 681

pulses (duration 600 ms intensity 10000 micromol photons m-2 s-1) 682

683

Low-temperature fluorescence measurements 684

21

Fluorescence emission spectra were measured with an AMINCO Bowman Series 2 685

Luminescence Spectrometer Wild-type and curT- cells were grown in the presence of 5 mM 686

glucose to mid log-phase and concentrated to 25 microgml chlorophyll adding 2 microM fluorescein 687

as an internal standard Samples (1 ml) were transferred to thin glass tubes dark-adapted for 688

30 min at 30 degC and shock frozen in liquid N2 To quantify chlorophyllfluorescein and 689

phycobilisome-mediated fluorescence samples were excited and emission recorded at 440 690

nm510 nm (chlorophyll and fluorescein excitationmax fluorescein emission) and 580 691

nm685 nm respectively Emission was scanned at 490-800 nm or at 640-800 nm 692

respectively 693

694

Antibody production and protein analysis 695

For generation of an αCurT antibody the N-terminal coding region of curT (amino 696

acid positions 1-58) was amplified by PCR using primers N04835 697

(AAGGATCCGTGGGCCGTAAACATTCAA) and N04833 698

(AAGTCGACGCACTTCCCACACCGGTTGTA) and cloned into the BamHI and XhoI sites 699

of the pGEX-4T-1 vector (GE Healthcare Freiburg Germany) Expression of the GST fusion 700

protein in Escherichia coli BL21(DE3) and subsequent affinity purification on Glutathione-701

Sepharose 4B (GE Healthcare) were carried out as described (Schottkowski et al 2009b) A 702

polyclonal antiserum was raised against this protein fragment in rabbits (Pineda Berlin 703

Germany) Other primary antibodies used in this study have been described previously ie 704

αpD1 (Schottkowski et al 2009b) αD1 (Schottkowski et al 2009b) αD2 (Klinkert et al 705

2006) αPratA (Klinkert et al 2004) αYcf48 (Rengstl et al 2011) αPitt (Schottkowski et 706

al 2009a) αPOR (Schottkowski et al 2009a) αYidC (Ossenbuumlhl et al 2006) αVIPP1 707

(Aseeva et al 2007) αSll0933 (Armbruster et al 2010) and αSlr0151 (Rast et al 2016) or 708

were purchased from Agrisera (Vaumlnnaumls Sweden) ie αCP43 αCP47 αPsaA αCyt f 709

αRbcL αIsiA The αGFP-HRP antibody was acquired from Miltenyi Biotech (Bergisch 710

Gladbach Germany) 711

Protein concentrations were determined according to Bradford (1976) using RotiQuant 712

(Carl Roth GmbH amp Co KG Karlsruhe Germany) Protein extraction membrane 713

fractionation on sucrose-density gradients and quantification of Western signal intensities was 714

performed as described previously (Rengstl et al 2011) Solubility properties of CurT were 715

determined according to Schottkowski et al (2009a) 716

22

Sucrose-density centrifugation separating PDM and thylakoid membrane fractions by 717

two consecutive gradients was carried out as described previously (Schottkowski et al 718

2009b Rengstl et al 2011) 719

Two-dimensional fractionations of cyanobacterial membrane proteins via BNSDS-720

PAGE and of pulse-labeled proteins by BNSDS-PAGE were performed as previously 721

reported (Klinkert et al 2004 Schottkowski et al 2009b Rengstl et al 2013) For the 722

analysis of native complexes in fractions obtained by sucrose-density centrifugation the 723

volume corresponding to 350 microg of protein in fraction 7 was applied to BNSDS-PAGE 724

For isoelectric focusing (IEF) the volume corresponding to 50 microg of protein from 725

fraction 7 in 200 microl of IEF buffer (8 M urea 4 CHAPS 1 IPG buffer pH 4-7 (GE 726

Healthcare)) was applied to an 11-cm Immobiline DryStrip pH 4-7 (GE Healthcare) in a 727

Protean IEF Cell (Bio-Rad Munich Germany) Strips were rehydrated for 12 h at 20 degC and 728

50V Focusing was carried out in the following steps 500 V rapid 1500 Vh 1000 V linear 729

880 Vh 6000 V linear 9680 Vh 6000 V rapid 5390 Vh 50 microA per gel focus temperature 730

20degC Subsequently the strips were incubated in equilibration buffer I (6 M urea 0375 M 731

Tris pH 88 20 glycerol 2 SDS 2 DTT) and equilibration buffer II (6 M urea 0375 732

M Tris pH 88 20 glycerol 2 SDS 25 iodoacetamide) for 10 min in each buffer 733

Then the IEF strips were applied to second-dimension SDS-PAGE 734

735

Transmission electron microscopy and immunogold labeling 736

Sample preparation for transmission electron microscopy including freeze substitution 737

and immunogold labeling of CurT was performed as described previously (Stengel et al 738

2012) Ultrathin sections were cut to thicknesses of 35 - 45 nm and 45 - 65 nm for 739

ultrastructural analyses and immunogold labeling respectively For immunogold labeling 740

sections collected on collodion-coated Ni grids were incubated for 18 h at 4degC with (rabbit) 741

αCurT (diluted 1100 1500 11000 or 14000 in blocking buffer (5 fetal calf serum) with 742

005 Tween 20) and further processed as described previously (Stengel et al 2012) As a 743

negative control wild-type Synechocystis 6803 cells were incubated without the primary 744

antibody and exposed to the gold-labeled anti-rabbit IgG To image the ultrastructure and the 745

immunogold-treated samples a Fei Morgagni 268 transmission electron microscope was used 746

and micrographs were taken at 80 kV 747

To avoid errors in the interpretation of the immunogold labeling experiment only 748

signals which were unambiguously localized to distinctly visible thylakoid membranes were 749

taken into account For each cell different regions (see Figure 10F) were defined and in each 750

23

region the signals on the convex and concave sides of the thylakoid membrane were analyzed 751

separately (see Supplemental Figure 11 for representative counts) Statistical significance was 752

assessed by χ2 test (Zoumlfel 1988) 753

For the analysis of clusters of CurT signals in biogenesis centers a cluster was defined 754

as a minimum of four signals in close proximity Overall 219 biogenesis centers were 755

examined with regard to CurT cluster formation 756

757

Preparation of proteoliposomes 758

Liposomes with a lipid mixture of 25 monogalactosyl diacylglycerol 42 759

digalactosyl diacylglycerol 16 sulfoquinovosyl diacylglycerol and 17 760

phosphatidylglycerol (Lipid Products South Nutfield UK) were prepared as described 761

previously (Armbruster et al 2013) To generate proteoliposomes CurT and CURT1A 762

proteins were expressed in the presence of liposomes for 3 h at 37degC using a PURExpress In 763

Vitro Protein Synthesis Kit (New England Biolabs Ipswich MA USA) The liposomes were 764

separated from the mix by centrifugation in a discontinuous sucrose gradient (100000 g 18 765

h) Subsequently the fraction containing the liposomes was extracted and dialyzed against 20 766

mM HEPES (pH 76) For transmission electron microscopy the proteoliposomes were 767

negatively stained with 1 uranyl acetate on a carbon-coated copper grid Micrographs were 768

taken on a Fei Morgagni 268 TEM at 80 kV 769

770

curT-CFP strain generation 771

Gibson assembly was used for single-step cloning (Gibson 2011) of the slr0483 gene 772

(together with its ~08 kb upstream region) the mTurquoise2 gene fragment the gentamycin-773

resistance cassette (aacC1) and an ~17-kb downstream region of slr0483 into pBR322 774

cleaved with EcoRV and NheI The slr0483 gene was fused in frame to the codon-optimized 775

mTurquoise2 (DNA20) preceded by a linker sequence encoding GSGSG The resulting 776

plasmid was used to transform Synechocystis 6803 as described previously (Zang et al 2007) 777

After ~ 10 days of incubation on BG11-GelRite (15 ) medium in the presence of 2 microgml 778

gentamycin several antibiotic resistant colonies were obtained and streaked out on fresh 779

medium These transformants were then tested for full segregation of the tagged allele by 780

colony PCR with primers flanking the slr0483 gene 781

782

Fluorescence microscopy 783

24

An aliquot of a cell suspension in mid-log phase was placed under a BG11-agarose 784

pad on a glass coverslip (15) and imaged on an inverted microscope (Zeiss 785

AxioObserverZ1) equipped with an ORCA Flash40 V2 (Hamamatsu) camera a Lumenecor 786

SOLA II Light Engine and a Plan-Apochromat 63x140 Oil DIC M27 (NA 14) objective 787

(Zeiss) Image acquisition was done with Zen 21 software in cyan and far-red fluorescence 788

channels (Zeiss Filter Sets 47 HE and 50) as Z-series with a step size of 250 nm and effective 789

pixel size of 103 nm Acquired image files were subsequently deconvolved (Constrained 790

Iterative Method) using a default theoretical Point Spread Function in Zen 20 (Zeiss) 791

Extraction of intensities for line profiles was performed by image thresholding the thylakoid 792

autofluorescence channel and eroding the resulting binary mask in Fiji (Schindelin et al 793

2012) 794

For immunofluorescence analysis cells were grown to mid-log phase as in the case of 795

the cells prepared for live-cell microscopy A 10-ml culture was fixed for 20 min in 37 796

formaldehyde and following extensive washing with phosphate-buffered saline (PBS) cells 797

were first permeabilized in 005 Triton-X for 20 min and then in lysis buffer (50 mM Tris-798

HCl 100 mM NaCl 5 mgml lysozyme) at 37degC for 2 h with gentle shaking To block 799

unspecific binding sites the cell pellet was incubated in 5 bovine serum albumin in PBS at 800

30degC for 1 h The αCurT serum (1500 dilution) was added to cells in fresh blocking buffer 801

for 1 h at 30degC with gentle shaking Cells were then washed three times with blocking buffer 802

and incubated with goat anti-rabbit IgG secondary antibodies conjugated to Oregon Green 488 803

(Invitrogen) (11000 dilution) under the conditions as for the primary antibodies Cells were 804

washed three times with PBS and prepared for microscopy as above Imaging was done as 805

described for live-cell microscopy except that a Colibri2 LED light source was employed for 806

illumination and a CoolSnap HQ camera (Photometrics) was used for image acquisition Cells 807

were imaged as Z-series (step size 280 nm) in the yellow and far-red fluorescent channels 808

(Zeiss Filter Sets 46 HE and 50) using the 505 nm and 625 nm LED modules Effective pixel 809

size in the final image was 102 nm Deconvolution and image analysis was done as described 810

above As judged by the staining intensity of the Oregon Green-conjugated antibodies 811

approximately half of the cells in any given field of view appeared to have been successfully 812

permeabilised a rate that is common in our experience No significant signal was detected in 813

the control sample that had not been exposed to the primary antibodies 814

815

25

Accession numbers 816

Sequence data from this article can be found in the CyanoBase and EMBLGenBank 817

data libraries under accession number slr0483 818

819

Supplemental Data 820

Supplemental Figure 1 Construction of the curT- mutant 821

Supplemental Figure 2 Growth phenotype of curT- 822

Supplemental Figure 3 Expression analysis of the open reading frame slr0482 (located 823

upstream of curT) in the curT- strain 824

Supplemental Figure 4 Absorbance spectra of curT- and wild-type cells 825

Supplemental Figure 5 High-light growth phenotypes of wild-type Synechocystis 6803 and 826

the curT- strain 827

Supplemental Figure 6 Ultrastructure of the TD41 mutant which lacks the psbA transcript 828

and the D1 protein 829

Supplemental Figure 7 Expression and localization of CurT-CFP 830

Supplemental Figure 8 Localization of CurT and CurT-CFP by fluorescence microscopy 831

Supplemental Figure 9 Chlorophyll autofluorescence of curT- 832

Supplemental Figure 10 The curT- mutant as a negative control for immunogold labeling 833

Supplemental Figure 11 Representative counts of immunogold signals 834

Supplemental Table 1 Overview of immunogold signals in curT- cells 835

Supplemental Table 2 Overview of immunogold signals in specific regions of Synechocystis 836

6803 wild-type cells 837

Supplemental Table 3 Statistical analysis of immunogold signals for wild-type 838

Synechocystis 6803 cells 839

Supplemental Table 4 Co-expression of curT 840

Supplemental Movie 1 Scan through the Z-axis of a curT-CFP cell 841

Supplemental Movie 2 Rendered 3D-model of a CurT-CFP detection 842

Supplemental Movie 3 Scan through the Z-axis of a curT-CFP cell with a traversing 843

thylakoid lamella 844

845

Acknowledgements 846

We thank Y Nishiyama for providing αpD1 and J Soll for αVIPP1 and αYidC antibodies 847

respectively and Nina Dyczmons-Nowaczyk for support with the fluorescence measurements 848

This work was supported by grants awarded to JN (Ni3909) MMN (NO 8363) and DL 849

26

(Le126529) by the Deutsche Forschungsgemeinschaft in the context of Research Unit 850

FOR2092 and the Cluster of Excellence RESOLV (EXC 1069) AG is a Howard Hughes 851

Medical Institute postdoctoral fellow in the laboratory of Erin OrsquoShea at Harvard University 852

LS was supported by a PhD fellowship from the Chinese Scholarship Council 853

854

Author Contributions 855

SH AR LS MMN DL and JN designed the research SH AR LS AG ILG EH ML BR 856

SV performed the research all authors contributed to data analysis SH AR and JN wrote the 857

paper 858

859

Competing Financial Interest statement 860

The authors declare no competing financial interests 861

862

We wish to dedicate this paper to Fabrice Rappaport an outstanding colleague and friend who 863

passed away so early 864

865

27

References 866

Allen JF de Paula WBM Puthiyaveetil S and Nield J (2011) A structural 867

phylogenetic map for chloroplast photosynthesis Trends Plant Sci 16 645-655 868

Anderson JM Horton P Kim E-H and Chow WS (2012) Towards elucidation of 869

dynamic structural changes of plant thylakoid architecture Philos Trans R Soc 870

Lond B Biol Sci 367 3515-3524 871

Armbruster U Zuumlhlke J Rengstl B Kreller R Makarenko E Ruumlhle T Schuumlnemann 872

D Jahns P Weisshaar B Nickelsen J and Leister D (2010) The Arabidopsis 873

thylakoid protein PAM68 is required for efficient D1 biogenesis and photosystem II 874

assembly Plant Cell 22 3439-3460 875

Armbruster U Labs M Pribil M Viola S Xu W Scharfenberg M Hertle AP 876

Rojahn U Jensen PE Rappaport F Joliot P Doumlrmann P Wanner G and 877

Leister D (2013) Arabidopsis CURVATURE THYLAKOID1 proteins modify 878

thylakoid architecture by inducing membrane curvature Plant Cell 25 2661-2678 879

Aseeva E Ossenbuumlhl F Sippel C Cho WK Stein B Eichacker LA Meurer J 880

Wanner G Westhoff P Soll J and Vothknecht UC (2007) Vipp1 is required for 881

basic thylakoid membrane formation but not for the assembly of thylakoid protein 882

complexes Plant Physiol Biochem 45 119-128 883

Bartsevich VV and Pakrasi HB (1995) Molecular identification of an ABC transporter 884

complex for manganese analysis of a cyanobacterial mutant strain impaired in the 885

photosynthetic oxygen evolution process EMBO J 14 1845-1853 886

Bartsevich VV and Pakrasi HB (1996) Manganese transport in the cyanobacterium 887

Synechocystis sp PCC 6803 J Biol Chem 271 26057-26061 888

Bernaacutet G Waschewski N and Roumlgner M (2009) Towards efficient hydrogen production 889

the impact of antenna size and external factors on electron transport dynamics in 890

Synechocystis PCC 6803 Photosynth Res 99 205-216 891

Boehm M Yu J Krynicka V Barker M Tichy M Komenda J Nixon PJ and Nield 892

J (2012) Subunit Organization of a Synechocystis Hetero-Oligomeric Thylakoid FtsH893

Complex Involved in Photosystem II Repair Plant Cell 24 3669-3683894

Bradford MM (1976) A rapid and sensitive method for the quantitation of microgram 895

quantities of protein utilizing the principle of protein-dye binding Anal Biochem 72 896

248-254897

28

Chang L Liu X Li Y Liu C-C Yang F Zhao J and Sui S-F (2015) Structural 898

organization of an intact phycobilisome and its association with photosystem II Cell 899

Res 25 726-737 900

Danielsson R Suorsa M Paakkarinen V Albertsson P-Aring Styring S Aro E-M and 901

Mamedov F (2006) Dimeric and monomeric organization of photosystem II 902

Distribution of five distinct complexes in the different domains of the thylakoid 903

membrane J Biol Chem 281 14241-14249 904

Daum B Nicastro D Austin J McIntosh JR and Kuumlhlbrandt W (2010) Arrangement 905

of photosystem II and ATP synthase in chloroplast membranes of Spinach and Pea 906

Plant Cell 22 1299-1312 907

Engel BD Schaffer M Kuhn Cuellar L Villa E Plitzko JM and Baumeister W 908

(2015) Native architecture of the Chlamydomonas chloroplast revealed by in situ 909

cryo-electron tomography eLife 4 e04889 910

Ford MGJ Mills IG Peter BJ Vallis Y Praefcke GJK Evans PR and McMahon 911

HT (2002) Curvature of clathrin-coated pits driven by epsin Nature 419 361-366 912

Fristedt R Willig A Granath P Cregravevecoeur M Rochaix J-D and Vener AV (2009) 913

Phosphorylation of photosystem II controls functional macroscopic folding of 914

photosynthetic membranes in Arabidopsis Plant Cell 21 3950-3964 915

Gallop JL and McMahon HT (2005) BAR domains and membrane curvature bringing 916

your curves to the BAR Biochem Soc Symp 72 223-231 917

Gibson DG (2011) Chapter fifteen - Enzymatic Assembly of Overlapping DNA Fragments 918

In Methods in Enzymology V Christopher ed (Academic Press) pp 349-361 919

Goedhart J von Stetten D Noirclerc-Savoye M Lelimousin M Joosen L Hink MA 920

van Weeren L Gadella TWJ and Royant A (2012) Structure-guided evolution of 921

cyan fluorescent proteins towards a quantum yield of 93 Nat Commun 3 751 922

Heinz S Liauw P Nickelsen J and Nowaczyk M (2016) Analysis of photosystem II 923

biogenesis in cyanobacteria Biochim Biophys Acta 1857 274-287 924

Hernaacutendez-Prieto M and Futschik M (2012) CyanoEXpress A web database for 925

exploration and visualisation of the integrated transcriptome of cyanobacterium 926

Synechocystis sp PCC6803 Bioinformation 8 634-638 927

Hernaacutendez-Prieto MA Semeniuk TA Giner-Lamia J and Futschik ME (2016) The 928

Transcriptional Landscape of the Photosynthetic Model Cyanobacterium 929

Synechocystis sp PCC6803 Sci Rep 6 22168 930

29

Huang F Fulda S Hagemann M and Norling B (2006) Proteomic screening of salt-931

stress-induced changes in plasma membranes of Synechocystis sp strain PCC 6803 932

Proteomics 6 910-920 933

Kirchhoff H (2013) Architectural switches in plant thylakoid membranes Photosynth Res 934

116 481-487 935

Klinkert B Elles I and Nickelsen J (2006) Translation of chloroplast psbD mRNA in 936

Chlamydomonas is controlled by a secondary RNA structure blocking the AUG start 937

codon Nucleic Acids Res 34 386-394 938

Klinkert B Ossenbuumlhl F Sikorski M Berry S Eichacker L and Nickelsen J (2004) 939

PratA a periplasmic tetratricopeptide repeat protein involved in biogenesis of 940

photosystem II in Synechocystis sp PCC 6803 J Biol Chem 279 44639-44644 941

Komenda J Nickelsen J Tichyacute M Praacutešil O Eichacker LA and Nixon PJ (2008) The 942

cyanobacterial homologue of HCF136YCF48 is a component of an early photosystem 943

II assembly complex and is important for both the efficient assembly and repair of 944

photosystem II in Synechocystis sp PCC 6803 J Biol Chem 283 22390-22399 945

Kopf M Klaumlhn S Scholz I Matthiessen JKF Hess WR and Voszlig B (2014) 946

Comparative analysis of the primary transcriptome of Synechocystis sp PCC 6803 947

DNA Res 21 527-539 948

Kunkel DD (1982) Thylakoid centers Structures associated with the cyanobacterial 949

photosynthetic membrane system Arch Microbiol 133 97-99 950

Liberton M Howard Berg R Heuser J Roth R and Pakrasi BH (2006) Ultrastructure 951

of the membrane systems in the unicellular cyanobacterium Synechocystis sp strain 952

PCC 6803 Protoplasma 227 129-138 953

Liberton M Saha R Jacobs JM Nguyen AY Gritsenko MA Smith RD 954

Koppenaal DW and Pakrasi HB (2016) Global Proteomic Analysis Reveals an 955

Exclusive Role of Thylakoid Membranes in Bioenergetics of a Model 956

Cyanobacterium Mol Cell Proteomics 15 2021-2032 957

Luque I and Ochoa de Alda JAG (2014) CURT1CAAD-containing aaRSs thylakoid 958

curvature and gene translation Trends Plant Sci 19 63-66 959

Marin K Stirnberg M Eisenhut M Kraumlmer R and Hagemann M (2006) Osmotic stress 960

in Synechocystis sp PCC 6803 low tolerance towards nonionic osmotic stress results 961

from lacking activation of glucosylglycerol accumulation Microbiology 152 2023-962

2030 963

Mullineaux CW (2005) Function and evolution of grana Trends Plant Sci 10 521-525 964

30

Mullineaux CW (2008) Biogenesis and dynamics of thylakoid membranes and the 965

photosynthetic apparatus In The Cyanobacteria A Herrero and E Flores eds 966

(Norfolk UK Caister Academic Press) pp 289ndash304 967

Nevo R Charuvi D Tsabari O and Reich Z (2012) Composition architecture and 968

dynamics of the photosynthetic apparatus in higher plants Plant J 70 157-176 969

Nickelsen J and Rengstl B (2013) Photosystem II assembly From cyanobacteria to plants 970

Annu Rev Plant Biol 64 609-635 971

Nickelsen J and Zerges W (2013) Thylakoid biogenesis has joined the new era of bacterial 972

cell biology Front Plant Sci 4 458 973

Nilsson F Simpson DJ Jansson C and Andersson B (1992) Ultrastructural and 974

biochemical characterization of a Synechocystis 6803 mutant with inactivated psbA 975

genes Arch Biochem Biophys 295 340-347 976

Odom WR Hodges R Chitnis PR and Guikema JA (1993) Characterization of 977

Synechocystis sp PCC 6803 in iron-supplied and iron-deficient media Plant Mol 978

Biol 23 1255-1264 979

Ossenbuumlhl F Inaba-Sulpice M Meurer J Soll J and Eichacker LA (2006) The 980

Synechocystis sp PCC 6803 Oxa1 homolog is essential for membrane integration of 981

reaction center precursor protein pD1 Plant Cell 18 2236-2246 982

Pisareva T Kwon J Oh J Kim S Ge C Wieslander Aring Choi J-S and Norling B 983

(2011) Model for Membrane Organization and Protein Sorting in the Cyanobacterium 984

Synechocystis sp PCC 6803 Inferred from Proteomics and Multivariate Sequence 985

Analyses J Proteome Res 10 3617-3631 986

Pribil M Labs M and Leister D (2014) Structure and dynamics of thylakoids in land 987

plants J Exp Bot 65 1955-1972 988

Rast A Heinz S and Nickelsen J (2015) Biogenesis of thylakoid membranes Biochim 989

Biophys Acta 1847 821-830 990

Rast A Rengstl B Heinz S Klingl A and Nickelsen J (2016) The role of Slr0151 a 991

tetratricopeptide repeat protein from Synechocystis sp PCC 6803 during Photosystem 992

II assembly and repair Front Plant Sci 7 605 993

Rengstl B Oster U Stengel A and Nickelsen J (2011) An Intermediate Membrane 994

Subfraction in Cyanobacteria Is Involved in an Assembly Network for Photosystem II 995

Biogenesis J Biol Chem 286 21944-21951 996

31

Rengstl B Knoppovaacute J Komenda J and Nickelsen J (2013) Characterization of a 997

Synechocystis double mutant lacking the photosystem II assembly factors YCF48 and 998

Sll0933 Planta 237 471-480 999

Rexroth S Mullineaux CW Ellinger D Sendtko E Roumlgner M and Koenig F (2011) 1000

The Plasma Membrane of the Cyanobacterium Gloeobacter violaceus Contains 1001

Segregated Bioenergetic Domains Plant Cell 23 2379-2390 1002

Rippka R Deruelles J Waterbury JB Herdman M and Stanier RY (1979) Generic 1003

Assignments Strain Histories and Properties of Pure Cultures of Cyanobacteria 1004

Microbiology 111 1-61 1005

Ruumltgers M and Schroda M (2013) A role of VIPP1 as a dynamic structure within 1006

thylakoid centers as sites of photosystem biogenesis Plant Signal Behav 8 e27037 1007

Sacharz J Bryan SJ Yu J Burroughs NJ Spence EM Nixon PJ and Mullineaux 1008

CW (2015) Sub-cellular location of FtsH proteases in the cyanobacterium1009

Synechocystis sp PCC 6803 suggests localised PSII repair zones in the thylakoid1010

membranes Mol Microbiol 96 448-4621011

Sandstroumlm S Park Y-I Oumlquist G and Gustafsson P (2001) CP43prime the isiA Gene 1012

Product Functions as an Excitation Energy Dissipator in the Cyanobacterium 1013

Synechococcus sp PCC 7942 Photochem Photobiol 74 431-437 1014

Schindelin J Arganda-Carreras I Frise E Kaynig V Longair M Pietzsch T 1015

Preibisch S Rueden C Saalfeld S Schmid B Tinevez J-Y White DJ 1016

Hartenstein V Eliceiri K Tomancak P and Cardona A (2012) Fiji an open-1017

source platform for biological-image analysis Nat Methods 9 676-682 1018

Schottkowski M Ratke J Oster U Nowaczyk M and Nickelsen J (2009a) Pitt a novel 1019

tetratricopeptide repeat protein involved in light-dependent chlorophyll biosynthesis 1020

and thylakoid membrane biogenesis in Synechocystis sp PCC 6803 Mol Plant 2 1021

1289-1297 1022

Schottkowski M Gkalympoudis S Tzekova N Stelljes C Schuumlnemann D Ankele E 1023

and Nickelsen J (2009b) Interaction of the periplasmic PratA factor and the PsbA 1024

(D1) protein during biogenesis of photosystem II in Synechocystis sp PCC 6803 J 1025

Biol Chem 284 1813-1819 1026

Selatildeo TT Zhang L Knoppovaaacute J Komenda J and Norling B (2016) Photosystem II 1027

Assembly Steps Take Place in the Thylakoid Membrane of the Cyanobacterium 1028

Synechocystis sp PCC6803 Plant Cell Physiol 57 878 1029

32

Spaumlt P Maček B and Forchhammer K (2015) Phosphoproteome of the cyanobacterium 1030

Synechocystis sp PCC 6803 and its dynamics during nitrogen starvation Front 1031

Microbiol 6 248 1032

Stengel A Guumlgel IL Hilger D Rengstl B Jung H and Nickelsen J (2012) Initial 1033

steps of photosystem II de novo assembly and preloading with manganese take place 1034

in biogenesis centers in Synechocystis Plant Cell 24 660-675 1035

Uniacke J and Zerges W (2007) Photosystem II assembly and repair are differentially 1036

localized in Chlamydomonas Plant Cell 19 3640-3654 1037

Uniacke J and Zerges W (2009) Chloroplast protein targeting involves localized 1038

translation in Chlamydomonas Proc Natl Acad Sci USA 106 1439-1444 1039

van de Meene AL Hohmann-Marriott M Vermaas WJ and Roberson R (2006) The 1040

three-dimensional structure of the cyanobacterium Synechocystis sp PCC 6803 Arch 1041

Microbiol 184 259-270 1042

van de Meene AML Sharp WP McDaniel JH Friedrich H Vermaas WFJ and 1043

Roberson RW (2012) Gross morphological changes in thylakoid membrane 1044

structure are associated with photosystem I deletion in Synechocystis sp PCC 6803 1045

Biochim Biophys Acta 1818 1427-1434 1046

Watanabe M and Ikeuchi M (2013) Phycobilisome architecture of a light-harvesting 1047

supercomplex Photosynth Res 116 265-276 1048

Wellburn AR and Lichtenthaler H (1984) Formulae and Program to Determine Total 1049

Carotenoids and Chlorophylls A and B of Leaf Extracts in Different Solvents In 1050

Advances in Photosynthesis Research Proceedings of the VIth International Congress 1051

on Photosynthesis Brussels Belgium August 1ndash6 1983 C Sybesma ed (Dordrecht 1052

Springer Netherlands) pp 9-12 1053

Wilde A Lunser K Ossenbuumlhl F Nickelsen J and Borner T (2001) Characterization of 1054

the cyanobacterial ycf37 mutation decreases the photosystem I content Biochem J 1055

357 211-216 1056

Wilson A Boulay C Wilde A Kerfeld CA and Kirilovsky D (2007) Light-Induced 1057

Energy Dissipation in Iron-Starved Cyanobacteria Roles of OCP and IsiA Proteins 1058

Plant Cell 19 656-672 1059

Xu M Bernaacutet G Singh A Mi H Roumlgner M Pakrasi HB and Ogawa T (2008) 1060

Properties of Mutants of Synechocystis sp Strain PCC 6803 Lacking Inorganic Carbon 1061

Sequestration Systems Plant Cell Physiol 49 1672-1677 1062

33

Yamamoto T Burke J Autz G and Jagendorf AT (1981) Bound ribosomes of Pea 1063

chloroplast thylakoid membranes location and release in vitro by high salt 1064

puromycin and RNase Plant Physiol 67 940-949 1065

Yang H Liao L Bo T Zhao L Sun X Lu X Norling B and Huang F (2014) 1066

Slr0151 in Synechocystis sp PCC 6803 is required for efficient repair of photosystem 1067

II under high-light condition J Integr Plant Biol 56 1136-1150 1068

Yeremenko N Kouřil R Ihalainen JA DHaene S van Oosterwijk N 1069

Andrizhiyevskaya EG Keegstra W Dekker HL Hagemann M Boekema EJ 1070

Matthijs HCP and Dekker JP (2004) Supramolecular Organization and Dual 1071

Function of the IsiA Chlorophyll-Binding Protein in Cyanobacteria Biochemistry 43 1072

10308-10313 1073

Zak E Norling B Maitra R Huang F Andersson B and Pakrasi HB (2001) The 1074

initial steps of biogenesis of cyanobacterial photosystems occur in plasma membranes 1075

Proc Natl Acad Sci USA 98 13443-13448 1076

Zang X Liu B Liu S Arunakumara KKIU and Zhang X (2007) Optimum 1077

Conditions for Transformation of Synechocystis sp PCC 6803 J Microbiol 45 241-1078

245 1079

Zhang L and Sakamoto W (2015) Possible function of VIPP1 in maintaining chloroplast 1080

membranes Biochim Biophys Acta 1847 831-837 1081

Zimmerberg J and Kozlov MM (2006) How proteins produce cellular membrane 1082

curvature Nat Rev Mol Cell Biol 7 9-19 1083

Zoumlfel P (1988) Statistik in der Praxis (Stuttgart Germany Gustav Fischer Verlag) 1084

1085

34

Figure Legends 1086

Figure 1 General characteristics of CurT A) Sequence alignment of CurT and CURT1A-D 1087

from A thaliana Predicted chloroplast transit-peptide sequences of CURT1A-D are omitted 1088

(Armbruster et al 2013) Positions of predicted C-terminal transmembrane domains (TDM) 1089

are marked (black bar) as is the position of the predicted amphipathic N-terminal helix in 1090

CurT (red bar) The green bar denotes the peptide sequence used for antibody production 1091

Identical and related amino acids that are conserved in 100 80 and 60 of the sequences 1092

are highlighted in black dark grey and light grey respectively B) Helical-wheel 1093

representation of the N-terminal amphipathic helix of CurT (red bar in A) The color code 1094

reflects the physicochemical properties of amino-acid side-chains green polar and 1095

uncharged blue polar and positively charged red polar and negatively charged yellow 1096

hydrophobic C) Solubility of CurT Membrane-associated proteins (50 microg) from wild-type 1097

cells were extracted with 5 mM HEPES (pH 76) containing either 1 M NaCl 01 M Na2CO3 1098

4 M urea 01 Triton X-100 or no additional solute After separation of membrane-bound 1099

(M) and solubilized (S) proteins by centrifugation proteins were fractionated by SDS-PAGE1100

and CurT was immunodetected on immunoblots As a control the integral membrane protein 1101

CP47 from PSII was analyzed in parallel D) Transmission electron micrographs of negatively 1102

stained liposomes Cell-free expression (CFE) of CurT and A thaliana CURT1A was 1103

performed in the presence of liposomes similar in composition to the lipids of the thylakoid 1104

membrane Liposomes before and after cell-free protein expression in the absence of DNA 1105

served as negative controls Black arrowheads indicate tubular connections between 1106

liposomes Scale bars 250 nm 1107

1108

Figure 2 Ultrastructural analysis of curT- cells Transmission electron micrographs of typical 1109

wild-type (A) and curT- (B-D) Synechocystis 6803 cells taken at 44000times (A B) and 28000times 1110

(C D) magnification respectively Ultrathin sections (35 to 45 nm) of cryofixed samples 1111

were stained with osmium tetroxide and post-stained using lead citrate Arrowheads indicate 1112

biogenesis centers Scale bars 200 nm (A B) and 500 nm (C D) respectively 1113

1114

Figure 3 Accumulation of components of photosynthetic complexes in the curT- mutant A) 1115

Whole cell extracts (30 microg protein) from wild-type and curT- strains were fractionated by 1116

SDS-PAGE and analyzed on immunoblots using the indicated antibodies B) The histogram 1117

shows levels of the indicated proteins in curT- extracts relative to wild-type samples (dashed 1118

red line) Data are means plusmn SD of three independent experiments Significant differences from 1119

35

wild-type protein levels according to Studentrsquos t-test with error probabilities of 5 and 1 1120

are indicated by and respectively 1121

1122

Figure 4 P700+ reduction kinetics and high-light effects in curT- cells A) Averaged traces 1123

(10 single measurements) of P700+ decay after complete oxidation by a 50-ms multiple 1124

turnover pulse (10000 micromol photons m-2 s-1) in the absence and presence of 10 microM DCMU 1125

B) Rate constants for P700+ reduction were obtained by fitting of the data with single1126

exponential functions Error bars indicate the SD of three independent measurements C) 1127

Impact of light intensity on the (relative) electron transport rate (rETR) Cells were exposed to 1128

gradually increasing light intensities which resulted in increasing electron transport until the 1129

capacity limit was reached PAR light intensity (micromol photons m-2 s-1) Error bars indicate the 1130

SD of three independent measurements D) D1 protein level in wild-type and curT- after high-1131

light treatment (800 micromol photons m-2s-1) in the presence and absence of lincomycin Samples 1132

were taken every 30 min and processed as in Figure 3 to determine the level of D1 present 1133

100 refers to wild-type D1 level at the beginning of the experiment 1134

1135

Figure 5 PSII assembly in curT- cells A) BNSDS-PAGE of membrane proteins Membrane 1136

fractions from wild-type and curT- cells were solubilized with 13 n-dodecyl-β-maltoside 1137

and proteins were fractionated by two-dimensional BNSDS-PAGE blotted and probed with 1138

antibodies against the PSII subunits D1 D2 CP47 and CP43 Wild-type blots were also 1139

probed with the αCurT antibody The sizes of marker proteins and the positions of PSII 1140

assembly intermediates (RCCII RCCI RC47) are shown above and below each image B) In 1141

vivo pulse labeling of membrane proteins with 35S Pulse-labeled PSII core proteins were 1142

separated via BNSDS-PAGE and visualized by autoradiography 1143

1144

Figure 6 Loss of CurT induces stress A) Low-temperature (77 K) fluorescence emission of 1145

Synechocystis 6803 wild-type (blue) and curT- (red) cells excited at 440 nm The spectra were 1146

normalized to the added fluorescein standard B) Low-temperature (77 K) fluorescence 1147

emission of Synechocystis 6803 wild-type (blue) and curT- (red) excited at 580 nm The 1148

spectra were normalized to 780 nm C) Level of IsiA in the curT- mutant relative to the wild-1149

type A mean value of 368 plusmn 96 (SD) was determined from three independent experiments 1150

1151

Figure 7 Membrane sublocalization of PSII-related factors Cell extracts from wild-type and 1152

curT- cells were fractionated by two consecutive rounds of sucrose-density gradient 1153

36

centrifugation (Schottkowski et al 2009b) The second linear gradient (20-60 sucrose) was 1154

apportioned into 14 fractions which were analyzed by immunoblotting using the indicated 1155

antibodies Fractions 1ndash6 represent PDMs and fractions 7ndash14 thylakoid membranes (TMs) 1156

To facilitate comparison between gradients sample volumes were normalized to the volume 1157

of fraction 7 that contained 40 microg of protein 1158

1159

Figure 8 Live-cell imaging of the curT-CFP strain by fluorescence microscopy In the curT-1160

CFP strain the native curT gene has been replaced by a CFP-tagged version resulting in the 1161

expression of the CurT-CFP fusion protein under the control of the native promotor A) 1162

Close-up views of the mid-cell plane in the CFP and far-red autofluorescence channels shown 1163

in slice 7 in panel B B) Synechocystis 6803 cells expressing CurT C-terminally fused to the 1164

mTurquoise2 variant of CFP from its native chromosomal promoter The two imaging 1165

channels are displayed as Z-axis montages (auto-scaled contrast step size 250 nm) in 1166

grayscale and color composite configuration The thylakoid autofluorescent channel as 1167

imaged in far-red fluorescence is depicted in magenta and CurT signal as imaged in cyan 1168

fluorescence is depicted in cyan C) Fluorescence intensity profiles of the two channels along 1169

the autofluorescent peripheral cell ldquoringrdquo are shown for slice 7 The maximum projection of 1170

the entire Z montage is also shown Scale bars (light grey) 2 microm 1171

1172

Figure 9 Immunofluorescence detection of CurT A) Close-ups of slice 5 in panel B B) 1173

Wild-type Synechocystis 6803 cells labeled with αCurT antibodies and detected with Oregon 1174

Green-conjugated secondary antibodies The Z-axis montages are shown as in Figure 8B 1175

except that the step size is 280 nm (1 to 10) C) Intensity profiles of the two channels along 1176

the autofluorescent peripheral cell ldquoringrdquo are shown for slice 5 The maximum projection of 1177

the entire Z montage is also shown Scale bars (light grey) 2 microm 1178

1179

Figure 10 Subcellular localization of CurT Ultrathin sections of wild-type Synechocystis 1180

6803 cells were incubated with rabbit αCurT prior to incubation with gold-conjugated goat 1181

anti-rabbit IgG A) Negative control (wild-type processed without addition of primary 1182

antibody) B C) Immunogold-labeled sections showing CurT localization at the cytoplasmic 1183

side of the thylakoid membrane D) Cluster formation of CurT signals at a putative biogenesis 1184

center from C E) Biogenesis center from the same cell (C) without any obvious CurT 1185

clustering of gold particles F) Schematic depiction of a wild-type cell (from Figure 2A) with 1186

color-coded curved membranes green = thylakoids that follow the curvature of the cell red = 1187

37

thylakoids that bend away from the plasma membrane yellow = thylakoids that bend toward 1188

the plasma membrane to converge on sites of biogenesis centers G) Relative distribution of 1189

gold signals between convex (dark color) and concave (light color) sides of membranes (n = 1190

1584 signals from a total of 95 cells) The undifferentiated overall signal distribution is given 1191

in blue Bars = 200 nm (overview) and 100 nm (details) 1192

1193

Figure 11 Differentially modified forms of CurT are found in different complexes in PDMs 1194

and thylakoid membranes Samples were isolated by fractionation of wild-type membranes 1195

via two consecutive sucrose density gradients according to Schottkowski et al (2009b) After 1196

density centrifugation samples were applied to BNSDS-PAGE analysis (A) or isoelectric 1197

focusing (B) Numbers on the right indicate the respective fraction from the second gradient 1198

(see Figure 7) Fraction 5 represents the PDMs and fraction 9 the thylakoid membrane 1199

1200

Figure 12 Loss of CurT increases sensitivity to abiotic stress A B) Doubling times of wild-1201

type and curT- under salt stress (A) or osmotic stress (B) Doubling times are means plusmn SD of 1202

three independent cultures C) Localization of CurT-CFP under salt and osmotic stress 1203

Samples were examined as described in Figure 8 Scale bars 1 microm D) Protein levels of wild-1204

type cells after growth in BG11 medium containing 500 mM NaCl Samples were analyzed on 1205

the same gel but unrelated samples between the presented signals were omitted E) 1206

Membrane preparations obtained from wild-type cells wild-type cells grown in the presence 1207

of 500 mM NaCl and curT- cells were subjected to the first gradient step in the membrane 1208

fractionation scheme The gradient was divided into five fractions and 10 of fractions I-IV 1209

and 02 of fraction V were analyzed by SDS-PAGE Fraction II includes the plasma 1210

membrane and fraction V consists of PratA-defined membrane and thylakoid membrane 1211

1212

Figure 13 Model of CurT distribution at convergence zones in Synechocystis 6803 The 1213

distribution of CurT in thylakoid (green) and plasma membranes (brown) is shown The 1214

pattern of localization of CurT in the thylakoid membrane is derived from membrane 1215

fractionation via sucrose density centrifugation fluorescence-based detection of the CurT-1216

CFP fusion and endogenous CurT and immunogold labeling experiments (Figures 7-10) The 1217

different CurT variants a b c and d identified in the IEF experiments (Figure 11) are depicted 1218

in yellow pink blue and black respectively CurT present in the plasma membrane is 1219

highlighted in gray as its precise nature and role remain to be defined (Figure 12) 1220

Membranes are represented as lipid bilayers Convex and concave faces of bent thylakoid 1221

38

sheets are indicated by black arrows The PDM which is dedicated to PSII assembly and 1222

repair is depicted in blue The dotted blue line emphasizes that the ultrastructure in this region 1223

has not yet been fully resolved PP periplasm PM plasma membrane TM thylakoid 1224

membrane L lumen PDM PratA-defined membrane 1225

1226

Tables 1227

Table 1 Physiological characteristics of the curT- mutant 1228

Strain Doubling time [h]

Oxygen Evolution[nmol h-1 OD750

-1]c

Chlorophyll content

[microg OD750-1]

d

Cell size [microm]e

Cell number [ml-1 OD750

-1]f

Wild type 817plusmn017a 1600plusmn042

b 1933plusmn187 251plusmn014 264plusmn020 390plusmn006 x 107

curT- 1259plusmn020a 3226plusmn056

b 1074plusmn20 195plusmn029 274plusmn044 367plusmn016 x 107

1229 abDoubling times in the presence (a) or absence (b) of 5 mM glucose measured under 1230

continuous illumination at 30 micromol photons m-2 s-1 and CO2-limiting conditions cOxygen 1231

evolution is expressed in nmol O2 produced per hour per OD750 unit dChlorophyll content is 1232

expressed in microg OD750-1 eThe diameter of non-dividing cells is presented in microm fCell number 1233

was determined per ml per OD750 Data are means plusmn SD of at least three independent 1234

experiments 1235

1236

Parsed CitationsAllen JF de Paula WBM Puthiyaveetil S and Nield J (2011) A structural phylogenetic map for chloroplast photosynthesisTrends Plant Sci 16 645-655

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Anderson JM Horton P Kim E-H and Chow WS (2012) Towards elucidation of dynamic structural changes of plant thylakoidarchitecture Philos Trans R Soc Lond B Biol Sci 367 3515-3524

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Armbruster U Zuumlhlke J Rengstl B Kreller R Makarenko E Ruumlhle T Schuumlnemann D Jahns P Weisshaar B NickelsenJ and Leister D (2010) The Arabidopsis thylakoid protein PAM68 is required for efficient D1 biogenesis and photosystem IIassembly Plant Cell 22 3439-3460

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Armbruster U Labs M Pribil M Viola S Xu W Scharfenberg M Hertle AP Rojahn U Jensen PE Rappaport F JoliotP Doumlrmann P Wanner G and Leister D (2013) Arabidopsis CURVATURE THYLAKOID1 proteins modify thylakoid architectureby inducing membrane curvature Plant Cell 25 2661-2678

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Aseeva E Ossenbuumlhl F Sippel C Cho WK Stein B Eichacker LA Meurer J Wanner G Westhoff P Soll J andVothknecht UC (2007) Vipp1 is required for basic thylakoid membrane formation but not for the assembly of thylakoid proteincomplexes Plant Physiol Biochem 45 119-128

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Bartsevich VV and Pakrasi HB (1995) Molecular identification of an ABC transporter complex for manganese analysis of acyanobacterial mutant strain impaired in the photosynthetic oxygen evolution process EMBO J 14 1845-1853

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Bartsevich VV and Pakrasi HB (1996) Manganese transport in the cyanobacterium Synechocystis sp PCC 6803 J Biol Chem271 26057-26061

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Bernaacutet G Waschewski N and Roumlgner M (2009) Towards efficient hydrogen production the impact of antenna size andexternal factors on electron transport dynamics in Synechocystis PCC 6803 Photosynth Res 99 205-216

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Boehm M Yu J Krynicka V Barker M Tichy M Komenda J Nixon PJ and Nield J (2012) Subunit Organization of aSynechocystis Hetero-Oligomeric Thylakoid FtsH Complex Involved in Photosystem II Repair Plant Cell 24 3669-3683

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Bradford MM (1976) A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle ofprotein-dye binding Anal Biochem 72 248-254

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Chang L Liu X Li Y Liu C-C Yang F Zhao J and Sui S-F (2015) Structural organization of an intact phycobilisome and itsassociation with photosystem II Cell Res 25 726-737

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Danielsson R Suorsa M Paakkarinen V Albertsson P-Aring Styring S Aro E-M and Mamedov F (2006) Dimeric andmonomeric organization of photosystem II Distribution of five distinct complexes in the different domains of the thylakoidmembrane J Biol Chem 281 14241-14249

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Daum B Nicastro D Austin J McIntosh JR and Kuumlhlbrandt W (2010) Arrangement of photosystem II and ATP synthase in

2

Abstract 35 36

Photosynthesis occurs in thylakoids a highly specialized membrane system In the 37 cyanobacterium Synechocystis sp PCC 6803 (hereafter Synechocystis 6803) the thylakoids 38 are arranged parallel to the plasma membrane and occasionally converge towards it to form 39 biogenesis centers The initial steps in photosystem II (PSII) assembly are thought to take 40 place in these regions which contain a membrane subcompartment harboring the early 41 assembly factor PratA and are referred to as PratA-defined membranes (PDMs) Loss of 42 CurT the Synechocystis 6803 homolog of Arabidopsis thaliana grana-shaping proteins of the 43 CURVATURE THYLAKOID1 family results in disrupted thylakoid organization and the 44 absence of biogenesis centers As a consequence PSII is less efficiently assembled and 45 accumulates to only 50 of wild-type levels CurT induces membrane curvature in vitro and 46 is distributed all over the thylakoids with local concentrations at biogenesis centers There it 47 forms a sophisticated tubular network at the cell periphery as revealed by live-cell imaging 48 CurT is part of several high molecular-weight complexes and Blue NativeSDS-PAGE and 49 isoelectric focusing demonstrated that different isoforms associate with PDMs and thylakoids 50 Moreover CurT deficiency enhances sensitivity to osmotic stress adding a level of 51 complexity to CurT function We propose that CurT is crucial for the differentiation of 52 membrane architecture including the formation of PSII-related biogenesis centers in 53 Synechocystis 6803 54

55 Introduction 56 57

Oxygenic photosynthesis originated in cyanobacteria more than 24 billion years ago 58

and went on to transform Earthrsquos atmosphere and biosphere The underlying process of light-59

driven photosynthetic electron transport is mediated by multiproteinpigment complexes 60

which are located within a specialized system of membrane sheets termed thylakoids During 61

the evolutionary transition from cyanobacteria to present-day chloroplasts this system has 62

undergone substantial diversification (Mullineaux 2005 Allen et al 2011) Contemporary 63

forms range from undifferentiated thylakoids in cyanobacteria to elaborate systems that are 64

differentiated into grana and stroma regions in plant chloroplasts (Mullineaux 2005) 65

Despite this increase in complexity over the course of evolution even ldquosimplerdquo 66

cyanobacterial systems exhibit compositional and functional membrane heterogeneity 67

(Nickelsen and Rengstl 2013) Perhaps the most striking example is the cyanobacterium 68

Gloeobacter violaceus which lacks internal thylakoids and organizes its photosynthetic 69

complexes in distinct patches within the plasma membrane (Rexroth et al 2011) Moreover 70

spatial separation between developing and functional thylakoids has been observed in the 71

model cyanobacterium Synechocystis sp PCC 6803 (hereafter Synechocystis 6803) 72

Immunolocalization of the photosystem II (PSII) assembly factor PratA (for processing-73

associated TPR protein) in fractionated membranes and examination of ultrathin sections by 74

immunogold electron microscopy have revealed specialized PratA-defined membrane (PDM) 75

3

regions forming biogenic centers at peripheral sites in cells where thylakoids converge 76

(Schottkowski et al 2009b Stengel et al 2012) 77

Some details of the ultrastructure of these centers have begun to emerge (Stengel et al 78

2012) Some of the convergence areas are composed of a rod-like structure ndash previously 79

named the ldquothylakoid centerrdquo ndash which is in turn surrounded by membranous material within 80

which thylakoid lamellae appear to originate (van de Meene et al 2006 Stengel et al 2012 81

Nickelsen and Zerges 2013 Ruumltgers and Schroda 2013) A current working model for these 82

biogenesis centers postulates that the initial steps in the assembly of photosynthetic complexes 83

ndash and in particular photosystem II (PSII) ndash take place at the biogenic PDMs Subsequently 84

pre-complexes migrate laterally into thylakoid lamellae where their assembly is completed 85

(Nickelsen and Rengstl 2013) Recently evidence based on the subcellular distribution of the 86

D1 degradation-related FtsH protease and the PSII repair factor Slr0151 (Yang et al 2014 87

Sacharz et al 2015 Rast et al 2016) has been obtained that maintenance ie the repair of 88

PSII is also localized at or near these areas However whether or not plasma and thylakoid 89

membranes fuse at these sites has not yet been resolved (Liberton et al 2006 van de Meene 90

et al 2006 van de Meene et al 2012) 91

Only limited information is available on the spatial organization of thylakoid 92

membrane biogenesis in land plants Their chloroplasts harbor a dynamic thylakoid membrane 93

system which is comprised of non-appressed stromal thylakoids and appressed grana regions 94

Stromal thylakoids are likely to represent sites where membrane proteins are synthesized and 95

assembled within the membrane (Yamamoto et al 1981 Danielsson et al 2006) while the 96

physicochemical forces driving grana formation are still a matter of debate (Nevo et al 2012 97

Kirchhoff 2013 Pribil et al 2014) It has however been proposed that stromal moieties of 98

LHCII determine membrane stacking of adjacent thylakoid disks (Fristedt et al 2009 Daum 99

et al 2010 Anderson et al 2012) Moreover a family of thylakoid-shaping proteins with 100

four members named CURVATURE THYLAKOID1A-D (CURT1A-D) has been identified 101

in Arabidopsis thaliana (Armbruster et al 2013) CURT1 proteins localize to grana margins 102

where they induce membrane bending thereby determining the architecture of the thylakoid 103

network (Pribil et al 2014) Intriguingly cyanobacteria whose thylakoids do not differentiate 104

into grana regions also contain a single CURT1 homolog (Armbruster et al 2013) Here we 105

report on the characterization of this homolog CurT from Synechocystis 6803 Our data 106

reveal that the cyanobacterial protein is essential for the shaping of thylakoid membranes and 107

thereby promotes efficient assembly of PSII at the cell periphery Our data argue for an 108

ancient membrane-curving activity of CURT1-like proteins which are necessary to form an 109

4

efficient thylakoid system in cyanobacteria as well as having a critical role in the response to 110

osmotic stress 111

112

Results 113

Inactivation of curT affects membrane architecture 114

The open reading frame slr0483 encodes the only CURT1-like protein expressed in the 115

cyanobacterium Synechocystis 6803 The corresponding cyanobacterial gene was previously 116

named synCURT1 to emphasize its homology to CURT1 from Arabidopsis thaliana 117

(Armbruster et al 2013 Luque and Ochoa de Alda 2014) However in conformity with 118

conventional nomenclature for bacterial genes we adopt the name lsquocurTrsquo The CurT protein is 119

predicted to comprise 149 amino acids and contains within its C-terminal half two putative 120

transmembrane domains (TMDs) which exhibit a high degree of sequence similarity with the 121

Arabidopsis CURT1A-D proteins The N-terminal half shows less similarity to its 122

Arabidopsis counterparts but it harbors a predicted amphipathic α-helix (amino acids 46-62) 123

that has been implicated in membrane bending (Figure 1A and 1B Armbruster et al 2013) 124

Interestingly the TMDs of CURT homologs share sequence and structural features with a 125

domain that is found in some thylakoid-associated cyanobacterial aminoacyl-tRNA 126

synthetases and has been hypothesized to be involved in mediating the unusual membrane 127

attachment of these enzymes (Luque and Ochoa de Alda 2014) 128

To verify the predicted membrane association of CurT total membranes from wild-129

type cells were exposed to various agents and the solubility of CurT was assessed using an 130

antibody directed against a fragment comprising its first 58 N-terminal amino acids (Figure 131

1A) We first confirmed that CurT can be detected in the membrane fractions of cell lysates 132

and exposure to 01 M Na2CO3 4 M urea or 1 M NaCl failed to extract it as would be 133

expected for a membrane-bound protein (Figure 1C) Indeed treatment of the cell lysate with 134

the non-ionic detergent Triton X-100 rendered CurT soluble as was the case for the PSII 135

inner antenna protein CP47 ndash an integral membrane protein with six transmembrane α-helices 136

(Figure 1C) Thus CurT like its Arabidopsis counterparts is likely to be an integral 137

membrane protein 138

To test whether the cyanobacterial CurT has similar membrane-tubulating properties to 139

CURT1A of A thaliana we used the same liposome-based assay to probe its ability to form 140

tubules (Armbruster et al 2013) We expressed CurT in vitro using a cell-free extract 141

supplemented with liposomes similar in composition to the thylakoid membrane 142

Subsequently liposome topology was visualized by transmission electron microscopy (TEM 143

5

Figure 1D) Like the grana-forming CURT1A its Synechocystis 6803 homolog efficiently 144

induced localized ldquocompressionrdquo of liposomes into thin tubule-like segments revealing its 145

strong membrane-curving activity (Figure 1D) Hence the membrane-shaping function of 146

members of the CURT1 family is conserved from cyanobacteria to plants Nevertheless 147

liposome shapes caused by either CurT or CURT1A displayed some differences in the degree 148

of membrane tubulation These might be due to the variable N-termini of both proteins 149

(Figure 1D) 150

To dissect the function of CurT in vivo we generated a knock-out mutant by inserting 151

a kanamycin-resistance cassette into the unique AgeI site in the slr0483 reading frame 152

(Supplemental Figure 1A Methods) Complete segregation of the mutation was confirmed by 153

PCR and immunoblot analyses (Supplemental Figure 1B and 1C) Progressively higher levels 154

of antibiotic (up to 400 microg kanamycinml) were used for mutant selection as previous 155

attempts to select a fully segregated curT- mutant had been unsuccessful probably due to 156

application of insufficient selection pressure (Armbruster et al 2013) When growth rates of 157

wild-type and mutant cells were compared 20- and 15-fold increases in doubling time were 158

observed for curT- grown under photoauto- and photoheterotrophic conditions respectively 159

(Table 1 Supplemental Figure 2) 160

Strikingly curT inactivation also led to loss of competence for DNA uptake during 161

both transformation and conjugation-based experiments Hence attempts to complement the 162

curT- mutant were not applicable However in the course of the work four independent 163

rounds of transformation of wild-type cells were carried out to generate fresh curT- mutants 164

All mutant strains obtained the same phenotype strongly suggesting that no secondary sites 165

were involved in its establishment To rule out the possibility that read-through transcription 166

from the resistance marker gene affects the upstream reading frame slr0482 (of unknown 167

function) in the mutant RT-PCR with appropriate primers was performed (Supplemental 168

Figure 3) No change in slr0482 mRNA accumulation was observed confirming that the curT- 169

phenotype is caused by disruption of the curT gene In agreement with this finding recent 170

transcriptome analyses of Synechocystis 6803 have clearly shown that the curT mRNA is 171

monocistronic (Kopf et al 2014) 172

In view of CurTrsquos in vitro membrane-tubulating activity the ultrastructure of the curT- 173

mutant was examined by TEM As shown in Figure 2A the wild-type strain exhibits the 174

typical thylakoid organization with ordered thylakoid sheets at the cell periphery and 175

convergence zones next to the plasma membrane In contrast massive disorganization of the 176

thylakoid membrane system was observed in curT- In all cells analyzed the mutant 177

6

thylakoids appeared as disordered sheets that traversed the cytoplasm and completely lacked 178

the typical convergence zones with the corresponding biogenesis centers at the periphery 179

(Figures 2B-D) This indicates a strict requirement of CurT for the establishment of normal 180

thylakoid membrane architecture in Synechocystis 6803 181

182

Inactivation of curT affects photosynthetic performance 183

The severely altered morphology of the thylakoid membrane system in curT- cells and 184

in particular the lack of PSII-related biogenesis centers prompted us to investigate the 185

photosynthetic performance of the mutant (Stengel et al 2012) The chlorophyll content was 186

reduced by ~20 and absorption spectroscopy also revealed a reduction in phycobilisomes 187

as well as an increase in carotenoid levels (Table 1 Supplemental Figure 4) Despite changes 188

in ultrastructure and pigment levels size and number of curT- cells at OD750 were not 189

significantly different as judged by t-test-based statistical analysis (Table 1) 190

To explore the photosynthetic defects of the mutant in detail immunoblot analyses 191

were performed using antibodies raised against specific subunits of photosynthetic complexes 192

and some of their biogenesis factors In curT- PSII reaction-center subunits including D1 D2 193

CP47 and CP43 were found to be present at 44 42 56 and 45 of the wild-type level 194

respectively (Figure 3) Interestingly amounts of the PSII assemblyrepair factors PratA and 195

Slr0151 as well as the light-dependent protochlorophyllide oxidoreductase (POR) enzyme 196

were also reduced (Figure 3 Yang et al 2014 Rast et al 2016) Levels of the Pitt protein 197

which interacts with POR (Schottkowski et al 2009a) and the Oxa homolog YidC 198

(Ossenbuumlhl et al 2006) were slightly increased in curT- (Figure 3) On the other hand 199

Sll0933 the homolog of the PSII assembly factor PAM68 in A thaliana accumulated to 200

250 of the wild-type level (Armbruster et al 2010) In contrast amounts of both Cytf and 201

PsaA which serve as markers for the Cyt(b6f) and PSI complexes respectively the RbcL 202

subunit of the Rubisco enzyme the PSII assembly factor Ycf48 (Komenda et al 2008) and 203

VIPP1 remained unaltered in curT- (Figure 3) Overall the alterations in protein accumulation 204

indicate that loss of CurT preferentially affects the accumulation of PSII 205

This result was further corroborated by analysis of the photosynthetic performance of 206

curT- The rate of light-dependent oxygen evolution was reduced by approximately 50 in the 207

mutant (Table 1) and analysis of P700+ reduction kinetics revealed impaired electron donation 208

by PSII (Figure 4A) PSII-driven P700+ reduction is slowed down by a factor of three in curT-209

whereas the residual cyclic electron transfer activity in the presence of DCMU is less than 210

5 in both wild-type and curT- (Figure 4B) In contrast the light intensity-dependent electron 211

7

transfer capacity which was measured as relative electron transfer rate (rETR) did not differ 212

significantly between wild-type and curT- (Figure 4C) Both wild-type and curT- cells reach a 213

capacity limit at ~ 250 micromol photons m-2s-1 and the decay of rETR beyond the capacity limit 214

is very similar These results indicate that the point of onset of PSII-related photoinhibition is 215

the same in both strains which in turn implies that electron flow downstream of PSII is 216

unchanged in the mutant 217

Low PSII levels in curT- could be caused either by reduced synthesisbiogenesis or its 218

enhanced degradation To measure the rates of D1 repair the kinetics of D1 accumulation 219

upon induction of photoinhibition by high-light treatment (800 micromol photons m-2s-1) was 220

assayed by immunological means (Figure 4D) In wild-type cells the D1 level decreased to 221

60 (relative to the initial time point) after 90 min of treatment As previously shown the 222

drop is much more pronounced (~35 left) when repair synthesis of D1 is inhibited by the 223

addition of lincomycin (Figure 4D Komenda et al 2008) Surprisingly in curT- the level of 224

residual D1 is rather stable over the same time period and lincomycin treatment induces a 225

more modest decrease to 60 relative to the initial time point (Figure 4D) These data clearly 226

indicate that in absence of CurT residual D1 is less susceptible to degradation even though 227

its absolute amount is reduced In line with this no effect on growth rates was observed when 228

either wild-type or curT- cells were cultivated for two days at 200 micromol photons m-2s-1 229

(Supplemental Figure 5) 230

To assess the role of CurT in the assembly of PSII we compared the two-dimensional 231

profiles of thylakoid membrane proteins from wild-type and mutant cells by Blue-Native 232

(BN)SDS-PAGE PSII assembly intermediates were subsequently visualized via 233

immunodetection of PSII core subunits As shown in Figure 5A dimeric PSII core complexes 234

(RCCII) are drastically underrepresented in curT- whereas relative levels of earlier assembly 235

intermediates including the monomeric CP43-less RC47 complex and non-assembled CP43 236

increase Parallel detection of CurT itself revealed a ldquosmearedrdquo signal in the size range from 237

15 up to 500 kDa suggesting that CurT forms part of high-molecular-weight complexes 238

(Figure 5A) Finally in vivo 35S protein pulse-labeling experiments confirmed that RC and 239

RC47 complexes in particular are efficiently formed in curT- but the transition to RCCI 240

complexes is severely delayed (Figure 5B) As a consequence dimeric RCCII complexes do 241

not incorporate any radioactive label over the experimentrsquos time course of 25 min (Figure 5B) 242

Taken together these data show that curT inactivation has a severe impact on PSII biogenesis 243

but little or no effect on the degradation of the complex 244

8

The data presented so far suggest a PSII-related phenotype for curT- so we explored 245

the effects of curT disruption on photosynthesis further by comparing the low-temperature 246

(77K) fluorescence emission spectra in cell suspensions following excitation of chlorophyll at 247

440 nm (Figure 6A) The signals were normalized to the emission maximum at 514 nm of the 248

external standard fluorescein (Figure 6A) In curT- the PSI emission peak amplitude was 249

similar to that of the wild-type (Figure 6A) The spectra differed however around 685 nm 250

Here we observed an increase in fluorescence in the mutant strain an emission signature that 251

is probably related to the inner antenna protein CP43 (Figure 6A Nilsson et al 1992) 252

Increased chlorophyll fluorescence at 685 nm has previously been shown to be characteristic 253

for cells that are accumulating the stress-induced IsiA protein which shares structural 254

similarities with CP43 (Odom et al 1993 Yeremenko et al 2004 Wilson et al 2007) A 255

second indication for accumulation of IsiA is a diagnostic blue shift of the 725 nm 256

fluorescence peak by approximately 5 nm which is indeed observed in the curT- spectrum 257

(Figure 6A Sandstroumlm et al 2001) We therefore determined the level of IsiA in both wild-258

type and curT- by immunoblot analysis As expected IsiA was strongly induced in curT- 259

suggesting that the mutant suffers from severe stress (Figure 6C) When fluorescence at 77K 260

was recorded after excitation at 580 nm which mainly excites the phycobiliproteins the 261

signal at 685 nm (PSII related) was enhanced in the curT- mutant most likely reflecting IsiA 262

emission andor the presence of uncoupled phycobilisomes (Figure 6B Wilson et al 2007) 263

In contrast the 725 nm peak (PSI related) was reduced in curT- relative to the wild-type 264

suggesting less coupling of phycobilisomes to PSI (Figure 6B) The increase in uncoupled 265

phycobilisomes can be directly attributed to the reduction in RCCII levels found in the curT- 266

mutant (Figure 5A) since phycobilisomes are attached to PSII dimers for efficient light 267

harvesting (Watanabe and Ikeuchi 2013 Chang et al 2015) 268

Thus the curT- mutant exhibits a characteristic set of photosynthetic defects The 269

primary target of the CurT membrane-shaping function appears to be PSII in particular in its 270

biogenic phase However the reduction in PSII content cannot be responsible for the lack of 271

thylakoid convergence zones at the plasma membrane because these structures can still be 272

observed in the psbA- mutant TD41 which is lacking D1 and therefore unable to assemble any 273

PSII complexes (Supplemental Figure 6 Nilsson et al 1992) 274

275

Subcellular localization of CurT 276

We have previously proposed that the initial steps in PSII assembly take place in 277

biogenesis centers located at the interface between plasma and thylakoid membranes (Stengel 278

9

et al 2012) These biogenic membranes (PDMs) are marked by the PSII Mn2+ delivery factor 279

PratA and can be separated from thylakoids by a two-step sucrose-gradient centrifugation 280

procedure (Schottkowski et al 2009b Rengstl et al 2011) When the distributions of various 281

proteins within such membrane fractions from the wild-type and curT- were compared two 282

striking changes were detected in the mutant First the precursor of the D1 subunit of PSII 283

(pD1) is absent from PDMs in the mutant and secondly the inner antenna protein CP47 ndash but 284

not CP43 ndash of PSII shifts towards fractions of lower density (Figure 7) Hence the 285

organization of PDMs appears to be perturbed in curT- In wild-type cells most of the CurT 286

protein was found in thylakoid membranes only a minor fraction similar in amount to that of 287

the PSII assembly factors Ycf48 Pitt and YidC as well as the VIPP1 protein comigrated with 288

PDMs (Figure 7) According to rough estimates based on densitometric signal analysis 25 289

of total cellular CurT is normally found in the PDMs and 75 in the thylakoids (Figure 7) 290

To further analyze the localization of CurT in its cellular context in vivo we 291

constructed a translational fusion in which the monomeric enhanced cyan fluorescent protein 292

(CFP) mTurquoise2 (Goedhart et al 2012) is attached to the C-terminus of CurT and is 293

expressed under the control of the native curT promoter The resulting strain curT-CFP 294

showed a fully restored wild-type growth phenotype indicating that the CFP tag does not 295

affect CurTrsquos function (Supplemental Figure 7A) In agreement with this the fusion protein 296

accumulated to wild-type levels (96 plusmn 16 Supplemental Figure 7B) and localized to the 297

same membrane sub-fractions as does native CurT (Supplemental Figure 7C) The CurT-CFP 298

fluorescence signal was distinctly discernible above the wild-type autofluorescence 299

background (Supplemental Figure 8A) and was distributed in a network-like pattern with 300

concentrated areas at the cell periphery at mid-plane Analysis of CurT-CFP fluorescence in 301

Z-axis montages revealed that these signals often appeared as rod-like structures which 302

seemed to follow the spherical inner surface of the cell (Figure 8A B Supplemental Movie 1 303

and 2) In some cases these structures also appear to extend through the cytoplasm (Figure 304

8A and 8B Supplemental Movie 3) 305

When chlorophyll autofluorescence indicative of thylakoid membranes was visualized 306

in the same cell only a partial overlap with the CurT-CFP signal was observed (Figure 8 307

Supplemental Movie 1-3) Strikingly the peripheral CurT-CFP signals frequently reached 308

their maximal intensity in those areas where chlorophyll fluorescence was low ie where 309

thylakoid convergence zones are expected to form (Sacharz et al 2015) This becomes even 310

clearer when the intensity of a circumferential profile that follows the thylakoidrsquos 311

10

fluorescence signal is quantified separately for each of the two fluorescent channels (Figure 312

8C) 313

In contrast the chlorophyll autofluorescence in the curT- mutant seems to be evenly 314

distributed (Supplemental Figure 9) Following the fluorescence in an intensity profile as in 315

curT-CFP no regions with a similar decline in fluorescence were found most likely due to 316

the absence of biogenesis centers In addition some circular structures presenting chlorophyll 317

autofluorescence were detected in the interior of the cells Hence the disturbed curT- 318

ultrastructure is also reflected in the distribution of chlorophyll pigments (Supplemental 319

Figure 9) 320

To confirm the network-like distribution of CurT-CFP in the cell we used 321

immunofluorescence to detect CurT in the wild-type in situ Synechocystis 6803 cells were 322

fixed and treated with the αCurT antibody and an Oregon Green-conjugated secondary 323

antibody As shown in Figure 9A and B both techniques revealed similar network-like 324

patterns of the CurT signal which coalesced into rod-like structures at the cell surface and 325

essentially filled up the gaps between the autofluorescent thylakoid regions (negative controls 326

shown in Supplemental Figure 8B and 8C) Again regions of low chlorophyll fluorescence 327

typical of biogenesis centers generally exhibited stronger CurT-related fluorescence (Figure 328

8C) Occasionally CurT-CFP signals were also observed near traversing thylakoid lamellae 329

(when these were present in the cell analyzed) but the autofluorescence intensity of such 330

thylakoids is much weaker (see Figure 8B cell b in slice 6 and Supplemental Movie 3) 331

Finally CurT was localized by immunogold labeling experiments on ultrathin sections 332

of wild-type Synechocystis 6803 cells Almost no signals were detected when wild-type and 333

curT- sections were processed in the absence of the primary antibody as a negative control 334

(Figure 10A and Supplemental Figure 10A respectively) When mutant curT- cells were 335

processed in the presence of the αCurT antiserum a low level of randomly distributed 336

background signals was observed (Supplemental Figure 10B Supplemental Table 1) 337

However the number of signals located at the thylakoid membrane was clearly reduced 338

relative to the wild-type Therefore these signals were treated as non-specific background 339

Upon incubation of wild-type cell sections with antibodies directed against the N-terminus of 340

CurT (Figure 1A) the antigen was detected on the cytoplasmic surface of thylakoid 341

membranes (Figure 10B and 10C) This strongly suggests that its N-terminus is oriented 342

towards the cytoplasm Overall CurT signals appeared to be distributed along both thylakoids 343

and PDMs This agrees with the broad distribution of CurT across various fractions in the 344

membrane fractionation experiments (Figure 7) In only a few cases (12 ) however was 345

11

some clustering of immunogold signals at thylakoid convergence regions found (Figure 10D 346

and 10E) Thus the high local concentration of CurT at biogenic centers seen in the 347

fluorescence-based approaches (Figures 8 and 9) was not quantitatively reflected in the 348

immunogold labeling data This is likely due to the fact that immunogold electron microscopy 349

can only detect antigens on the surface of the section This issue is further complicated by the 350

heterogeneity of the CurT assemblies (see below and Discussion section) 351

Nevertheless closer inspection of the immunogold signals revealed an asymmetric 352

distribution of CurT signals with regard to the two faces of thylakoid sheets As illustrated in 353

Figure 10G curved thylakoid sheets possess a longer convex and a shorter concave face 354

When we analyzed a total of approximately 1500 CurT immunogold signals (from a total of 355

95 cells) which were unambiguously located to one side of the thylakoid membrane (for a 356

representative example see Supplemental Figure 11) 561 were found to be located at the 357

convex face while the other 439 localized to the concave side (Figure 10G Supplemental 358

Table 2) When differently curved regions (Figure 10F) including thylakoid lamellae (i) that 359

follow the overall shape of the cell (green) (ii) bend away from the plasma membrane (red) or 360

(iii) towards it ie where thylakoids converge to form biogenesis centers (yellow) were 361

examined separately red and green regions showed a CurT distribution in the range of 55 362

convex to 45 concave (Figure 10G Supplemental Table 2) However at the biogenesis 363

centers (the regions highlighted in yellow in Figure 10F) the uneven distribution of the 364

immunogold signals was more pronounced 61 of signals were found on the convex side 365

and 39 on the concave face of thylakoid lamellae (Figure 10G Supplemental Table 2) 366

Statistical analyses confirmed the significance of these differences in signal distributions 367

along the thylakoid membrane types (Supplemental Table 3) 368

Taken together with the finding that CurT is required for the formation of the 369

convergence sites forming biogenesis centers these data are consistent with the idea that the 370

thylakoid sheets are shaped by CurT which induces membrane curvature via asymmetric 371

intercalation on the two sides of thylakoid sheet 372

373

Different forms of CurT are found in PDMs and thylakoids 374

CurT was found to localize to both highly curved PDMs and less bent thylakoids Its 375

high local concentration at biogenic centers as seen in the fluorescence-based approaches 376

suggests a dosage-dependent effect of CurT on membrane shaping An alternative possibility 377

is that different CurT variants might exist in the two membrane types which could potentially 378

serve different functions To explore this possibility we asked whether CurT is found in 379

12

different complexes by using 2D BNSDS-PAGE to characterize membrane material isolated 380

via two-step sucrose gradient centrifugation (see Figure 7) In accordance with the data in 381

Figure 5A we find several low-molecular-weight complexes containing CurT (Figure 11A) 382

Smaller complexes of ~80 (complex I) and ~100 kDa (complex II) accumulate in membrane 383

fraction 5 (representing PDMs) but these are far less prevalent in fraction 9 representing 384

thylakoids (Figure 11A) In addition CurT-containing sub-complexes of ~140 (complex III) 385

and ~200 kDa (complex IV) are more prominently represented in thylakoids together with 386

even larger complexes ranging up to 670 kDa (Figure 11A) 387

Even more strikingly PDMs and thylakoids also differ with respect to the forms of 388

CurT they contain Thus isoelectric focusing (IEF) analysis of both membrane fractions 389

revealed at least four different CurT isoforms (a-d Figure 11B) PDMs contain mainly forms 390

b and d as well as trace amounts of a while thylakoids apparently possess very low levels of 391

form d and accumulate forms a b and c (Figure 11B) The nature of the underlying CurT 392

modifications still has to be determined Interestingly however CurT has recently been 393

identified as a phosphoprotein in a proteomic study (Spaumlt et al 2015) and the CurT variants 394

in Figure 11B may differ in their phosphorylation states At all events PDMs and thylakoids 395

can be distinguished by their complement of CurT isoforms which potentially play a role in 396

formation of the CurT sub-complexes that define the two membrane fractions 397

398

CurT is involved in the osmotic stress response 399

To further explore the stress-related role of CurT (Figure 6) and its link to IsiA 400

induction the effect of other potential stressors on curT- cells was tested High light levels had 401

a minor effect on curT- growth and its photosynthetic performance (Figure 4 Supplemental 402

Figure 5 and section above) suggesting that other environmental factors induced isiA 403

expression Our search was also motivated by a previous proteomic survey of plasma 404

membrane proteins of Synechocystis 6803 in high salt conditions in which CurT and VIPP1 405

were found among the most highly induced targets (Huang et al 2006) First we cultured 406

wild-type and curT- cells in different salt concentrations and found that growth of curT- was 407

severely affected in high salt (Figure 12A) Wild-type cells were only slightly affected by the 408

addition of salt to the medium The deleterious effect of the loss of curT on growth was even 409

more pronounced when maltose an osmotically active compound was present in the medium 410

(Figure 12B) Indeed curT- cells failed to survive exposure to 150 mM maltose whereas 411

growth of the wild-type was only slightly compromised These findings assign an additional 412

function to CurT ie a protective role during osmotic stress 413

13

When the curT-CFP strain was analyzed under these stress conditions enhanced 414

accumulation of CurT at the cell periphery was found mostly outside the autofluorescent 415

thylakoids and consistent with accumulation at the plasma membrane (Figure 12C) This was 416

further substantiated by membrane fractionation experiments which also revealed an 417

increased relative abundance of CurT in the plasma membrane fraction in the first sucrose 418

gradient (Figure 12E) Determination of total cellular CurT levels demonstrated that its 419

absolute amount did not increase under stress (Figure 12D) Therefore its higher abundance 420

in the plasma membrane under osmotic stress is likely to be due to CurT trafficking towards 421

the plasma membrane instead of increased synthesis 422

The same appears to hold true for VIPP1 which has been implicated in membrane 423

maintenance in both cyanobacteria and chloroplasts (Zhang and Sakamoto 2015) At stress 424

conditions an increase of the VIPP1 signal in the plasma membrane can be monitored in 425

wild-type (Figure 12E) However enhanced accumulation of VIPP1 in plasma membranes is 426

unaffected in the curT- mutant suggesting that thylakoid convergence zones are not strictly 427

required for the localization of VIPP1 428

429

Discussion 430

CurT determines thylakoid architecture 431

This study demonstrates that the protein CurT a homolog of the grana-forming 432

CURT1 proteins in plants is essential for establishing the proper thylakoid membrane 433

architecture in the cyanobacterium Synechocystis 6803 In particular CurTrsquos membrane-434

bending activity is likely to be required for the formation of thylakoid biogenesis centers at 435

points on the cell periphery where thylakoids converge towards the plasma membrane Here 436

PratA-mediated preloading of early PSII assembly intermediates with Mn2+ ions has been 437

proposed to take place together with PSII repair (Stengel et al 2012 Sacharz et al 2015) 438

This idea is supported by the following lines of evidence (i) The curT- mutant is devoid of 439

any thylakoid sectors that have convergence zones at their distal ends instead thylakoid 440

membranes are displaced and disposed as disordered or continuous rings (ii) CurT similarly 441

to CURT1A possesses a membrane-curving activity in vitro and intercalates asymmetrically 442

into thylakoids (iii) A high local concentration of CurT is observed at regions of high 443

curvature where biogenesis centers are found (iv) Lack of CurT affects the formation and 444

accumulation of PSII complexes as well as the abundance of some of its assembly factors 445

The drastic effects of CurT inactivation indicate an important role for this factor in membrane 446

shaping In contrast to the situation for CURT1A from Arabidopsis attempts to stably 447

14

overexpress CurT in Synechocystis 6803 failed Although short-lived transient increases in 448

CurT levels were observed when curT was expressed via strong heterologous promoters 449

wild-type levels of the protein were restored during subsequent rounds of cultivation of 450

transgenic lines Apparently Synechocystis 6803 cells do not tolerate substantial alterations in 451

CurT dosage and counter-select against these 452

This is in agreement with a dosage-dependent membrane-curving activity of CurT 453

which is suggested by its high local concentration at the edges of thylakoid autofluorescent 454

regions which mark the sites of the highly curved thylakoid convergence zones (Figures 8 9 455

and 13 Supplemental Movie 1 2 and 3) In addition some CurT was detected in structures 456

extending through the cytoplasm which most likely represent thylakoid sheets traversing the 457

cell from one thylakoid convergence zone to another (Figures 2A and 8) CurT might be 458

involved in the formation and stabilization of these structures 459

Members of the CURT1 family contain an N-terminal amphipathic α-helix that may 460

be involved in the membrane-bending activity of CurT (Armbruster et al 2013) Several 461

eukaryotic membrane-shaping proteins possess amphipathic helices as part of either an ENTH 462

(epsin N-terminal homology) or an N-BAR (Bin amphiphysin Rvs with N-terminal 463

amphipathic helix) domain (Ford et al 2002 Gallop and McMahon 2005 Zimmerberg and 464

Kozlov 2006) ENTH and N-BAR domains are rather large (~200 amino acids) and it has 465

been shown that amphipatic helices present in those domains insert into one leaflet of the lipid 466

bilayer and thereby induce curvature of the membrane (reviewed by Gallop and McMahon 467

2005 Zimmerberg and Kozlov 2006) However CurT itself is a small protein (149 amino 468

acids) that contains two transmembrane domains which insert into both leaflets of the lipid 469

bilayer (Figure 1A) as already suggested by Armbruster et al (2013) The amphipathic helix 470

faces the cytoplasm in Synechocystis 6803 or the stroma in A thaliana and most likely it 471

fine-tunes the degree of membrane bending mediated by CurT (Armbruster et al 2013) 472

In addition the increase in curvature correlated with CurT accumulation at convex 473

sides of thylakoid lamella (Figure 10 and 13) Hence curving might be mediated by 474

asymmetric integration of CurT into the lipid bilayers forming opposite faces of thylakoid 475

membrane sheets (Figure 13) However the mechanism causing this asymmetry remains 476

elusive 477

The presence of different CurT isoforms and complexes in PDMs and thylakoids adds 478

a further level of complexity and most likely reflects the dynamic regulation of this system 479

(Figure 11) The formation of different complexes might be primed by the phosphorylation of 480

CurT within its N-terminal cytoplasmic part (Spaumlt et al 2015) It seems likely that these 481

15

complexes play distinct roles in mediating the different CurT functions ie membrane 482

bending and maintenance 483

However it remains to be seen how exactly curvature is established maintained and 484

fine-tuned In addition other determinants of membrane topology and their putative interplay 485

with CurT have to be considered eg lipid and protein (complex) composition of 486

membranes cellular turgor pressure and other factors required for membrane 487

biogenesismaintenance eg the VIPP1 protein before precise molecular models of CurTrsquos 488

mode of action can be constructed (Rast et al 2015 and see below) That these other factors 489

can be crucial for membrane architecture is documented by the fact that some marine 490

cyanobacteria such as Prochlorococcus and Synechococcus contain curved thylakoids (but 491

no thylakoid convergence zones at the plasma membrane) although they lack a curT gene 492

493

The role of biogenesis centers 494

The absence of biogenesis centers in the curT- mutant now enables one to answer some 495

questions relating to the role of these thylakoid sub-structures which form in some but not all 496

cyanobacteria (Kunkel 1982 van de Meene et al 2006) First they are not essential since 497

even the curT- mutant still accumulates PSII to ~50 of wild-type levels On the other hand 498

in the mutant assembly of PSII is impaired as revealed by the increased accumulation of early 499

assembly intermediates In addition PSII dimers are almost completely absent in curT- 500

Whether the reduction in PSII dimers is attributable to an assembly problem linked to the 501

absence of biogenesis centers or to a secondary defect in dimer stabilization caused by 502

changes in overall thylakoid membrane ultrastructure remains to be determined Thus 503

biogenesis centers are more likely to represent evolutionary ldquoadd-onsrdquo that facilitated efficient 504

thylakoid biogenesis This is compatible with the fact that some cyanobacteria are devoid of 505

any biogenesis center-related substructures Second their absence compromises PSII but the 506

accumulation of other photosynthetic complexes ie PSI and the Cyt(b6f) complex is not 507

affected by CurT deficiency (Figure 3) This observation agrees with previous findings that 508

neither the PsaA subunit of PSI nor its assembly factor Ycf37 is detectable in isolated PDM 509

fractions (Rengstl et al 2011) 510

In addition to reduced de novo PSII assembly a higher relative stability of D1 in high-511

light experiments has been detected in curT- which suggests that D1 degradation during PSII 512

repair is less efficient in the mutant Photo-damaged D1 is degraded by the FtsH2FtsH3 513

complex which has previously been shown to partly localize to thylakoid convergence zones 514

at the cell periphery ie biogenesis centers (Boehm et al 2012 Sacharz et al 2015) It 515

16

therefore seems possible that the absence of biogenesis centers in curT- leads to 516

mislocalization of the FtsH2FtsH3 complex and less effective D1 degradation 517

Moreover a PSII related-function for CurT is supported by a meta-analysis of the 518

Synechocystis 6803 transcriptome When the CyanoEXpress 22 database (Hernaacutendez-Prieto 519

and Futschik 2012 Hernaacutendez-Prieto et al 2016) was queried for genes co-expressed with 520

curT (slr0483) genes for five PSII subunits ndash psbE psbO psbF psbL and psb30 ndash were 521

found among the first ten hits (Supplemental Table 4) From this we infer that biogenic 522

centers do not play an essential role in the assembly of all photosynthetic complexes but 523

serve to enhance PSII assemblyrepair possibly through the efficient delivery of Mn2+ 524

Residual PSII in curT- cells is likely to be supplied with cytoplasmic Mn2+ via a second 525

independently operating ABC transporter-based system in the plasma membrane named the 526

Mnt pathway (Bartsevich and Pakrasi 1995 Bartsevich and Pakrasi 1996) 527

Formally we cannot exclude that CurT is directly involved in the PSII assembly 528

process However considering CurTrsquos membrane bending capacity and the mutant phenotype 529

(Figure 1D and Figure 2) it appears more likely that CurT forms cellular substructures for 530

efficient PSII biogenesis ie biogenesis centers 531

As mentioned above some ultrastructural features of biogenesis centers have emerged 532

from studies employing EM-based tomography (van de Meene et al 2006) To date however 533

a high-resolution picture of the precise membrane architecture within these centers remains 534

elusive In particular whether or not a direct connection between plasma membrane and 535

thylakoids exists continues to be debated As recently discussed and in line with this gap in 536

knowledge different membrane fractionation techniques have revealed different distributions 537

of PSII-related subunits and assembly factors between plasma and thylakoid membranes 538

(Heinz et al 2016 Liberton et al 2016 Selatildeo et al 2016) The overall picture that emerges 539

is that the initial hypothesis that PSII biogenesis is initiated at the plasma membrane is no 540

longer tenable whereas a specialized thylakoid sub-fraction like the PDMs that make contact 541

with the plasma membrane could explain many of the available data and thus clarify some 542

aspects of the debate (Zak et al 2001 Pisareva et al 2011 Rast et al 2015) Moreover it 543

has previously been hypothesized that ldquoribosome-decorated membrane-like complexesrdquo 544

forming at the innermost thylakoid sheet might represent biogenic compartments (van de 545

Meene et al 2006 Mullineaux 2008) Whether these structures are affected in curT- cannot 546

be judged based on our TEM analysis but requires ultrastructural data of higher resolution 547

However the accessibility of thylakoids for ribosomes should be increased in the less 548

compressed membrane system of curT- (Figure 2B-D) 549

17

A scenario similar to that of Synechocystis 6803 holds for the situation in chloroplasts 550

of the green alga Chlamydomonas reinhardtii in which de novo PSII biogenesis has been 551

shown to be initiated in punctate regions named T-zones located close to the pyrenoid 552

(Uniacke and Zerges 2007) Unlike the mRNAs for the PSII components neither RNAs for 553

PSI subunits nor PSI assembly factors are localized to T-zones indicating that PSI and PSII 554

assembly processes are spatially separated (Uniacke and Zerges 2009 Nickelsen and Zerges 555

2013 Rast et al 2015) Interestingly a recent cryoelectron tomography study demonstrated 556

that next to T-zones at the chloroplast base-lobe junction the inner chloroplast envelope 557

exhibits invaginationsconnections to thylakoids that structurally resemble the organization of 558

cyanobacterial biogenesis centers (Engel et al 2015) For future investigations it will be 559

interesting to see if a homolog of the CURT1 family is involved in the formation of these 560

structures in C reinhardtii 561

562

Evolution of CURT1 function 563

Homologs of the CURT1 protein family can be found throughout cyanobacteria green 564

algae and plants (Armbruster et al 2013) The Arabidopsis CURT1A-D proteins have 565

recently been shown to induce bending of thylakoid membranes at grana margin regions 566

(Armbruster et al 2013) Interestingly and in contrast to the situation in Synechocystis 6803 567

their inactivation did not result in severe photosynthetic deficiencies although the thylakoids 568

formed lacked defined grana stacks Nevertheless the data available support the idea that the 569

function of thylakoid membrane structures that were regarded as being independent ie 570

cyanobacterial biogenesis centers and grana are closely related Intriguingly both of these 571

thylakoid membrane structures are dedicated to aspects of PSII function but do not involve 572

PSI (Pribil et al 2014) In both the prokaryotic and eukaryotic systems CURT1 homologs 573

appear to bend thylakoid membranes as indicated by (i) the distortion of membrane 574

ultrastructure seen in mutants devoid of curved thylakoids (ii) the localization of CURT1 575

homologs at grana margins and their local concentration at biogenesis centers (iii) the in vitro 576

membrane-curving activity of both CURT forms The phenotypic differences between 577

A thaliana and Synechocystis 6803 mutants may however be attributable to the different 578

functions of the membrane sub-compartments affected in the two model organisms Whereas 579

the role of grana is still under debate one function of the cyanobacterial biogenesis centers is 580

the above-mentioned high-throughput uptake of Mn2+ ions for efficient assembly of PSII 581

(Stengel et al 2012 Nickelsen and Rengstl 2013 Pribil et al 2014) However it appears 582

that in both cases the primary function of CURT1 proteins is to generate curved membrane 583

18

regions These discoveries suggest that until now two independently observed structures ie 584

cyanobacterial thylakoid biogenesis centers and chloroplast grana regions are closely related 585

The degree of curvature is much less pronounced in the cyanobacterial system As previously 586

discussed it was probably the subsequent evolution of a membrane-localized light-harvesting 587

system in chloroplasts that made the formation of tightly curved grana thylakoids possible 588

(Mullineaux 2005 Nevo et al 2012 Pribil et al 2014) 589

590

CurT is involved in osmotic stress response 591

One unexpected phenotype of the curT- mutant is its sensitivity to osmotic stress 592

These data revealed that in addition to shaping membranes CurT also influences their 593

functional integrity This latter function might be intrinsic to CurT or could be mediated by 594

the VIPP1 protein which has been shown to be required for membrane maintenance in 595

bacteria and chloroplasts probably by acting as a supplier of lipids (for an overview see 596

Zhang and Sakamoto 2015) Both factors accumulate in the plasma membrane upon osmotic 597

stress but VIPP1 localization is not severely affected by CurT inactivation which suggests 598

that VIPP1 operates independently of CurT In agreement with this repeated co-599

immunoprecipitations revealed no interaction between both proteins Therefore it remains to 600

be established whether a direct functional relationship between them exists 601

Previous investigations of osmotic stress in Synechocystis 6803 showed a kidney-602

shaped form of wild-type cells under very high concentrations of osmotically active 603

compounds (Marin et al 2006) The cells were severely deformed indicating changes in the 604

structure of the cellular envelope Since CurT shifts towards the plasma membrane already 605

under lower osmolyte concentrations we suggest a stabilizing function of CurT in the plasma 606

membrane CurT might be necessary to tolerate the forces trying to deform the cells under 607

osmotic stress 608

In conclusion this analysis has identified a crucial determinant for shaping and 609

maintaining the cyanobacterial thylakoid membrane system ie CurT a homolog of the 610

grana-forming CURT1 protein family from A thaliana In particular CurT is involved in the 611

formation of specific thylakoid substructures close to the plasma membrane at which PSII is 612

assembledrepaired Future work will dissect the precise ultrastructure of these centers and 613

enable us to elaborate a molecular model for the spatiotemporal organization of PSII assembly 614

in cyanobacteria 615

616

19

Methods 617

Strains and growth conditions 618

Wild-type and mutant Synechocystis 6803 cells were grown on solid or in liquid BG 619

11 medium (Rippka et al 1979) supplemented with 5 mM glucose (unless indicated 620

otherwise) at 30degC under continuous illumination at a photon irradiance of 30 μmol m-2 s-1 of 621

white light For growth during high-light experiments for investigation of D1 repair cells 622

were cultivated in a FMT150 photobioreactor (Photon Systems Instruments Draacutesov Czech 623

Republic) at 800 micromol photons m-2 s-1 in the presence or absence of lincomycin (100 microgml) 624

Cell density was monitored photometrically at 750 nm Doubling times were determined after 625

two days of growth To generate the insertion mutant curT- the curT gene (slr0483) was first 626

amplified from wild-type genomic DNA by PCR using the primer pair 04835 627

(GAAGCCTATTTAGCTAAGGCCGAAAG) and 04833 628

(TAGTACCTGGTCTTCCATGGCGT) and the resulting fragment was cloned into the 629

Bluescript pKS vector (Stratagene Waldbronn Germany) A kanamycin resistance cassette 630

was then inserted into the single AgeI restriction site (159 bp downstream of the start codon) 631

and this disruption construct was used to replace the wild-type gene as described (Wilde et al 632

2001) 633

634

Bioinformatic and computational analysis 635

CURT1 sequences of Synechocystis 6803 were obtained from CyanoBase 636

(httpgenomekazusaorjpcyanobaseSynechocystis) and CURT1 homologs in other 637

organisms were retrieved from NCBIBLAST (httpblastncbinlmnihgovBlastcgi) 638

Numbers and positions of putative transmembrane domains in the predicted proteins were 639

determined with TMHMM20 (httpwwwcbsdtudkservicesTMHMM) The sequence for 640

the N-terminal amphipathic helix was predicted by Jpred 3 641

(httpwwwcompbiodundeeacukwww-jpred) and plotted using a helical wheel projection 642

script (httprzlabucreduscriptswheelwheelcgi) The programs ClustalW2 643

(httpwwwebiacuktoolsclustalw2) and GeneDoc (httpwwwpscedubiomedgenedoc) 644

were used to generate multiple alignments of amino acid sequences Quantitative analysis of 645

immunoblots was performed with the AIDA Image Analyzer V325 (Raytest 646

Isotopenmessgeraumlte GmbH Straubenhardt Germany) 647

Co-expression patterns of curT were analyzed using the CyanoEXpress 22 database 648

(httpcyanoexpresssysbiolabeu Hernaacutendez-Prieto and Futschik 2012 Hernaacutendez-Prieto et 649

al 2016) 650

20

651

Measurement of chlorophyll concentration and oxygen production 652

Determination of chlorophyll content was carried out according to Wellburn and 653

Lichtenthaler (1984) For oxygen evolution measurements cells were grown in BG-11 654

without glucose harvested in mid-log phase and diluted to an OD750 nm = 05 Oxygen 655

evolution rates were measured with a Clark-type oxygen electrode (Hansatech Instruments 656

Ltd Kingrsquos Lynn Norfolk UK) at 1000 micromol photons m-2 s-1 (cool white light) after 5 min of 657

dark acclimation Oxygen evolution under saturating light conditions was measured without 658

any additives 659

660

Cell size and cell number estimation 661

Synechocystis 6803 strains were grown in liquid BG11 media containing 5 mM 662

glucose For cell size estimation the cells were analyzed with a confocal laser scanning 663

microscope TCS SP5 (Leica Wetzlar Germany) The diameter of the cells was measured 664

with the LAS AF Lite software (Leica Wetzlar Germany) Cells that were about to divide 665

were not taken into account For the determination of cell number cultures were set to an 666

OD750 = 1 and analyzed by using a Neubauer counting chamber (Paul Marienfeld GmbH amp 667

Co KG Lauda-Koumlnigshofen Germany) Statistical significance was determined by Studentrsquos 668

t-test 669

670

Measurements of P700+ reduction kinetics and relative electron transport rates 671

P700+ reduction kinetics and changes in chlorophyll fluorescence yield at different 672

light intensities were measured at a chlorophyll concentration of 5 microgml with a Dual-PAM-673

100 instrument (Heinz Walz GmbH Effeltrich Germany) Complete P700 oxidation was 674

achieved by a 50-ms multiple turnover pulse (10000 micromol photons m-2 s-1) after 2 min of dark 675

incubation P700+ reduction kinetics were recorded without any additions as well as in the 676

presence of 10 microM DCMU Ten technical replicates were averaged and fitted with single 677

exponential functions Data interpretation was done according to Bernaacutet et al (2009) 678

Light saturation measurements were performed according to Xu et al (2008) The 679

actinic light intensity was increased stepwise from 0 to 665 micromol photons m-2 s-1 with 30-s 680

adaptation periods Maximal fluorescence yields were obtained by applying saturating light 681

pulses (duration 600 ms intensity 10000 micromol photons m-2 s-1) 682

683

Low-temperature fluorescence measurements 684

21

Fluorescence emission spectra were measured with an AMINCO Bowman Series 2 685

Luminescence Spectrometer Wild-type and curT- cells were grown in the presence of 5 mM 686

glucose to mid log-phase and concentrated to 25 microgml chlorophyll adding 2 microM fluorescein 687

as an internal standard Samples (1 ml) were transferred to thin glass tubes dark-adapted for 688

30 min at 30 degC and shock frozen in liquid N2 To quantify chlorophyllfluorescein and 689

phycobilisome-mediated fluorescence samples were excited and emission recorded at 440 690

nm510 nm (chlorophyll and fluorescein excitationmax fluorescein emission) and 580 691

nm685 nm respectively Emission was scanned at 490-800 nm or at 640-800 nm 692

respectively 693

694

Antibody production and protein analysis 695

For generation of an αCurT antibody the N-terminal coding region of curT (amino 696

acid positions 1-58) was amplified by PCR using primers N04835 697

(AAGGATCCGTGGGCCGTAAACATTCAA) and N04833 698

(AAGTCGACGCACTTCCCACACCGGTTGTA) and cloned into the BamHI and XhoI sites 699

of the pGEX-4T-1 vector (GE Healthcare Freiburg Germany) Expression of the GST fusion 700

protein in Escherichia coli BL21(DE3) and subsequent affinity purification on Glutathione-701

Sepharose 4B (GE Healthcare) were carried out as described (Schottkowski et al 2009b) A 702

polyclonal antiserum was raised against this protein fragment in rabbits (Pineda Berlin 703

Germany) Other primary antibodies used in this study have been described previously ie 704

αpD1 (Schottkowski et al 2009b) αD1 (Schottkowski et al 2009b) αD2 (Klinkert et al 705

2006) αPratA (Klinkert et al 2004) αYcf48 (Rengstl et al 2011) αPitt (Schottkowski et 706

al 2009a) αPOR (Schottkowski et al 2009a) αYidC (Ossenbuumlhl et al 2006) αVIPP1 707

(Aseeva et al 2007) αSll0933 (Armbruster et al 2010) and αSlr0151 (Rast et al 2016) or 708

were purchased from Agrisera (Vaumlnnaumls Sweden) ie αCP43 αCP47 αPsaA αCyt f 709

αRbcL αIsiA The αGFP-HRP antibody was acquired from Miltenyi Biotech (Bergisch 710

Gladbach Germany) 711

Protein concentrations were determined according to Bradford (1976) using RotiQuant 712

(Carl Roth GmbH amp Co KG Karlsruhe Germany) Protein extraction membrane 713

fractionation on sucrose-density gradients and quantification of Western signal intensities was 714

performed as described previously (Rengstl et al 2011) Solubility properties of CurT were 715

determined according to Schottkowski et al (2009a) 716

22

Sucrose-density centrifugation separating PDM and thylakoid membrane fractions by 717

two consecutive gradients was carried out as described previously (Schottkowski et al 718

2009b Rengstl et al 2011) 719

Two-dimensional fractionations of cyanobacterial membrane proteins via BNSDS-720

PAGE and of pulse-labeled proteins by BNSDS-PAGE were performed as previously 721

reported (Klinkert et al 2004 Schottkowski et al 2009b Rengstl et al 2013) For the 722

analysis of native complexes in fractions obtained by sucrose-density centrifugation the 723

volume corresponding to 350 microg of protein in fraction 7 was applied to BNSDS-PAGE 724

For isoelectric focusing (IEF) the volume corresponding to 50 microg of protein from 725

fraction 7 in 200 microl of IEF buffer (8 M urea 4 CHAPS 1 IPG buffer pH 4-7 (GE 726

Healthcare)) was applied to an 11-cm Immobiline DryStrip pH 4-7 (GE Healthcare) in a 727

Protean IEF Cell (Bio-Rad Munich Germany) Strips were rehydrated for 12 h at 20 degC and 728

50V Focusing was carried out in the following steps 500 V rapid 1500 Vh 1000 V linear 729

880 Vh 6000 V linear 9680 Vh 6000 V rapid 5390 Vh 50 microA per gel focus temperature 730

20degC Subsequently the strips were incubated in equilibration buffer I (6 M urea 0375 M 731

Tris pH 88 20 glycerol 2 SDS 2 DTT) and equilibration buffer II (6 M urea 0375 732

M Tris pH 88 20 glycerol 2 SDS 25 iodoacetamide) for 10 min in each buffer 733

Then the IEF strips were applied to second-dimension SDS-PAGE 734

735

Transmission electron microscopy and immunogold labeling 736

Sample preparation for transmission electron microscopy including freeze substitution 737

and immunogold labeling of CurT was performed as described previously (Stengel et al 738

2012) Ultrathin sections were cut to thicknesses of 35 - 45 nm and 45 - 65 nm for 739

ultrastructural analyses and immunogold labeling respectively For immunogold labeling 740

sections collected on collodion-coated Ni grids were incubated for 18 h at 4degC with (rabbit) 741

αCurT (diluted 1100 1500 11000 or 14000 in blocking buffer (5 fetal calf serum) with 742

005 Tween 20) and further processed as described previously (Stengel et al 2012) As a 743

negative control wild-type Synechocystis 6803 cells were incubated without the primary 744

antibody and exposed to the gold-labeled anti-rabbit IgG To image the ultrastructure and the 745

immunogold-treated samples a Fei Morgagni 268 transmission electron microscope was used 746

and micrographs were taken at 80 kV 747

To avoid errors in the interpretation of the immunogold labeling experiment only 748

signals which were unambiguously localized to distinctly visible thylakoid membranes were 749

taken into account For each cell different regions (see Figure 10F) were defined and in each 750

23

region the signals on the convex and concave sides of the thylakoid membrane were analyzed 751

separately (see Supplemental Figure 11 for representative counts) Statistical significance was 752

assessed by χ2 test (Zoumlfel 1988) 753

For the analysis of clusters of CurT signals in biogenesis centers a cluster was defined 754

as a minimum of four signals in close proximity Overall 219 biogenesis centers were 755

examined with regard to CurT cluster formation 756

757

Preparation of proteoliposomes 758

Liposomes with a lipid mixture of 25 monogalactosyl diacylglycerol 42 759

digalactosyl diacylglycerol 16 sulfoquinovosyl diacylglycerol and 17 760

phosphatidylglycerol (Lipid Products South Nutfield UK) were prepared as described 761

previously (Armbruster et al 2013) To generate proteoliposomes CurT and CURT1A 762

proteins were expressed in the presence of liposomes for 3 h at 37degC using a PURExpress In 763

Vitro Protein Synthesis Kit (New England Biolabs Ipswich MA USA) The liposomes were 764

separated from the mix by centrifugation in a discontinuous sucrose gradient (100000 g 18 765

h) Subsequently the fraction containing the liposomes was extracted and dialyzed against 20 766

mM HEPES (pH 76) For transmission electron microscopy the proteoliposomes were 767

negatively stained with 1 uranyl acetate on a carbon-coated copper grid Micrographs were 768

taken on a Fei Morgagni 268 TEM at 80 kV 769

770

curT-CFP strain generation 771

Gibson assembly was used for single-step cloning (Gibson 2011) of the slr0483 gene 772

(together with its ~08 kb upstream region) the mTurquoise2 gene fragment the gentamycin-773

resistance cassette (aacC1) and an ~17-kb downstream region of slr0483 into pBR322 774

cleaved with EcoRV and NheI The slr0483 gene was fused in frame to the codon-optimized 775

mTurquoise2 (DNA20) preceded by a linker sequence encoding GSGSG The resulting 776

plasmid was used to transform Synechocystis 6803 as described previously (Zang et al 2007) 777

After ~ 10 days of incubation on BG11-GelRite (15 ) medium in the presence of 2 microgml 778

gentamycin several antibiotic resistant colonies were obtained and streaked out on fresh 779

medium These transformants were then tested for full segregation of the tagged allele by 780

colony PCR with primers flanking the slr0483 gene 781

782

Fluorescence microscopy 783

24

An aliquot of a cell suspension in mid-log phase was placed under a BG11-agarose 784

pad on a glass coverslip (15) and imaged on an inverted microscope (Zeiss 785

AxioObserverZ1) equipped with an ORCA Flash40 V2 (Hamamatsu) camera a Lumenecor 786

SOLA II Light Engine and a Plan-Apochromat 63x140 Oil DIC M27 (NA 14) objective 787

(Zeiss) Image acquisition was done with Zen 21 software in cyan and far-red fluorescence 788

channels (Zeiss Filter Sets 47 HE and 50) as Z-series with a step size of 250 nm and effective 789

pixel size of 103 nm Acquired image files were subsequently deconvolved (Constrained 790

Iterative Method) using a default theoretical Point Spread Function in Zen 20 (Zeiss) 791

Extraction of intensities for line profiles was performed by image thresholding the thylakoid 792

autofluorescence channel and eroding the resulting binary mask in Fiji (Schindelin et al 793

2012) 794

For immunofluorescence analysis cells were grown to mid-log phase as in the case of 795

the cells prepared for live-cell microscopy A 10-ml culture was fixed for 20 min in 37 796

formaldehyde and following extensive washing with phosphate-buffered saline (PBS) cells 797

were first permeabilized in 005 Triton-X for 20 min and then in lysis buffer (50 mM Tris-798

HCl 100 mM NaCl 5 mgml lysozyme) at 37degC for 2 h with gentle shaking To block 799

unspecific binding sites the cell pellet was incubated in 5 bovine serum albumin in PBS at 800

30degC for 1 h The αCurT serum (1500 dilution) was added to cells in fresh blocking buffer 801

for 1 h at 30degC with gentle shaking Cells were then washed three times with blocking buffer 802

and incubated with goat anti-rabbit IgG secondary antibodies conjugated to Oregon Green 488 803

(Invitrogen) (11000 dilution) under the conditions as for the primary antibodies Cells were 804

washed three times with PBS and prepared for microscopy as above Imaging was done as 805

described for live-cell microscopy except that a Colibri2 LED light source was employed for 806

illumination and a CoolSnap HQ camera (Photometrics) was used for image acquisition Cells 807

were imaged as Z-series (step size 280 nm) in the yellow and far-red fluorescent channels 808

(Zeiss Filter Sets 46 HE and 50) using the 505 nm and 625 nm LED modules Effective pixel 809

size in the final image was 102 nm Deconvolution and image analysis was done as described 810

above As judged by the staining intensity of the Oregon Green-conjugated antibodies 811

approximately half of the cells in any given field of view appeared to have been successfully 812

permeabilised a rate that is common in our experience No significant signal was detected in 813

the control sample that had not been exposed to the primary antibodies 814

815

25

Accession numbers 816

Sequence data from this article can be found in the CyanoBase and EMBLGenBank 817

data libraries under accession number slr0483 818

819

Supplemental Data 820

Supplemental Figure 1 Construction of the curT- mutant 821

Supplemental Figure 2 Growth phenotype of curT- 822

Supplemental Figure 3 Expression analysis of the open reading frame slr0482 (located 823

upstream of curT) in the curT- strain 824

Supplemental Figure 4 Absorbance spectra of curT- and wild-type cells 825

Supplemental Figure 5 High-light growth phenotypes of wild-type Synechocystis 6803 and 826

the curT- strain 827

Supplemental Figure 6 Ultrastructure of the TD41 mutant which lacks the psbA transcript 828

and the D1 protein 829

Supplemental Figure 7 Expression and localization of CurT-CFP 830

Supplemental Figure 8 Localization of CurT and CurT-CFP by fluorescence microscopy 831

Supplemental Figure 9 Chlorophyll autofluorescence of curT- 832

Supplemental Figure 10 The curT- mutant as a negative control for immunogold labeling 833

Supplemental Figure 11 Representative counts of immunogold signals 834

Supplemental Table 1 Overview of immunogold signals in curT- cells 835

Supplemental Table 2 Overview of immunogold signals in specific regions of Synechocystis 836

6803 wild-type cells 837

Supplemental Table 3 Statistical analysis of immunogold signals for wild-type 838

Synechocystis 6803 cells 839

Supplemental Table 4 Co-expression of curT 840

Supplemental Movie 1 Scan through the Z-axis of a curT-CFP cell 841

Supplemental Movie 2 Rendered 3D-model of a CurT-CFP detection 842

Supplemental Movie 3 Scan through the Z-axis of a curT-CFP cell with a traversing 843

thylakoid lamella 844

845

Acknowledgements 846

We thank Y Nishiyama for providing αpD1 and J Soll for αVIPP1 and αYidC antibodies 847

respectively and Nina Dyczmons-Nowaczyk for support with the fluorescence measurements 848

This work was supported by grants awarded to JN (Ni3909) MMN (NO 8363) and DL 849

26

(Le126529) by the Deutsche Forschungsgemeinschaft in the context of Research Unit 850

FOR2092 and the Cluster of Excellence RESOLV (EXC 1069) AG is a Howard Hughes 851

Medical Institute postdoctoral fellow in the laboratory of Erin OrsquoShea at Harvard University 852

LS was supported by a PhD fellowship from the Chinese Scholarship Council 853

854

Author Contributions 855

SH AR LS MMN DL and JN designed the research SH AR LS AG ILG EH ML BR 856

SV performed the research all authors contributed to data analysis SH AR and JN wrote the 857

paper 858

859

Competing Financial Interest statement 860

The authors declare no competing financial interests 861

862

We wish to dedicate this paper to Fabrice Rappaport an outstanding colleague and friend who 863

passed away so early 864

865

27

References 866

Allen JF de Paula WBM Puthiyaveetil S and Nield J (2011) A structural 867

phylogenetic map for chloroplast photosynthesis Trends Plant Sci 16 645-655 868

Anderson JM Horton P Kim E-H and Chow WS (2012) Towards elucidation of 869

dynamic structural changes of plant thylakoid architecture Philos Trans R Soc 870

Lond B Biol Sci 367 3515-3524 871

Armbruster U Zuumlhlke J Rengstl B Kreller R Makarenko E Ruumlhle T Schuumlnemann 872

D Jahns P Weisshaar B Nickelsen J and Leister D (2010) The Arabidopsis 873

thylakoid protein PAM68 is required for efficient D1 biogenesis and photosystem II 874

assembly Plant Cell 22 3439-3460 875

Armbruster U Labs M Pribil M Viola S Xu W Scharfenberg M Hertle AP 876

Rojahn U Jensen PE Rappaport F Joliot P Doumlrmann P Wanner G and 877

Leister D (2013) Arabidopsis CURVATURE THYLAKOID1 proteins modify 878

thylakoid architecture by inducing membrane curvature Plant Cell 25 2661-2678 879

Aseeva E Ossenbuumlhl F Sippel C Cho WK Stein B Eichacker LA Meurer J 880

Wanner G Westhoff P Soll J and Vothknecht UC (2007) Vipp1 is required for 881

basic thylakoid membrane formation but not for the assembly of thylakoid protein 882

complexes Plant Physiol Biochem 45 119-128 883

Bartsevich VV and Pakrasi HB (1995) Molecular identification of an ABC transporter 884

complex for manganese analysis of a cyanobacterial mutant strain impaired in the 885

photosynthetic oxygen evolution process EMBO J 14 1845-1853 886

Bartsevich VV and Pakrasi HB (1996) Manganese transport in the cyanobacterium 887

Synechocystis sp PCC 6803 J Biol Chem 271 26057-26061 888

Bernaacutet G Waschewski N and Roumlgner M (2009) Towards efficient hydrogen production 889

the impact of antenna size and external factors on electron transport dynamics in 890

Synechocystis PCC 6803 Photosynth Res 99 205-216 891

Boehm M Yu J Krynicka V Barker M Tichy M Komenda J Nixon PJ and Nield 892

J (2012) Subunit Organization of a Synechocystis Hetero-Oligomeric Thylakoid FtsH893

Complex Involved in Photosystem II Repair Plant Cell 24 3669-3683894

Bradford MM (1976) A rapid and sensitive method for the quantitation of microgram 895

quantities of protein utilizing the principle of protein-dye binding Anal Biochem 72 896

248-254897

28

Chang L Liu X Li Y Liu C-C Yang F Zhao J and Sui S-F (2015) Structural 898

organization of an intact phycobilisome and its association with photosystem II Cell 899

Res 25 726-737 900

Danielsson R Suorsa M Paakkarinen V Albertsson P-Aring Styring S Aro E-M and 901

Mamedov F (2006) Dimeric and monomeric organization of photosystem II 902

Distribution of five distinct complexes in the different domains of the thylakoid 903

membrane J Biol Chem 281 14241-14249 904

Daum B Nicastro D Austin J McIntosh JR and Kuumlhlbrandt W (2010) Arrangement 905

of photosystem II and ATP synthase in chloroplast membranes of Spinach and Pea 906

Plant Cell 22 1299-1312 907

Engel BD Schaffer M Kuhn Cuellar L Villa E Plitzko JM and Baumeister W 908

(2015) Native architecture of the Chlamydomonas chloroplast revealed by in situ 909

cryo-electron tomography eLife 4 e04889 910

Ford MGJ Mills IG Peter BJ Vallis Y Praefcke GJK Evans PR and McMahon 911

HT (2002) Curvature of clathrin-coated pits driven by epsin Nature 419 361-366 912

Fristedt R Willig A Granath P Cregravevecoeur M Rochaix J-D and Vener AV (2009) 913

Phosphorylation of photosystem II controls functional macroscopic folding of 914

photosynthetic membranes in Arabidopsis Plant Cell 21 3950-3964 915

Gallop JL and McMahon HT (2005) BAR domains and membrane curvature bringing 916

your curves to the BAR Biochem Soc Symp 72 223-231 917

Gibson DG (2011) Chapter fifteen - Enzymatic Assembly of Overlapping DNA Fragments 918

In Methods in Enzymology V Christopher ed (Academic Press) pp 349-361 919

Goedhart J von Stetten D Noirclerc-Savoye M Lelimousin M Joosen L Hink MA 920

van Weeren L Gadella TWJ and Royant A (2012) Structure-guided evolution of 921

cyan fluorescent proteins towards a quantum yield of 93 Nat Commun 3 751 922

Heinz S Liauw P Nickelsen J and Nowaczyk M (2016) Analysis of photosystem II 923

biogenesis in cyanobacteria Biochim Biophys Acta 1857 274-287 924

Hernaacutendez-Prieto M and Futschik M (2012) CyanoEXpress A web database for 925

exploration and visualisation of the integrated transcriptome of cyanobacterium 926

Synechocystis sp PCC6803 Bioinformation 8 634-638 927

Hernaacutendez-Prieto MA Semeniuk TA Giner-Lamia J and Futschik ME (2016) The 928

Transcriptional Landscape of the Photosynthetic Model Cyanobacterium 929

Synechocystis sp PCC6803 Sci Rep 6 22168 930

29

Huang F Fulda S Hagemann M and Norling B (2006) Proteomic screening of salt-931

stress-induced changes in plasma membranes of Synechocystis sp strain PCC 6803 932

Proteomics 6 910-920 933

Kirchhoff H (2013) Architectural switches in plant thylakoid membranes Photosynth Res 934

116 481-487 935

Klinkert B Elles I and Nickelsen J (2006) Translation of chloroplast psbD mRNA in 936

Chlamydomonas is controlled by a secondary RNA structure blocking the AUG start 937

codon Nucleic Acids Res 34 386-394 938

Klinkert B Ossenbuumlhl F Sikorski M Berry S Eichacker L and Nickelsen J (2004) 939

PratA a periplasmic tetratricopeptide repeat protein involved in biogenesis of 940

photosystem II in Synechocystis sp PCC 6803 J Biol Chem 279 44639-44644 941

Komenda J Nickelsen J Tichyacute M Praacutešil O Eichacker LA and Nixon PJ (2008) The 942

cyanobacterial homologue of HCF136YCF48 is a component of an early photosystem 943

II assembly complex and is important for both the efficient assembly and repair of 944

photosystem II in Synechocystis sp PCC 6803 J Biol Chem 283 22390-22399 945

Kopf M Klaumlhn S Scholz I Matthiessen JKF Hess WR and Voszlig B (2014) 946

Comparative analysis of the primary transcriptome of Synechocystis sp PCC 6803 947

DNA Res 21 527-539 948

Kunkel DD (1982) Thylakoid centers Structures associated with the cyanobacterial 949

photosynthetic membrane system Arch Microbiol 133 97-99 950

Liberton M Howard Berg R Heuser J Roth R and Pakrasi BH (2006) Ultrastructure 951

of the membrane systems in the unicellular cyanobacterium Synechocystis sp strain 952

PCC 6803 Protoplasma 227 129-138 953

Liberton M Saha R Jacobs JM Nguyen AY Gritsenko MA Smith RD 954

Koppenaal DW and Pakrasi HB (2016) Global Proteomic Analysis Reveals an 955

Exclusive Role of Thylakoid Membranes in Bioenergetics of a Model 956

Cyanobacterium Mol Cell Proteomics 15 2021-2032 957

Luque I and Ochoa de Alda JAG (2014) CURT1CAAD-containing aaRSs thylakoid 958

curvature and gene translation Trends Plant Sci 19 63-66 959

Marin K Stirnberg M Eisenhut M Kraumlmer R and Hagemann M (2006) Osmotic stress 960

in Synechocystis sp PCC 6803 low tolerance towards nonionic osmotic stress results 961

from lacking activation of glucosylglycerol accumulation Microbiology 152 2023-962

2030 963

Mullineaux CW (2005) Function and evolution of grana Trends Plant Sci 10 521-525 964

30

Mullineaux CW (2008) Biogenesis and dynamics of thylakoid membranes and the 965

photosynthetic apparatus In The Cyanobacteria A Herrero and E Flores eds 966

(Norfolk UK Caister Academic Press) pp 289ndash304 967

Nevo R Charuvi D Tsabari O and Reich Z (2012) Composition architecture and 968

dynamics of the photosynthetic apparatus in higher plants Plant J 70 157-176 969

Nickelsen J and Rengstl B (2013) Photosystem II assembly From cyanobacteria to plants 970

Annu Rev Plant Biol 64 609-635 971

Nickelsen J and Zerges W (2013) Thylakoid biogenesis has joined the new era of bacterial 972

cell biology Front Plant Sci 4 458 973

Nilsson F Simpson DJ Jansson C and Andersson B (1992) Ultrastructural and 974

biochemical characterization of a Synechocystis 6803 mutant with inactivated psbA 975

genes Arch Biochem Biophys 295 340-347 976

Odom WR Hodges R Chitnis PR and Guikema JA (1993) Characterization of 977

Synechocystis sp PCC 6803 in iron-supplied and iron-deficient media Plant Mol 978

Biol 23 1255-1264 979

Ossenbuumlhl F Inaba-Sulpice M Meurer J Soll J and Eichacker LA (2006) The 980

Synechocystis sp PCC 6803 Oxa1 homolog is essential for membrane integration of 981

reaction center precursor protein pD1 Plant Cell 18 2236-2246 982

Pisareva T Kwon J Oh J Kim S Ge C Wieslander Aring Choi J-S and Norling B 983

(2011) Model for Membrane Organization and Protein Sorting in the Cyanobacterium 984

Synechocystis sp PCC 6803 Inferred from Proteomics and Multivariate Sequence 985

Analyses J Proteome Res 10 3617-3631 986

Pribil M Labs M and Leister D (2014) Structure and dynamics of thylakoids in land 987

plants J Exp Bot 65 1955-1972 988

Rast A Heinz S and Nickelsen J (2015) Biogenesis of thylakoid membranes Biochim 989

Biophys Acta 1847 821-830 990

Rast A Rengstl B Heinz S Klingl A and Nickelsen J (2016) The role of Slr0151 a 991

tetratricopeptide repeat protein from Synechocystis sp PCC 6803 during Photosystem 992

II assembly and repair Front Plant Sci 7 605 993

Rengstl B Oster U Stengel A and Nickelsen J (2011) An Intermediate Membrane 994

Subfraction in Cyanobacteria Is Involved in an Assembly Network for Photosystem II 995

Biogenesis J Biol Chem 286 21944-21951 996

31

Rengstl B Knoppovaacute J Komenda J and Nickelsen J (2013) Characterization of a 997

Synechocystis double mutant lacking the photosystem II assembly factors YCF48 and 998

Sll0933 Planta 237 471-480 999

Rexroth S Mullineaux CW Ellinger D Sendtko E Roumlgner M and Koenig F (2011) 1000

The Plasma Membrane of the Cyanobacterium Gloeobacter violaceus Contains 1001

Segregated Bioenergetic Domains Plant Cell 23 2379-2390 1002

Rippka R Deruelles J Waterbury JB Herdman M and Stanier RY (1979) Generic 1003

Assignments Strain Histories and Properties of Pure Cultures of Cyanobacteria 1004

Microbiology 111 1-61 1005

Ruumltgers M and Schroda M (2013) A role of VIPP1 as a dynamic structure within 1006

thylakoid centers as sites of photosystem biogenesis Plant Signal Behav 8 e27037 1007

Sacharz J Bryan SJ Yu J Burroughs NJ Spence EM Nixon PJ and Mullineaux 1008

CW (2015) Sub-cellular location of FtsH proteases in the cyanobacterium1009

Synechocystis sp PCC 6803 suggests localised PSII repair zones in the thylakoid1010

membranes Mol Microbiol 96 448-4621011

Sandstroumlm S Park Y-I Oumlquist G and Gustafsson P (2001) CP43prime the isiA Gene 1012

Product Functions as an Excitation Energy Dissipator in the Cyanobacterium 1013

Synechococcus sp PCC 7942 Photochem Photobiol 74 431-437 1014

Schindelin J Arganda-Carreras I Frise E Kaynig V Longair M Pietzsch T 1015

Preibisch S Rueden C Saalfeld S Schmid B Tinevez J-Y White DJ 1016

Hartenstein V Eliceiri K Tomancak P and Cardona A (2012) Fiji an open-1017

source platform for biological-image analysis Nat Methods 9 676-682 1018

Schottkowski M Ratke J Oster U Nowaczyk M and Nickelsen J (2009a) Pitt a novel 1019

tetratricopeptide repeat protein involved in light-dependent chlorophyll biosynthesis 1020

and thylakoid membrane biogenesis in Synechocystis sp PCC 6803 Mol Plant 2 1021

1289-1297 1022

Schottkowski M Gkalympoudis S Tzekova N Stelljes C Schuumlnemann D Ankele E 1023

and Nickelsen J (2009b) Interaction of the periplasmic PratA factor and the PsbA 1024

(D1) protein during biogenesis of photosystem II in Synechocystis sp PCC 6803 J 1025

Biol Chem 284 1813-1819 1026

Selatildeo TT Zhang L Knoppovaaacute J Komenda J and Norling B (2016) Photosystem II 1027

Assembly Steps Take Place in the Thylakoid Membrane of the Cyanobacterium 1028

Synechocystis sp PCC6803 Plant Cell Physiol 57 878 1029

32

Spaumlt P Maček B and Forchhammer K (2015) Phosphoproteome of the cyanobacterium 1030

Synechocystis sp PCC 6803 and its dynamics during nitrogen starvation Front 1031

Microbiol 6 248 1032

Stengel A Guumlgel IL Hilger D Rengstl B Jung H and Nickelsen J (2012) Initial 1033

steps of photosystem II de novo assembly and preloading with manganese take place 1034

in biogenesis centers in Synechocystis Plant Cell 24 660-675 1035

Uniacke J and Zerges W (2007) Photosystem II assembly and repair are differentially 1036

localized in Chlamydomonas Plant Cell 19 3640-3654 1037

Uniacke J and Zerges W (2009) Chloroplast protein targeting involves localized 1038

translation in Chlamydomonas Proc Natl Acad Sci USA 106 1439-1444 1039

van de Meene AL Hohmann-Marriott M Vermaas WJ and Roberson R (2006) The 1040

three-dimensional structure of the cyanobacterium Synechocystis sp PCC 6803 Arch 1041

Microbiol 184 259-270 1042

van de Meene AML Sharp WP McDaniel JH Friedrich H Vermaas WFJ and 1043

Roberson RW (2012) Gross morphological changes in thylakoid membrane 1044

structure are associated with photosystem I deletion in Synechocystis sp PCC 6803 1045

Biochim Biophys Acta 1818 1427-1434 1046

Watanabe M and Ikeuchi M (2013) Phycobilisome architecture of a light-harvesting 1047

supercomplex Photosynth Res 116 265-276 1048

Wellburn AR and Lichtenthaler H (1984) Formulae and Program to Determine Total 1049

Carotenoids and Chlorophylls A and B of Leaf Extracts in Different Solvents In 1050

Advances in Photosynthesis Research Proceedings of the VIth International Congress 1051

on Photosynthesis Brussels Belgium August 1ndash6 1983 C Sybesma ed (Dordrecht 1052

Springer Netherlands) pp 9-12 1053

Wilde A Lunser K Ossenbuumlhl F Nickelsen J and Borner T (2001) Characterization of 1054

the cyanobacterial ycf37 mutation decreases the photosystem I content Biochem J 1055

357 211-216 1056

Wilson A Boulay C Wilde A Kerfeld CA and Kirilovsky D (2007) Light-Induced 1057

Energy Dissipation in Iron-Starved Cyanobacteria Roles of OCP and IsiA Proteins 1058

Plant Cell 19 656-672 1059

Xu M Bernaacutet G Singh A Mi H Roumlgner M Pakrasi HB and Ogawa T (2008) 1060

Properties of Mutants of Synechocystis sp Strain PCC 6803 Lacking Inorganic Carbon 1061

Sequestration Systems Plant Cell Physiol 49 1672-1677 1062

33

Yamamoto T Burke J Autz G and Jagendorf AT (1981) Bound ribosomes of Pea 1063

chloroplast thylakoid membranes location and release in vitro by high salt 1064

puromycin and RNase Plant Physiol 67 940-949 1065

Yang H Liao L Bo T Zhao L Sun X Lu X Norling B and Huang F (2014) 1066

Slr0151 in Synechocystis sp PCC 6803 is required for efficient repair of photosystem 1067

II under high-light condition J Integr Plant Biol 56 1136-1150 1068

Yeremenko N Kouřil R Ihalainen JA DHaene S van Oosterwijk N 1069

Andrizhiyevskaya EG Keegstra W Dekker HL Hagemann M Boekema EJ 1070

Matthijs HCP and Dekker JP (2004) Supramolecular Organization and Dual 1071

Function of the IsiA Chlorophyll-Binding Protein in Cyanobacteria Biochemistry 43 1072

10308-10313 1073

Zak E Norling B Maitra R Huang F Andersson B and Pakrasi HB (2001) The 1074

initial steps of biogenesis of cyanobacterial photosystems occur in plasma membranes 1075

Proc Natl Acad Sci USA 98 13443-13448 1076

Zang X Liu B Liu S Arunakumara KKIU and Zhang X (2007) Optimum 1077

Conditions for Transformation of Synechocystis sp PCC 6803 J Microbiol 45 241-1078

245 1079

Zhang L and Sakamoto W (2015) Possible function of VIPP1 in maintaining chloroplast 1080

membranes Biochim Biophys Acta 1847 831-837 1081

Zimmerberg J and Kozlov MM (2006) How proteins produce cellular membrane 1082

curvature Nat Rev Mol Cell Biol 7 9-19 1083

Zoumlfel P (1988) Statistik in der Praxis (Stuttgart Germany Gustav Fischer Verlag) 1084

1085

34

Figure Legends 1086

Figure 1 General characteristics of CurT A) Sequence alignment of CurT and CURT1A-D 1087

from A thaliana Predicted chloroplast transit-peptide sequences of CURT1A-D are omitted 1088

(Armbruster et al 2013) Positions of predicted C-terminal transmembrane domains (TDM) 1089

are marked (black bar) as is the position of the predicted amphipathic N-terminal helix in 1090

CurT (red bar) The green bar denotes the peptide sequence used for antibody production 1091

Identical and related amino acids that are conserved in 100 80 and 60 of the sequences 1092

are highlighted in black dark grey and light grey respectively B) Helical-wheel 1093

representation of the N-terminal amphipathic helix of CurT (red bar in A) The color code 1094

reflects the physicochemical properties of amino-acid side-chains green polar and 1095

uncharged blue polar and positively charged red polar and negatively charged yellow 1096

hydrophobic C) Solubility of CurT Membrane-associated proteins (50 microg) from wild-type 1097

cells were extracted with 5 mM HEPES (pH 76) containing either 1 M NaCl 01 M Na2CO3 1098

4 M urea 01 Triton X-100 or no additional solute After separation of membrane-bound 1099

(M) and solubilized (S) proteins by centrifugation proteins were fractionated by SDS-PAGE1100

and CurT was immunodetected on immunoblots As a control the integral membrane protein 1101

CP47 from PSII was analyzed in parallel D) Transmission electron micrographs of negatively 1102

stained liposomes Cell-free expression (CFE) of CurT and A thaliana CURT1A was 1103

performed in the presence of liposomes similar in composition to the lipids of the thylakoid 1104

membrane Liposomes before and after cell-free protein expression in the absence of DNA 1105

served as negative controls Black arrowheads indicate tubular connections between 1106

liposomes Scale bars 250 nm 1107

1108

Figure 2 Ultrastructural analysis of curT- cells Transmission electron micrographs of typical 1109

wild-type (A) and curT- (B-D) Synechocystis 6803 cells taken at 44000times (A B) and 28000times 1110

(C D) magnification respectively Ultrathin sections (35 to 45 nm) of cryofixed samples 1111

were stained with osmium tetroxide and post-stained using lead citrate Arrowheads indicate 1112

biogenesis centers Scale bars 200 nm (A B) and 500 nm (C D) respectively 1113

1114

Figure 3 Accumulation of components of photosynthetic complexes in the curT- mutant A) 1115

Whole cell extracts (30 microg protein) from wild-type and curT- strains were fractionated by 1116

SDS-PAGE and analyzed on immunoblots using the indicated antibodies B) The histogram 1117

shows levels of the indicated proteins in curT- extracts relative to wild-type samples (dashed 1118

red line) Data are means plusmn SD of three independent experiments Significant differences from 1119

35

wild-type protein levels according to Studentrsquos t-test with error probabilities of 5 and 1 1120

are indicated by and respectively 1121

1122

Figure 4 P700+ reduction kinetics and high-light effects in curT- cells A) Averaged traces 1123

(10 single measurements) of P700+ decay after complete oxidation by a 50-ms multiple 1124

turnover pulse (10000 micromol photons m-2 s-1) in the absence and presence of 10 microM DCMU 1125

B) Rate constants for P700+ reduction were obtained by fitting of the data with single1126

exponential functions Error bars indicate the SD of three independent measurements C) 1127

Impact of light intensity on the (relative) electron transport rate (rETR) Cells were exposed to 1128

gradually increasing light intensities which resulted in increasing electron transport until the 1129

capacity limit was reached PAR light intensity (micromol photons m-2 s-1) Error bars indicate the 1130

SD of three independent measurements D) D1 protein level in wild-type and curT- after high-1131

light treatment (800 micromol photons m-2s-1) in the presence and absence of lincomycin Samples 1132

were taken every 30 min and processed as in Figure 3 to determine the level of D1 present 1133

100 refers to wild-type D1 level at the beginning of the experiment 1134

1135

Figure 5 PSII assembly in curT- cells A) BNSDS-PAGE of membrane proteins Membrane 1136

fractions from wild-type and curT- cells were solubilized with 13 n-dodecyl-β-maltoside 1137

and proteins were fractionated by two-dimensional BNSDS-PAGE blotted and probed with 1138

antibodies against the PSII subunits D1 D2 CP47 and CP43 Wild-type blots were also 1139

probed with the αCurT antibody The sizes of marker proteins and the positions of PSII 1140

assembly intermediates (RCCII RCCI RC47) are shown above and below each image B) In 1141

vivo pulse labeling of membrane proteins with 35S Pulse-labeled PSII core proteins were 1142

separated via BNSDS-PAGE and visualized by autoradiography 1143

1144

Figure 6 Loss of CurT induces stress A) Low-temperature (77 K) fluorescence emission of 1145

Synechocystis 6803 wild-type (blue) and curT- (red) cells excited at 440 nm The spectra were 1146

normalized to the added fluorescein standard B) Low-temperature (77 K) fluorescence 1147

emission of Synechocystis 6803 wild-type (blue) and curT- (red) excited at 580 nm The 1148

spectra were normalized to 780 nm C) Level of IsiA in the curT- mutant relative to the wild-1149

type A mean value of 368 plusmn 96 (SD) was determined from three independent experiments 1150

1151

Figure 7 Membrane sublocalization of PSII-related factors Cell extracts from wild-type and 1152

curT- cells were fractionated by two consecutive rounds of sucrose-density gradient 1153

36

centrifugation (Schottkowski et al 2009b) The second linear gradient (20-60 sucrose) was 1154

apportioned into 14 fractions which were analyzed by immunoblotting using the indicated 1155

antibodies Fractions 1ndash6 represent PDMs and fractions 7ndash14 thylakoid membranes (TMs) 1156

To facilitate comparison between gradients sample volumes were normalized to the volume 1157

of fraction 7 that contained 40 microg of protein 1158

1159

Figure 8 Live-cell imaging of the curT-CFP strain by fluorescence microscopy In the curT-1160

CFP strain the native curT gene has been replaced by a CFP-tagged version resulting in the 1161

expression of the CurT-CFP fusion protein under the control of the native promotor A) 1162

Close-up views of the mid-cell plane in the CFP and far-red autofluorescence channels shown 1163

in slice 7 in panel B B) Synechocystis 6803 cells expressing CurT C-terminally fused to the 1164

mTurquoise2 variant of CFP from its native chromosomal promoter The two imaging 1165

channels are displayed as Z-axis montages (auto-scaled contrast step size 250 nm) in 1166

grayscale and color composite configuration The thylakoid autofluorescent channel as 1167

imaged in far-red fluorescence is depicted in magenta and CurT signal as imaged in cyan 1168

fluorescence is depicted in cyan C) Fluorescence intensity profiles of the two channels along 1169

the autofluorescent peripheral cell ldquoringrdquo are shown for slice 7 The maximum projection of 1170

the entire Z montage is also shown Scale bars (light grey) 2 microm 1171

1172

Figure 9 Immunofluorescence detection of CurT A) Close-ups of slice 5 in panel B B) 1173

Wild-type Synechocystis 6803 cells labeled with αCurT antibodies and detected with Oregon 1174

Green-conjugated secondary antibodies The Z-axis montages are shown as in Figure 8B 1175

except that the step size is 280 nm (1 to 10) C) Intensity profiles of the two channels along 1176

the autofluorescent peripheral cell ldquoringrdquo are shown for slice 5 The maximum projection of 1177

the entire Z montage is also shown Scale bars (light grey) 2 microm 1178

1179

Figure 10 Subcellular localization of CurT Ultrathin sections of wild-type Synechocystis 1180

6803 cells were incubated with rabbit αCurT prior to incubation with gold-conjugated goat 1181

anti-rabbit IgG A) Negative control (wild-type processed without addition of primary 1182

antibody) B C) Immunogold-labeled sections showing CurT localization at the cytoplasmic 1183

side of the thylakoid membrane D) Cluster formation of CurT signals at a putative biogenesis 1184

center from C E) Biogenesis center from the same cell (C) without any obvious CurT 1185

clustering of gold particles F) Schematic depiction of a wild-type cell (from Figure 2A) with 1186

color-coded curved membranes green = thylakoids that follow the curvature of the cell red = 1187

37

thylakoids that bend away from the plasma membrane yellow = thylakoids that bend toward 1188

the plasma membrane to converge on sites of biogenesis centers G) Relative distribution of 1189

gold signals between convex (dark color) and concave (light color) sides of membranes (n = 1190

1584 signals from a total of 95 cells) The undifferentiated overall signal distribution is given 1191

in blue Bars = 200 nm (overview) and 100 nm (details) 1192

1193

Figure 11 Differentially modified forms of CurT are found in different complexes in PDMs 1194

and thylakoid membranes Samples were isolated by fractionation of wild-type membranes 1195

via two consecutive sucrose density gradients according to Schottkowski et al (2009b) After 1196

density centrifugation samples were applied to BNSDS-PAGE analysis (A) or isoelectric 1197

focusing (B) Numbers on the right indicate the respective fraction from the second gradient 1198

(see Figure 7) Fraction 5 represents the PDMs and fraction 9 the thylakoid membrane 1199

1200

Figure 12 Loss of CurT increases sensitivity to abiotic stress A B) Doubling times of wild-1201

type and curT- under salt stress (A) or osmotic stress (B) Doubling times are means plusmn SD of 1202

three independent cultures C) Localization of CurT-CFP under salt and osmotic stress 1203

Samples were examined as described in Figure 8 Scale bars 1 microm D) Protein levels of wild-1204

type cells after growth in BG11 medium containing 500 mM NaCl Samples were analyzed on 1205

the same gel but unrelated samples between the presented signals were omitted E) 1206

Membrane preparations obtained from wild-type cells wild-type cells grown in the presence 1207

of 500 mM NaCl and curT- cells were subjected to the first gradient step in the membrane 1208

fractionation scheme The gradient was divided into five fractions and 10 of fractions I-IV 1209

and 02 of fraction V were analyzed by SDS-PAGE Fraction II includes the plasma 1210

membrane and fraction V consists of PratA-defined membrane and thylakoid membrane 1211

1212

Figure 13 Model of CurT distribution at convergence zones in Synechocystis 6803 The 1213

distribution of CurT in thylakoid (green) and plasma membranes (brown) is shown The 1214

pattern of localization of CurT in the thylakoid membrane is derived from membrane 1215

fractionation via sucrose density centrifugation fluorescence-based detection of the CurT-1216

CFP fusion and endogenous CurT and immunogold labeling experiments (Figures 7-10) The 1217

different CurT variants a b c and d identified in the IEF experiments (Figure 11) are depicted 1218

in yellow pink blue and black respectively CurT present in the plasma membrane is 1219

highlighted in gray as its precise nature and role remain to be defined (Figure 12) 1220

Membranes are represented as lipid bilayers Convex and concave faces of bent thylakoid 1221

38

sheets are indicated by black arrows The PDM which is dedicated to PSII assembly and 1222

repair is depicted in blue The dotted blue line emphasizes that the ultrastructure in this region 1223

has not yet been fully resolved PP periplasm PM plasma membrane TM thylakoid 1224

membrane L lumen PDM PratA-defined membrane 1225

1226

Tables 1227

Table 1 Physiological characteristics of the curT- mutant 1228

Strain Doubling time [h]

Oxygen Evolution[nmol h-1 OD750

-1]c

Chlorophyll content

[microg OD750-1]

d

Cell size [microm]e

Cell number [ml-1 OD750

-1]f

Wild type 817plusmn017a 1600plusmn042

b 1933plusmn187 251plusmn014 264plusmn020 390plusmn006 x 107

curT- 1259plusmn020a 3226plusmn056

b 1074plusmn20 195plusmn029 274plusmn044 367plusmn016 x 107

1229 abDoubling times in the presence (a) or absence (b) of 5 mM glucose measured under 1230

continuous illumination at 30 micromol photons m-2 s-1 and CO2-limiting conditions cOxygen 1231

evolution is expressed in nmol O2 produced per hour per OD750 unit dChlorophyll content is 1232

expressed in microg OD750-1 eThe diameter of non-dividing cells is presented in microm fCell number 1233

was determined per ml per OD750 Data are means plusmn SD of at least three independent 1234

experiments 1235

1236

Parsed CitationsAllen JF de Paula WBM Puthiyaveetil S and Nield J (2011) A structural phylogenetic map for chloroplast photosynthesisTrends Plant Sci 16 645-655

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Anderson JM Horton P Kim E-H and Chow WS (2012) Towards elucidation of dynamic structural changes of plant thylakoidarchitecture Philos Trans R Soc Lond B Biol Sci 367 3515-3524

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Armbruster U Zuumlhlke J Rengstl B Kreller R Makarenko E Ruumlhle T Schuumlnemann D Jahns P Weisshaar B NickelsenJ and Leister D (2010) The Arabidopsis thylakoid protein PAM68 is required for efficient D1 biogenesis and photosystem IIassembly Plant Cell 22 3439-3460

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Armbruster U Labs M Pribil M Viola S Xu W Scharfenberg M Hertle AP Rojahn U Jensen PE Rappaport F JoliotP Doumlrmann P Wanner G and Leister D (2013) Arabidopsis CURVATURE THYLAKOID1 proteins modify thylakoid architectureby inducing membrane curvature Plant Cell 25 2661-2678

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Aseeva E Ossenbuumlhl F Sippel C Cho WK Stein B Eichacker LA Meurer J Wanner G Westhoff P Soll J andVothknecht UC (2007) Vipp1 is required for basic thylakoid membrane formation but not for the assembly of thylakoid proteincomplexes Plant Physiol Biochem 45 119-128

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Bartsevich VV and Pakrasi HB (1995) Molecular identification of an ABC transporter complex for manganese analysis of acyanobacterial mutant strain impaired in the photosynthetic oxygen evolution process EMBO J 14 1845-1853

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Bartsevich VV and Pakrasi HB (1996) Manganese transport in the cyanobacterium Synechocystis sp PCC 6803 J Biol Chem271 26057-26061

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Bernaacutet G Waschewski N and Roumlgner M (2009) Towards efficient hydrogen production the impact of antenna size andexternal factors on electron transport dynamics in Synechocystis PCC 6803 Photosynth Res 99 205-216

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Boehm M Yu J Krynicka V Barker M Tichy M Komenda J Nixon PJ and Nield J (2012) Subunit Organization of aSynechocystis Hetero-Oligomeric Thylakoid FtsH Complex Involved in Photosystem II Repair Plant Cell 24 3669-3683

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Bradford MM (1976) A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle ofprotein-dye binding Anal Biochem 72 248-254

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Chang L Liu X Li Y Liu C-C Yang F Zhao J and Sui S-F (2015) Structural organization of an intact phycobilisome and itsassociation with photosystem II Cell Res 25 726-737

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Danielsson R Suorsa M Paakkarinen V Albertsson P-Aring Styring S Aro E-M and Mamedov F (2006) Dimeric andmonomeric organization of photosystem II Distribution of five distinct complexes in the different domains of the thylakoidmembrane J Biol Chem 281 14241-14249

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Daum B Nicastro D Austin J McIntosh JR and Kuumlhlbrandt W (2010) Arrangement of photosystem II and ATP synthase in

3

regions forming biogenic centers at peripheral sites in cells where thylakoids converge 76

(Schottkowski et al 2009b Stengel et al 2012) 77

Some details of the ultrastructure of these centers have begun to emerge (Stengel et al 78

2012) Some of the convergence areas are composed of a rod-like structure ndash previously 79

named the ldquothylakoid centerrdquo ndash which is in turn surrounded by membranous material within 80

which thylakoid lamellae appear to originate (van de Meene et al 2006 Stengel et al 2012 81

Nickelsen and Zerges 2013 Ruumltgers and Schroda 2013) A current working model for these 82

biogenesis centers postulates that the initial steps in the assembly of photosynthetic complexes 83

ndash and in particular photosystem II (PSII) ndash take place at the biogenic PDMs Subsequently 84

pre-complexes migrate laterally into thylakoid lamellae where their assembly is completed 85

(Nickelsen and Rengstl 2013) Recently evidence based on the subcellular distribution of the 86

D1 degradation-related FtsH protease and the PSII repair factor Slr0151 (Yang et al 2014 87

Sacharz et al 2015 Rast et al 2016) has been obtained that maintenance ie the repair of 88

PSII is also localized at or near these areas However whether or not plasma and thylakoid 89

membranes fuse at these sites has not yet been resolved (Liberton et al 2006 van de Meene 90

et al 2006 van de Meene et al 2012) 91

Only limited information is available on the spatial organization of thylakoid 92

membrane biogenesis in land plants Their chloroplasts harbor a dynamic thylakoid membrane 93

system which is comprised of non-appressed stromal thylakoids and appressed grana regions 94

Stromal thylakoids are likely to represent sites where membrane proteins are synthesized and 95

assembled within the membrane (Yamamoto et al 1981 Danielsson et al 2006) while the 96

physicochemical forces driving grana formation are still a matter of debate (Nevo et al 2012 97

Kirchhoff 2013 Pribil et al 2014) It has however been proposed that stromal moieties of 98

LHCII determine membrane stacking of adjacent thylakoid disks (Fristedt et al 2009 Daum 99

et al 2010 Anderson et al 2012) Moreover a family of thylakoid-shaping proteins with 100

four members named CURVATURE THYLAKOID1A-D (CURT1A-D) has been identified 101

in Arabidopsis thaliana (Armbruster et al 2013) CURT1 proteins localize to grana margins 102

where they induce membrane bending thereby determining the architecture of the thylakoid 103

network (Pribil et al 2014) Intriguingly cyanobacteria whose thylakoids do not differentiate 104

into grana regions also contain a single CURT1 homolog (Armbruster et al 2013) Here we 105

report on the characterization of this homolog CurT from Synechocystis 6803 Our data 106

reveal that the cyanobacterial protein is essential for the shaping of thylakoid membranes and 107

thereby promotes efficient assembly of PSII at the cell periphery Our data argue for an 108

ancient membrane-curving activity of CURT1-like proteins which are necessary to form an 109

4

efficient thylakoid system in cyanobacteria as well as having a critical role in the response to 110

osmotic stress 111

112

Results 113

Inactivation of curT affects membrane architecture 114

The open reading frame slr0483 encodes the only CURT1-like protein expressed in the 115

cyanobacterium Synechocystis 6803 The corresponding cyanobacterial gene was previously 116

named synCURT1 to emphasize its homology to CURT1 from Arabidopsis thaliana 117

(Armbruster et al 2013 Luque and Ochoa de Alda 2014) However in conformity with 118

conventional nomenclature for bacterial genes we adopt the name lsquocurTrsquo The CurT protein is 119

predicted to comprise 149 amino acids and contains within its C-terminal half two putative 120

transmembrane domains (TMDs) which exhibit a high degree of sequence similarity with the 121

Arabidopsis CURT1A-D proteins The N-terminal half shows less similarity to its 122

Arabidopsis counterparts but it harbors a predicted amphipathic α-helix (amino acids 46-62) 123

that has been implicated in membrane bending (Figure 1A and 1B Armbruster et al 2013) 124

Interestingly the TMDs of CURT homologs share sequence and structural features with a 125

domain that is found in some thylakoid-associated cyanobacterial aminoacyl-tRNA 126

synthetases and has been hypothesized to be involved in mediating the unusual membrane 127

attachment of these enzymes (Luque and Ochoa de Alda 2014) 128

To verify the predicted membrane association of CurT total membranes from wild-129

type cells were exposed to various agents and the solubility of CurT was assessed using an 130

antibody directed against a fragment comprising its first 58 N-terminal amino acids (Figure 131

1A) We first confirmed that CurT can be detected in the membrane fractions of cell lysates 132

and exposure to 01 M Na2CO3 4 M urea or 1 M NaCl failed to extract it as would be 133

expected for a membrane-bound protein (Figure 1C) Indeed treatment of the cell lysate with 134

the non-ionic detergent Triton X-100 rendered CurT soluble as was the case for the PSII 135

inner antenna protein CP47 ndash an integral membrane protein with six transmembrane α-helices 136

(Figure 1C) Thus CurT like its Arabidopsis counterparts is likely to be an integral 137

membrane protein 138

To test whether the cyanobacterial CurT has similar membrane-tubulating properties to 139

CURT1A of A thaliana we used the same liposome-based assay to probe its ability to form 140

tubules (Armbruster et al 2013) We expressed CurT in vitro using a cell-free extract 141

supplemented with liposomes similar in composition to the thylakoid membrane 142

Subsequently liposome topology was visualized by transmission electron microscopy (TEM 143

5

Figure 1D) Like the grana-forming CURT1A its Synechocystis 6803 homolog efficiently 144

induced localized ldquocompressionrdquo of liposomes into thin tubule-like segments revealing its 145

strong membrane-curving activity (Figure 1D) Hence the membrane-shaping function of 146

members of the CURT1 family is conserved from cyanobacteria to plants Nevertheless 147

liposome shapes caused by either CurT or CURT1A displayed some differences in the degree 148

of membrane tubulation These might be due to the variable N-termini of both proteins 149

(Figure 1D) 150

To dissect the function of CurT in vivo we generated a knock-out mutant by inserting 151

a kanamycin-resistance cassette into the unique AgeI site in the slr0483 reading frame 152

(Supplemental Figure 1A Methods) Complete segregation of the mutation was confirmed by 153

PCR and immunoblot analyses (Supplemental Figure 1B and 1C) Progressively higher levels 154

of antibiotic (up to 400 microg kanamycinml) were used for mutant selection as previous 155

attempts to select a fully segregated curT- mutant had been unsuccessful probably due to 156

application of insufficient selection pressure (Armbruster et al 2013) When growth rates of 157

wild-type and mutant cells were compared 20- and 15-fold increases in doubling time were 158

observed for curT- grown under photoauto- and photoheterotrophic conditions respectively 159

(Table 1 Supplemental Figure 2) 160

Strikingly curT inactivation also led to loss of competence for DNA uptake during 161

both transformation and conjugation-based experiments Hence attempts to complement the 162

curT- mutant were not applicable However in the course of the work four independent 163

rounds of transformation of wild-type cells were carried out to generate fresh curT- mutants 164

All mutant strains obtained the same phenotype strongly suggesting that no secondary sites 165

were involved in its establishment To rule out the possibility that read-through transcription 166

from the resistance marker gene affects the upstream reading frame slr0482 (of unknown 167

function) in the mutant RT-PCR with appropriate primers was performed (Supplemental 168

Figure 3) No change in slr0482 mRNA accumulation was observed confirming that the curT- 169

phenotype is caused by disruption of the curT gene In agreement with this finding recent 170

transcriptome analyses of Synechocystis 6803 have clearly shown that the curT mRNA is 171

monocistronic (Kopf et al 2014) 172

In view of CurTrsquos in vitro membrane-tubulating activity the ultrastructure of the curT- 173

mutant was examined by TEM As shown in Figure 2A the wild-type strain exhibits the 174

typical thylakoid organization with ordered thylakoid sheets at the cell periphery and 175

convergence zones next to the plasma membrane In contrast massive disorganization of the 176

thylakoid membrane system was observed in curT- In all cells analyzed the mutant 177

6

thylakoids appeared as disordered sheets that traversed the cytoplasm and completely lacked 178

the typical convergence zones with the corresponding biogenesis centers at the periphery 179

(Figures 2B-D) This indicates a strict requirement of CurT for the establishment of normal 180

thylakoid membrane architecture in Synechocystis 6803 181

182

Inactivation of curT affects photosynthetic performance 183

The severely altered morphology of the thylakoid membrane system in curT- cells and 184

in particular the lack of PSII-related biogenesis centers prompted us to investigate the 185

photosynthetic performance of the mutant (Stengel et al 2012) The chlorophyll content was 186

reduced by ~20 and absorption spectroscopy also revealed a reduction in phycobilisomes 187

as well as an increase in carotenoid levels (Table 1 Supplemental Figure 4) Despite changes 188

in ultrastructure and pigment levels size and number of curT- cells at OD750 were not 189

significantly different as judged by t-test-based statistical analysis (Table 1) 190

To explore the photosynthetic defects of the mutant in detail immunoblot analyses 191

were performed using antibodies raised against specific subunits of photosynthetic complexes 192

and some of their biogenesis factors In curT- PSII reaction-center subunits including D1 D2 193

CP47 and CP43 were found to be present at 44 42 56 and 45 of the wild-type level 194

respectively (Figure 3) Interestingly amounts of the PSII assemblyrepair factors PratA and 195

Slr0151 as well as the light-dependent protochlorophyllide oxidoreductase (POR) enzyme 196

were also reduced (Figure 3 Yang et al 2014 Rast et al 2016) Levels of the Pitt protein 197

which interacts with POR (Schottkowski et al 2009a) and the Oxa homolog YidC 198

(Ossenbuumlhl et al 2006) were slightly increased in curT- (Figure 3) On the other hand 199

Sll0933 the homolog of the PSII assembly factor PAM68 in A thaliana accumulated to 200

250 of the wild-type level (Armbruster et al 2010) In contrast amounts of both Cytf and 201

PsaA which serve as markers for the Cyt(b6f) and PSI complexes respectively the RbcL 202

subunit of the Rubisco enzyme the PSII assembly factor Ycf48 (Komenda et al 2008) and 203

VIPP1 remained unaltered in curT- (Figure 3) Overall the alterations in protein accumulation 204

indicate that loss of CurT preferentially affects the accumulation of PSII 205

This result was further corroborated by analysis of the photosynthetic performance of 206

curT- The rate of light-dependent oxygen evolution was reduced by approximately 50 in the 207

mutant (Table 1) and analysis of P700+ reduction kinetics revealed impaired electron donation 208

by PSII (Figure 4A) PSII-driven P700+ reduction is slowed down by a factor of three in curT-209

whereas the residual cyclic electron transfer activity in the presence of DCMU is less than 210

5 in both wild-type and curT- (Figure 4B) In contrast the light intensity-dependent electron 211

7

transfer capacity which was measured as relative electron transfer rate (rETR) did not differ 212

significantly between wild-type and curT- (Figure 4C) Both wild-type and curT- cells reach a 213

capacity limit at ~ 250 micromol photons m-2s-1 and the decay of rETR beyond the capacity limit 214

is very similar These results indicate that the point of onset of PSII-related photoinhibition is 215

the same in both strains which in turn implies that electron flow downstream of PSII is 216

unchanged in the mutant 217

Low PSII levels in curT- could be caused either by reduced synthesisbiogenesis or its 218

enhanced degradation To measure the rates of D1 repair the kinetics of D1 accumulation 219

upon induction of photoinhibition by high-light treatment (800 micromol photons m-2s-1) was 220

assayed by immunological means (Figure 4D) In wild-type cells the D1 level decreased to 221

60 (relative to the initial time point) after 90 min of treatment As previously shown the 222

drop is much more pronounced (~35 left) when repair synthesis of D1 is inhibited by the 223

addition of lincomycin (Figure 4D Komenda et al 2008) Surprisingly in curT- the level of 224

residual D1 is rather stable over the same time period and lincomycin treatment induces a 225

more modest decrease to 60 relative to the initial time point (Figure 4D) These data clearly 226

indicate that in absence of CurT residual D1 is less susceptible to degradation even though 227

its absolute amount is reduced In line with this no effect on growth rates was observed when 228

either wild-type or curT- cells were cultivated for two days at 200 micromol photons m-2s-1 229

(Supplemental Figure 5) 230

To assess the role of CurT in the assembly of PSII we compared the two-dimensional 231

profiles of thylakoid membrane proteins from wild-type and mutant cells by Blue-Native 232

(BN)SDS-PAGE PSII assembly intermediates were subsequently visualized via 233

immunodetection of PSII core subunits As shown in Figure 5A dimeric PSII core complexes 234

(RCCII) are drastically underrepresented in curT- whereas relative levels of earlier assembly 235

intermediates including the monomeric CP43-less RC47 complex and non-assembled CP43 236

increase Parallel detection of CurT itself revealed a ldquosmearedrdquo signal in the size range from 237

15 up to 500 kDa suggesting that CurT forms part of high-molecular-weight complexes 238

(Figure 5A) Finally in vivo 35S protein pulse-labeling experiments confirmed that RC and 239

RC47 complexes in particular are efficiently formed in curT- but the transition to RCCI 240

complexes is severely delayed (Figure 5B) As a consequence dimeric RCCII complexes do 241

not incorporate any radioactive label over the experimentrsquos time course of 25 min (Figure 5B) 242

Taken together these data show that curT inactivation has a severe impact on PSII biogenesis 243

but little or no effect on the degradation of the complex 244

8

The data presented so far suggest a PSII-related phenotype for curT- so we explored 245

the effects of curT disruption on photosynthesis further by comparing the low-temperature 246

(77K) fluorescence emission spectra in cell suspensions following excitation of chlorophyll at 247

440 nm (Figure 6A) The signals were normalized to the emission maximum at 514 nm of the 248

external standard fluorescein (Figure 6A) In curT- the PSI emission peak amplitude was 249

similar to that of the wild-type (Figure 6A) The spectra differed however around 685 nm 250

Here we observed an increase in fluorescence in the mutant strain an emission signature that 251

is probably related to the inner antenna protein CP43 (Figure 6A Nilsson et al 1992) 252

Increased chlorophyll fluorescence at 685 nm has previously been shown to be characteristic 253

for cells that are accumulating the stress-induced IsiA protein which shares structural 254

similarities with CP43 (Odom et al 1993 Yeremenko et al 2004 Wilson et al 2007) A 255

second indication for accumulation of IsiA is a diagnostic blue shift of the 725 nm 256

fluorescence peak by approximately 5 nm which is indeed observed in the curT- spectrum 257

(Figure 6A Sandstroumlm et al 2001) We therefore determined the level of IsiA in both wild-258

type and curT- by immunoblot analysis As expected IsiA was strongly induced in curT- 259

suggesting that the mutant suffers from severe stress (Figure 6C) When fluorescence at 77K 260

was recorded after excitation at 580 nm which mainly excites the phycobiliproteins the 261

signal at 685 nm (PSII related) was enhanced in the curT- mutant most likely reflecting IsiA 262

emission andor the presence of uncoupled phycobilisomes (Figure 6B Wilson et al 2007) 263

In contrast the 725 nm peak (PSI related) was reduced in curT- relative to the wild-type 264

suggesting less coupling of phycobilisomes to PSI (Figure 6B) The increase in uncoupled 265

phycobilisomes can be directly attributed to the reduction in RCCII levels found in the curT- 266

mutant (Figure 5A) since phycobilisomes are attached to PSII dimers for efficient light 267

harvesting (Watanabe and Ikeuchi 2013 Chang et al 2015) 268

Thus the curT- mutant exhibits a characteristic set of photosynthetic defects The 269

primary target of the CurT membrane-shaping function appears to be PSII in particular in its 270

biogenic phase However the reduction in PSII content cannot be responsible for the lack of 271

thylakoid convergence zones at the plasma membrane because these structures can still be 272

observed in the psbA- mutant TD41 which is lacking D1 and therefore unable to assemble any 273

PSII complexes (Supplemental Figure 6 Nilsson et al 1992) 274

275

Subcellular localization of CurT 276

We have previously proposed that the initial steps in PSII assembly take place in 277

biogenesis centers located at the interface between plasma and thylakoid membranes (Stengel 278

9

et al 2012) These biogenic membranes (PDMs) are marked by the PSII Mn2+ delivery factor 279

PratA and can be separated from thylakoids by a two-step sucrose-gradient centrifugation 280

procedure (Schottkowski et al 2009b Rengstl et al 2011) When the distributions of various 281

proteins within such membrane fractions from the wild-type and curT- were compared two 282

striking changes were detected in the mutant First the precursor of the D1 subunit of PSII 283

(pD1) is absent from PDMs in the mutant and secondly the inner antenna protein CP47 ndash but 284

not CP43 ndash of PSII shifts towards fractions of lower density (Figure 7) Hence the 285

organization of PDMs appears to be perturbed in curT- In wild-type cells most of the CurT 286

protein was found in thylakoid membranes only a minor fraction similar in amount to that of 287

the PSII assembly factors Ycf48 Pitt and YidC as well as the VIPP1 protein comigrated with 288

PDMs (Figure 7) According to rough estimates based on densitometric signal analysis 25 289

of total cellular CurT is normally found in the PDMs and 75 in the thylakoids (Figure 7) 290

To further analyze the localization of CurT in its cellular context in vivo we 291

constructed a translational fusion in which the monomeric enhanced cyan fluorescent protein 292

(CFP) mTurquoise2 (Goedhart et al 2012) is attached to the C-terminus of CurT and is 293

expressed under the control of the native curT promoter The resulting strain curT-CFP 294

showed a fully restored wild-type growth phenotype indicating that the CFP tag does not 295

affect CurTrsquos function (Supplemental Figure 7A) In agreement with this the fusion protein 296

accumulated to wild-type levels (96 plusmn 16 Supplemental Figure 7B) and localized to the 297

same membrane sub-fractions as does native CurT (Supplemental Figure 7C) The CurT-CFP 298

fluorescence signal was distinctly discernible above the wild-type autofluorescence 299

background (Supplemental Figure 8A) and was distributed in a network-like pattern with 300

concentrated areas at the cell periphery at mid-plane Analysis of CurT-CFP fluorescence in 301

Z-axis montages revealed that these signals often appeared as rod-like structures which 302

seemed to follow the spherical inner surface of the cell (Figure 8A B Supplemental Movie 1 303

and 2) In some cases these structures also appear to extend through the cytoplasm (Figure 304

8A and 8B Supplemental Movie 3) 305

When chlorophyll autofluorescence indicative of thylakoid membranes was visualized 306

in the same cell only a partial overlap with the CurT-CFP signal was observed (Figure 8 307

Supplemental Movie 1-3) Strikingly the peripheral CurT-CFP signals frequently reached 308

their maximal intensity in those areas where chlorophyll fluorescence was low ie where 309

thylakoid convergence zones are expected to form (Sacharz et al 2015) This becomes even 310

clearer when the intensity of a circumferential profile that follows the thylakoidrsquos 311

10

fluorescence signal is quantified separately for each of the two fluorescent channels (Figure 312

8C) 313

In contrast the chlorophyll autofluorescence in the curT- mutant seems to be evenly 314

distributed (Supplemental Figure 9) Following the fluorescence in an intensity profile as in 315

curT-CFP no regions with a similar decline in fluorescence were found most likely due to 316

the absence of biogenesis centers In addition some circular structures presenting chlorophyll 317

autofluorescence were detected in the interior of the cells Hence the disturbed curT- 318

ultrastructure is also reflected in the distribution of chlorophyll pigments (Supplemental 319

Figure 9) 320

To confirm the network-like distribution of CurT-CFP in the cell we used 321

immunofluorescence to detect CurT in the wild-type in situ Synechocystis 6803 cells were 322

fixed and treated with the αCurT antibody and an Oregon Green-conjugated secondary 323

antibody As shown in Figure 9A and B both techniques revealed similar network-like 324

patterns of the CurT signal which coalesced into rod-like structures at the cell surface and 325

essentially filled up the gaps between the autofluorescent thylakoid regions (negative controls 326

shown in Supplemental Figure 8B and 8C) Again regions of low chlorophyll fluorescence 327

typical of biogenesis centers generally exhibited stronger CurT-related fluorescence (Figure 328

8C) Occasionally CurT-CFP signals were also observed near traversing thylakoid lamellae 329

(when these were present in the cell analyzed) but the autofluorescence intensity of such 330

thylakoids is much weaker (see Figure 8B cell b in slice 6 and Supplemental Movie 3) 331

Finally CurT was localized by immunogold labeling experiments on ultrathin sections 332

of wild-type Synechocystis 6803 cells Almost no signals were detected when wild-type and 333

curT- sections were processed in the absence of the primary antibody as a negative control 334

(Figure 10A and Supplemental Figure 10A respectively) When mutant curT- cells were 335

processed in the presence of the αCurT antiserum a low level of randomly distributed 336

background signals was observed (Supplemental Figure 10B Supplemental Table 1) 337

However the number of signals located at the thylakoid membrane was clearly reduced 338

relative to the wild-type Therefore these signals were treated as non-specific background 339

Upon incubation of wild-type cell sections with antibodies directed against the N-terminus of 340

CurT (Figure 1A) the antigen was detected on the cytoplasmic surface of thylakoid 341

membranes (Figure 10B and 10C) This strongly suggests that its N-terminus is oriented 342

towards the cytoplasm Overall CurT signals appeared to be distributed along both thylakoids 343

and PDMs This agrees with the broad distribution of CurT across various fractions in the 344

membrane fractionation experiments (Figure 7) In only a few cases (12 ) however was 345

11

some clustering of immunogold signals at thylakoid convergence regions found (Figure 10D 346

and 10E) Thus the high local concentration of CurT at biogenic centers seen in the 347

fluorescence-based approaches (Figures 8 and 9) was not quantitatively reflected in the 348

immunogold labeling data This is likely due to the fact that immunogold electron microscopy 349

can only detect antigens on the surface of the section This issue is further complicated by the 350

heterogeneity of the CurT assemblies (see below and Discussion section) 351

Nevertheless closer inspection of the immunogold signals revealed an asymmetric 352

distribution of CurT signals with regard to the two faces of thylakoid sheets As illustrated in 353

Figure 10G curved thylakoid sheets possess a longer convex and a shorter concave face 354

When we analyzed a total of approximately 1500 CurT immunogold signals (from a total of 355

95 cells) which were unambiguously located to one side of the thylakoid membrane (for a 356

representative example see Supplemental Figure 11) 561 were found to be located at the 357

convex face while the other 439 localized to the concave side (Figure 10G Supplemental 358

Table 2) When differently curved regions (Figure 10F) including thylakoid lamellae (i) that 359

follow the overall shape of the cell (green) (ii) bend away from the plasma membrane (red) or 360

(iii) towards it ie where thylakoids converge to form biogenesis centers (yellow) were 361

examined separately red and green regions showed a CurT distribution in the range of 55 362

convex to 45 concave (Figure 10G Supplemental Table 2) However at the biogenesis 363

centers (the regions highlighted in yellow in Figure 10F) the uneven distribution of the 364

immunogold signals was more pronounced 61 of signals were found on the convex side 365

and 39 on the concave face of thylakoid lamellae (Figure 10G Supplemental Table 2) 366

Statistical analyses confirmed the significance of these differences in signal distributions 367

along the thylakoid membrane types (Supplemental Table 3) 368

Taken together with the finding that CurT is required for the formation of the 369

convergence sites forming biogenesis centers these data are consistent with the idea that the 370

thylakoid sheets are shaped by CurT which induces membrane curvature via asymmetric 371

intercalation on the two sides of thylakoid sheet 372

373

Different forms of CurT are found in PDMs and thylakoids 374

CurT was found to localize to both highly curved PDMs and less bent thylakoids Its 375

high local concentration at biogenic centers as seen in the fluorescence-based approaches 376

suggests a dosage-dependent effect of CurT on membrane shaping An alternative possibility 377

is that different CurT variants might exist in the two membrane types which could potentially 378

serve different functions To explore this possibility we asked whether CurT is found in 379

12

different complexes by using 2D BNSDS-PAGE to characterize membrane material isolated 380

via two-step sucrose gradient centrifugation (see Figure 7) In accordance with the data in 381

Figure 5A we find several low-molecular-weight complexes containing CurT (Figure 11A) 382

Smaller complexes of ~80 (complex I) and ~100 kDa (complex II) accumulate in membrane 383

fraction 5 (representing PDMs) but these are far less prevalent in fraction 9 representing 384

thylakoids (Figure 11A) In addition CurT-containing sub-complexes of ~140 (complex III) 385

and ~200 kDa (complex IV) are more prominently represented in thylakoids together with 386

even larger complexes ranging up to 670 kDa (Figure 11A) 387

Even more strikingly PDMs and thylakoids also differ with respect to the forms of 388

CurT they contain Thus isoelectric focusing (IEF) analysis of both membrane fractions 389

revealed at least four different CurT isoforms (a-d Figure 11B) PDMs contain mainly forms 390

b and d as well as trace amounts of a while thylakoids apparently possess very low levels of 391

form d and accumulate forms a b and c (Figure 11B) The nature of the underlying CurT 392

modifications still has to be determined Interestingly however CurT has recently been 393

identified as a phosphoprotein in a proteomic study (Spaumlt et al 2015) and the CurT variants 394

in Figure 11B may differ in their phosphorylation states At all events PDMs and thylakoids 395

can be distinguished by their complement of CurT isoforms which potentially play a role in 396

formation of the CurT sub-complexes that define the two membrane fractions 397

398

CurT is involved in the osmotic stress response 399

To further explore the stress-related role of CurT (Figure 6) and its link to IsiA 400

induction the effect of other potential stressors on curT- cells was tested High light levels had 401

a minor effect on curT- growth and its photosynthetic performance (Figure 4 Supplemental 402

Figure 5 and section above) suggesting that other environmental factors induced isiA 403

expression Our search was also motivated by a previous proteomic survey of plasma 404

membrane proteins of Synechocystis 6803 in high salt conditions in which CurT and VIPP1 405

were found among the most highly induced targets (Huang et al 2006) First we cultured 406

wild-type and curT- cells in different salt concentrations and found that growth of curT- was 407

severely affected in high salt (Figure 12A) Wild-type cells were only slightly affected by the 408

addition of salt to the medium The deleterious effect of the loss of curT on growth was even 409

more pronounced when maltose an osmotically active compound was present in the medium 410

(Figure 12B) Indeed curT- cells failed to survive exposure to 150 mM maltose whereas 411

growth of the wild-type was only slightly compromised These findings assign an additional 412

function to CurT ie a protective role during osmotic stress 413

13

When the curT-CFP strain was analyzed under these stress conditions enhanced 414

accumulation of CurT at the cell periphery was found mostly outside the autofluorescent 415

thylakoids and consistent with accumulation at the plasma membrane (Figure 12C) This was 416

further substantiated by membrane fractionation experiments which also revealed an 417

increased relative abundance of CurT in the plasma membrane fraction in the first sucrose 418

gradient (Figure 12E) Determination of total cellular CurT levels demonstrated that its 419

absolute amount did not increase under stress (Figure 12D) Therefore its higher abundance 420

in the plasma membrane under osmotic stress is likely to be due to CurT trafficking towards 421

the plasma membrane instead of increased synthesis 422

The same appears to hold true for VIPP1 which has been implicated in membrane 423

maintenance in both cyanobacteria and chloroplasts (Zhang and Sakamoto 2015) At stress 424

conditions an increase of the VIPP1 signal in the plasma membrane can be monitored in 425

wild-type (Figure 12E) However enhanced accumulation of VIPP1 in plasma membranes is 426

unaffected in the curT- mutant suggesting that thylakoid convergence zones are not strictly 427

required for the localization of VIPP1 428

429

Discussion 430

CurT determines thylakoid architecture 431

This study demonstrates that the protein CurT a homolog of the grana-forming 432

CURT1 proteins in plants is essential for establishing the proper thylakoid membrane 433

architecture in the cyanobacterium Synechocystis 6803 In particular CurTrsquos membrane-434

bending activity is likely to be required for the formation of thylakoid biogenesis centers at 435

points on the cell periphery where thylakoids converge towards the plasma membrane Here 436

PratA-mediated preloading of early PSII assembly intermediates with Mn2+ ions has been 437

proposed to take place together with PSII repair (Stengel et al 2012 Sacharz et al 2015) 438

This idea is supported by the following lines of evidence (i) The curT- mutant is devoid of 439

any thylakoid sectors that have convergence zones at their distal ends instead thylakoid 440

membranes are displaced and disposed as disordered or continuous rings (ii) CurT similarly 441

to CURT1A possesses a membrane-curving activity in vitro and intercalates asymmetrically 442

into thylakoids (iii) A high local concentration of CurT is observed at regions of high 443

curvature where biogenesis centers are found (iv) Lack of CurT affects the formation and 444

accumulation of PSII complexes as well as the abundance of some of its assembly factors 445

The drastic effects of CurT inactivation indicate an important role for this factor in membrane 446

shaping In contrast to the situation for CURT1A from Arabidopsis attempts to stably 447

14

overexpress CurT in Synechocystis 6803 failed Although short-lived transient increases in 448

CurT levels were observed when curT was expressed via strong heterologous promoters 449

wild-type levels of the protein were restored during subsequent rounds of cultivation of 450

transgenic lines Apparently Synechocystis 6803 cells do not tolerate substantial alterations in 451

CurT dosage and counter-select against these 452

This is in agreement with a dosage-dependent membrane-curving activity of CurT 453

which is suggested by its high local concentration at the edges of thylakoid autofluorescent 454

regions which mark the sites of the highly curved thylakoid convergence zones (Figures 8 9 455

and 13 Supplemental Movie 1 2 and 3) In addition some CurT was detected in structures 456

extending through the cytoplasm which most likely represent thylakoid sheets traversing the 457

cell from one thylakoid convergence zone to another (Figures 2A and 8) CurT might be 458

involved in the formation and stabilization of these structures 459

Members of the CURT1 family contain an N-terminal amphipathic α-helix that may 460

be involved in the membrane-bending activity of CurT (Armbruster et al 2013) Several 461

eukaryotic membrane-shaping proteins possess amphipathic helices as part of either an ENTH 462

(epsin N-terminal homology) or an N-BAR (Bin amphiphysin Rvs with N-terminal 463

amphipathic helix) domain (Ford et al 2002 Gallop and McMahon 2005 Zimmerberg and 464

Kozlov 2006) ENTH and N-BAR domains are rather large (~200 amino acids) and it has 465

been shown that amphipatic helices present in those domains insert into one leaflet of the lipid 466

bilayer and thereby induce curvature of the membrane (reviewed by Gallop and McMahon 467

2005 Zimmerberg and Kozlov 2006) However CurT itself is a small protein (149 amino 468

acids) that contains two transmembrane domains which insert into both leaflets of the lipid 469

bilayer (Figure 1A) as already suggested by Armbruster et al (2013) The amphipathic helix 470

faces the cytoplasm in Synechocystis 6803 or the stroma in A thaliana and most likely it 471

fine-tunes the degree of membrane bending mediated by CurT (Armbruster et al 2013) 472

In addition the increase in curvature correlated with CurT accumulation at convex 473

sides of thylakoid lamella (Figure 10 and 13) Hence curving might be mediated by 474

asymmetric integration of CurT into the lipid bilayers forming opposite faces of thylakoid 475

membrane sheets (Figure 13) However the mechanism causing this asymmetry remains 476

elusive 477

The presence of different CurT isoforms and complexes in PDMs and thylakoids adds 478

a further level of complexity and most likely reflects the dynamic regulation of this system 479

(Figure 11) The formation of different complexes might be primed by the phosphorylation of 480

CurT within its N-terminal cytoplasmic part (Spaumlt et al 2015) It seems likely that these 481

15

complexes play distinct roles in mediating the different CurT functions ie membrane 482

bending and maintenance 483

However it remains to be seen how exactly curvature is established maintained and 484

fine-tuned In addition other determinants of membrane topology and their putative interplay 485

with CurT have to be considered eg lipid and protein (complex) composition of 486

membranes cellular turgor pressure and other factors required for membrane 487

biogenesismaintenance eg the VIPP1 protein before precise molecular models of CurTrsquos 488

mode of action can be constructed (Rast et al 2015 and see below) That these other factors 489

can be crucial for membrane architecture is documented by the fact that some marine 490

cyanobacteria such as Prochlorococcus and Synechococcus contain curved thylakoids (but 491

no thylakoid convergence zones at the plasma membrane) although they lack a curT gene 492

493

The role of biogenesis centers 494

The absence of biogenesis centers in the curT- mutant now enables one to answer some 495

questions relating to the role of these thylakoid sub-structures which form in some but not all 496

cyanobacteria (Kunkel 1982 van de Meene et al 2006) First they are not essential since 497

even the curT- mutant still accumulates PSII to ~50 of wild-type levels On the other hand 498

in the mutant assembly of PSII is impaired as revealed by the increased accumulation of early 499

assembly intermediates In addition PSII dimers are almost completely absent in curT- 500

Whether the reduction in PSII dimers is attributable to an assembly problem linked to the 501

absence of biogenesis centers or to a secondary defect in dimer stabilization caused by 502

changes in overall thylakoid membrane ultrastructure remains to be determined Thus 503

biogenesis centers are more likely to represent evolutionary ldquoadd-onsrdquo that facilitated efficient 504

thylakoid biogenesis This is compatible with the fact that some cyanobacteria are devoid of 505

any biogenesis center-related substructures Second their absence compromises PSII but the 506

accumulation of other photosynthetic complexes ie PSI and the Cyt(b6f) complex is not 507

affected by CurT deficiency (Figure 3) This observation agrees with previous findings that 508

neither the PsaA subunit of PSI nor its assembly factor Ycf37 is detectable in isolated PDM 509

fractions (Rengstl et al 2011) 510

In addition to reduced de novo PSII assembly a higher relative stability of D1 in high-511

light experiments has been detected in curT- which suggests that D1 degradation during PSII 512

repair is less efficient in the mutant Photo-damaged D1 is degraded by the FtsH2FtsH3 513

complex which has previously been shown to partly localize to thylakoid convergence zones 514

at the cell periphery ie biogenesis centers (Boehm et al 2012 Sacharz et al 2015) It 515

16

therefore seems possible that the absence of biogenesis centers in curT- leads to 516

mislocalization of the FtsH2FtsH3 complex and less effective D1 degradation 517

Moreover a PSII related-function for CurT is supported by a meta-analysis of the 518

Synechocystis 6803 transcriptome When the CyanoEXpress 22 database (Hernaacutendez-Prieto 519

and Futschik 2012 Hernaacutendez-Prieto et al 2016) was queried for genes co-expressed with 520

curT (slr0483) genes for five PSII subunits ndash psbE psbO psbF psbL and psb30 ndash were 521

found among the first ten hits (Supplemental Table 4) From this we infer that biogenic 522

centers do not play an essential role in the assembly of all photosynthetic complexes but 523

serve to enhance PSII assemblyrepair possibly through the efficient delivery of Mn2+ 524

Residual PSII in curT- cells is likely to be supplied with cytoplasmic Mn2+ via a second 525

independently operating ABC transporter-based system in the plasma membrane named the 526

Mnt pathway (Bartsevich and Pakrasi 1995 Bartsevich and Pakrasi 1996) 527

Formally we cannot exclude that CurT is directly involved in the PSII assembly 528

process However considering CurTrsquos membrane bending capacity and the mutant phenotype 529

(Figure 1D and Figure 2) it appears more likely that CurT forms cellular substructures for 530

efficient PSII biogenesis ie biogenesis centers 531

As mentioned above some ultrastructural features of biogenesis centers have emerged 532

from studies employing EM-based tomography (van de Meene et al 2006) To date however 533

a high-resolution picture of the precise membrane architecture within these centers remains 534

elusive In particular whether or not a direct connection between plasma membrane and 535

thylakoids exists continues to be debated As recently discussed and in line with this gap in 536

knowledge different membrane fractionation techniques have revealed different distributions 537

of PSII-related subunits and assembly factors between plasma and thylakoid membranes 538

(Heinz et al 2016 Liberton et al 2016 Selatildeo et al 2016) The overall picture that emerges 539

is that the initial hypothesis that PSII biogenesis is initiated at the plasma membrane is no 540

longer tenable whereas a specialized thylakoid sub-fraction like the PDMs that make contact 541

with the plasma membrane could explain many of the available data and thus clarify some 542

aspects of the debate (Zak et al 2001 Pisareva et al 2011 Rast et al 2015) Moreover it 543

has previously been hypothesized that ldquoribosome-decorated membrane-like complexesrdquo 544

forming at the innermost thylakoid sheet might represent biogenic compartments (van de 545

Meene et al 2006 Mullineaux 2008) Whether these structures are affected in curT- cannot 546

be judged based on our TEM analysis but requires ultrastructural data of higher resolution 547

However the accessibility of thylakoids for ribosomes should be increased in the less 548

compressed membrane system of curT- (Figure 2B-D) 549

17

A scenario similar to that of Synechocystis 6803 holds for the situation in chloroplasts 550

of the green alga Chlamydomonas reinhardtii in which de novo PSII biogenesis has been 551

shown to be initiated in punctate regions named T-zones located close to the pyrenoid 552

(Uniacke and Zerges 2007) Unlike the mRNAs for the PSII components neither RNAs for 553

PSI subunits nor PSI assembly factors are localized to T-zones indicating that PSI and PSII 554

assembly processes are spatially separated (Uniacke and Zerges 2009 Nickelsen and Zerges 555

2013 Rast et al 2015) Interestingly a recent cryoelectron tomography study demonstrated 556

that next to T-zones at the chloroplast base-lobe junction the inner chloroplast envelope 557

exhibits invaginationsconnections to thylakoids that structurally resemble the organization of 558

cyanobacterial biogenesis centers (Engel et al 2015) For future investigations it will be 559

interesting to see if a homolog of the CURT1 family is involved in the formation of these 560

structures in C reinhardtii 561

562

Evolution of CURT1 function 563

Homologs of the CURT1 protein family can be found throughout cyanobacteria green 564

algae and plants (Armbruster et al 2013) The Arabidopsis CURT1A-D proteins have 565

recently been shown to induce bending of thylakoid membranes at grana margin regions 566

(Armbruster et al 2013) Interestingly and in contrast to the situation in Synechocystis 6803 567

their inactivation did not result in severe photosynthetic deficiencies although the thylakoids 568

formed lacked defined grana stacks Nevertheless the data available support the idea that the 569

function of thylakoid membrane structures that were regarded as being independent ie 570

cyanobacterial biogenesis centers and grana are closely related Intriguingly both of these 571

thylakoid membrane structures are dedicated to aspects of PSII function but do not involve 572

PSI (Pribil et al 2014) In both the prokaryotic and eukaryotic systems CURT1 homologs 573

appear to bend thylakoid membranes as indicated by (i) the distortion of membrane 574

ultrastructure seen in mutants devoid of curved thylakoids (ii) the localization of CURT1 575

homologs at grana margins and their local concentration at biogenesis centers (iii) the in vitro 576

membrane-curving activity of both CURT forms The phenotypic differences between 577

A thaliana and Synechocystis 6803 mutants may however be attributable to the different 578

functions of the membrane sub-compartments affected in the two model organisms Whereas 579

the role of grana is still under debate one function of the cyanobacterial biogenesis centers is 580

the above-mentioned high-throughput uptake of Mn2+ ions for efficient assembly of PSII 581

(Stengel et al 2012 Nickelsen and Rengstl 2013 Pribil et al 2014) However it appears 582

that in both cases the primary function of CURT1 proteins is to generate curved membrane 583

18

regions These discoveries suggest that until now two independently observed structures ie 584

cyanobacterial thylakoid biogenesis centers and chloroplast grana regions are closely related 585

The degree of curvature is much less pronounced in the cyanobacterial system As previously 586

discussed it was probably the subsequent evolution of a membrane-localized light-harvesting 587

system in chloroplasts that made the formation of tightly curved grana thylakoids possible 588

(Mullineaux 2005 Nevo et al 2012 Pribil et al 2014) 589

590

CurT is involved in osmotic stress response 591

One unexpected phenotype of the curT- mutant is its sensitivity to osmotic stress 592

These data revealed that in addition to shaping membranes CurT also influences their 593

functional integrity This latter function might be intrinsic to CurT or could be mediated by 594

the VIPP1 protein which has been shown to be required for membrane maintenance in 595

bacteria and chloroplasts probably by acting as a supplier of lipids (for an overview see 596

Zhang and Sakamoto 2015) Both factors accumulate in the plasma membrane upon osmotic 597

stress but VIPP1 localization is not severely affected by CurT inactivation which suggests 598

that VIPP1 operates independently of CurT In agreement with this repeated co-599

immunoprecipitations revealed no interaction between both proteins Therefore it remains to 600

be established whether a direct functional relationship between them exists 601

Previous investigations of osmotic stress in Synechocystis 6803 showed a kidney-602

shaped form of wild-type cells under very high concentrations of osmotically active 603

compounds (Marin et al 2006) The cells were severely deformed indicating changes in the 604

structure of the cellular envelope Since CurT shifts towards the plasma membrane already 605

under lower osmolyte concentrations we suggest a stabilizing function of CurT in the plasma 606

membrane CurT might be necessary to tolerate the forces trying to deform the cells under 607

osmotic stress 608

In conclusion this analysis has identified a crucial determinant for shaping and 609

maintaining the cyanobacterial thylakoid membrane system ie CurT a homolog of the 610

grana-forming CURT1 protein family from A thaliana In particular CurT is involved in the 611

formation of specific thylakoid substructures close to the plasma membrane at which PSII is 612

assembledrepaired Future work will dissect the precise ultrastructure of these centers and 613

enable us to elaborate a molecular model for the spatiotemporal organization of PSII assembly 614

in cyanobacteria 615

616

19

Methods 617

Strains and growth conditions 618

Wild-type and mutant Synechocystis 6803 cells were grown on solid or in liquid BG 619

11 medium (Rippka et al 1979) supplemented with 5 mM glucose (unless indicated 620

otherwise) at 30degC under continuous illumination at a photon irradiance of 30 μmol m-2 s-1 of 621

white light For growth during high-light experiments for investigation of D1 repair cells 622

were cultivated in a FMT150 photobioreactor (Photon Systems Instruments Draacutesov Czech 623

Republic) at 800 micromol photons m-2 s-1 in the presence or absence of lincomycin (100 microgml) 624

Cell density was monitored photometrically at 750 nm Doubling times were determined after 625

two days of growth To generate the insertion mutant curT- the curT gene (slr0483) was first 626

amplified from wild-type genomic DNA by PCR using the primer pair 04835 627

(GAAGCCTATTTAGCTAAGGCCGAAAG) and 04833 628

(TAGTACCTGGTCTTCCATGGCGT) and the resulting fragment was cloned into the 629

Bluescript pKS vector (Stratagene Waldbronn Germany) A kanamycin resistance cassette 630

was then inserted into the single AgeI restriction site (159 bp downstream of the start codon) 631

and this disruption construct was used to replace the wild-type gene as described (Wilde et al 632

2001) 633

634

Bioinformatic and computational analysis 635

CURT1 sequences of Synechocystis 6803 were obtained from CyanoBase 636

(httpgenomekazusaorjpcyanobaseSynechocystis) and CURT1 homologs in other 637

organisms were retrieved from NCBIBLAST (httpblastncbinlmnihgovBlastcgi) 638

Numbers and positions of putative transmembrane domains in the predicted proteins were 639

determined with TMHMM20 (httpwwwcbsdtudkservicesTMHMM) The sequence for 640

the N-terminal amphipathic helix was predicted by Jpred 3 641

(httpwwwcompbiodundeeacukwww-jpred) and plotted using a helical wheel projection 642

script (httprzlabucreduscriptswheelwheelcgi) The programs ClustalW2 643

(httpwwwebiacuktoolsclustalw2) and GeneDoc (httpwwwpscedubiomedgenedoc) 644

were used to generate multiple alignments of amino acid sequences Quantitative analysis of 645

immunoblots was performed with the AIDA Image Analyzer V325 (Raytest 646

Isotopenmessgeraumlte GmbH Straubenhardt Germany) 647

Co-expression patterns of curT were analyzed using the CyanoEXpress 22 database 648

(httpcyanoexpresssysbiolabeu Hernaacutendez-Prieto and Futschik 2012 Hernaacutendez-Prieto et 649

al 2016) 650

20

651

Measurement of chlorophyll concentration and oxygen production 652

Determination of chlorophyll content was carried out according to Wellburn and 653

Lichtenthaler (1984) For oxygen evolution measurements cells were grown in BG-11 654

without glucose harvested in mid-log phase and diluted to an OD750 nm = 05 Oxygen 655

evolution rates were measured with a Clark-type oxygen electrode (Hansatech Instruments 656

Ltd Kingrsquos Lynn Norfolk UK) at 1000 micromol photons m-2 s-1 (cool white light) after 5 min of 657

dark acclimation Oxygen evolution under saturating light conditions was measured without 658

any additives 659

660

Cell size and cell number estimation 661

Synechocystis 6803 strains were grown in liquid BG11 media containing 5 mM 662

glucose For cell size estimation the cells were analyzed with a confocal laser scanning 663

microscope TCS SP5 (Leica Wetzlar Germany) The diameter of the cells was measured 664

with the LAS AF Lite software (Leica Wetzlar Germany) Cells that were about to divide 665

were not taken into account For the determination of cell number cultures were set to an 666

OD750 = 1 and analyzed by using a Neubauer counting chamber (Paul Marienfeld GmbH amp 667

Co KG Lauda-Koumlnigshofen Germany) Statistical significance was determined by Studentrsquos 668

t-test 669

670

Measurements of P700+ reduction kinetics and relative electron transport rates 671

P700+ reduction kinetics and changes in chlorophyll fluorescence yield at different 672

light intensities were measured at a chlorophyll concentration of 5 microgml with a Dual-PAM-673

100 instrument (Heinz Walz GmbH Effeltrich Germany) Complete P700 oxidation was 674

achieved by a 50-ms multiple turnover pulse (10000 micromol photons m-2 s-1) after 2 min of dark 675

incubation P700+ reduction kinetics were recorded without any additions as well as in the 676

presence of 10 microM DCMU Ten technical replicates were averaged and fitted with single 677

exponential functions Data interpretation was done according to Bernaacutet et al (2009) 678

Light saturation measurements were performed according to Xu et al (2008) The 679

actinic light intensity was increased stepwise from 0 to 665 micromol photons m-2 s-1 with 30-s 680

adaptation periods Maximal fluorescence yields were obtained by applying saturating light 681

pulses (duration 600 ms intensity 10000 micromol photons m-2 s-1) 682

683

Low-temperature fluorescence measurements 684

21

Fluorescence emission spectra were measured with an AMINCO Bowman Series 2 685

Luminescence Spectrometer Wild-type and curT- cells were grown in the presence of 5 mM 686

glucose to mid log-phase and concentrated to 25 microgml chlorophyll adding 2 microM fluorescein 687

as an internal standard Samples (1 ml) were transferred to thin glass tubes dark-adapted for 688

30 min at 30 degC and shock frozen in liquid N2 To quantify chlorophyllfluorescein and 689

phycobilisome-mediated fluorescence samples were excited and emission recorded at 440 690

nm510 nm (chlorophyll and fluorescein excitationmax fluorescein emission) and 580 691

nm685 nm respectively Emission was scanned at 490-800 nm or at 640-800 nm 692

respectively 693

694

Antibody production and protein analysis 695

For generation of an αCurT antibody the N-terminal coding region of curT (amino 696

acid positions 1-58) was amplified by PCR using primers N04835 697

(AAGGATCCGTGGGCCGTAAACATTCAA) and N04833 698

(AAGTCGACGCACTTCCCACACCGGTTGTA) and cloned into the BamHI and XhoI sites 699

of the pGEX-4T-1 vector (GE Healthcare Freiburg Germany) Expression of the GST fusion 700

protein in Escherichia coli BL21(DE3) and subsequent affinity purification on Glutathione-701

Sepharose 4B (GE Healthcare) were carried out as described (Schottkowski et al 2009b) A 702

polyclonal antiserum was raised against this protein fragment in rabbits (Pineda Berlin 703

Germany) Other primary antibodies used in this study have been described previously ie 704

αpD1 (Schottkowski et al 2009b) αD1 (Schottkowski et al 2009b) αD2 (Klinkert et al 705

2006) αPratA (Klinkert et al 2004) αYcf48 (Rengstl et al 2011) αPitt (Schottkowski et 706

al 2009a) αPOR (Schottkowski et al 2009a) αYidC (Ossenbuumlhl et al 2006) αVIPP1 707

(Aseeva et al 2007) αSll0933 (Armbruster et al 2010) and αSlr0151 (Rast et al 2016) or 708

were purchased from Agrisera (Vaumlnnaumls Sweden) ie αCP43 αCP47 αPsaA αCyt f 709

αRbcL αIsiA The αGFP-HRP antibody was acquired from Miltenyi Biotech (Bergisch 710

Gladbach Germany) 711

Protein concentrations were determined according to Bradford (1976) using RotiQuant 712

(Carl Roth GmbH amp Co KG Karlsruhe Germany) Protein extraction membrane 713

fractionation on sucrose-density gradients and quantification of Western signal intensities was 714

performed as described previously (Rengstl et al 2011) Solubility properties of CurT were 715

determined according to Schottkowski et al (2009a) 716

22

Sucrose-density centrifugation separating PDM and thylakoid membrane fractions by 717

two consecutive gradients was carried out as described previously (Schottkowski et al 718

2009b Rengstl et al 2011) 719

Two-dimensional fractionations of cyanobacterial membrane proteins via BNSDS-720

PAGE and of pulse-labeled proteins by BNSDS-PAGE were performed as previously 721

reported (Klinkert et al 2004 Schottkowski et al 2009b Rengstl et al 2013) For the 722

analysis of native complexes in fractions obtained by sucrose-density centrifugation the 723

volume corresponding to 350 microg of protein in fraction 7 was applied to BNSDS-PAGE 724

For isoelectric focusing (IEF) the volume corresponding to 50 microg of protein from 725

fraction 7 in 200 microl of IEF buffer (8 M urea 4 CHAPS 1 IPG buffer pH 4-7 (GE 726

Healthcare)) was applied to an 11-cm Immobiline DryStrip pH 4-7 (GE Healthcare) in a 727

Protean IEF Cell (Bio-Rad Munich Germany) Strips were rehydrated for 12 h at 20 degC and 728

50V Focusing was carried out in the following steps 500 V rapid 1500 Vh 1000 V linear 729

880 Vh 6000 V linear 9680 Vh 6000 V rapid 5390 Vh 50 microA per gel focus temperature 730

20degC Subsequently the strips were incubated in equilibration buffer I (6 M urea 0375 M 731

Tris pH 88 20 glycerol 2 SDS 2 DTT) and equilibration buffer II (6 M urea 0375 732

M Tris pH 88 20 glycerol 2 SDS 25 iodoacetamide) for 10 min in each buffer 733

Then the IEF strips were applied to second-dimension SDS-PAGE 734

735

Transmission electron microscopy and immunogold labeling 736

Sample preparation for transmission electron microscopy including freeze substitution 737

and immunogold labeling of CurT was performed as described previously (Stengel et al 738

2012) Ultrathin sections were cut to thicknesses of 35 - 45 nm and 45 - 65 nm for 739

ultrastructural analyses and immunogold labeling respectively For immunogold labeling 740

sections collected on collodion-coated Ni grids were incubated for 18 h at 4degC with (rabbit) 741

αCurT (diluted 1100 1500 11000 or 14000 in blocking buffer (5 fetal calf serum) with 742

005 Tween 20) and further processed as described previously (Stengel et al 2012) As a 743

negative control wild-type Synechocystis 6803 cells were incubated without the primary 744

antibody and exposed to the gold-labeled anti-rabbit IgG To image the ultrastructure and the 745

immunogold-treated samples a Fei Morgagni 268 transmission electron microscope was used 746

and micrographs were taken at 80 kV 747

To avoid errors in the interpretation of the immunogold labeling experiment only 748

signals which were unambiguously localized to distinctly visible thylakoid membranes were 749

taken into account For each cell different regions (see Figure 10F) were defined and in each 750

23

region the signals on the convex and concave sides of the thylakoid membrane were analyzed 751

separately (see Supplemental Figure 11 for representative counts) Statistical significance was 752

assessed by χ2 test (Zoumlfel 1988) 753

For the analysis of clusters of CurT signals in biogenesis centers a cluster was defined 754

as a minimum of four signals in close proximity Overall 219 biogenesis centers were 755

examined with regard to CurT cluster formation 756

757

Preparation of proteoliposomes 758

Liposomes with a lipid mixture of 25 monogalactosyl diacylglycerol 42 759

digalactosyl diacylglycerol 16 sulfoquinovosyl diacylglycerol and 17 760

phosphatidylglycerol (Lipid Products South Nutfield UK) were prepared as described 761

previously (Armbruster et al 2013) To generate proteoliposomes CurT and CURT1A 762

proteins were expressed in the presence of liposomes for 3 h at 37degC using a PURExpress In 763

Vitro Protein Synthesis Kit (New England Biolabs Ipswich MA USA) The liposomes were 764

separated from the mix by centrifugation in a discontinuous sucrose gradient (100000 g 18 765

h) Subsequently the fraction containing the liposomes was extracted and dialyzed against 20 766

mM HEPES (pH 76) For transmission electron microscopy the proteoliposomes were 767

negatively stained with 1 uranyl acetate on a carbon-coated copper grid Micrographs were 768

taken on a Fei Morgagni 268 TEM at 80 kV 769

770

curT-CFP strain generation 771

Gibson assembly was used for single-step cloning (Gibson 2011) of the slr0483 gene 772

(together with its ~08 kb upstream region) the mTurquoise2 gene fragment the gentamycin-773

resistance cassette (aacC1) and an ~17-kb downstream region of slr0483 into pBR322 774

cleaved with EcoRV and NheI The slr0483 gene was fused in frame to the codon-optimized 775

mTurquoise2 (DNA20) preceded by a linker sequence encoding GSGSG The resulting 776

plasmid was used to transform Synechocystis 6803 as described previously (Zang et al 2007) 777

After ~ 10 days of incubation on BG11-GelRite (15 ) medium in the presence of 2 microgml 778

gentamycin several antibiotic resistant colonies were obtained and streaked out on fresh 779

medium These transformants were then tested for full segregation of the tagged allele by 780

colony PCR with primers flanking the slr0483 gene 781

782

Fluorescence microscopy 783

24

An aliquot of a cell suspension in mid-log phase was placed under a BG11-agarose 784

pad on a glass coverslip (15) and imaged on an inverted microscope (Zeiss 785

AxioObserverZ1) equipped with an ORCA Flash40 V2 (Hamamatsu) camera a Lumenecor 786

SOLA II Light Engine and a Plan-Apochromat 63x140 Oil DIC M27 (NA 14) objective 787

(Zeiss) Image acquisition was done with Zen 21 software in cyan and far-red fluorescence 788

channels (Zeiss Filter Sets 47 HE and 50) as Z-series with a step size of 250 nm and effective 789

pixel size of 103 nm Acquired image files were subsequently deconvolved (Constrained 790

Iterative Method) using a default theoretical Point Spread Function in Zen 20 (Zeiss) 791

Extraction of intensities for line profiles was performed by image thresholding the thylakoid 792

autofluorescence channel and eroding the resulting binary mask in Fiji (Schindelin et al 793

2012) 794

For immunofluorescence analysis cells were grown to mid-log phase as in the case of 795

the cells prepared for live-cell microscopy A 10-ml culture was fixed for 20 min in 37 796

formaldehyde and following extensive washing with phosphate-buffered saline (PBS) cells 797

were first permeabilized in 005 Triton-X for 20 min and then in lysis buffer (50 mM Tris-798

HCl 100 mM NaCl 5 mgml lysozyme) at 37degC for 2 h with gentle shaking To block 799

unspecific binding sites the cell pellet was incubated in 5 bovine serum albumin in PBS at 800

30degC for 1 h The αCurT serum (1500 dilution) was added to cells in fresh blocking buffer 801

for 1 h at 30degC with gentle shaking Cells were then washed three times with blocking buffer 802

and incubated with goat anti-rabbit IgG secondary antibodies conjugated to Oregon Green 488 803

(Invitrogen) (11000 dilution) under the conditions as for the primary antibodies Cells were 804

washed three times with PBS and prepared for microscopy as above Imaging was done as 805

described for live-cell microscopy except that a Colibri2 LED light source was employed for 806

illumination and a CoolSnap HQ camera (Photometrics) was used for image acquisition Cells 807

were imaged as Z-series (step size 280 nm) in the yellow and far-red fluorescent channels 808

(Zeiss Filter Sets 46 HE and 50) using the 505 nm and 625 nm LED modules Effective pixel 809

size in the final image was 102 nm Deconvolution and image analysis was done as described 810

above As judged by the staining intensity of the Oregon Green-conjugated antibodies 811

approximately half of the cells in any given field of view appeared to have been successfully 812

permeabilised a rate that is common in our experience No significant signal was detected in 813

the control sample that had not been exposed to the primary antibodies 814

815

25

Accession numbers 816

Sequence data from this article can be found in the CyanoBase and EMBLGenBank 817

data libraries under accession number slr0483 818

819

Supplemental Data 820

Supplemental Figure 1 Construction of the curT- mutant 821

Supplemental Figure 2 Growth phenotype of curT- 822

Supplemental Figure 3 Expression analysis of the open reading frame slr0482 (located 823

upstream of curT) in the curT- strain 824

Supplemental Figure 4 Absorbance spectra of curT- and wild-type cells 825

Supplemental Figure 5 High-light growth phenotypes of wild-type Synechocystis 6803 and 826

the curT- strain 827

Supplemental Figure 6 Ultrastructure of the TD41 mutant which lacks the psbA transcript 828

and the D1 protein 829

Supplemental Figure 7 Expression and localization of CurT-CFP 830

Supplemental Figure 8 Localization of CurT and CurT-CFP by fluorescence microscopy 831

Supplemental Figure 9 Chlorophyll autofluorescence of curT- 832

Supplemental Figure 10 The curT- mutant as a negative control for immunogold labeling 833

Supplemental Figure 11 Representative counts of immunogold signals 834

Supplemental Table 1 Overview of immunogold signals in curT- cells 835

Supplemental Table 2 Overview of immunogold signals in specific regions of Synechocystis 836

6803 wild-type cells 837

Supplemental Table 3 Statistical analysis of immunogold signals for wild-type 838

Synechocystis 6803 cells 839

Supplemental Table 4 Co-expression of curT 840

Supplemental Movie 1 Scan through the Z-axis of a curT-CFP cell 841

Supplemental Movie 2 Rendered 3D-model of a CurT-CFP detection 842

Supplemental Movie 3 Scan through the Z-axis of a curT-CFP cell with a traversing 843

thylakoid lamella 844

845

Acknowledgements 846

We thank Y Nishiyama for providing αpD1 and J Soll for αVIPP1 and αYidC antibodies 847

respectively and Nina Dyczmons-Nowaczyk for support with the fluorescence measurements 848

This work was supported by grants awarded to JN (Ni3909) MMN (NO 8363) and DL 849

26

(Le126529) by the Deutsche Forschungsgemeinschaft in the context of Research Unit 850

FOR2092 and the Cluster of Excellence RESOLV (EXC 1069) AG is a Howard Hughes 851

Medical Institute postdoctoral fellow in the laboratory of Erin OrsquoShea at Harvard University 852

LS was supported by a PhD fellowship from the Chinese Scholarship Council 853

854

Author Contributions 855

SH AR LS MMN DL and JN designed the research SH AR LS AG ILG EH ML BR 856

SV performed the research all authors contributed to data analysis SH AR and JN wrote the 857

paper 858

859

Competing Financial Interest statement 860

The authors declare no competing financial interests 861

862

We wish to dedicate this paper to Fabrice Rappaport an outstanding colleague and friend who 863

passed away so early 864

865

27

References 866

Allen JF de Paula WBM Puthiyaveetil S and Nield J (2011) A structural 867

phylogenetic map for chloroplast photosynthesis Trends Plant Sci 16 645-655 868

Anderson JM Horton P Kim E-H and Chow WS (2012) Towards elucidation of 869

dynamic structural changes of plant thylakoid architecture Philos Trans R Soc 870

Lond B Biol Sci 367 3515-3524 871

Armbruster U Zuumlhlke J Rengstl B Kreller R Makarenko E Ruumlhle T Schuumlnemann 872

D Jahns P Weisshaar B Nickelsen J and Leister D (2010) The Arabidopsis 873

thylakoid protein PAM68 is required for efficient D1 biogenesis and photosystem II 874

assembly Plant Cell 22 3439-3460 875

Armbruster U Labs M Pribil M Viola S Xu W Scharfenberg M Hertle AP 876

Rojahn U Jensen PE Rappaport F Joliot P Doumlrmann P Wanner G and 877

Leister D (2013) Arabidopsis CURVATURE THYLAKOID1 proteins modify 878

thylakoid architecture by inducing membrane curvature Plant Cell 25 2661-2678 879

Aseeva E Ossenbuumlhl F Sippel C Cho WK Stein B Eichacker LA Meurer J 880

Wanner G Westhoff P Soll J and Vothknecht UC (2007) Vipp1 is required for 881

basic thylakoid membrane formation but not for the assembly of thylakoid protein 882

complexes Plant Physiol Biochem 45 119-128 883

Bartsevich VV and Pakrasi HB (1995) Molecular identification of an ABC transporter 884

complex for manganese analysis of a cyanobacterial mutant strain impaired in the 885

photosynthetic oxygen evolution process EMBO J 14 1845-1853 886

Bartsevich VV and Pakrasi HB (1996) Manganese transport in the cyanobacterium 887

Synechocystis sp PCC 6803 J Biol Chem 271 26057-26061 888

Bernaacutet G Waschewski N and Roumlgner M (2009) Towards efficient hydrogen production 889

the impact of antenna size and external factors on electron transport dynamics in 890

Synechocystis PCC 6803 Photosynth Res 99 205-216 891

Boehm M Yu J Krynicka V Barker M Tichy M Komenda J Nixon PJ and Nield 892

J (2012) Subunit Organization of a Synechocystis Hetero-Oligomeric Thylakoid FtsH893

Complex Involved in Photosystem II Repair Plant Cell 24 3669-3683894

Bradford MM (1976) A rapid and sensitive method for the quantitation of microgram 895

quantities of protein utilizing the principle of protein-dye binding Anal Biochem 72 896

248-254897

28

Chang L Liu X Li Y Liu C-C Yang F Zhao J and Sui S-F (2015) Structural 898

organization of an intact phycobilisome and its association with photosystem II Cell 899

Res 25 726-737 900

Danielsson R Suorsa M Paakkarinen V Albertsson P-Aring Styring S Aro E-M and 901

Mamedov F (2006) Dimeric and monomeric organization of photosystem II 902

Distribution of five distinct complexes in the different domains of the thylakoid 903

membrane J Biol Chem 281 14241-14249 904

Daum B Nicastro D Austin J McIntosh JR and Kuumlhlbrandt W (2010) Arrangement 905

of photosystem II and ATP synthase in chloroplast membranes of Spinach and Pea 906

Plant Cell 22 1299-1312 907

Engel BD Schaffer M Kuhn Cuellar L Villa E Plitzko JM and Baumeister W 908

(2015) Native architecture of the Chlamydomonas chloroplast revealed by in situ 909

cryo-electron tomography eLife 4 e04889 910

Ford MGJ Mills IG Peter BJ Vallis Y Praefcke GJK Evans PR and McMahon 911

HT (2002) Curvature of clathrin-coated pits driven by epsin Nature 419 361-366 912

Fristedt R Willig A Granath P Cregravevecoeur M Rochaix J-D and Vener AV (2009) 913

Phosphorylation of photosystem II controls functional macroscopic folding of 914

photosynthetic membranes in Arabidopsis Plant Cell 21 3950-3964 915

Gallop JL and McMahon HT (2005) BAR domains and membrane curvature bringing 916

your curves to the BAR Biochem Soc Symp 72 223-231 917

Gibson DG (2011) Chapter fifteen - Enzymatic Assembly of Overlapping DNA Fragments 918

In Methods in Enzymology V Christopher ed (Academic Press) pp 349-361 919

Goedhart J von Stetten D Noirclerc-Savoye M Lelimousin M Joosen L Hink MA 920

van Weeren L Gadella TWJ and Royant A (2012) Structure-guided evolution of 921

cyan fluorescent proteins towards a quantum yield of 93 Nat Commun 3 751 922

Heinz S Liauw P Nickelsen J and Nowaczyk M (2016) Analysis of photosystem II 923

biogenesis in cyanobacteria Biochim Biophys Acta 1857 274-287 924

Hernaacutendez-Prieto M and Futschik M (2012) CyanoEXpress A web database for 925

exploration and visualisation of the integrated transcriptome of cyanobacterium 926

Synechocystis sp PCC6803 Bioinformation 8 634-638 927

Hernaacutendez-Prieto MA Semeniuk TA Giner-Lamia J and Futschik ME (2016) The 928

Transcriptional Landscape of the Photosynthetic Model Cyanobacterium 929

Synechocystis sp PCC6803 Sci Rep 6 22168 930

29

Huang F Fulda S Hagemann M and Norling B (2006) Proteomic screening of salt-931

stress-induced changes in plasma membranes of Synechocystis sp strain PCC 6803 932

Proteomics 6 910-920 933

Kirchhoff H (2013) Architectural switches in plant thylakoid membranes Photosynth Res 934

116 481-487 935

Klinkert B Elles I and Nickelsen J (2006) Translation of chloroplast psbD mRNA in 936

Chlamydomonas is controlled by a secondary RNA structure blocking the AUG start 937

codon Nucleic Acids Res 34 386-394 938

Klinkert B Ossenbuumlhl F Sikorski M Berry S Eichacker L and Nickelsen J (2004) 939

PratA a periplasmic tetratricopeptide repeat protein involved in biogenesis of 940

photosystem II in Synechocystis sp PCC 6803 J Biol Chem 279 44639-44644 941

Komenda J Nickelsen J Tichyacute M Praacutešil O Eichacker LA and Nixon PJ (2008) The 942

cyanobacterial homologue of HCF136YCF48 is a component of an early photosystem 943

II assembly complex and is important for both the efficient assembly and repair of 944

photosystem II in Synechocystis sp PCC 6803 J Biol Chem 283 22390-22399 945

Kopf M Klaumlhn S Scholz I Matthiessen JKF Hess WR and Voszlig B (2014) 946

Comparative analysis of the primary transcriptome of Synechocystis sp PCC 6803 947

DNA Res 21 527-539 948

Kunkel DD (1982) Thylakoid centers Structures associated with the cyanobacterial 949

photosynthetic membrane system Arch Microbiol 133 97-99 950

Liberton M Howard Berg R Heuser J Roth R and Pakrasi BH (2006) Ultrastructure 951

of the membrane systems in the unicellular cyanobacterium Synechocystis sp strain 952

PCC 6803 Protoplasma 227 129-138 953

Liberton M Saha R Jacobs JM Nguyen AY Gritsenko MA Smith RD 954

Koppenaal DW and Pakrasi HB (2016) Global Proteomic Analysis Reveals an 955

Exclusive Role of Thylakoid Membranes in Bioenergetics of a Model 956

Cyanobacterium Mol Cell Proteomics 15 2021-2032 957

Luque I and Ochoa de Alda JAG (2014) CURT1CAAD-containing aaRSs thylakoid 958

curvature and gene translation Trends Plant Sci 19 63-66 959

Marin K Stirnberg M Eisenhut M Kraumlmer R and Hagemann M (2006) Osmotic stress 960

in Synechocystis sp PCC 6803 low tolerance towards nonionic osmotic stress results 961

from lacking activation of glucosylglycerol accumulation Microbiology 152 2023-962

2030 963

Mullineaux CW (2005) Function and evolution of grana Trends Plant Sci 10 521-525 964

30

Mullineaux CW (2008) Biogenesis and dynamics of thylakoid membranes and the 965

photosynthetic apparatus In The Cyanobacteria A Herrero and E Flores eds 966

(Norfolk UK Caister Academic Press) pp 289ndash304 967

Nevo R Charuvi D Tsabari O and Reich Z (2012) Composition architecture and 968

dynamics of the photosynthetic apparatus in higher plants Plant J 70 157-176 969

Nickelsen J and Rengstl B (2013) Photosystem II assembly From cyanobacteria to plants 970

Annu Rev Plant Biol 64 609-635 971

Nickelsen J and Zerges W (2013) Thylakoid biogenesis has joined the new era of bacterial 972

cell biology Front Plant Sci 4 458 973

Nilsson F Simpson DJ Jansson C and Andersson B (1992) Ultrastructural and 974

biochemical characterization of a Synechocystis 6803 mutant with inactivated psbA 975

genes Arch Biochem Biophys 295 340-347 976

Odom WR Hodges R Chitnis PR and Guikema JA (1993) Characterization of 977

Synechocystis sp PCC 6803 in iron-supplied and iron-deficient media Plant Mol 978

Biol 23 1255-1264 979

Ossenbuumlhl F Inaba-Sulpice M Meurer J Soll J and Eichacker LA (2006) The 980

Synechocystis sp PCC 6803 Oxa1 homolog is essential for membrane integration of 981

reaction center precursor protein pD1 Plant Cell 18 2236-2246 982

Pisareva T Kwon J Oh J Kim S Ge C Wieslander Aring Choi J-S and Norling B 983

(2011) Model for Membrane Organization and Protein Sorting in the Cyanobacterium 984

Synechocystis sp PCC 6803 Inferred from Proteomics and Multivariate Sequence 985

Analyses J Proteome Res 10 3617-3631 986

Pribil M Labs M and Leister D (2014) Structure and dynamics of thylakoids in land 987

plants J Exp Bot 65 1955-1972 988

Rast A Heinz S and Nickelsen J (2015) Biogenesis of thylakoid membranes Biochim 989

Biophys Acta 1847 821-830 990

Rast A Rengstl B Heinz S Klingl A and Nickelsen J (2016) The role of Slr0151 a 991

tetratricopeptide repeat protein from Synechocystis sp PCC 6803 during Photosystem 992

II assembly and repair Front Plant Sci 7 605 993

Rengstl B Oster U Stengel A and Nickelsen J (2011) An Intermediate Membrane 994

Subfraction in Cyanobacteria Is Involved in an Assembly Network for Photosystem II 995

Biogenesis J Biol Chem 286 21944-21951 996

31

Rengstl B Knoppovaacute J Komenda J and Nickelsen J (2013) Characterization of a 997

Synechocystis double mutant lacking the photosystem II assembly factors YCF48 and 998

Sll0933 Planta 237 471-480 999

Rexroth S Mullineaux CW Ellinger D Sendtko E Roumlgner M and Koenig F (2011) 1000

The Plasma Membrane of the Cyanobacterium Gloeobacter violaceus Contains 1001

Segregated Bioenergetic Domains Plant Cell 23 2379-2390 1002

Rippka R Deruelles J Waterbury JB Herdman M and Stanier RY (1979) Generic 1003

Assignments Strain Histories and Properties of Pure Cultures of Cyanobacteria 1004

Microbiology 111 1-61 1005

Ruumltgers M and Schroda M (2013) A role of VIPP1 as a dynamic structure within 1006

thylakoid centers as sites of photosystem biogenesis Plant Signal Behav 8 e27037 1007

Sacharz J Bryan SJ Yu J Burroughs NJ Spence EM Nixon PJ and Mullineaux 1008

CW (2015) Sub-cellular location of FtsH proteases in the cyanobacterium1009

Synechocystis sp PCC 6803 suggests localised PSII repair zones in the thylakoid1010

membranes Mol Microbiol 96 448-4621011

Sandstroumlm S Park Y-I Oumlquist G and Gustafsson P (2001) CP43prime the isiA Gene 1012

Product Functions as an Excitation Energy Dissipator in the Cyanobacterium 1013

Synechococcus sp PCC 7942 Photochem Photobiol 74 431-437 1014

Schindelin J Arganda-Carreras I Frise E Kaynig V Longair M Pietzsch T 1015

Preibisch S Rueden C Saalfeld S Schmid B Tinevez J-Y White DJ 1016

Hartenstein V Eliceiri K Tomancak P and Cardona A (2012) Fiji an open-1017

source platform for biological-image analysis Nat Methods 9 676-682 1018

Schottkowski M Ratke J Oster U Nowaczyk M and Nickelsen J (2009a) Pitt a novel 1019

tetratricopeptide repeat protein involved in light-dependent chlorophyll biosynthesis 1020

and thylakoid membrane biogenesis in Synechocystis sp PCC 6803 Mol Plant 2 1021

1289-1297 1022

Schottkowski M Gkalympoudis S Tzekova N Stelljes C Schuumlnemann D Ankele E 1023

and Nickelsen J (2009b) Interaction of the periplasmic PratA factor and the PsbA 1024

(D1) protein during biogenesis of photosystem II in Synechocystis sp PCC 6803 J 1025

Biol Chem 284 1813-1819 1026

Selatildeo TT Zhang L Knoppovaaacute J Komenda J and Norling B (2016) Photosystem II 1027

Assembly Steps Take Place in the Thylakoid Membrane of the Cyanobacterium 1028

Synechocystis sp PCC6803 Plant Cell Physiol 57 878 1029

32

Spaumlt P Maček B and Forchhammer K (2015) Phosphoproteome of the cyanobacterium 1030

Synechocystis sp PCC 6803 and its dynamics during nitrogen starvation Front 1031

Microbiol 6 248 1032

Stengel A Guumlgel IL Hilger D Rengstl B Jung H and Nickelsen J (2012) Initial 1033

steps of photosystem II de novo assembly and preloading with manganese take place 1034

in biogenesis centers in Synechocystis Plant Cell 24 660-675 1035

Uniacke J and Zerges W (2007) Photosystem II assembly and repair are differentially 1036

localized in Chlamydomonas Plant Cell 19 3640-3654 1037

Uniacke J and Zerges W (2009) Chloroplast protein targeting involves localized 1038

translation in Chlamydomonas Proc Natl Acad Sci USA 106 1439-1444 1039

van de Meene AL Hohmann-Marriott M Vermaas WJ and Roberson R (2006) The 1040

three-dimensional structure of the cyanobacterium Synechocystis sp PCC 6803 Arch 1041

Microbiol 184 259-270 1042

van de Meene AML Sharp WP McDaniel JH Friedrich H Vermaas WFJ and 1043

Roberson RW (2012) Gross morphological changes in thylakoid membrane 1044

structure are associated with photosystem I deletion in Synechocystis sp PCC 6803 1045

Biochim Biophys Acta 1818 1427-1434 1046

Watanabe M and Ikeuchi M (2013) Phycobilisome architecture of a light-harvesting 1047

supercomplex Photosynth Res 116 265-276 1048

Wellburn AR and Lichtenthaler H (1984) Formulae and Program to Determine Total 1049

Carotenoids and Chlorophylls A and B of Leaf Extracts in Different Solvents In 1050

Advances in Photosynthesis Research Proceedings of the VIth International Congress 1051

on Photosynthesis Brussels Belgium August 1ndash6 1983 C Sybesma ed (Dordrecht 1052

Springer Netherlands) pp 9-12 1053

Wilde A Lunser K Ossenbuumlhl F Nickelsen J and Borner T (2001) Characterization of 1054

the cyanobacterial ycf37 mutation decreases the photosystem I content Biochem J 1055

357 211-216 1056

Wilson A Boulay C Wilde A Kerfeld CA and Kirilovsky D (2007) Light-Induced 1057

Energy Dissipation in Iron-Starved Cyanobacteria Roles of OCP and IsiA Proteins 1058

Plant Cell 19 656-672 1059

Xu M Bernaacutet G Singh A Mi H Roumlgner M Pakrasi HB and Ogawa T (2008) 1060

Properties of Mutants of Synechocystis sp Strain PCC 6803 Lacking Inorganic Carbon 1061

Sequestration Systems Plant Cell Physiol 49 1672-1677 1062

33

Yamamoto T Burke J Autz G and Jagendorf AT (1981) Bound ribosomes of Pea 1063

chloroplast thylakoid membranes location and release in vitro by high salt 1064

puromycin and RNase Plant Physiol 67 940-949 1065

Yang H Liao L Bo T Zhao L Sun X Lu X Norling B and Huang F (2014) 1066

Slr0151 in Synechocystis sp PCC 6803 is required for efficient repair of photosystem 1067

II under high-light condition J Integr Plant Biol 56 1136-1150 1068

Yeremenko N Kouřil R Ihalainen JA DHaene S van Oosterwijk N 1069

Andrizhiyevskaya EG Keegstra W Dekker HL Hagemann M Boekema EJ 1070

Matthijs HCP and Dekker JP (2004) Supramolecular Organization and Dual 1071

Function of the IsiA Chlorophyll-Binding Protein in Cyanobacteria Biochemistry 43 1072

10308-10313 1073

Zak E Norling B Maitra R Huang F Andersson B and Pakrasi HB (2001) The 1074

initial steps of biogenesis of cyanobacterial photosystems occur in plasma membranes 1075

Proc Natl Acad Sci USA 98 13443-13448 1076

Zang X Liu B Liu S Arunakumara KKIU and Zhang X (2007) Optimum 1077

Conditions for Transformation of Synechocystis sp PCC 6803 J Microbiol 45 241-1078

245 1079

Zhang L and Sakamoto W (2015) Possible function of VIPP1 in maintaining chloroplast 1080

membranes Biochim Biophys Acta 1847 831-837 1081

Zimmerberg J and Kozlov MM (2006) How proteins produce cellular membrane 1082

curvature Nat Rev Mol Cell Biol 7 9-19 1083

Zoumlfel P (1988) Statistik in der Praxis (Stuttgart Germany Gustav Fischer Verlag) 1084

1085

34

Figure Legends 1086

Figure 1 General characteristics of CurT A) Sequence alignment of CurT and CURT1A-D 1087

from A thaliana Predicted chloroplast transit-peptide sequences of CURT1A-D are omitted 1088

(Armbruster et al 2013) Positions of predicted C-terminal transmembrane domains (TDM) 1089

are marked (black bar) as is the position of the predicted amphipathic N-terminal helix in 1090

CurT (red bar) The green bar denotes the peptide sequence used for antibody production 1091

Identical and related amino acids that are conserved in 100 80 and 60 of the sequences 1092

are highlighted in black dark grey and light grey respectively B) Helical-wheel 1093

representation of the N-terminal amphipathic helix of CurT (red bar in A) The color code 1094

reflects the physicochemical properties of amino-acid side-chains green polar and 1095

uncharged blue polar and positively charged red polar and negatively charged yellow 1096

hydrophobic C) Solubility of CurT Membrane-associated proteins (50 microg) from wild-type 1097

cells were extracted with 5 mM HEPES (pH 76) containing either 1 M NaCl 01 M Na2CO3 1098

4 M urea 01 Triton X-100 or no additional solute After separation of membrane-bound 1099

(M) and solubilized (S) proteins by centrifugation proteins were fractionated by SDS-PAGE1100

and CurT was immunodetected on immunoblots As a control the integral membrane protein 1101

CP47 from PSII was analyzed in parallel D) Transmission electron micrographs of negatively 1102

stained liposomes Cell-free expression (CFE) of CurT and A thaliana CURT1A was 1103

performed in the presence of liposomes similar in composition to the lipids of the thylakoid 1104

membrane Liposomes before and after cell-free protein expression in the absence of DNA 1105

served as negative controls Black arrowheads indicate tubular connections between 1106

liposomes Scale bars 250 nm 1107

1108

Figure 2 Ultrastructural analysis of curT- cells Transmission electron micrographs of typical 1109

wild-type (A) and curT- (B-D) Synechocystis 6803 cells taken at 44000times (A B) and 28000times 1110

(C D) magnification respectively Ultrathin sections (35 to 45 nm) of cryofixed samples 1111

were stained with osmium tetroxide and post-stained using lead citrate Arrowheads indicate 1112

biogenesis centers Scale bars 200 nm (A B) and 500 nm (C D) respectively 1113

1114

Figure 3 Accumulation of components of photosynthetic complexes in the curT- mutant A) 1115

Whole cell extracts (30 microg protein) from wild-type and curT- strains were fractionated by 1116

SDS-PAGE and analyzed on immunoblots using the indicated antibodies B) The histogram 1117

shows levels of the indicated proteins in curT- extracts relative to wild-type samples (dashed 1118

red line) Data are means plusmn SD of three independent experiments Significant differences from 1119

35

wild-type protein levels according to Studentrsquos t-test with error probabilities of 5 and 1 1120

are indicated by and respectively 1121

1122

Figure 4 P700+ reduction kinetics and high-light effects in curT- cells A) Averaged traces 1123

(10 single measurements) of P700+ decay after complete oxidation by a 50-ms multiple 1124

turnover pulse (10000 micromol photons m-2 s-1) in the absence and presence of 10 microM DCMU 1125

B) Rate constants for P700+ reduction were obtained by fitting of the data with single1126

exponential functions Error bars indicate the SD of three independent measurements C) 1127

Impact of light intensity on the (relative) electron transport rate (rETR) Cells were exposed to 1128

gradually increasing light intensities which resulted in increasing electron transport until the 1129

capacity limit was reached PAR light intensity (micromol photons m-2 s-1) Error bars indicate the 1130

SD of three independent measurements D) D1 protein level in wild-type and curT- after high-1131

light treatment (800 micromol photons m-2s-1) in the presence and absence of lincomycin Samples 1132

were taken every 30 min and processed as in Figure 3 to determine the level of D1 present 1133

100 refers to wild-type D1 level at the beginning of the experiment 1134

1135

Figure 5 PSII assembly in curT- cells A) BNSDS-PAGE of membrane proteins Membrane 1136

fractions from wild-type and curT- cells were solubilized with 13 n-dodecyl-β-maltoside 1137

and proteins were fractionated by two-dimensional BNSDS-PAGE blotted and probed with 1138

antibodies against the PSII subunits D1 D2 CP47 and CP43 Wild-type blots were also 1139

probed with the αCurT antibody The sizes of marker proteins and the positions of PSII 1140

assembly intermediates (RCCII RCCI RC47) are shown above and below each image B) In 1141

vivo pulse labeling of membrane proteins with 35S Pulse-labeled PSII core proteins were 1142

separated via BNSDS-PAGE and visualized by autoradiography 1143

1144

Figure 6 Loss of CurT induces stress A) Low-temperature (77 K) fluorescence emission of 1145

Synechocystis 6803 wild-type (blue) and curT- (red) cells excited at 440 nm The spectra were 1146

normalized to the added fluorescein standard B) Low-temperature (77 K) fluorescence 1147

emission of Synechocystis 6803 wild-type (blue) and curT- (red) excited at 580 nm The 1148

spectra were normalized to 780 nm C) Level of IsiA in the curT- mutant relative to the wild-1149

type A mean value of 368 plusmn 96 (SD) was determined from three independent experiments 1150

1151

Figure 7 Membrane sublocalization of PSII-related factors Cell extracts from wild-type and 1152

curT- cells were fractionated by two consecutive rounds of sucrose-density gradient 1153

36

centrifugation (Schottkowski et al 2009b) The second linear gradient (20-60 sucrose) was 1154

apportioned into 14 fractions which were analyzed by immunoblotting using the indicated 1155

antibodies Fractions 1ndash6 represent PDMs and fractions 7ndash14 thylakoid membranes (TMs) 1156

To facilitate comparison between gradients sample volumes were normalized to the volume 1157

of fraction 7 that contained 40 microg of protein 1158

1159

Figure 8 Live-cell imaging of the curT-CFP strain by fluorescence microscopy In the curT-1160

CFP strain the native curT gene has been replaced by a CFP-tagged version resulting in the 1161

expression of the CurT-CFP fusion protein under the control of the native promotor A) 1162

Close-up views of the mid-cell plane in the CFP and far-red autofluorescence channels shown 1163

in slice 7 in panel B B) Synechocystis 6803 cells expressing CurT C-terminally fused to the 1164

mTurquoise2 variant of CFP from its native chromosomal promoter The two imaging 1165

channels are displayed as Z-axis montages (auto-scaled contrast step size 250 nm) in 1166

grayscale and color composite configuration The thylakoid autofluorescent channel as 1167

imaged in far-red fluorescence is depicted in magenta and CurT signal as imaged in cyan 1168

fluorescence is depicted in cyan C) Fluorescence intensity profiles of the two channels along 1169

the autofluorescent peripheral cell ldquoringrdquo are shown for slice 7 The maximum projection of 1170

the entire Z montage is also shown Scale bars (light grey) 2 microm 1171

1172

Figure 9 Immunofluorescence detection of CurT A) Close-ups of slice 5 in panel B B) 1173

Wild-type Synechocystis 6803 cells labeled with αCurT antibodies and detected with Oregon 1174

Green-conjugated secondary antibodies The Z-axis montages are shown as in Figure 8B 1175

except that the step size is 280 nm (1 to 10) C) Intensity profiles of the two channels along 1176

the autofluorescent peripheral cell ldquoringrdquo are shown for slice 5 The maximum projection of 1177

the entire Z montage is also shown Scale bars (light grey) 2 microm 1178

1179

Figure 10 Subcellular localization of CurT Ultrathin sections of wild-type Synechocystis 1180

6803 cells were incubated with rabbit αCurT prior to incubation with gold-conjugated goat 1181

anti-rabbit IgG A) Negative control (wild-type processed without addition of primary 1182

antibody) B C) Immunogold-labeled sections showing CurT localization at the cytoplasmic 1183

side of the thylakoid membrane D) Cluster formation of CurT signals at a putative biogenesis 1184

center from C E) Biogenesis center from the same cell (C) without any obvious CurT 1185

clustering of gold particles F) Schematic depiction of a wild-type cell (from Figure 2A) with 1186

color-coded curved membranes green = thylakoids that follow the curvature of the cell red = 1187

37

thylakoids that bend away from the plasma membrane yellow = thylakoids that bend toward 1188

the plasma membrane to converge on sites of biogenesis centers G) Relative distribution of 1189

gold signals between convex (dark color) and concave (light color) sides of membranes (n = 1190

1584 signals from a total of 95 cells) The undifferentiated overall signal distribution is given 1191

in blue Bars = 200 nm (overview) and 100 nm (details) 1192

1193

Figure 11 Differentially modified forms of CurT are found in different complexes in PDMs 1194

and thylakoid membranes Samples were isolated by fractionation of wild-type membranes 1195

via two consecutive sucrose density gradients according to Schottkowski et al (2009b) After 1196

density centrifugation samples were applied to BNSDS-PAGE analysis (A) or isoelectric 1197

focusing (B) Numbers on the right indicate the respective fraction from the second gradient 1198

(see Figure 7) Fraction 5 represents the PDMs and fraction 9 the thylakoid membrane 1199

1200

Figure 12 Loss of CurT increases sensitivity to abiotic stress A B) Doubling times of wild-1201

type and curT- under salt stress (A) or osmotic stress (B) Doubling times are means plusmn SD of 1202

three independent cultures C) Localization of CurT-CFP under salt and osmotic stress 1203

Samples were examined as described in Figure 8 Scale bars 1 microm D) Protein levels of wild-1204

type cells after growth in BG11 medium containing 500 mM NaCl Samples were analyzed on 1205

the same gel but unrelated samples between the presented signals were omitted E) 1206

Membrane preparations obtained from wild-type cells wild-type cells grown in the presence 1207

of 500 mM NaCl and curT- cells were subjected to the first gradient step in the membrane 1208

fractionation scheme The gradient was divided into five fractions and 10 of fractions I-IV 1209

and 02 of fraction V were analyzed by SDS-PAGE Fraction II includes the plasma 1210

membrane and fraction V consists of PratA-defined membrane and thylakoid membrane 1211

1212

Figure 13 Model of CurT distribution at convergence zones in Synechocystis 6803 The 1213

distribution of CurT in thylakoid (green) and plasma membranes (brown) is shown The 1214

pattern of localization of CurT in the thylakoid membrane is derived from membrane 1215

fractionation via sucrose density centrifugation fluorescence-based detection of the CurT-1216

CFP fusion and endogenous CurT and immunogold labeling experiments (Figures 7-10) The 1217

different CurT variants a b c and d identified in the IEF experiments (Figure 11) are depicted 1218

in yellow pink blue and black respectively CurT present in the plasma membrane is 1219

highlighted in gray as its precise nature and role remain to be defined (Figure 12) 1220

Membranes are represented as lipid bilayers Convex and concave faces of bent thylakoid 1221

38

sheets are indicated by black arrows The PDM which is dedicated to PSII assembly and 1222

repair is depicted in blue The dotted blue line emphasizes that the ultrastructure in this region 1223

has not yet been fully resolved PP periplasm PM plasma membrane TM thylakoid 1224

membrane L lumen PDM PratA-defined membrane 1225

1226

Tables 1227

Table 1 Physiological characteristics of the curT- mutant 1228

Strain Doubling time [h]

Oxygen Evolution[nmol h-1 OD750

-1]c

Chlorophyll content

[microg OD750-1]

d

Cell size [microm]e

Cell number [ml-1 OD750

-1]f

Wild type 817plusmn017a 1600plusmn042

b 1933plusmn187 251plusmn014 264plusmn020 390plusmn006 x 107

curT- 1259plusmn020a 3226plusmn056

b 1074plusmn20 195plusmn029 274plusmn044 367plusmn016 x 107

1229 abDoubling times in the presence (a) or absence (b) of 5 mM glucose measured under 1230

continuous illumination at 30 micromol photons m-2 s-1 and CO2-limiting conditions cOxygen 1231

evolution is expressed in nmol O2 produced per hour per OD750 unit dChlorophyll content is 1232

expressed in microg OD750-1 eThe diameter of non-dividing cells is presented in microm fCell number 1233

was determined per ml per OD750 Data are means plusmn SD of at least three independent 1234

experiments 1235

1236

Parsed CitationsAllen JF de Paula WBM Puthiyaveetil S and Nield J (2011) A structural phylogenetic map for chloroplast photosynthesisTrends Plant Sci 16 645-655

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Anderson JM Horton P Kim E-H and Chow WS (2012) Towards elucidation of dynamic structural changes of plant thylakoidarchitecture Philos Trans R Soc Lond B Biol Sci 367 3515-3524

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Armbruster U Zuumlhlke J Rengstl B Kreller R Makarenko E Ruumlhle T Schuumlnemann D Jahns P Weisshaar B NickelsenJ and Leister D (2010) The Arabidopsis thylakoid protein PAM68 is required for efficient D1 biogenesis and photosystem IIassembly Plant Cell 22 3439-3460

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Armbruster U Labs M Pribil M Viola S Xu W Scharfenberg M Hertle AP Rojahn U Jensen PE Rappaport F JoliotP Doumlrmann P Wanner G and Leister D (2013) Arabidopsis CURVATURE THYLAKOID1 proteins modify thylakoid architectureby inducing membrane curvature Plant Cell 25 2661-2678

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Aseeva E Ossenbuumlhl F Sippel C Cho WK Stein B Eichacker LA Meurer J Wanner G Westhoff P Soll J andVothknecht UC (2007) Vipp1 is required for basic thylakoid membrane formation but not for the assembly of thylakoid proteincomplexes Plant Physiol Biochem 45 119-128

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Bartsevich VV and Pakrasi HB (1995) Molecular identification of an ABC transporter complex for manganese analysis of acyanobacterial mutant strain impaired in the photosynthetic oxygen evolution process EMBO J 14 1845-1853

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Bartsevich VV and Pakrasi HB (1996) Manganese transport in the cyanobacterium Synechocystis sp PCC 6803 J Biol Chem271 26057-26061

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Bernaacutet G Waschewski N and Roumlgner M (2009) Towards efficient hydrogen production the impact of antenna size andexternal factors on electron transport dynamics in Synechocystis PCC 6803 Photosynth Res 99 205-216

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Boehm M Yu J Krynicka V Barker M Tichy M Komenda J Nixon PJ and Nield J (2012) Subunit Organization of aSynechocystis Hetero-Oligomeric Thylakoid FtsH Complex Involved in Photosystem II Repair Plant Cell 24 3669-3683

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Bradford MM (1976) A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle ofprotein-dye binding Anal Biochem 72 248-254

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Chang L Liu X Li Y Liu C-C Yang F Zhao J and Sui S-F (2015) Structural organization of an intact phycobilisome and itsassociation with photosystem II Cell Res 25 726-737

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Danielsson R Suorsa M Paakkarinen V Albertsson P-Aring Styring S Aro E-M and Mamedov F (2006) Dimeric andmonomeric organization of photosystem II Distribution of five distinct complexes in the different domains of the thylakoidmembrane J Biol Chem 281 14241-14249

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Daum B Nicastro D Austin J McIntosh JR and Kuumlhlbrandt W (2010) Arrangement of photosystem II and ATP synthase in

4

efficient thylakoid system in cyanobacteria as well as having a critical role in the response to 110

osmotic stress 111

112

Results 113

Inactivation of curT affects membrane architecture 114

The open reading frame slr0483 encodes the only CURT1-like protein expressed in the 115

cyanobacterium Synechocystis 6803 The corresponding cyanobacterial gene was previously 116

named synCURT1 to emphasize its homology to CURT1 from Arabidopsis thaliana 117

(Armbruster et al 2013 Luque and Ochoa de Alda 2014) However in conformity with 118

conventional nomenclature for bacterial genes we adopt the name lsquocurTrsquo The CurT protein is 119

predicted to comprise 149 amino acids and contains within its C-terminal half two putative 120

transmembrane domains (TMDs) which exhibit a high degree of sequence similarity with the 121

Arabidopsis CURT1A-D proteins The N-terminal half shows less similarity to its 122

Arabidopsis counterparts but it harbors a predicted amphipathic α-helix (amino acids 46-62) 123

that has been implicated in membrane bending (Figure 1A and 1B Armbruster et al 2013) 124

Interestingly the TMDs of CURT homologs share sequence and structural features with a 125

domain that is found in some thylakoid-associated cyanobacterial aminoacyl-tRNA 126

synthetases and has been hypothesized to be involved in mediating the unusual membrane 127

attachment of these enzymes (Luque and Ochoa de Alda 2014) 128

To verify the predicted membrane association of CurT total membranes from wild-129

type cells were exposed to various agents and the solubility of CurT was assessed using an 130

antibody directed against a fragment comprising its first 58 N-terminal amino acids (Figure 131

1A) We first confirmed that CurT can be detected in the membrane fractions of cell lysates 132

and exposure to 01 M Na2CO3 4 M urea or 1 M NaCl failed to extract it as would be 133

expected for a membrane-bound protein (Figure 1C) Indeed treatment of the cell lysate with 134

the non-ionic detergent Triton X-100 rendered CurT soluble as was the case for the PSII 135

inner antenna protein CP47 ndash an integral membrane protein with six transmembrane α-helices 136

(Figure 1C) Thus CurT like its Arabidopsis counterparts is likely to be an integral 137

membrane protein 138

To test whether the cyanobacterial CurT has similar membrane-tubulating properties to 139

CURT1A of A thaliana we used the same liposome-based assay to probe its ability to form 140

tubules (Armbruster et al 2013) We expressed CurT in vitro using a cell-free extract 141

supplemented with liposomes similar in composition to the thylakoid membrane 142

Subsequently liposome topology was visualized by transmission electron microscopy (TEM 143

5

Figure 1D) Like the grana-forming CURT1A its Synechocystis 6803 homolog efficiently 144

induced localized ldquocompressionrdquo of liposomes into thin tubule-like segments revealing its 145

strong membrane-curving activity (Figure 1D) Hence the membrane-shaping function of 146

members of the CURT1 family is conserved from cyanobacteria to plants Nevertheless 147

liposome shapes caused by either CurT or CURT1A displayed some differences in the degree 148

of membrane tubulation These might be due to the variable N-termini of both proteins 149

(Figure 1D) 150

To dissect the function of CurT in vivo we generated a knock-out mutant by inserting 151

a kanamycin-resistance cassette into the unique AgeI site in the slr0483 reading frame 152

(Supplemental Figure 1A Methods) Complete segregation of the mutation was confirmed by 153

PCR and immunoblot analyses (Supplemental Figure 1B and 1C) Progressively higher levels 154

of antibiotic (up to 400 microg kanamycinml) were used for mutant selection as previous 155

attempts to select a fully segregated curT- mutant had been unsuccessful probably due to 156

application of insufficient selection pressure (Armbruster et al 2013) When growth rates of 157

wild-type and mutant cells were compared 20- and 15-fold increases in doubling time were 158

observed for curT- grown under photoauto- and photoheterotrophic conditions respectively 159

(Table 1 Supplemental Figure 2) 160

Strikingly curT inactivation also led to loss of competence for DNA uptake during 161

both transformation and conjugation-based experiments Hence attempts to complement the 162

curT- mutant were not applicable However in the course of the work four independent 163

rounds of transformation of wild-type cells were carried out to generate fresh curT- mutants 164

All mutant strains obtained the same phenotype strongly suggesting that no secondary sites 165

were involved in its establishment To rule out the possibility that read-through transcription 166

from the resistance marker gene affects the upstream reading frame slr0482 (of unknown 167

function) in the mutant RT-PCR with appropriate primers was performed (Supplemental 168

Figure 3) No change in slr0482 mRNA accumulation was observed confirming that the curT- 169

phenotype is caused by disruption of the curT gene In agreement with this finding recent 170

transcriptome analyses of Synechocystis 6803 have clearly shown that the curT mRNA is 171

monocistronic (Kopf et al 2014) 172

In view of CurTrsquos in vitro membrane-tubulating activity the ultrastructure of the curT- 173

mutant was examined by TEM As shown in Figure 2A the wild-type strain exhibits the 174

typical thylakoid organization with ordered thylakoid sheets at the cell periphery and 175

convergence zones next to the plasma membrane In contrast massive disorganization of the 176

thylakoid membrane system was observed in curT- In all cells analyzed the mutant 177

6

thylakoids appeared as disordered sheets that traversed the cytoplasm and completely lacked 178

the typical convergence zones with the corresponding biogenesis centers at the periphery 179

(Figures 2B-D) This indicates a strict requirement of CurT for the establishment of normal 180

thylakoid membrane architecture in Synechocystis 6803 181

182

Inactivation of curT affects photosynthetic performance 183

The severely altered morphology of the thylakoid membrane system in curT- cells and 184

in particular the lack of PSII-related biogenesis centers prompted us to investigate the 185

photosynthetic performance of the mutant (Stengel et al 2012) The chlorophyll content was 186

reduced by ~20 and absorption spectroscopy also revealed a reduction in phycobilisomes 187

as well as an increase in carotenoid levels (Table 1 Supplemental Figure 4) Despite changes 188

in ultrastructure and pigment levels size and number of curT- cells at OD750 were not 189

significantly different as judged by t-test-based statistical analysis (Table 1) 190

To explore the photosynthetic defects of the mutant in detail immunoblot analyses 191

were performed using antibodies raised against specific subunits of photosynthetic complexes 192

and some of their biogenesis factors In curT- PSII reaction-center subunits including D1 D2 193

CP47 and CP43 were found to be present at 44 42 56 and 45 of the wild-type level 194

respectively (Figure 3) Interestingly amounts of the PSII assemblyrepair factors PratA and 195

Slr0151 as well as the light-dependent protochlorophyllide oxidoreductase (POR) enzyme 196

were also reduced (Figure 3 Yang et al 2014 Rast et al 2016) Levels of the Pitt protein 197

which interacts with POR (Schottkowski et al 2009a) and the Oxa homolog YidC 198

(Ossenbuumlhl et al 2006) were slightly increased in curT- (Figure 3) On the other hand 199

Sll0933 the homolog of the PSII assembly factor PAM68 in A thaliana accumulated to 200

250 of the wild-type level (Armbruster et al 2010) In contrast amounts of both Cytf and 201

PsaA which serve as markers for the Cyt(b6f) and PSI complexes respectively the RbcL 202

subunit of the Rubisco enzyme the PSII assembly factor Ycf48 (Komenda et al 2008) and 203

VIPP1 remained unaltered in curT- (Figure 3) Overall the alterations in protein accumulation 204

indicate that loss of CurT preferentially affects the accumulation of PSII 205

This result was further corroborated by analysis of the photosynthetic performance of 206

curT- The rate of light-dependent oxygen evolution was reduced by approximately 50 in the 207

mutant (Table 1) and analysis of P700+ reduction kinetics revealed impaired electron donation 208

by PSII (Figure 4A) PSII-driven P700+ reduction is slowed down by a factor of three in curT-209

whereas the residual cyclic electron transfer activity in the presence of DCMU is less than 210

5 in both wild-type and curT- (Figure 4B) In contrast the light intensity-dependent electron 211

7

transfer capacity which was measured as relative electron transfer rate (rETR) did not differ 212

significantly between wild-type and curT- (Figure 4C) Both wild-type and curT- cells reach a 213

capacity limit at ~ 250 micromol photons m-2s-1 and the decay of rETR beyond the capacity limit 214

is very similar These results indicate that the point of onset of PSII-related photoinhibition is 215

the same in both strains which in turn implies that electron flow downstream of PSII is 216

unchanged in the mutant 217

Low PSII levels in curT- could be caused either by reduced synthesisbiogenesis or its 218

enhanced degradation To measure the rates of D1 repair the kinetics of D1 accumulation 219

upon induction of photoinhibition by high-light treatment (800 micromol photons m-2s-1) was 220

assayed by immunological means (Figure 4D) In wild-type cells the D1 level decreased to 221

60 (relative to the initial time point) after 90 min of treatment As previously shown the 222

drop is much more pronounced (~35 left) when repair synthesis of D1 is inhibited by the 223

addition of lincomycin (Figure 4D Komenda et al 2008) Surprisingly in curT- the level of 224

residual D1 is rather stable over the same time period and lincomycin treatment induces a 225

more modest decrease to 60 relative to the initial time point (Figure 4D) These data clearly 226

indicate that in absence of CurT residual D1 is less susceptible to degradation even though 227

its absolute amount is reduced In line with this no effect on growth rates was observed when 228

either wild-type or curT- cells were cultivated for two days at 200 micromol photons m-2s-1 229

(Supplemental Figure 5) 230

To assess the role of CurT in the assembly of PSII we compared the two-dimensional 231

profiles of thylakoid membrane proteins from wild-type and mutant cells by Blue-Native 232

(BN)SDS-PAGE PSII assembly intermediates were subsequently visualized via 233

immunodetection of PSII core subunits As shown in Figure 5A dimeric PSII core complexes 234

(RCCII) are drastically underrepresented in curT- whereas relative levels of earlier assembly 235

intermediates including the monomeric CP43-less RC47 complex and non-assembled CP43 236

increase Parallel detection of CurT itself revealed a ldquosmearedrdquo signal in the size range from 237

15 up to 500 kDa suggesting that CurT forms part of high-molecular-weight complexes 238

(Figure 5A) Finally in vivo 35S protein pulse-labeling experiments confirmed that RC and 239

RC47 complexes in particular are efficiently formed in curT- but the transition to RCCI 240

complexes is severely delayed (Figure 5B) As a consequence dimeric RCCII complexes do 241

not incorporate any radioactive label over the experimentrsquos time course of 25 min (Figure 5B) 242

Taken together these data show that curT inactivation has a severe impact on PSII biogenesis 243

but little or no effect on the degradation of the complex 244

8

The data presented so far suggest a PSII-related phenotype for curT- so we explored 245

the effects of curT disruption on photosynthesis further by comparing the low-temperature 246

(77K) fluorescence emission spectra in cell suspensions following excitation of chlorophyll at 247

440 nm (Figure 6A) The signals were normalized to the emission maximum at 514 nm of the 248

external standard fluorescein (Figure 6A) In curT- the PSI emission peak amplitude was 249

similar to that of the wild-type (Figure 6A) The spectra differed however around 685 nm 250

Here we observed an increase in fluorescence in the mutant strain an emission signature that 251

is probably related to the inner antenna protein CP43 (Figure 6A Nilsson et al 1992) 252

Increased chlorophyll fluorescence at 685 nm has previously been shown to be characteristic 253

for cells that are accumulating the stress-induced IsiA protein which shares structural 254

similarities with CP43 (Odom et al 1993 Yeremenko et al 2004 Wilson et al 2007) A 255

second indication for accumulation of IsiA is a diagnostic blue shift of the 725 nm 256

fluorescence peak by approximately 5 nm which is indeed observed in the curT- spectrum 257

(Figure 6A Sandstroumlm et al 2001) We therefore determined the level of IsiA in both wild-258

type and curT- by immunoblot analysis As expected IsiA was strongly induced in curT- 259

suggesting that the mutant suffers from severe stress (Figure 6C) When fluorescence at 77K 260

was recorded after excitation at 580 nm which mainly excites the phycobiliproteins the 261

signal at 685 nm (PSII related) was enhanced in the curT- mutant most likely reflecting IsiA 262

emission andor the presence of uncoupled phycobilisomes (Figure 6B Wilson et al 2007) 263

In contrast the 725 nm peak (PSI related) was reduced in curT- relative to the wild-type 264

suggesting less coupling of phycobilisomes to PSI (Figure 6B) The increase in uncoupled 265

phycobilisomes can be directly attributed to the reduction in RCCII levels found in the curT- 266

mutant (Figure 5A) since phycobilisomes are attached to PSII dimers for efficient light 267

harvesting (Watanabe and Ikeuchi 2013 Chang et al 2015) 268

Thus the curT- mutant exhibits a characteristic set of photosynthetic defects The 269

primary target of the CurT membrane-shaping function appears to be PSII in particular in its 270

biogenic phase However the reduction in PSII content cannot be responsible for the lack of 271

thylakoid convergence zones at the plasma membrane because these structures can still be 272

observed in the psbA- mutant TD41 which is lacking D1 and therefore unable to assemble any 273

PSII complexes (Supplemental Figure 6 Nilsson et al 1992) 274

275

Subcellular localization of CurT 276

We have previously proposed that the initial steps in PSII assembly take place in 277

biogenesis centers located at the interface between plasma and thylakoid membranes (Stengel 278

9

et al 2012) These biogenic membranes (PDMs) are marked by the PSII Mn2+ delivery factor 279

PratA and can be separated from thylakoids by a two-step sucrose-gradient centrifugation 280

procedure (Schottkowski et al 2009b Rengstl et al 2011) When the distributions of various 281

proteins within such membrane fractions from the wild-type and curT- were compared two 282

striking changes were detected in the mutant First the precursor of the D1 subunit of PSII 283

(pD1) is absent from PDMs in the mutant and secondly the inner antenna protein CP47 ndash but 284

not CP43 ndash of PSII shifts towards fractions of lower density (Figure 7) Hence the 285

organization of PDMs appears to be perturbed in curT- In wild-type cells most of the CurT 286

protein was found in thylakoid membranes only a minor fraction similar in amount to that of 287

the PSII assembly factors Ycf48 Pitt and YidC as well as the VIPP1 protein comigrated with 288

PDMs (Figure 7) According to rough estimates based on densitometric signal analysis 25 289

of total cellular CurT is normally found in the PDMs and 75 in the thylakoids (Figure 7) 290

To further analyze the localization of CurT in its cellular context in vivo we 291

constructed a translational fusion in which the monomeric enhanced cyan fluorescent protein 292

(CFP) mTurquoise2 (Goedhart et al 2012) is attached to the C-terminus of CurT and is 293

expressed under the control of the native curT promoter The resulting strain curT-CFP 294

showed a fully restored wild-type growth phenotype indicating that the CFP tag does not 295

affect CurTrsquos function (Supplemental Figure 7A) In agreement with this the fusion protein 296

accumulated to wild-type levels (96 plusmn 16 Supplemental Figure 7B) and localized to the 297

same membrane sub-fractions as does native CurT (Supplemental Figure 7C) The CurT-CFP 298

fluorescence signal was distinctly discernible above the wild-type autofluorescence 299

background (Supplemental Figure 8A) and was distributed in a network-like pattern with 300

concentrated areas at the cell periphery at mid-plane Analysis of CurT-CFP fluorescence in 301

Z-axis montages revealed that these signals often appeared as rod-like structures which 302

seemed to follow the spherical inner surface of the cell (Figure 8A B Supplemental Movie 1 303

and 2) In some cases these structures also appear to extend through the cytoplasm (Figure 304

8A and 8B Supplemental Movie 3) 305

When chlorophyll autofluorescence indicative of thylakoid membranes was visualized 306

in the same cell only a partial overlap with the CurT-CFP signal was observed (Figure 8 307

Supplemental Movie 1-3) Strikingly the peripheral CurT-CFP signals frequently reached 308

their maximal intensity in those areas where chlorophyll fluorescence was low ie where 309

thylakoid convergence zones are expected to form (Sacharz et al 2015) This becomes even 310

clearer when the intensity of a circumferential profile that follows the thylakoidrsquos 311

10

fluorescence signal is quantified separately for each of the two fluorescent channels (Figure 312

8C) 313

In contrast the chlorophyll autofluorescence in the curT- mutant seems to be evenly 314

distributed (Supplemental Figure 9) Following the fluorescence in an intensity profile as in 315

curT-CFP no regions with a similar decline in fluorescence were found most likely due to 316

the absence of biogenesis centers In addition some circular structures presenting chlorophyll 317

autofluorescence were detected in the interior of the cells Hence the disturbed curT- 318

ultrastructure is also reflected in the distribution of chlorophyll pigments (Supplemental 319

Figure 9) 320

To confirm the network-like distribution of CurT-CFP in the cell we used 321

immunofluorescence to detect CurT in the wild-type in situ Synechocystis 6803 cells were 322

fixed and treated with the αCurT antibody and an Oregon Green-conjugated secondary 323

antibody As shown in Figure 9A and B both techniques revealed similar network-like 324

patterns of the CurT signal which coalesced into rod-like structures at the cell surface and 325

essentially filled up the gaps between the autofluorescent thylakoid regions (negative controls 326

shown in Supplemental Figure 8B and 8C) Again regions of low chlorophyll fluorescence 327

typical of biogenesis centers generally exhibited stronger CurT-related fluorescence (Figure 328

8C) Occasionally CurT-CFP signals were also observed near traversing thylakoid lamellae 329

(when these were present in the cell analyzed) but the autofluorescence intensity of such 330

thylakoids is much weaker (see Figure 8B cell b in slice 6 and Supplemental Movie 3) 331

Finally CurT was localized by immunogold labeling experiments on ultrathin sections 332

of wild-type Synechocystis 6803 cells Almost no signals were detected when wild-type and 333

curT- sections were processed in the absence of the primary antibody as a negative control 334

(Figure 10A and Supplemental Figure 10A respectively) When mutant curT- cells were 335

processed in the presence of the αCurT antiserum a low level of randomly distributed 336

background signals was observed (Supplemental Figure 10B Supplemental Table 1) 337

However the number of signals located at the thylakoid membrane was clearly reduced 338

relative to the wild-type Therefore these signals were treated as non-specific background 339

Upon incubation of wild-type cell sections with antibodies directed against the N-terminus of 340

CurT (Figure 1A) the antigen was detected on the cytoplasmic surface of thylakoid 341

membranes (Figure 10B and 10C) This strongly suggests that its N-terminus is oriented 342

towards the cytoplasm Overall CurT signals appeared to be distributed along both thylakoids 343

and PDMs This agrees with the broad distribution of CurT across various fractions in the 344

membrane fractionation experiments (Figure 7) In only a few cases (12 ) however was 345

11

some clustering of immunogold signals at thylakoid convergence regions found (Figure 10D 346

and 10E) Thus the high local concentration of CurT at biogenic centers seen in the 347

fluorescence-based approaches (Figures 8 and 9) was not quantitatively reflected in the 348

immunogold labeling data This is likely due to the fact that immunogold electron microscopy 349

can only detect antigens on the surface of the section This issue is further complicated by the 350

heterogeneity of the CurT assemblies (see below and Discussion section) 351

Nevertheless closer inspection of the immunogold signals revealed an asymmetric 352

distribution of CurT signals with regard to the two faces of thylakoid sheets As illustrated in 353

Figure 10G curved thylakoid sheets possess a longer convex and a shorter concave face 354

When we analyzed a total of approximately 1500 CurT immunogold signals (from a total of 355

95 cells) which were unambiguously located to one side of the thylakoid membrane (for a 356

representative example see Supplemental Figure 11) 561 were found to be located at the 357

convex face while the other 439 localized to the concave side (Figure 10G Supplemental 358

Table 2) When differently curved regions (Figure 10F) including thylakoid lamellae (i) that 359

follow the overall shape of the cell (green) (ii) bend away from the plasma membrane (red) or 360

(iii) towards it ie where thylakoids converge to form biogenesis centers (yellow) were 361

examined separately red and green regions showed a CurT distribution in the range of 55 362

convex to 45 concave (Figure 10G Supplemental Table 2) However at the biogenesis 363

centers (the regions highlighted in yellow in Figure 10F) the uneven distribution of the 364

immunogold signals was more pronounced 61 of signals were found on the convex side 365

and 39 on the concave face of thylakoid lamellae (Figure 10G Supplemental Table 2) 366

Statistical analyses confirmed the significance of these differences in signal distributions 367

along the thylakoid membrane types (Supplemental Table 3) 368

Taken together with the finding that CurT is required for the formation of the 369

convergence sites forming biogenesis centers these data are consistent with the idea that the 370

thylakoid sheets are shaped by CurT which induces membrane curvature via asymmetric 371

intercalation on the two sides of thylakoid sheet 372

373

Different forms of CurT are found in PDMs and thylakoids 374

CurT was found to localize to both highly curved PDMs and less bent thylakoids Its 375

high local concentration at biogenic centers as seen in the fluorescence-based approaches 376

suggests a dosage-dependent effect of CurT on membrane shaping An alternative possibility 377

is that different CurT variants might exist in the two membrane types which could potentially 378

serve different functions To explore this possibility we asked whether CurT is found in 379

12

different complexes by using 2D BNSDS-PAGE to characterize membrane material isolated 380

via two-step sucrose gradient centrifugation (see Figure 7) In accordance with the data in 381

Figure 5A we find several low-molecular-weight complexes containing CurT (Figure 11A) 382

Smaller complexes of ~80 (complex I) and ~100 kDa (complex II) accumulate in membrane 383

fraction 5 (representing PDMs) but these are far less prevalent in fraction 9 representing 384

thylakoids (Figure 11A) In addition CurT-containing sub-complexes of ~140 (complex III) 385

and ~200 kDa (complex IV) are more prominently represented in thylakoids together with 386

even larger complexes ranging up to 670 kDa (Figure 11A) 387

Even more strikingly PDMs and thylakoids also differ with respect to the forms of 388

CurT they contain Thus isoelectric focusing (IEF) analysis of both membrane fractions 389

revealed at least four different CurT isoforms (a-d Figure 11B) PDMs contain mainly forms 390

b and d as well as trace amounts of a while thylakoids apparently possess very low levels of 391

form d and accumulate forms a b and c (Figure 11B) The nature of the underlying CurT 392

modifications still has to be determined Interestingly however CurT has recently been 393

identified as a phosphoprotein in a proteomic study (Spaumlt et al 2015) and the CurT variants 394

in Figure 11B may differ in their phosphorylation states At all events PDMs and thylakoids 395

can be distinguished by their complement of CurT isoforms which potentially play a role in 396

formation of the CurT sub-complexes that define the two membrane fractions 397

398

CurT is involved in the osmotic stress response 399

To further explore the stress-related role of CurT (Figure 6) and its link to IsiA 400

induction the effect of other potential stressors on curT- cells was tested High light levels had 401

a minor effect on curT- growth and its photosynthetic performance (Figure 4 Supplemental 402

Figure 5 and section above) suggesting that other environmental factors induced isiA 403

expression Our search was also motivated by a previous proteomic survey of plasma 404

membrane proteins of Synechocystis 6803 in high salt conditions in which CurT and VIPP1 405

were found among the most highly induced targets (Huang et al 2006) First we cultured 406

wild-type and curT- cells in different salt concentrations and found that growth of curT- was 407

severely affected in high salt (Figure 12A) Wild-type cells were only slightly affected by the 408

addition of salt to the medium The deleterious effect of the loss of curT on growth was even 409

more pronounced when maltose an osmotically active compound was present in the medium 410

(Figure 12B) Indeed curT- cells failed to survive exposure to 150 mM maltose whereas 411

growth of the wild-type was only slightly compromised These findings assign an additional 412

function to CurT ie a protective role during osmotic stress 413

13

When the curT-CFP strain was analyzed under these stress conditions enhanced 414

accumulation of CurT at the cell periphery was found mostly outside the autofluorescent 415

thylakoids and consistent with accumulation at the plasma membrane (Figure 12C) This was 416

further substantiated by membrane fractionation experiments which also revealed an 417

increased relative abundance of CurT in the plasma membrane fraction in the first sucrose 418

gradient (Figure 12E) Determination of total cellular CurT levels demonstrated that its 419

absolute amount did not increase under stress (Figure 12D) Therefore its higher abundance 420

in the plasma membrane under osmotic stress is likely to be due to CurT trafficking towards 421

the plasma membrane instead of increased synthesis 422

The same appears to hold true for VIPP1 which has been implicated in membrane 423

maintenance in both cyanobacteria and chloroplasts (Zhang and Sakamoto 2015) At stress 424

conditions an increase of the VIPP1 signal in the plasma membrane can be monitored in 425

wild-type (Figure 12E) However enhanced accumulation of VIPP1 in plasma membranes is 426

unaffected in the curT- mutant suggesting that thylakoid convergence zones are not strictly 427

required for the localization of VIPP1 428

429

Discussion 430

CurT determines thylakoid architecture 431

This study demonstrates that the protein CurT a homolog of the grana-forming 432

CURT1 proteins in plants is essential for establishing the proper thylakoid membrane 433

architecture in the cyanobacterium Synechocystis 6803 In particular CurTrsquos membrane-434

bending activity is likely to be required for the formation of thylakoid biogenesis centers at 435

points on the cell periphery where thylakoids converge towards the plasma membrane Here 436

PratA-mediated preloading of early PSII assembly intermediates with Mn2+ ions has been 437

proposed to take place together with PSII repair (Stengel et al 2012 Sacharz et al 2015) 438

This idea is supported by the following lines of evidence (i) The curT- mutant is devoid of 439

any thylakoid sectors that have convergence zones at their distal ends instead thylakoid 440

membranes are displaced and disposed as disordered or continuous rings (ii) CurT similarly 441

to CURT1A possesses a membrane-curving activity in vitro and intercalates asymmetrically 442

into thylakoids (iii) A high local concentration of CurT is observed at regions of high 443

curvature where biogenesis centers are found (iv) Lack of CurT affects the formation and 444

accumulation of PSII complexes as well as the abundance of some of its assembly factors 445

The drastic effects of CurT inactivation indicate an important role for this factor in membrane 446

shaping In contrast to the situation for CURT1A from Arabidopsis attempts to stably 447

14

overexpress CurT in Synechocystis 6803 failed Although short-lived transient increases in 448

CurT levels were observed when curT was expressed via strong heterologous promoters 449

wild-type levels of the protein were restored during subsequent rounds of cultivation of 450

transgenic lines Apparently Synechocystis 6803 cells do not tolerate substantial alterations in 451

CurT dosage and counter-select against these 452

This is in agreement with a dosage-dependent membrane-curving activity of CurT 453

which is suggested by its high local concentration at the edges of thylakoid autofluorescent 454

regions which mark the sites of the highly curved thylakoid convergence zones (Figures 8 9 455

and 13 Supplemental Movie 1 2 and 3) In addition some CurT was detected in structures 456

extending through the cytoplasm which most likely represent thylakoid sheets traversing the 457

cell from one thylakoid convergence zone to another (Figures 2A and 8) CurT might be 458

involved in the formation and stabilization of these structures 459

Members of the CURT1 family contain an N-terminal amphipathic α-helix that may 460

be involved in the membrane-bending activity of CurT (Armbruster et al 2013) Several 461

eukaryotic membrane-shaping proteins possess amphipathic helices as part of either an ENTH 462

(epsin N-terminal homology) or an N-BAR (Bin amphiphysin Rvs with N-terminal 463

amphipathic helix) domain (Ford et al 2002 Gallop and McMahon 2005 Zimmerberg and 464

Kozlov 2006) ENTH and N-BAR domains are rather large (~200 amino acids) and it has 465

been shown that amphipatic helices present in those domains insert into one leaflet of the lipid 466

bilayer and thereby induce curvature of the membrane (reviewed by Gallop and McMahon 467

2005 Zimmerberg and Kozlov 2006) However CurT itself is a small protein (149 amino 468

acids) that contains two transmembrane domains which insert into both leaflets of the lipid 469

bilayer (Figure 1A) as already suggested by Armbruster et al (2013) The amphipathic helix 470

faces the cytoplasm in Synechocystis 6803 or the stroma in A thaliana and most likely it 471

fine-tunes the degree of membrane bending mediated by CurT (Armbruster et al 2013) 472

In addition the increase in curvature correlated with CurT accumulation at convex 473

sides of thylakoid lamella (Figure 10 and 13) Hence curving might be mediated by 474

asymmetric integration of CurT into the lipid bilayers forming opposite faces of thylakoid 475

membrane sheets (Figure 13) However the mechanism causing this asymmetry remains 476

elusive 477

The presence of different CurT isoforms and complexes in PDMs and thylakoids adds 478

a further level of complexity and most likely reflects the dynamic regulation of this system 479

(Figure 11) The formation of different complexes might be primed by the phosphorylation of 480

CurT within its N-terminal cytoplasmic part (Spaumlt et al 2015) It seems likely that these 481

15

complexes play distinct roles in mediating the different CurT functions ie membrane 482

bending and maintenance 483

However it remains to be seen how exactly curvature is established maintained and 484

fine-tuned In addition other determinants of membrane topology and their putative interplay 485

with CurT have to be considered eg lipid and protein (complex) composition of 486

membranes cellular turgor pressure and other factors required for membrane 487

biogenesismaintenance eg the VIPP1 protein before precise molecular models of CurTrsquos 488

mode of action can be constructed (Rast et al 2015 and see below) That these other factors 489

can be crucial for membrane architecture is documented by the fact that some marine 490

cyanobacteria such as Prochlorococcus and Synechococcus contain curved thylakoids (but 491

no thylakoid convergence zones at the plasma membrane) although they lack a curT gene 492

493

The role of biogenesis centers 494

The absence of biogenesis centers in the curT- mutant now enables one to answer some 495

questions relating to the role of these thylakoid sub-structures which form in some but not all 496

cyanobacteria (Kunkel 1982 van de Meene et al 2006) First they are not essential since 497

even the curT- mutant still accumulates PSII to ~50 of wild-type levels On the other hand 498

in the mutant assembly of PSII is impaired as revealed by the increased accumulation of early 499

assembly intermediates In addition PSII dimers are almost completely absent in curT- 500

Whether the reduction in PSII dimers is attributable to an assembly problem linked to the 501

absence of biogenesis centers or to a secondary defect in dimer stabilization caused by 502

changes in overall thylakoid membrane ultrastructure remains to be determined Thus 503

biogenesis centers are more likely to represent evolutionary ldquoadd-onsrdquo that facilitated efficient 504

thylakoid biogenesis This is compatible with the fact that some cyanobacteria are devoid of 505

any biogenesis center-related substructures Second their absence compromises PSII but the 506

accumulation of other photosynthetic complexes ie PSI and the Cyt(b6f) complex is not 507

affected by CurT deficiency (Figure 3) This observation agrees with previous findings that 508

neither the PsaA subunit of PSI nor its assembly factor Ycf37 is detectable in isolated PDM 509

fractions (Rengstl et al 2011) 510

In addition to reduced de novo PSII assembly a higher relative stability of D1 in high-511

light experiments has been detected in curT- which suggests that D1 degradation during PSII 512

repair is less efficient in the mutant Photo-damaged D1 is degraded by the FtsH2FtsH3 513

complex which has previously been shown to partly localize to thylakoid convergence zones 514

at the cell periphery ie biogenesis centers (Boehm et al 2012 Sacharz et al 2015) It 515

16

therefore seems possible that the absence of biogenesis centers in curT- leads to 516

mislocalization of the FtsH2FtsH3 complex and less effective D1 degradation 517

Moreover a PSII related-function for CurT is supported by a meta-analysis of the 518

Synechocystis 6803 transcriptome When the CyanoEXpress 22 database (Hernaacutendez-Prieto 519

and Futschik 2012 Hernaacutendez-Prieto et al 2016) was queried for genes co-expressed with 520

curT (slr0483) genes for five PSII subunits ndash psbE psbO psbF psbL and psb30 ndash were 521

found among the first ten hits (Supplemental Table 4) From this we infer that biogenic 522

centers do not play an essential role in the assembly of all photosynthetic complexes but 523

serve to enhance PSII assemblyrepair possibly through the efficient delivery of Mn2+ 524

Residual PSII in curT- cells is likely to be supplied with cytoplasmic Mn2+ via a second 525

independently operating ABC transporter-based system in the plasma membrane named the 526

Mnt pathway (Bartsevich and Pakrasi 1995 Bartsevich and Pakrasi 1996) 527

Formally we cannot exclude that CurT is directly involved in the PSII assembly 528

process However considering CurTrsquos membrane bending capacity and the mutant phenotype 529

(Figure 1D and Figure 2) it appears more likely that CurT forms cellular substructures for 530

efficient PSII biogenesis ie biogenesis centers 531

As mentioned above some ultrastructural features of biogenesis centers have emerged 532

from studies employing EM-based tomography (van de Meene et al 2006) To date however 533

a high-resolution picture of the precise membrane architecture within these centers remains 534

elusive In particular whether or not a direct connection between plasma membrane and 535

thylakoids exists continues to be debated As recently discussed and in line with this gap in 536

knowledge different membrane fractionation techniques have revealed different distributions 537

of PSII-related subunits and assembly factors between plasma and thylakoid membranes 538

(Heinz et al 2016 Liberton et al 2016 Selatildeo et al 2016) The overall picture that emerges 539

is that the initial hypothesis that PSII biogenesis is initiated at the plasma membrane is no 540

longer tenable whereas a specialized thylakoid sub-fraction like the PDMs that make contact 541

with the plasma membrane could explain many of the available data and thus clarify some 542

aspects of the debate (Zak et al 2001 Pisareva et al 2011 Rast et al 2015) Moreover it 543

has previously been hypothesized that ldquoribosome-decorated membrane-like complexesrdquo 544

forming at the innermost thylakoid sheet might represent biogenic compartments (van de 545

Meene et al 2006 Mullineaux 2008) Whether these structures are affected in curT- cannot 546

be judged based on our TEM analysis but requires ultrastructural data of higher resolution 547

However the accessibility of thylakoids for ribosomes should be increased in the less 548

compressed membrane system of curT- (Figure 2B-D) 549

17

A scenario similar to that of Synechocystis 6803 holds for the situation in chloroplasts 550

of the green alga Chlamydomonas reinhardtii in which de novo PSII biogenesis has been 551

shown to be initiated in punctate regions named T-zones located close to the pyrenoid 552

(Uniacke and Zerges 2007) Unlike the mRNAs for the PSII components neither RNAs for 553

PSI subunits nor PSI assembly factors are localized to T-zones indicating that PSI and PSII 554

assembly processes are spatially separated (Uniacke and Zerges 2009 Nickelsen and Zerges 555

2013 Rast et al 2015) Interestingly a recent cryoelectron tomography study demonstrated 556

that next to T-zones at the chloroplast base-lobe junction the inner chloroplast envelope 557

exhibits invaginationsconnections to thylakoids that structurally resemble the organization of 558

cyanobacterial biogenesis centers (Engel et al 2015) For future investigations it will be 559

interesting to see if a homolog of the CURT1 family is involved in the formation of these 560

structures in C reinhardtii 561

562

Evolution of CURT1 function 563

Homologs of the CURT1 protein family can be found throughout cyanobacteria green 564

algae and plants (Armbruster et al 2013) The Arabidopsis CURT1A-D proteins have 565

recently been shown to induce bending of thylakoid membranes at grana margin regions 566

(Armbruster et al 2013) Interestingly and in contrast to the situation in Synechocystis 6803 567

their inactivation did not result in severe photosynthetic deficiencies although the thylakoids 568

formed lacked defined grana stacks Nevertheless the data available support the idea that the 569

function of thylakoid membrane structures that were regarded as being independent ie 570

cyanobacterial biogenesis centers and grana are closely related Intriguingly both of these 571

thylakoid membrane structures are dedicated to aspects of PSII function but do not involve 572

PSI (Pribil et al 2014) In both the prokaryotic and eukaryotic systems CURT1 homologs 573

appear to bend thylakoid membranes as indicated by (i) the distortion of membrane 574

ultrastructure seen in mutants devoid of curved thylakoids (ii) the localization of CURT1 575

homologs at grana margins and their local concentration at biogenesis centers (iii) the in vitro 576

membrane-curving activity of both CURT forms The phenotypic differences between 577

A thaliana and Synechocystis 6803 mutants may however be attributable to the different 578

functions of the membrane sub-compartments affected in the two model organisms Whereas 579

the role of grana is still under debate one function of the cyanobacterial biogenesis centers is 580

the above-mentioned high-throughput uptake of Mn2+ ions for efficient assembly of PSII 581

(Stengel et al 2012 Nickelsen and Rengstl 2013 Pribil et al 2014) However it appears 582

that in both cases the primary function of CURT1 proteins is to generate curved membrane 583

18

regions These discoveries suggest that until now two independently observed structures ie 584

cyanobacterial thylakoid biogenesis centers and chloroplast grana regions are closely related 585

The degree of curvature is much less pronounced in the cyanobacterial system As previously 586

discussed it was probably the subsequent evolution of a membrane-localized light-harvesting 587

system in chloroplasts that made the formation of tightly curved grana thylakoids possible 588

(Mullineaux 2005 Nevo et al 2012 Pribil et al 2014) 589

590

CurT is involved in osmotic stress response 591

One unexpected phenotype of the curT- mutant is its sensitivity to osmotic stress 592

These data revealed that in addition to shaping membranes CurT also influences their 593

functional integrity This latter function might be intrinsic to CurT or could be mediated by 594

the VIPP1 protein which has been shown to be required for membrane maintenance in 595

bacteria and chloroplasts probably by acting as a supplier of lipids (for an overview see 596

Zhang and Sakamoto 2015) Both factors accumulate in the plasma membrane upon osmotic 597

stress but VIPP1 localization is not severely affected by CurT inactivation which suggests 598

that VIPP1 operates independently of CurT In agreement with this repeated co-599

immunoprecipitations revealed no interaction between both proteins Therefore it remains to 600

be established whether a direct functional relationship between them exists 601

Previous investigations of osmotic stress in Synechocystis 6803 showed a kidney-602

shaped form of wild-type cells under very high concentrations of osmotically active 603

compounds (Marin et al 2006) The cells were severely deformed indicating changes in the 604

structure of the cellular envelope Since CurT shifts towards the plasma membrane already 605

under lower osmolyte concentrations we suggest a stabilizing function of CurT in the plasma 606

membrane CurT might be necessary to tolerate the forces trying to deform the cells under 607

osmotic stress 608

In conclusion this analysis has identified a crucial determinant for shaping and 609

maintaining the cyanobacterial thylakoid membrane system ie CurT a homolog of the 610

grana-forming CURT1 protein family from A thaliana In particular CurT is involved in the 611

formation of specific thylakoid substructures close to the plasma membrane at which PSII is 612

assembledrepaired Future work will dissect the precise ultrastructure of these centers and 613

enable us to elaborate a molecular model for the spatiotemporal organization of PSII assembly 614

in cyanobacteria 615

616

19

Methods 617

Strains and growth conditions 618

Wild-type and mutant Synechocystis 6803 cells were grown on solid or in liquid BG 619

11 medium (Rippka et al 1979) supplemented with 5 mM glucose (unless indicated 620

otherwise) at 30degC under continuous illumination at a photon irradiance of 30 μmol m-2 s-1 of 621

white light For growth during high-light experiments for investigation of D1 repair cells 622

were cultivated in a FMT150 photobioreactor (Photon Systems Instruments Draacutesov Czech 623

Republic) at 800 micromol photons m-2 s-1 in the presence or absence of lincomycin (100 microgml) 624

Cell density was monitored photometrically at 750 nm Doubling times were determined after 625

two days of growth To generate the insertion mutant curT- the curT gene (slr0483) was first 626

amplified from wild-type genomic DNA by PCR using the primer pair 04835 627

(GAAGCCTATTTAGCTAAGGCCGAAAG) and 04833 628

(TAGTACCTGGTCTTCCATGGCGT) and the resulting fragment was cloned into the 629

Bluescript pKS vector (Stratagene Waldbronn Germany) A kanamycin resistance cassette 630

was then inserted into the single AgeI restriction site (159 bp downstream of the start codon) 631

and this disruption construct was used to replace the wild-type gene as described (Wilde et al 632

2001) 633

634

Bioinformatic and computational analysis 635

CURT1 sequences of Synechocystis 6803 were obtained from CyanoBase 636

(httpgenomekazusaorjpcyanobaseSynechocystis) and CURT1 homologs in other 637

organisms were retrieved from NCBIBLAST (httpblastncbinlmnihgovBlastcgi) 638

Numbers and positions of putative transmembrane domains in the predicted proteins were 639

determined with TMHMM20 (httpwwwcbsdtudkservicesTMHMM) The sequence for 640

the N-terminal amphipathic helix was predicted by Jpred 3 641

(httpwwwcompbiodundeeacukwww-jpred) and plotted using a helical wheel projection 642

script (httprzlabucreduscriptswheelwheelcgi) The programs ClustalW2 643

(httpwwwebiacuktoolsclustalw2) and GeneDoc (httpwwwpscedubiomedgenedoc) 644

were used to generate multiple alignments of amino acid sequences Quantitative analysis of 645

immunoblots was performed with the AIDA Image Analyzer V325 (Raytest 646

Isotopenmessgeraumlte GmbH Straubenhardt Germany) 647

Co-expression patterns of curT were analyzed using the CyanoEXpress 22 database 648

(httpcyanoexpresssysbiolabeu Hernaacutendez-Prieto and Futschik 2012 Hernaacutendez-Prieto et 649

al 2016) 650

20

651

Measurement of chlorophyll concentration and oxygen production 652

Determination of chlorophyll content was carried out according to Wellburn and 653

Lichtenthaler (1984) For oxygen evolution measurements cells were grown in BG-11 654

without glucose harvested in mid-log phase and diluted to an OD750 nm = 05 Oxygen 655

evolution rates were measured with a Clark-type oxygen electrode (Hansatech Instruments 656

Ltd Kingrsquos Lynn Norfolk UK) at 1000 micromol photons m-2 s-1 (cool white light) after 5 min of 657

dark acclimation Oxygen evolution under saturating light conditions was measured without 658

any additives 659

660

Cell size and cell number estimation 661

Synechocystis 6803 strains were grown in liquid BG11 media containing 5 mM 662

glucose For cell size estimation the cells were analyzed with a confocal laser scanning 663

microscope TCS SP5 (Leica Wetzlar Germany) The diameter of the cells was measured 664

with the LAS AF Lite software (Leica Wetzlar Germany) Cells that were about to divide 665

were not taken into account For the determination of cell number cultures were set to an 666

OD750 = 1 and analyzed by using a Neubauer counting chamber (Paul Marienfeld GmbH amp 667

Co KG Lauda-Koumlnigshofen Germany) Statistical significance was determined by Studentrsquos 668

t-test 669

670

Measurements of P700+ reduction kinetics and relative electron transport rates 671

P700+ reduction kinetics and changes in chlorophyll fluorescence yield at different 672

light intensities were measured at a chlorophyll concentration of 5 microgml with a Dual-PAM-673

100 instrument (Heinz Walz GmbH Effeltrich Germany) Complete P700 oxidation was 674

achieved by a 50-ms multiple turnover pulse (10000 micromol photons m-2 s-1) after 2 min of dark 675

incubation P700+ reduction kinetics were recorded without any additions as well as in the 676

presence of 10 microM DCMU Ten technical replicates were averaged and fitted with single 677

exponential functions Data interpretation was done according to Bernaacutet et al (2009) 678

Light saturation measurements were performed according to Xu et al (2008) The 679

actinic light intensity was increased stepwise from 0 to 665 micromol photons m-2 s-1 with 30-s 680

adaptation periods Maximal fluorescence yields were obtained by applying saturating light 681

pulses (duration 600 ms intensity 10000 micromol photons m-2 s-1) 682

683

Low-temperature fluorescence measurements 684

21

Fluorescence emission spectra were measured with an AMINCO Bowman Series 2 685

Luminescence Spectrometer Wild-type and curT- cells were grown in the presence of 5 mM 686

glucose to mid log-phase and concentrated to 25 microgml chlorophyll adding 2 microM fluorescein 687

as an internal standard Samples (1 ml) were transferred to thin glass tubes dark-adapted for 688

30 min at 30 degC and shock frozen in liquid N2 To quantify chlorophyllfluorescein and 689

phycobilisome-mediated fluorescence samples were excited and emission recorded at 440 690

nm510 nm (chlorophyll and fluorescein excitationmax fluorescein emission) and 580 691

nm685 nm respectively Emission was scanned at 490-800 nm or at 640-800 nm 692

respectively 693

694

Antibody production and protein analysis 695

For generation of an αCurT antibody the N-terminal coding region of curT (amino 696

acid positions 1-58) was amplified by PCR using primers N04835 697

(AAGGATCCGTGGGCCGTAAACATTCAA) and N04833 698

(AAGTCGACGCACTTCCCACACCGGTTGTA) and cloned into the BamHI and XhoI sites 699

of the pGEX-4T-1 vector (GE Healthcare Freiburg Germany) Expression of the GST fusion 700

protein in Escherichia coli BL21(DE3) and subsequent affinity purification on Glutathione-701

Sepharose 4B (GE Healthcare) were carried out as described (Schottkowski et al 2009b) A 702

polyclonal antiserum was raised against this protein fragment in rabbits (Pineda Berlin 703

Germany) Other primary antibodies used in this study have been described previously ie 704

αpD1 (Schottkowski et al 2009b) αD1 (Schottkowski et al 2009b) αD2 (Klinkert et al 705

2006) αPratA (Klinkert et al 2004) αYcf48 (Rengstl et al 2011) αPitt (Schottkowski et 706

al 2009a) αPOR (Schottkowski et al 2009a) αYidC (Ossenbuumlhl et al 2006) αVIPP1 707

(Aseeva et al 2007) αSll0933 (Armbruster et al 2010) and αSlr0151 (Rast et al 2016) or 708

were purchased from Agrisera (Vaumlnnaumls Sweden) ie αCP43 αCP47 αPsaA αCyt f 709

αRbcL αIsiA The αGFP-HRP antibody was acquired from Miltenyi Biotech (Bergisch 710

Gladbach Germany) 711

Protein concentrations were determined according to Bradford (1976) using RotiQuant 712

(Carl Roth GmbH amp Co KG Karlsruhe Germany) Protein extraction membrane 713

fractionation on sucrose-density gradients and quantification of Western signal intensities was 714

performed as described previously (Rengstl et al 2011) Solubility properties of CurT were 715

determined according to Schottkowski et al (2009a) 716

22

Sucrose-density centrifugation separating PDM and thylakoid membrane fractions by 717

two consecutive gradients was carried out as described previously (Schottkowski et al 718

2009b Rengstl et al 2011) 719

Two-dimensional fractionations of cyanobacterial membrane proteins via BNSDS-720

PAGE and of pulse-labeled proteins by BNSDS-PAGE were performed as previously 721

reported (Klinkert et al 2004 Schottkowski et al 2009b Rengstl et al 2013) For the 722

analysis of native complexes in fractions obtained by sucrose-density centrifugation the 723

volume corresponding to 350 microg of protein in fraction 7 was applied to BNSDS-PAGE 724

For isoelectric focusing (IEF) the volume corresponding to 50 microg of protein from 725

fraction 7 in 200 microl of IEF buffer (8 M urea 4 CHAPS 1 IPG buffer pH 4-7 (GE 726

Healthcare)) was applied to an 11-cm Immobiline DryStrip pH 4-7 (GE Healthcare) in a 727

Protean IEF Cell (Bio-Rad Munich Germany) Strips were rehydrated for 12 h at 20 degC and 728

50V Focusing was carried out in the following steps 500 V rapid 1500 Vh 1000 V linear 729

880 Vh 6000 V linear 9680 Vh 6000 V rapid 5390 Vh 50 microA per gel focus temperature 730

20degC Subsequently the strips were incubated in equilibration buffer I (6 M urea 0375 M 731

Tris pH 88 20 glycerol 2 SDS 2 DTT) and equilibration buffer II (6 M urea 0375 732

M Tris pH 88 20 glycerol 2 SDS 25 iodoacetamide) for 10 min in each buffer 733

Then the IEF strips were applied to second-dimension SDS-PAGE 734

735

Transmission electron microscopy and immunogold labeling 736

Sample preparation for transmission electron microscopy including freeze substitution 737

and immunogold labeling of CurT was performed as described previously (Stengel et al 738

2012) Ultrathin sections were cut to thicknesses of 35 - 45 nm and 45 - 65 nm for 739

ultrastructural analyses and immunogold labeling respectively For immunogold labeling 740

sections collected on collodion-coated Ni grids were incubated for 18 h at 4degC with (rabbit) 741

αCurT (diluted 1100 1500 11000 or 14000 in blocking buffer (5 fetal calf serum) with 742

005 Tween 20) and further processed as described previously (Stengel et al 2012) As a 743

negative control wild-type Synechocystis 6803 cells were incubated without the primary 744

antibody and exposed to the gold-labeled anti-rabbit IgG To image the ultrastructure and the 745

immunogold-treated samples a Fei Morgagni 268 transmission electron microscope was used 746

and micrographs were taken at 80 kV 747

To avoid errors in the interpretation of the immunogold labeling experiment only 748

signals which were unambiguously localized to distinctly visible thylakoid membranes were 749

taken into account For each cell different regions (see Figure 10F) were defined and in each 750

23

region the signals on the convex and concave sides of the thylakoid membrane were analyzed 751

separately (see Supplemental Figure 11 for representative counts) Statistical significance was 752

assessed by χ2 test (Zoumlfel 1988) 753

For the analysis of clusters of CurT signals in biogenesis centers a cluster was defined 754

as a minimum of four signals in close proximity Overall 219 biogenesis centers were 755

examined with regard to CurT cluster formation 756

757

Preparation of proteoliposomes 758

Liposomes with a lipid mixture of 25 monogalactosyl diacylglycerol 42 759

digalactosyl diacylglycerol 16 sulfoquinovosyl diacylglycerol and 17 760

phosphatidylglycerol (Lipid Products South Nutfield UK) were prepared as described 761

previously (Armbruster et al 2013) To generate proteoliposomes CurT and CURT1A 762

proteins were expressed in the presence of liposomes for 3 h at 37degC using a PURExpress In 763

Vitro Protein Synthesis Kit (New England Biolabs Ipswich MA USA) The liposomes were 764

separated from the mix by centrifugation in a discontinuous sucrose gradient (100000 g 18 765

h) Subsequently the fraction containing the liposomes was extracted and dialyzed against 20 766

mM HEPES (pH 76) For transmission electron microscopy the proteoliposomes were 767

negatively stained with 1 uranyl acetate on a carbon-coated copper grid Micrographs were 768

taken on a Fei Morgagni 268 TEM at 80 kV 769

770

curT-CFP strain generation 771

Gibson assembly was used for single-step cloning (Gibson 2011) of the slr0483 gene 772

(together with its ~08 kb upstream region) the mTurquoise2 gene fragment the gentamycin-773

resistance cassette (aacC1) and an ~17-kb downstream region of slr0483 into pBR322 774

cleaved with EcoRV and NheI The slr0483 gene was fused in frame to the codon-optimized 775

mTurquoise2 (DNA20) preceded by a linker sequence encoding GSGSG The resulting 776

plasmid was used to transform Synechocystis 6803 as described previously (Zang et al 2007) 777

After ~ 10 days of incubation on BG11-GelRite (15 ) medium in the presence of 2 microgml 778

gentamycin several antibiotic resistant colonies were obtained and streaked out on fresh 779

medium These transformants were then tested for full segregation of the tagged allele by 780

colony PCR with primers flanking the slr0483 gene 781

782

Fluorescence microscopy 783

24

An aliquot of a cell suspension in mid-log phase was placed under a BG11-agarose 784

pad on a glass coverslip (15) and imaged on an inverted microscope (Zeiss 785

AxioObserverZ1) equipped with an ORCA Flash40 V2 (Hamamatsu) camera a Lumenecor 786

SOLA II Light Engine and a Plan-Apochromat 63x140 Oil DIC M27 (NA 14) objective 787

(Zeiss) Image acquisition was done with Zen 21 software in cyan and far-red fluorescence 788

channels (Zeiss Filter Sets 47 HE and 50) as Z-series with a step size of 250 nm and effective 789

pixel size of 103 nm Acquired image files were subsequently deconvolved (Constrained 790

Iterative Method) using a default theoretical Point Spread Function in Zen 20 (Zeiss) 791

Extraction of intensities for line profiles was performed by image thresholding the thylakoid 792

autofluorescence channel and eroding the resulting binary mask in Fiji (Schindelin et al 793

2012) 794

For immunofluorescence analysis cells were grown to mid-log phase as in the case of 795

the cells prepared for live-cell microscopy A 10-ml culture was fixed for 20 min in 37 796

formaldehyde and following extensive washing with phosphate-buffered saline (PBS) cells 797

were first permeabilized in 005 Triton-X for 20 min and then in lysis buffer (50 mM Tris-798

HCl 100 mM NaCl 5 mgml lysozyme) at 37degC for 2 h with gentle shaking To block 799

unspecific binding sites the cell pellet was incubated in 5 bovine serum albumin in PBS at 800

30degC for 1 h The αCurT serum (1500 dilution) was added to cells in fresh blocking buffer 801

for 1 h at 30degC with gentle shaking Cells were then washed three times with blocking buffer 802

and incubated with goat anti-rabbit IgG secondary antibodies conjugated to Oregon Green 488 803

(Invitrogen) (11000 dilution) under the conditions as for the primary antibodies Cells were 804

washed three times with PBS and prepared for microscopy as above Imaging was done as 805

described for live-cell microscopy except that a Colibri2 LED light source was employed for 806

illumination and a CoolSnap HQ camera (Photometrics) was used for image acquisition Cells 807

were imaged as Z-series (step size 280 nm) in the yellow and far-red fluorescent channels 808

(Zeiss Filter Sets 46 HE and 50) using the 505 nm and 625 nm LED modules Effective pixel 809

size in the final image was 102 nm Deconvolution and image analysis was done as described 810

above As judged by the staining intensity of the Oregon Green-conjugated antibodies 811

approximately half of the cells in any given field of view appeared to have been successfully 812

permeabilised a rate that is common in our experience No significant signal was detected in 813

the control sample that had not been exposed to the primary antibodies 814

815

25

Accession numbers 816

Sequence data from this article can be found in the CyanoBase and EMBLGenBank 817

data libraries under accession number slr0483 818

819

Supplemental Data 820

Supplemental Figure 1 Construction of the curT- mutant 821

Supplemental Figure 2 Growth phenotype of curT- 822

Supplemental Figure 3 Expression analysis of the open reading frame slr0482 (located 823

upstream of curT) in the curT- strain 824

Supplemental Figure 4 Absorbance spectra of curT- and wild-type cells 825

Supplemental Figure 5 High-light growth phenotypes of wild-type Synechocystis 6803 and 826

the curT- strain 827

Supplemental Figure 6 Ultrastructure of the TD41 mutant which lacks the psbA transcript 828

and the D1 protein 829

Supplemental Figure 7 Expression and localization of CurT-CFP 830

Supplemental Figure 8 Localization of CurT and CurT-CFP by fluorescence microscopy 831

Supplemental Figure 9 Chlorophyll autofluorescence of curT- 832

Supplemental Figure 10 The curT- mutant as a negative control for immunogold labeling 833

Supplemental Figure 11 Representative counts of immunogold signals 834

Supplemental Table 1 Overview of immunogold signals in curT- cells 835

Supplemental Table 2 Overview of immunogold signals in specific regions of Synechocystis 836

6803 wild-type cells 837

Supplemental Table 3 Statistical analysis of immunogold signals for wild-type 838

Synechocystis 6803 cells 839

Supplemental Table 4 Co-expression of curT 840

Supplemental Movie 1 Scan through the Z-axis of a curT-CFP cell 841

Supplemental Movie 2 Rendered 3D-model of a CurT-CFP detection 842

Supplemental Movie 3 Scan through the Z-axis of a curT-CFP cell with a traversing 843

thylakoid lamella 844

845

Acknowledgements 846

We thank Y Nishiyama for providing αpD1 and J Soll for αVIPP1 and αYidC antibodies 847

respectively and Nina Dyczmons-Nowaczyk for support with the fluorescence measurements 848

This work was supported by grants awarded to JN (Ni3909) MMN (NO 8363) and DL 849

26

(Le126529) by the Deutsche Forschungsgemeinschaft in the context of Research Unit 850

FOR2092 and the Cluster of Excellence RESOLV (EXC 1069) AG is a Howard Hughes 851

Medical Institute postdoctoral fellow in the laboratory of Erin OrsquoShea at Harvard University 852

LS was supported by a PhD fellowship from the Chinese Scholarship Council 853

854

Author Contributions 855

SH AR LS MMN DL and JN designed the research SH AR LS AG ILG EH ML BR 856

SV performed the research all authors contributed to data analysis SH AR and JN wrote the 857

paper 858

859

Competing Financial Interest statement 860

The authors declare no competing financial interests 861

862

We wish to dedicate this paper to Fabrice Rappaport an outstanding colleague and friend who 863

passed away so early 864

865

27

References 866

Allen JF de Paula WBM Puthiyaveetil S and Nield J (2011) A structural 867

phylogenetic map for chloroplast photosynthesis Trends Plant Sci 16 645-655 868

Anderson JM Horton P Kim E-H and Chow WS (2012) Towards elucidation of 869

dynamic structural changes of plant thylakoid architecture Philos Trans R Soc 870

Lond B Biol Sci 367 3515-3524 871

Armbruster U Zuumlhlke J Rengstl B Kreller R Makarenko E Ruumlhle T Schuumlnemann 872

D Jahns P Weisshaar B Nickelsen J and Leister D (2010) The Arabidopsis 873

thylakoid protein PAM68 is required for efficient D1 biogenesis and photosystem II 874

assembly Plant Cell 22 3439-3460 875

Armbruster U Labs M Pribil M Viola S Xu W Scharfenberg M Hertle AP 876

Rojahn U Jensen PE Rappaport F Joliot P Doumlrmann P Wanner G and 877

Leister D (2013) Arabidopsis CURVATURE THYLAKOID1 proteins modify 878

thylakoid architecture by inducing membrane curvature Plant Cell 25 2661-2678 879

Aseeva E Ossenbuumlhl F Sippel C Cho WK Stein B Eichacker LA Meurer J 880

Wanner G Westhoff P Soll J and Vothknecht UC (2007) Vipp1 is required for 881

basic thylakoid membrane formation but not for the assembly of thylakoid protein 882

complexes Plant Physiol Biochem 45 119-128 883

Bartsevich VV and Pakrasi HB (1995) Molecular identification of an ABC transporter 884

complex for manganese analysis of a cyanobacterial mutant strain impaired in the 885

photosynthetic oxygen evolution process EMBO J 14 1845-1853 886

Bartsevich VV and Pakrasi HB (1996) Manganese transport in the cyanobacterium 887

Synechocystis sp PCC 6803 J Biol Chem 271 26057-26061 888

Bernaacutet G Waschewski N and Roumlgner M (2009) Towards efficient hydrogen production 889

the impact of antenna size and external factors on electron transport dynamics in 890

Synechocystis PCC 6803 Photosynth Res 99 205-216 891

Boehm M Yu J Krynicka V Barker M Tichy M Komenda J Nixon PJ and Nield 892

J (2012) Subunit Organization of a Synechocystis Hetero-Oligomeric Thylakoid FtsH893

Complex Involved in Photosystem II Repair Plant Cell 24 3669-3683894

Bradford MM (1976) A rapid and sensitive method for the quantitation of microgram 895

quantities of protein utilizing the principle of protein-dye binding Anal Biochem 72 896

248-254897

28

Chang L Liu X Li Y Liu C-C Yang F Zhao J and Sui S-F (2015) Structural 898

organization of an intact phycobilisome and its association with photosystem II Cell 899

Res 25 726-737 900

Danielsson R Suorsa M Paakkarinen V Albertsson P-Aring Styring S Aro E-M and 901

Mamedov F (2006) Dimeric and monomeric organization of photosystem II 902

Distribution of five distinct complexes in the different domains of the thylakoid 903

membrane J Biol Chem 281 14241-14249 904

Daum B Nicastro D Austin J McIntosh JR and Kuumlhlbrandt W (2010) Arrangement 905

of photosystem II and ATP synthase in chloroplast membranes of Spinach and Pea 906

Plant Cell 22 1299-1312 907

Engel BD Schaffer M Kuhn Cuellar L Villa E Plitzko JM and Baumeister W 908

(2015) Native architecture of the Chlamydomonas chloroplast revealed by in situ 909

cryo-electron tomography eLife 4 e04889 910

Ford MGJ Mills IG Peter BJ Vallis Y Praefcke GJK Evans PR and McMahon 911

HT (2002) Curvature of clathrin-coated pits driven by epsin Nature 419 361-366 912

Fristedt R Willig A Granath P Cregravevecoeur M Rochaix J-D and Vener AV (2009) 913

Phosphorylation of photosystem II controls functional macroscopic folding of 914

photosynthetic membranes in Arabidopsis Plant Cell 21 3950-3964 915

Gallop JL and McMahon HT (2005) BAR domains and membrane curvature bringing 916

your curves to the BAR Biochem Soc Symp 72 223-231 917

Gibson DG (2011) Chapter fifteen - Enzymatic Assembly of Overlapping DNA Fragments 918

In Methods in Enzymology V Christopher ed (Academic Press) pp 349-361 919

Goedhart J von Stetten D Noirclerc-Savoye M Lelimousin M Joosen L Hink MA 920

van Weeren L Gadella TWJ and Royant A (2012) Structure-guided evolution of 921

cyan fluorescent proteins towards a quantum yield of 93 Nat Commun 3 751 922

Heinz S Liauw P Nickelsen J and Nowaczyk M (2016) Analysis of photosystem II 923

biogenesis in cyanobacteria Biochim Biophys Acta 1857 274-287 924

Hernaacutendez-Prieto M and Futschik M (2012) CyanoEXpress A web database for 925

exploration and visualisation of the integrated transcriptome of cyanobacterium 926

Synechocystis sp PCC6803 Bioinformation 8 634-638 927

Hernaacutendez-Prieto MA Semeniuk TA Giner-Lamia J and Futschik ME (2016) The 928

Transcriptional Landscape of the Photosynthetic Model Cyanobacterium 929

Synechocystis sp PCC6803 Sci Rep 6 22168 930

29

Huang F Fulda S Hagemann M and Norling B (2006) Proteomic screening of salt-931

stress-induced changes in plasma membranes of Synechocystis sp strain PCC 6803 932

Proteomics 6 910-920 933

Kirchhoff H (2013) Architectural switches in plant thylakoid membranes Photosynth Res 934

116 481-487 935

Klinkert B Elles I and Nickelsen J (2006) Translation of chloroplast psbD mRNA in 936

Chlamydomonas is controlled by a secondary RNA structure blocking the AUG start 937

codon Nucleic Acids Res 34 386-394 938

Klinkert B Ossenbuumlhl F Sikorski M Berry S Eichacker L and Nickelsen J (2004) 939

PratA a periplasmic tetratricopeptide repeat protein involved in biogenesis of 940

photosystem II in Synechocystis sp PCC 6803 J Biol Chem 279 44639-44644 941

Komenda J Nickelsen J Tichyacute M Praacutešil O Eichacker LA and Nixon PJ (2008) The 942

cyanobacterial homologue of HCF136YCF48 is a component of an early photosystem 943

II assembly complex and is important for both the efficient assembly and repair of 944

photosystem II in Synechocystis sp PCC 6803 J Biol Chem 283 22390-22399 945

Kopf M Klaumlhn S Scholz I Matthiessen JKF Hess WR and Voszlig B (2014) 946

Comparative analysis of the primary transcriptome of Synechocystis sp PCC 6803 947

DNA Res 21 527-539 948

Kunkel DD (1982) Thylakoid centers Structures associated with the cyanobacterial 949

photosynthetic membrane system Arch Microbiol 133 97-99 950

Liberton M Howard Berg R Heuser J Roth R and Pakrasi BH (2006) Ultrastructure 951

of the membrane systems in the unicellular cyanobacterium Synechocystis sp strain 952

PCC 6803 Protoplasma 227 129-138 953

Liberton M Saha R Jacobs JM Nguyen AY Gritsenko MA Smith RD 954

Koppenaal DW and Pakrasi HB (2016) Global Proteomic Analysis Reveals an 955

Exclusive Role of Thylakoid Membranes in Bioenergetics of a Model 956

Cyanobacterium Mol Cell Proteomics 15 2021-2032 957

Luque I and Ochoa de Alda JAG (2014) CURT1CAAD-containing aaRSs thylakoid 958

curvature and gene translation Trends Plant Sci 19 63-66 959

Marin K Stirnberg M Eisenhut M Kraumlmer R and Hagemann M (2006) Osmotic stress 960

in Synechocystis sp PCC 6803 low tolerance towards nonionic osmotic stress results 961

from lacking activation of glucosylglycerol accumulation Microbiology 152 2023-962

2030 963

Mullineaux CW (2005) Function and evolution of grana Trends Plant Sci 10 521-525 964

30

Mullineaux CW (2008) Biogenesis and dynamics of thylakoid membranes and the 965

photosynthetic apparatus In The Cyanobacteria A Herrero and E Flores eds 966

(Norfolk UK Caister Academic Press) pp 289ndash304 967

Nevo R Charuvi D Tsabari O and Reich Z (2012) Composition architecture and 968

dynamics of the photosynthetic apparatus in higher plants Plant J 70 157-176 969

Nickelsen J and Rengstl B (2013) Photosystem II assembly From cyanobacteria to plants 970

Annu Rev Plant Biol 64 609-635 971

Nickelsen J and Zerges W (2013) Thylakoid biogenesis has joined the new era of bacterial 972

cell biology Front Plant Sci 4 458 973

Nilsson F Simpson DJ Jansson C and Andersson B (1992) Ultrastructural and 974

biochemical characterization of a Synechocystis 6803 mutant with inactivated psbA 975

genes Arch Biochem Biophys 295 340-347 976

Odom WR Hodges R Chitnis PR and Guikema JA (1993) Characterization of 977

Synechocystis sp PCC 6803 in iron-supplied and iron-deficient media Plant Mol 978

Biol 23 1255-1264 979

Ossenbuumlhl F Inaba-Sulpice M Meurer J Soll J and Eichacker LA (2006) The 980

Synechocystis sp PCC 6803 Oxa1 homolog is essential for membrane integration of 981

reaction center precursor protein pD1 Plant Cell 18 2236-2246 982

Pisareva T Kwon J Oh J Kim S Ge C Wieslander Aring Choi J-S and Norling B 983

(2011) Model for Membrane Organization and Protein Sorting in the Cyanobacterium 984

Synechocystis sp PCC 6803 Inferred from Proteomics and Multivariate Sequence 985

Analyses J Proteome Res 10 3617-3631 986

Pribil M Labs M and Leister D (2014) Structure and dynamics of thylakoids in land 987

plants J Exp Bot 65 1955-1972 988

Rast A Heinz S and Nickelsen J (2015) Biogenesis of thylakoid membranes Biochim 989

Biophys Acta 1847 821-830 990

Rast A Rengstl B Heinz S Klingl A and Nickelsen J (2016) The role of Slr0151 a 991

tetratricopeptide repeat protein from Synechocystis sp PCC 6803 during Photosystem 992

II assembly and repair Front Plant Sci 7 605 993

Rengstl B Oster U Stengel A and Nickelsen J (2011) An Intermediate Membrane 994

Subfraction in Cyanobacteria Is Involved in an Assembly Network for Photosystem II 995

Biogenesis J Biol Chem 286 21944-21951 996

31

Rengstl B Knoppovaacute J Komenda J and Nickelsen J (2013) Characterization of a 997

Synechocystis double mutant lacking the photosystem II assembly factors YCF48 and 998

Sll0933 Planta 237 471-480 999

Rexroth S Mullineaux CW Ellinger D Sendtko E Roumlgner M and Koenig F (2011) 1000

The Plasma Membrane of the Cyanobacterium Gloeobacter violaceus Contains 1001

Segregated Bioenergetic Domains Plant Cell 23 2379-2390 1002

Rippka R Deruelles J Waterbury JB Herdman M and Stanier RY (1979) Generic 1003

Assignments Strain Histories and Properties of Pure Cultures of Cyanobacteria 1004

Microbiology 111 1-61 1005

Ruumltgers M and Schroda M (2013) A role of VIPP1 as a dynamic structure within 1006

thylakoid centers as sites of photosystem biogenesis Plant Signal Behav 8 e27037 1007

Sacharz J Bryan SJ Yu J Burroughs NJ Spence EM Nixon PJ and Mullineaux 1008

CW (2015) Sub-cellular location of FtsH proteases in the cyanobacterium1009

Synechocystis sp PCC 6803 suggests localised PSII repair zones in the thylakoid1010

membranes Mol Microbiol 96 448-4621011

Sandstroumlm S Park Y-I Oumlquist G and Gustafsson P (2001) CP43prime the isiA Gene 1012

Product Functions as an Excitation Energy Dissipator in the Cyanobacterium 1013

Synechococcus sp PCC 7942 Photochem Photobiol 74 431-437 1014

Schindelin J Arganda-Carreras I Frise E Kaynig V Longair M Pietzsch T 1015

Preibisch S Rueden C Saalfeld S Schmid B Tinevez J-Y White DJ 1016

Hartenstein V Eliceiri K Tomancak P and Cardona A (2012) Fiji an open-1017

source platform for biological-image analysis Nat Methods 9 676-682 1018

Schottkowski M Ratke J Oster U Nowaczyk M and Nickelsen J (2009a) Pitt a novel 1019

tetratricopeptide repeat protein involved in light-dependent chlorophyll biosynthesis 1020

and thylakoid membrane biogenesis in Synechocystis sp PCC 6803 Mol Plant 2 1021

1289-1297 1022

Schottkowski M Gkalympoudis S Tzekova N Stelljes C Schuumlnemann D Ankele E 1023

and Nickelsen J (2009b) Interaction of the periplasmic PratA factor and the PsbA 1024

(D1) protein during biogenesis of photosystem II in Synechocystis sp PCC 6803 J 1025

Biol Chem 284 1813-1819 1026

Selatildeo TT Zhang L Knoppovaaacute J Komenda J and Norling B (2016) Photosystem II 1027

Assembly Steps Take Place in the Thylakoid Membrane of the Cyanobacterium 1028

Synechocystis sp PCC6803 Plant Cell Physiol 57 878 1029

32

Spaumlt P Maček B and Forchhammer K (2015) Phosphoproteome of the cyanobacterium 1030

Synechocystis sp PCC 6803 and its dynamics during nitrogen starvation Front 1031

Microbiol 6 248 1032

Stengel A Guumlgel IL Hilger D Rengstl B Jung H and Nickelsen J (2012) Initial 1033

steps of photosystem II de novo assembly and preloading with manganese take place 1034

in biogenesis centers in Synechocystis Plant Cell 24 660-675 1035

Uniacke J and Zerges W (2007) Photosystem II assembly and repair are differentially 1036

localized in Chlamydomonas Plant Cell 19 3640-3654 1037

Uniacke J and Zerges W (2009) Chloroplast protein targeting involves localized 1038

translation in Chlamydomonas Proc Natl Acad Sci USA 106 1439-1444 1039

van de Meene AL Hohmann-Marriott M Vermaas WJ and Roberson R (2006) The 1040

three-dimensional structure of the cyanobacterium Synechocystis sp PCC 6803 Arch 1041

Microbiol 184 259-270 1042

van de Meene AML Sharp WP McDaniel JH Friedrich H Vermaas WFJ and 1043

Roberson RW (2012) Gross morphological changes in thylakoid membrane 1044

structure are associated with photosystem I deletion in Synechocystis sp PCC 6803 1045

Biochim Biophys Acta 1818 1427-1434 1046

Watanabe M and Ikeuchi M (2013) Phycobilisome architecture of a light-harvesting 1047

supercomplex Photosynth Res 116 265-276 1048

Wellburn AR and Lichtenthaler H (1984) Formulae and Program to Determine Total 1049

Carotenoids and Chlorophylls A and B of Leaf Extracts in Different Solvents In 1050

Advances in Photosynthesis Research Proceedings of the VIth International Congress 1051

on Photosynthesis Brussels Belgium August 1ndash6 1983 C Sybesma ed (Dordrecht 1052

Springer Netherlands) pp 9-12 1053

Wilde A Lunser K Ossenbuumlhl F Nickelsen J and Borner T (2001) Characterization of 1054

the cyanobacterial ycf37 mutation decreases the photosystem I content Biochem J 1055

357 211-216 1056

Wilson A Boulay C Wilde A Kerfeld CA and Kirilovsky D (2007) Light-Induced 1057

Energy Dissipation in Iron-Starved Cyanobacteria Roles of OCP and IsiA Proteins 1058

Plant Cell 19 656-672 1059

Xu M Bernaacutet G Singh A Mi H Roumlgner M Pakrasi HB and Ogawa T (2008) 1060

Properties of Mutants of Synechocystis sp Strain PCC 6803 Lacking Inorganic Carbon 1061

Sequestration Systems Plant Cell Physiol 49 1672-1677 1062

33

Yamamoto T Burke J Autz G and Jagendorf AT (1981) Bound ribosomes of Pea 1063

chloroplast thylakoid membranes location and release in vitro by high salt 1064

puromycin and RNase Plant Physiol 67 940-949 1065

Yang H Liao L Bo T Zhao L Sun X Lu X Norling B and Huang F (2014) 1066

Slr0151 in Synechocystis sp PCC 6803 is required for efficient repair of photosystem 1067

II under high-light condition J Integr Plant Biol 56 1136-1150 1068

Yeremenko N Kouřil R Ihalainen JA DHaene S van Oosterwijk N 1069

Andrizhiyevskaya EG Keegstra W Dekker HL Hagemann M Boekema EJ 1070

Matthijs HCP and Dekker JP (2004) Supramolecular Organization and Dual 1071

Function of the IsiA Chlorophyll-Binding Protein in Cyanobacteria Biochemistry 43 1072

10308-10313 1073

Zak E Norling B Maitra R Huang F Andersson B and Pakrasi HB (2001) The 1074

initial steps of biogenesis of cyanobacterial photosystems occur in plasma membranes 1075

Proc Natl Acad Sci USA 98 13443-13448 1076

Zang X Liu B Liu S Arunakumara KKIU and Zhang X (2007) Optimum 1077

Conditions for Transformation of Synechocystis sp PCC 6803 J Microbiol 45 241-1078

245 1079

Zhang L and Sakamoto W (2015) Possible function of VIPP1 in maintaining chloroplast 1080

membranes Biochim Biophys Acta 1847 831-837 1081

Zimmerberg J and Kozlov MM (2006) How proteins produce cellular membrane 1082

curvature Nat Rev Mol Cell Biol 7 9-19 1083

Zoumlfel P (1988) Statistik in der Praxis (Stuttgart Germany Gustav Fischer Verlag) 1084

1085

34

Figure Legends 1086

Figure 1 General characteristics of CurT A) Sequence alignment of CurT and CURT1A-D 1087

from A thaliana Predicted chloroplast transit-peptide sequences of CURT1A-D are omitted 1088

(Armbruster et al 2013) Positions of predicted C-terminal transmembrane domains (TDM) 1089

are marked (black bar) as is the position of the predicted amphipathic N-terminal helix in 1090

CurT (red bar) The green bar denotes the peptide sequence used for antibody production 1091

Identical and related amino acids that are conserved in 100 80 and 60 of the sequences 1092

are highlighted in black dark grey and light grey respectively B) Helical-wheel 1093

representation of the N-terminal amphipathic helix of CurT (red bar in A) The color code 1094

reflects the physicochemical properties of amino-acid side-chains green polar and 1095

uncharged blue polar and positively charged red polar and negatively charged yellow 1096

hydrophobic C) Solubility of CurT Membrane-associated proteins (50 microg) from wild-type 1097

cells were extracted with 5 mM HEPES (pH 76) containing either 1 M NaCl 01 M Na2CO3 1098

4 M urea 01 Triton X-100 or no additional solute After separation of membrane-bound 1099

(M) and solubilized (S) proteins by centrifugation proteins were fractionated by SDS-PAGE1100

and CurT was immunodetected on immunoblots As a control the integral membrane protein 1101

CP47 from PSII was analyzed in parallel D) Transmission electron micrographs of negatively 1102

stained liposomes Cell-free expression (CFE) of CurT and A thaliana CURT1A was 1103

performed in the presence of liposomes similar in composition to the lipids of the thylakoid 1104

membrane Liposomes before and after cell-free protein expression in the absence of DNA 1105

served as negative controls Black arrowheads indicate tubular connections between 1106

liposomes Scale bars 250 nm 1107

1108

Figure 2 Ultrastructural analysis of curT- cells Transmission electron micrographs of typical 1109

wild-type (A) and curT- (B-D) Synechocystis 6803 cells taken at 44000times (A B) and 28000times 1110

(C D) magnification respectively Ultrathin sections (35 to 45 nm) of cryofixed samples 1111

were stained with osmium tetroxide and post-stained using lead citrate Arrowheads indicate 1112

biogenesis centers Scale bars 200 nm (A B) and 500 nm (C D) respectively 1113

1114

Figure 3 Accumulation of components of photosynthetic complexes in the curT- mutant A) 1115

Whole cell extracts (30 microg protein) from wild-type and curT- strains were fractionated by 1116

SDS-PAGE and analyzed on immunoblots using the indicated antibodies B) The histogram 1117

shows levels of the indicated proteins in curT- extracts relative to wild-type samples (dashed 1118

red line) Data are means plusmn SD of three independent experiments Significant differences from 1119

35

wild-type protein levels according to Studentrsquos t-test with error probabilities of 5 and 1 1120

are indicated by and respectively 1121

1122

Figure 4 P700+ reduction kinetics and high-light effects in curT- cells A) Averaged traces 1123

(10 single measurements) of P700+ decay after complete oxidation by a 50-ms multiple 1124

turnover pulse (10000 micromol photons m-2 s-1) in the absence and presence of 10 microM DCMU 1125

B) Rate constants for P700+ reduction were obtained by fitting of the data with single1126

exponential functions Error bars indicate the SD of three independent measurements C) 1127

Impact of light intensity on the (relative) electron transport rate (rETR) Cells were exposed to 1128

gradually increasing light intensities which resulted in increasing electron transport until the 1129

capacity limit was reached PAR light intensity (micromol photons m-2 s-1) Error bars indicate the 1130

SD of three independent measurements D) D1 protein level in wild-type and curT- after high-1131

light treatment (800 micromol photons m-2s-1) in the presence and absence of lincomycin Samples 1132

were taken every 30 min and processed as in Figure 3 to determine the level of D1 present 1133

100 refers to wild-type D1 level at the beginning of the experiment 1134

1135

Figure 5 PSII assembly in curT- cells A) BNSDS-PAGE of membrane proteins Membrane 1136

fractions from wild-type and curT- cells were solubilized with 13 n-dodecyl-β-maltoside 1137

and proteins were fractionated by two-dimensional BNSDS-PAGE blotted and probed with 1138

antibodies against the PSII subunits D1 D2 CP47 and CP43 Wild-type blots were also 1139

probed with the αCurT antibody The sizes of marker proteins and the positions of PSII 1140

assembly intermediates (RCCII RCCI RC47) are shown above and below each image B) In 1141

vivo pulse labeling of membrane proteins with 35S Pulse-labeled PSII core proteins were 1142

separated via BNSDS-PAGE and visualized by autoradiography 1143

1144

Figure 6 Loss of CurT induces stress A) Low-temperature (77 K) fluorescence emission of 1145

Synechocystis 6803 wild-type (blue) and curT- (red) cells excited at 440 nm The spectra were 1146

normalized to the added fluorescein standard B) Low-temperature (77 K) fluorescence 1147

emission of Synechocystis 6803 wild-type (blue) and curT- (red) excited at 580 nm The 1148

spectra were normalized to 780 nm C) Level of IsiA in the curT- mutant relative to the wild-1149

type A mean value of 368 plusmn 96 (SD) was determined from three independent experiments 1150

1151

Figure 7 Membrane sublocalization of PSII-related factors Cell extracts from wild-type and 1152

curT- cells were fractionated by two consecutive rounds of sucrose-density gradient 1153

36

centrifugation (Schottkowski et al 2009b) The second linear gradient (20-60 sucrose) was 1154

apportioned into 14 fractions which were analyzed by immunoblotting using the indicated 1155

antibodies Fractions 1ndash6 represent PDMs and fractions 7ndash14 thylakoid membranes (TMs) 1156

To facilitate comparison between gradients sample volumes were normalized to the volume 1157

of fraction 7 that contained 40 microg of protein 1158

1159

Figure 8 Live-cell imaging of the curT-CFP strain by fluorescence microscopy In the curT-1160

CFP strain the native curT gene has been replaced by a CFP-tagged version resulting in the 1161

expression of the CurT-CFP fusion protein under the control of the native promotor A) 1162

Close-up views of the mid-cell plane in the CFP and far-red autofluorescence channels shown 1163

in slice 7 in panel B B) Synechocystis 6803 cells expressing CurT C-terminally fused to the 1164

mTurquoise2 variant of CFP from its native chromosomal promoter The two imaging 1165

channels are displayed as Z-axis montages (auto-scaled contrast step size 250 nm) in 1166

grayscale and color composite configuration The thylakoid autofluorescent channel as 1167

imaged in far-red fluorescence is depicted in magenta and CurT signal as imaged in cyan 1168

fluorescence is depicted in cyan C) Fluorescence intensity profiles of the two channels along 1169

the autofluorescent peripheral cell ldquoringrdquo are shown for slice 7 The maximum projection of 1170

the entire Z montage is also shown Scale bars (light grey) 2 microm 1171

1172

Figure 9 Immunofluorescence detection of CurT A) Close-ups of slice 5 in panel B B) 1173

Wild-type Synechocystis 6803 cells labeled with αCurT antibodies and detected with Oregon 1174

Green-conjugated secondary antibodies The Z-axis montages are shown as in Figure 8B 1175

except that the step size is 280 nm (1 to 10) C) Intensity profiles of the two channels along 1176

the autofluorescent peripheral cell ldquoringrdquo are shown for slice 5 The maximum projection of 1177

the entire Z montage is also shown Scale bars (light grey) 2 microm 1178

1179

Figure 10 Subcellular localization of CurT Ultrathin sections of wild-type Synechocystis 1180

6803 cells were incubated with rabbit αCurT prior to incubation with gold-conjugated goat 1181

anti-rabbit IgG A) Negative control (wild-type processed without addition of primary 1182

antibody) B C) Immunogold-labeled sections showing CurT localization at the cytoplasmic 1183

side of the thylakoid membrane D) Cluster formation of CurT signals at a putative biogenesis 1184

center from C E) Biogenesis center from the same cell (C) without any obvious CurT 1185

clustering of gold particles F) Schematic depiction of a wild-type cell (from Figure 2A) with 1186

color-coded curved membranes green = thylakoids that follow the curvature of the cell red = 1187

37

thylakoids that bend away from the plasma membrane yellow = thylakoids that bend toward 1188

the plasma membrane to converge on sites of biogenesis centers G) Relative distribution of 1189

gold signals between convex (dark color) and concave (light color) sides of membranes (n = 1190

1584 signals from a total of 95 cells) The undifferentiated overall signal distribution is given 1191

in blue Bars = 200 nm (overview) and 100 nm (details) 1192

1193

Figure 11 Differentially modified forms of CurT are found in different complexes in PDMs 1194

and thylakoid membranes Samples were isolated by fractionation of wild-type membranes 1195

via two consecutive sucrose density gradients according to Schottkowski et al (2009b) After 1196

density centrifugation samples were applied to BNSDS-PAGE analysis (A) or isoelectric 1197

focusing (B) Numbers on the right indicate the respective fraction from the second gradient 1198

(see Figure 7) Fraction 5 represents the PDMs and fraction 9 the thylakoid membrane 1199

1200

Figure 12 Loss of CurT increases sensitivity to abiotic stress A B) Doubling times of wild-1201

type and curT- under salt stress (A) or osmotic stress (B) Doubling times are means plusmn SD of 1202

three independent cultures C) Localization of CurT-CFP under salt and osmotic stress 1203

Samples were examined as described in Figure 8 Scale bars 1 microm D) Protein levels of wild-1204

type cells after growth in BG11 medium containing 500 mM NaCl Samples were analyzed on 1205

the same gel but unrelated samples between the presented signals were omitted E) 1206

Membrane preparations obtained from wild-type cells wild-type cells grown in the presence 1207

of 500 mM NaCl and curT- cells were subjected to the first gradient step in the membrane 1208

fractionation scheme The gradient was divided into five fractions and 10 of fractions I-IV 1209

and 02 of fraction V were analyzed by SDS-PAGE Fraction II includes the plasma 1210

membrane and fraction V consists of PratA-defined membrane and thylakoid membrane 1211

1212

Figure 13 Model of CurT distribution at convergence zones in Synechocystis 6803 The 1213

distribution of CurT in thylakoid (green) and plasma membranes (brown) is shown The 1214

pattern of localization of CurT in the thylakoid membrane is derived from membrane 1215

fractionation via sucrose density centrifugation fluorescence-based detection of the CurT-1216

CFP fusion and endogenous CurT and immunogold labeling experiments (Figures 7-10) The 1217

different CurT variants a b c and d identified in the IEF experiments (Figure 11) are depicted 1218

in yellow pink blue and black respectively CurT present in the plasma membrane is 1219

highlighted in gray as its precise nature and role remain to be defined (Figure 12) 1220

Membranes are represented as lipid bilayers Convex and concave faces of bent thylakoid 1221

38

sheets are indicated by black arrows The PDM which is dedicated to PSII assembly and 1222

repair is depicted in blue The dotted blue line emphasizes that the ultrastructure in this region 1223

has not yet been fully resolved PP periplasm PM plasma membrane TM thylakoid 1224

membrane L lumen PDM PratA-defined membrane 1225

1226

Tables 1227

Table 1 Physiological characteristics of the curT- mutant 1228

Strain Doubling time [h]

Oxygen Evolution[nmol h-1 OD750

-1]c

Chlorophyll content

[microg OD750-1]

d

Cell size [microm]e

Cell number [ml-1 OD750

-1]f

Wild type 817plusmn017a 1600plusmn042

b 1933plusmn187 251plusmn014 264plusmn020 390plusmn006 x 107

curT- 1259plusmn020a 3226plusmn056

b 1074plusmn20 195plusmn029 274plusmn044 367plusmn016 x 107

1229 abDoubling times in the presence (a) or absence (b) of 5 mM glucose measured under 1230

continuous illumination at 30 micromol photons m-2 s-1 and CO2-limiting conditions cOxygen 1231

evolution is expressed in nmol O2 produced per hour per OD750 unit dChlorophyll content is 1232

expressed in microg OD750-1 eThe diameter of non-dividing cells is presented in microm fCell number 1233

was determined per ml per OD750 Data are means plusmn SD of at least three independent 1234

experiments 1235

1236

Parsed CitationsAllen JF de Paula WBM Puthiyaveetil S and Nield J (2011) A structural phylogenetic map for chloroplast photosynthesisTrends Plant Sci 16 645-655

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Anderson JM Horton P Kim E-H and Chow WS (2012) Towards elucidation of dynamic structural changes of plant thylakoidarchitecture Philos Trans R Soc Lond B Biol Sci 367 3515-3524

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Armbruster U Zuumlhlke J Rengstl B Kreller R Makarenko E Ruumlhle T Schuumlnemann D Jahns P Weisshaar B NickelsenJ and Leister D (2010) The Arabidopsis thylakoid protein PAM68 is required for efficient D1 biogenesis and photosystem IIassembly Plant Cell 22 3439-3460

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Armbruster U Labs M Pribil M Viola S Xu W Scharfenberg M Hertle AP Rojahn U Jensen PE Rappaport F JoliotP Doumlrmann P Wanner G and Leister D (2013) Arabidopsis CURVATURE THYLAKOID1 proteins modify thylakoid architectureby inducing membrane curvature Plant Cell 25 2661-2678

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Aseeva E Ossenbuumlhl F Sippel C Cho WK Stein B Eichacker LA Meurer J Wanner G Westhoff P Soll J andVothknecht UC (2007) Vipp1 is required for basic thylakoid membrane formation but not for the assembly of thylakoid proteincomplexes Plant Physiol Biochem 45 119-128

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Bartsevich VV and Pakrasi HB (1995) Molecular identification of an ABC transporter complex for manganese analysis of acyanobacterial mutant strain impaired in the photosynthetic oxygen evolution process EMBO J 14 1845-1853

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Bartsevich VV and Pakrasi HB (1996) Manganese transport in the cyanobacterium Synechocystis sp PCC 6803 J Biol Chem271 26057-26061

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Bernaacutet G Waschewski N and Roumlgner M (2009) Towards efficient hydrogen production the impact of antenna size andexternal factors on electron transport dynamics in Synechocystis PCC 6803 Photosynth Res 99 205-216

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Boehm M Yu J Krynicka V Barker M Tichy M Komenda J Nixon PJ and Nield J (2012) Subunit Organization of aSynechocystis Hetero-Oligomeric Thylakoid FtsH Complex Involved in Photosystem II Repair Plant Cell 24 3669-3683

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Bradford MM (1976) A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle ofprotein-dye binding Anal Biochem 72 248-254

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Chang L Liu X Li Y Liu C-C Yang F Zhao J and Sui S-F (2015) Structural organization of an intact phycobilisome and itsassociation with photosystem II Cell Res 25 726-737

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Danielsson R Suorsa M Paakkarinen V Albertsson P-Aring Styring S Aro E-M and Mamedov F (2006) Dimeric andmonomeric organization of photosystem II Distribution of five distinct complexes in the different domains of the thylakoidmembrane J Biol Chem 281 14241-14249

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Daum B Nicastro D Austin J McIntosh JR and Kuumlhlbrandt W (2010) Arrangement of photosystem II and ATP synthase in

5

Figure 1D) Like the grana-forming CURT1A its Synechocystis 6803 homolog efficiently 144

induced localized ldquocompressionrdquo of liposomes into thin tubule-like segments revealing its 145

strong membrane-curving activity (Figure 1D) Hence the membrane-shaping function of 146

members of the CURT1 family is conserved from cyanobacteria to plants Nevertheless 147

liposome shapes caused by either CurT or CURT1A displayed some differences in the degree 148

of membrane tubulation These might be due to the variable N-termini of both proteins 149

(Figure 1D) 150

To dissect the function of CurT in vivo we generated a knock-out mutant by inserting 151

a kanamycin-resistance cassette into the unique AgeI site in the slr0483 reading frame 152

(Supplemental Figure 1A Methods) Complete segregation of the mutation was confirmed by 153

PCR and immunoblot analyses (Supplemental Figure 1B and 1C) Progressively higher levels 154

of antibiotic (up to 400 microg kanamycinml) were used for mutant selection as previous 155

attempts to select a fully segregated curT- mutant had been unsuccessful probably due to 156

application of insufficient selection pressure (Armbruster et al 2013) When growth rates of 157

wild-type and mutant cells were compared 20- and 15-fold increases in doubling time were 158

observed for curT- grown under photoauto- and photoheterotrophic conditions respectively 159

(Table 1 Supplemental Figure 2) 160

Strikingly curT inactivation also led to loss of competence for DNA uptake during 161

both transformation and conjugation-based experiments Hence attempts to complement the 162

curT- mutant were not applicable However in the course of the work four independent 163

rounds of transformation of wild-type cells were carried out to generate fresh curT- mutants 164

All mutant strains obtained the same phenotype strongly suggesting that no secondary sites 165

were involved in its establishment To rule out the possibility that read-through transcription 166

from the resistance marker gene affects the upstream reading frame slr0482 (of unknown 167

function) in the mutant RT-PCR with appropriate primers was performed (Supplemental 168

Figure 3) No change in slr0482 mRNA accumulation was observed confirming that the curT- 169

phenotype is caused by disruption of the curT gene In agreement with this finding recent 170

transcriptome analyses of Synechocystis 6803 have clearly shown that the curT mRNA is 171

monocistronic (Kopf et al 2014) 172

In view of CurTrsquos in vitro membrane-tubulating activity the ultrastructure of the curT- 173

mutant was examined by TEM As shown in Figure 2A the wild-type strain exhibits the 174

typical thylakoid organization with ordered thylakoid sheets at the cell periphery and 175

convergence zones next to the plasma membrane In contrast massive disorganization of the 176

thylakoid membrane system was observed in curT- In all cells analyzed the mutant 177

6

thylakoids appeared as disordered sheets that traversed the cytoplasm and completely lacked 178

the typical convergence zones with the corresponding biogenesis centers at the periphery 179

(Figures 2B-D) This indicates a strict requirement of CurT for the establishment of normal 180

thylakoid membrane architecture in Synechocystis 6803 181

182

Inactivation of curT affects photosynthetic performance 183

The severely altered morphology of the thylakoid membrane system in curT- cells and 184

in particular the lack of PSII-related biogenesis centers prompted us to investigate the 185

photosynthetic performance of the mutant (Stengel et al 2012) The chlorophyll content was 186

reduced by ~20 and absorption spectroscopy also revealed a reduction in phycobilisomes 187

as well as an increase in carotenoid levels (Table 1 Supplemental Figure 4) Despite changes 188

in ultrastructure and pigment levels size and number of curT- cells at OD750 were not 189

significantly different as judged by t-test-based statistical analysis (Table 1) 190

To explore the photosynthetic defects of the mutant in detail immunoblot analyses 191

were performed using antibodies raised against specific subunits of photosynthetic complexes 192

and some of their biogenesis factors In curT- PSII reaction-center subunits including D1 D2 193

CP47 and CP43 were found to be present at 44 42 56 and 45 of the wild-type level 194

respectively (Figure 3) Interestingly amounts of the PSII assemblyrepair factors PratA and 195

Slr0151 as well as the light-dependent protochlorophyllide oxidoreductase (POR) enzyme 196

were also reduced (Figure 3 Yang et al 2014 Rast et al 2016) Levels of the Pitt protein 197

which interacts with POR (Schottkowski et al 2009a) and the Oxa homolog YidC 198

(Ossenbuumlhl et al 2006) were slightly increased in curT- (Figure 3) On the other hand 199

Sll0933 the homolog of the PSII assembly factor PAM68 in A thaliana accumulated to 200

250 of the wild-type level (Armbruster et al 2010) In contrast amounts of both Cytf and 201

PsaA which serve as markers for the Cyt(b6f) and PSI complexes respectively the RbcL 202

subunit of the Rubisco enzyme the PSII assembly factor Ycf48 (Komenda et al 2008) and 203

VIPP1 remained unaltered in curT- (Figure 3) Overall the alterations in protein accumulation 204

indicate that loss of CurT preferentially affects the accumulation of PSII 205

This result was further corroborated by analysis of the photosynthetic performance of 206

curT- The rate of light-dependent oxygen evolution was reduced by approximately 50 in the 207

mutant (Table 1) and analysis of P700+ reduction kinetics revealed impaired electron donation 208

by PSII (Figure 4A) PSII-driven P700+ reduction is slowed down by a factor of three in curT-209

whereas the residual cyclic electron transfer activity in the presence of DCMU is less than 210

5 in both wild-type and curT- (Figure 4B) In contrast the light intensity-dependent electron 211

7

transfer capacity which was measured as relative electron transfer rate (rETR) did not differ 212

significantly between wild-type and curT- (Figure 4C) Both wild-type and curT- cells reach a 213

capacity limit at ~ 250 micromol photons m-2s-1 and the decay of rETR beyond the capacity limit 214

is very similar These results indicate that the point of onset of PSII-related photoinhibition is 215

the same in both strains which in turn implies that electron flow downstream of PSII is 216

unchanged in the mutant 217

Low PSII levels in curT- could be caused either by reduced synthesisbiogenesis or its 218

enhanced degradation To measure the rates of D1 repair the kinetics of D1 accumulation 219

upon induction of photoinhibition by high-light treatment (800 micromol photons m-2s-1) was 220

assayed by immunological means (Figure 4D) In wild-type cells the D1 level decreased to 221

60 (relative to the initial time point) after 90 min of treatment As previously shown the 222

drop is much more pronounced (~35 left) when repair synthesis of D1 is inhibited by the 223

addition of lincomycin (Figure 4D Komenda et al 2008) Surprisingly in curT- the level of 224

residual D1 is rather stable over the same time period and lincomycin treatment induces a 225

more modest decrease to 60 relative to the initial time point (Figure 4D) These data clearly 226

indicate that in absence of CurT residual D1 is less susceptible to degradation even though 227

its absolute amount is reduced In line with this no effect on growth rates was observed when 228

either wild-type or curT- cells were cultivated for two days at 200 micromol photons m-2s-1 229

(Supplemental Figure 5) 230

To assess the role of CurT in the assembly of PSII we compared the two-dimensional 231

profiles of thylakoid membrane proteins from wild-type and mutant cells by Blue-Native 232

(BN)SDS-PAGE PSII assembly intermediates were subsequently visualized via 233

immunodetection of PSII core subunits As shown in Figure 5A dimeric PSII core complexes 234

(RCCII) are drastically underrepresented in curT- whereas relative levels of earlier assembly 235

intermediates including the monomeric CP43-less RC47 complex and non-assembled CP43 236

increase Parallel detection of CurT itself revealed a ldquosmearedrdquo signal in the size range from 237

15 up to 500 kDa suggesting that CurT forms part of high-molecular-weight complexes 238

(Figure 5A) Finally in vivo 35S protein pulse-labeling experiments confirmed that RC and 239

RC47 complexes in particular are efficiently formed in curT- but the transition to RCCI 240

complexes is severely delayed (Figure 5B) As a consequence dimeric RCCII complexes do 241

not incorporate any radioactive label over the experimentrsquos time course of 25 min (Figure 5B) 242

Taken together these data show that curT inactivation has a severe impact on PSII biogenesis 243

but little or no effect on the degradation of the complex 244

8

The data presented so far suggest a PSII-related phenotype for curT- so we explored 245

the effects of curT disruption on photosynthesis further by comparing the low-temperature 246

(77K) fluorescence emission spectra in cell suspensions following excitation of chlorophyll at 247

440 nm (Figure 6A) The signals were normalized to the emission maximum at 514 nm of the 248

external standard fluorescein (Figure 6A) In curT- the PSI emission peak amplitude was 249

similar to that of the wild-type (Figure 6A) The spectra differed however around 685 nm 250

Here we observed an increase in fluorescence in the mutant strain an emission signature that 251

is probably related to the inner antenna protein CP43 (Figure 6A Nilsson et al 1992) 252

Increased chlorophyll fluorescence at 685 nm has previously been shown to be characteristic 253

for cells that are accumulating the stress-induced IsiA protein which shares structural 254

similarities with CP43 (Odom et al 1993 Yeremenko et al 2004 Wilson et al 2007) A 255

second indication for accumulation of IsiA is a diagnostic blue shift of the 725 nm 256

fluorescence peak by approximately 5 nm which is indeed observed in the curT- spectrum 257

(Figure 6A Sandstroumlm et al 2001) We therefore determined the level of IsiA in both wild-258

type and curT- by immunoblot analysis As expected IsiA was strongly induced in curT- 259

suggesting that the mutant suffers from severe stress (Figure 6C) When fluorescence at 77K 260

was recorded after excitation at 580 nm which mainly excites the phycobiliproteins the 261

signal at 685 nm (PSII related) was enhanced in the curT- mutant most likely reflecting IsiA 262

emission andor the presence of uncoupled phycobilisomes (Figure 6B Wilson et al 2007) 263

In contrast the 725 nm peak (PSI related) was reduced in curT- relative to the wild-type 264

suggesting less coupling of phycobilisomes to PSI (Figure 6B) The increase in uncoupled 265

phycobilisomes can be directly attributed to the reduction in RCCII levels found in the curT- 266

mutant (Figure 5A) since phycobilisomes are attached to PSII dimers for efficient light 267

harvesting (Watanabe and Ikeuchi 2013 Chang et al 2015) 268

Thus the curT- mutant exhibits a characteristic set of photosynthetic defects The 269

primary target of the CurT membrane-shaping function appears to be PSII in particular in its 270

biogenic phase However the reduction in PSII content cannot be responsible for the lack of 271

thylakoid convergence zones at the plasma membrane because these structures can still be 272

observed in the psbA- mutant TD41 which is lacking D1 and therefore unable to assemble any 273

PSII complexes (Supplemental Figure 6 Nilsson et al 1992) 274

275

Subcellular localization of CurT 276

We have previously proposed that the initial steps in PSII assembly take place in 277

biogenesis centers located at the interface between plasma and thylakoid membranes (Stengel 278

9

et al 2012) These biogenic membranes (PDMs) are marked by the PSII Mn2+ delivery factor 279

PratA and can be separated from thylakoids by a two-step sucrose-gradient centrifugation 280

procedure (Schottkowski et al 2009b Rengstl et al 2011) When the distributions of various 281

proteins within such membrane fractions from the wild-type and curT- were compared two 282

striking changes were detected in the mutant First the precursor of the D1 subunit of PSII 283

(pD1) is absent from PDMs in the mutant and secondly the inner antenna protein CP47 ndash but 284

not CP43 ndash of PSII shifts towards fractions of lower density (Figure 7) Hence the 285

organization of PDMs appears to be perturbed in curT- In wild-type cells most of the CurT 286

protein was found in thylakoid membranes only a minor fraction similar in amount to that of 287

the PSII assembly factors Ycf48 Pitt and YidC as well as the VIPP1 protein comigrated with 288

PDMs (Figure 7) According to rough estimates based on densitometric signal analysis 25 289

of total cellular CurT is normally found in the PDMs and 75 in the thylakoids (Figure 7) 290

To further analyze the localization of CurT in its cellular context in vivo we 291

constructed a translational fusion in which the monomeric enhanced cyan fluorescent protein 292

(CFP) mTurquoise2 (Goedhart et al 2012) is attached to the C-terminus of CurT and is 293

expressed under the control of the native curT promoter The resulting strain curT-CFP 294

showed a fully restored wild-type growth phenotype indicating that the CFP tag does not 295

affect CurTrsquos function (Supplemental Figure 7A) In agreement with this the fusion protein 296

accumulated to wild-type levels (96 plusmn 16 Supplemental Figure 7B) and localized to the 297

same membrane sub-fractions as does native CurT (Supplemental Figure 7C) The CurT-CFP 298

fluorescence signal was distinctly discernible above the wild-type autofluorescence 299

background (Supplemental Figure 8A) and was distributed in a network-like pattern with 300

concentrated areas at the cell periphery at mid-plane Analysis of CurT-CFP fluorescence in 301

Z-axis montages revealed that these signals often appeared as rod-like structures which 302

seemed to follow the spherical inner surface of the cell (Figure 8A B Supplemental Movie 1 303

and 2) In some cases these structures also appear to extend through the cytoplasm (Figure 304

8A and 8B Supplemental Movie 3) 305

When chlorophyll autofluorescence indicative of thylakoid membranes was visualized 306

in the same cell only a partial overlap with the CurT-CFP signal was observed (Figure 8 307

Supplemental Movie 1-3) Strikingly the peripheral CurT-CFP signals frequently reached 308

their maximal intensity in those areas where chlorophyll fluorescence was low ie where 309

thylakoid convergence zones are expected to form (Sacharz et al 2015) This becomes even 310

clearer when the intensity of a circumferential profile that follows the thylakoidrsquos 311

10

fluorescence signal is quantified separately for each of the two fluorescent channels (Figure 312

8C) 313

In contrast the chlorophyll autofluorescence in the curT- mutant seems to be evenly 314

distributed (Supplemental Figure 9) Following the fluorescence in an intensity profile as in 315

curT-CFP no regions with a similar decline in fluorescence were found most likely due to 316

the absence of biogenesis centers In addition some circular structures presenting chlorophyll 317

autofluorescence were detected in the interior of the cells Hence the disturbed curT- 318

ultrastructure is also reflected in the distribution of chlorophyll pigments (Supplemental 319

Figure 9) 320

To confirm the network-like distribution of CurT-CFP in the cell we used 321

immunofluorescence to detect CurT in the wild-type in situ Synechocystis 6803 cells were 322

fixed and treated with the αCurT antibody and an Oregon Green-conjugated secondary 323

antibody As shown in Figure 9A and B both techniques revealed similar network-like 324

patterns of the CurT signal which coalesced into rod-like structures at the cell surface and 325

essentially filled up the gaps between the autofluorescent thylakoid regions (negative controls 326

shown in Supplemental Figure 8B and 8C) Again regions of low chlorophyll fluorescence 327

typical of biogenesis centers generally exhibited stronger CurT-related fluorescence (Figure 328

8C) Occasionally CurT-CFP signals were also observed near traversing thylakoid lamellae 329

(when these were present in the cell analyzed) but the autofluorescence intensity of such 330

thylakoids is much weaker (see Figure 8B cell b in slice 6 and Supplemental Movie 3) 331

Finally CurT was localized by immunogold labeling experiments on ultrathin sections 332

of wild-type Synechocystis 6803 cells Almost no signals were detected when wild-type and 333

curT- sections were processed in the absence of the primary antibody as a negative control 334

(Figure 10A and Supplemental Figure 10A respectively) When mutant curT- cells were 335

processed in the presence of the αCurT antiserum a low level of randomly distributed 336

background signals was observed (Supplemental Figure 10B Supplemental Table 1) 337

However the number of signals located at the thylakoid membrane was clearly reduced 338

relative to the wild-type Therefore these signals were treated as non-specific background 339

Upon incubation of wild-type cell sections with antibodies directed against the N-terminus of 340

CurT (Figure 1A) the antigen was detected on the cytoplasmic surface of thylakoid 341

membranes (Figure 10B and 10C) This strongly suggests that its N-terminus is oriented 342

towards the cytoplasm Overall CurT signals appeared to be distributed along both thylakoids 343

and PDMs This agrees with the broad distribution of CurT across various fractions in the 344

membrane fractionation experiments (Figure 7) In only a few cases (12 ) however was 345

11

some clustering of immunogold signals at thylakoid convergence regions found (Figure 10D 346

and 10E) Thus the high local concentration of CurT at biogenic centers seen in the 347

fluorescence-based approaches (Figures 8 and 9) was not quantitatively reflected in the 348

immunogold labeling data This is likely due to the fact that immunogold electron microscopy 349

can only detect antigens on the surface of the section This issue is further complicated by the 350

heterogeneity of the CurT assemblies (see below and Discussion section) 351

Nevertheless closer inspection of the immunogold signals revealed an asymmetric 352

distribution of CurT signals with regard to the two faces of thylakoid sheets As illustrated in 353

Figure 10G curved thylakoid sheets possess a longer convex and a shorter concave face 354

When we analyzed a total of approximately 1500 CurT immunogold signals (from a total of 355

95 cells) which were unambiguously located to one side of the thylakoid membrane (for a 356

representative example see Supplemental Figure 11) 561 were found to be located at the 357

convex face while the other 439 localized to the concave side (Figure 10G Supplemental 358

Table 2) When differently curved regions (Figure 10F) including thylakoid lamellae (i) that 359

follow the overall shape of the cell (green) (ii) bend away from the plasma membrane (red) or 360

(iii) towards it ie where thylakoids converge to form biogenesis centers (yellow) were 361

examined separately red and green regions showed a CurT distribution in the range of 55 362

convex to 45 concave (Figure 10G Supplemental Table 2) However at the biogenesis 363

centers (the regions highlighted in yellow in Figure 10F) the uneven distribution of the 364

immunogold signals was more pronounced 61 of signals were found on the convex side 365

and 39 on the concave face of thylakoid lamellae (Figure 10G Supplemental Table 2) 366

Statistical analyses confirmed the significance of these differences in signal distributions 367

along the thylakoid membrane types (Supplemental Table 3) 368

Taken together with the finding that CurT is required for the formation of the 369

convergence sites forming biogenesis centers these data are consistent with the idea that the 370

thylakoid sheets are shaped by CurT which induces membrane curvature via asymmetric 371

intercalation on the two sides of thylakoid sheet 372

373

Different forms of CurT are found in PDMs and thylakoids 374

CurT was found to localize to both highly curved PDMs and less bent thylakoids Its 375

high local concentration at biogenic centers as seen in the fluorescence-based approaches 376

suggests a dosage-dependent effect of CurT on membrane shaping An alternative possibility 377

is that different CurT variants might exist in the two membrane types which could potentially 378

serve different functions To explore this possibility we asked whether CurT is found in 379

12

different complexes by using 2D BNSDS-PAGE to characterize membrane material isolated 380

via two-step sucrose gradient centrifugation (see Figure 7) In accordance with the data in 381

Figure 5A we find several low-molecular-weight complexes containing CurT (Figure 11A) 382

Smaller complexes of ~80 (complex I) and ~100 kDa (complex II) accumulate in membrane 383

fraction 5 (representing PDMs) but these are far less prevalent in fraction 9 representing 384

thylakoids (Figure 11A) In addition CurT-containing sub-complexes of ~140 (complex III) 385

and ~200 kDa (complex IV) are more prominently represented in thylakoids together with 386

even larger complexes ranging up to 670 kDa (Figure 11A) 387

Even more strikingly PDMs and thylakoids also differ with respect to the forms of 388

CurT they contain Thus isoelectric focusing (IEF) analysis of both membrane fractions 389

revealed at least four different CurT isoforms (a-d Figure 11B) PDMs contain mainly forms 390

b and d as well as trace amounts of a while thylakoids apparently possess very low levels of 391

form d and accumulate forms a b and c (Figure 11B) The nature of the underlying CurT 392

modifications still has to be determined Interestingly however CurT has recently been 393

identified as a phosphoprotein in a proteomic study (Spaumlt et al 2015) and the CurT variants 394

in Figure 11B may differ in their phosphorylation states At all events PDMs and thylakoids 395

can be distinguished by their complement of CurT isoforms which potentially play a role in 396

formation of the CurT sub-complexes that define the two membrane fractions 397

398

CurT is involved in the osmotic stress response 399

To further explore the stress-related role of CurT (Figure 6) and its link to IsiA 400

induction the effect of other potential stressors on curT- cells was tested High light levels had 401

a minor effect on curT- growth and its photosynthetic performance (Figure 4 Supplemental 402

Figure 5 and section above) suggesting that other environmental factors induced isiA 403

expression Our search was also motivated by a previous proteomic survey of plasma 404

membrane proteins of Synechocystis 6803 in high salt conditions in which CurT and VIPP1 405

were found among the most highly induced targets (Huang et al 2006) First we cultured 406

wild-type and curT- cells in different salt concentrations and found that growth of curT- was 407

severely affected in high salt (Figure 12A) Wild-type cells were only slightly affected by the 408

addition of salt to the medium The deleterious effect of the loss of curT on growth was even 409

more pronounced when maltose an osmotically active compound was present in the medium 410

(Figure 12B) Indeed curT- cells failed to survive exposure to 150 mM maltose whereas 411

growth of the wild-type was only slightly compromised These findings assign an additional 412

function to CurT ie a protective role during osmotic stress 413

13

When the curT-CFP strain was analyzed under these stress conditions enhanced 414

accumulation of CurT at the cell periphery was found mostly outside the autofluorescent 415

thylakoids and consistent with accumulation at the plasma membrane (Figure 12C) This was 416

further substantiated by membrane fractionation experiments which also revealed an 417

increased relative abundance of CurT in the plasma membrane fraction in the first sucrose 418

gradient (Figure 12E) Determination of total cellular CurT levels demonstrated that its 419

absolute amount did not increase under stress (Figure 12D) Therefore its higher abundance 420

in the plasma membrane under osmotic stress is likely to be due to CurT trafficking towards 421

the plasma membrane instead of increased synthesis 422

The same appears to hold true for VIPP1 which has been implicated in membrane 423

maintenance in both cyanobacteria and chloroplasts (Zhang and Sakamoto 2015) At stress 424

conditions an increase of the VIPP1 signal in the plasma membrane can be monitored in 425

wild-type (Figure 12E) However enhanced accumulation of VIPP1 in plasma membranes is 426

unaffected in the curT- mutant suggesting that thylakoid convergence zones are not strictly 427

required for the localization of VIPP1 428

429

Discussion 430

CurT determines thylakoid architecture 431

This study demonstrates that the protein CurT a homolog of the grana-forming 432

CURT1 proteins in plants is essential for establishing the proper thylakoid membrane 433

architecture in the cyanobacterium Synechocystis 6803 In particular CurTrsquos membrane-434

bending activity is likely to be required for the formation of thylakoid biogenesis centers at 435

points on the cell periphery where thylakoids converge towards the plasma membrane Here 436

PratA-mediated preloading of early PSII assembly intermediates with Mn2+ ions has been 437

proposed to take place together with PSII repair (Stengel et al 2012 Sacharz et al 2015) 438

This idea is supported by the following lines of evidence (i) The curT- mutant is devoid of 439

any thylakoid sectors that have convergence zones at their distal ends instead thylakoid 440

membranes are displaced and disposed as disordered or continuous rings (ii) CurT similarly 441

to CURT1A possesses a membrane-curving activity in vitro and intercalates asymmetrically 442

into thylakoids (iii) A high local concentration of CurT is observed at regions of high 443

curvature where biogenesis centers are found (iv) Lack of CurT affects the formation and 444

accumulation of PSII complexes as well as the abundance of some of its assembly factors 445

The drastic effects of CurT inactivation indicate an important role for this factor in membrane 446

shaping In contrast to the situation for CURT1A from Arabidopsis attempts to stably 447

14

overexpress CurT in Synechocystis 6803 failed Although short-lived transient increases in 448

CurT levels were observed when curT was expressed via strong heterologous promoters 449

wild-type levels of the protein were restored during subsequent rounds of cultivation of 450

transgenic lines Apparently Synechocystis 6803 cells do not tolerate substantial alterations in 451

CurT dosage and counter-select against these 452

This is in agreement with a dosage-dependent membrane-curving activity of CurT 453

which is suggested by its high local concentration at the edges of thylakoid autofluorescent 454

regions which mark the sites of the highly curved thylakoid convergence zones (Figures 8 9 455

and 13 Supplemental Movie 1 2 and 3) In addition some CurT was detected in structures 456

extending through the cytoplasm which most likely represent thylakoid sheets traversing the 457

cell from one thylakoid convergence zone to another (Figures 2A and 8) CurT might be 458

involved in the formation and stabilization of these structures 459

Members of the CURT1 family contain an N-terminal amphipathic α-helix that may 460

be involved in the membrane-bending activity of CurT (Armbruster et al 2013) Several 461

eukaryotic membrane-shaping proteins possess amphipathic helices as part of either an ENTH 462

(epsin N-terminal homology) or an N-BAR (Bin amphiphysin Rvs with N-terminal 463

amphipathic helix) domain (Ford et al 2002 Gallop and McMahon 2005 Zimmerberg and 464

Kozlov 2006) ENTH and N-BAR domains are rather large (~200 amino acids) and it has 465

been shown that amphipatic helices present in those domains insert into one leaflet of the lipid 466

bilayer and thereby induce curvature of the membrane (reviewed by Gallop and McMahon 467

2005 Zimmerberg and Kozlov 2006) However CurT itself is a small protein (149 amino 468

acids) that contains two transmembrane domains which insert into both leaflets of the lipid 469

bilayer (Figure 1A) as already suggested by Armbruster et al (2013) The amphipathic helix 470

faces the cytoplasm in Synechocystis 6803 or the stroma in A thaliana and most likely it 471

fine-tunes the degree of membrane bending mediated by CurT (Armbruster et al 2013) 472

In addition the increase in curvature correlated with CurT accumulation at convex 473

sides of thylakoid lamella (Figure 10 and 13) Hence curving might be mediated by 474

asymmetric integration of CurT into the lipid bilayers forming opposite faces of thylakoid 475

membrane sheets (Figure 13) However the mechanism causing this asymmetry remains 476

elusive 477

The presence of different CurT isoforms and complexes in PDMs and thylakoids adds 478

a further level of complexity and most likely reflects the dynamic regulation of this system 479

(Figure 11) The formation of different complexes might be primed by the phosphorylation of 480

CurT within its N-terminal cytoplasmic part (Spaumlt et al 2015) It seems likely that these 481

15

complexes play distinct roles in mediating the different CurT functions ie membrane 482

bending and maintenance 483

However it remains to be seen how exactly curvature is established maintained and 484

fine-tuned In addition other determinants of membrane topology and their putative interplay 485

with CurT have to be considered eg lipid and protein (complex) composition of 486

membranes cellular turgor pressure and other factors required for membrane 487

biogenesismaintenance eg the VIPP1 protein before precise molecular models of CurTrsquos 488

mode of action can be constructed (Rast et al 2015 and see below) That these other factors 489

can be crucial for membrane architecture is documented by the fact that some marine 490

cyanobacteria such as Prochlorococcus and Synechococcus contain curved thylakoids (but 491

no thylakoid convergence zones at the plasma membrane) although they lack a curT gene 492

493

The role of biogenesis centers 494

The absence of biogenesis centers in the curT- mutant now enables one to answer some 495

questions relating to the role of these thylakoid sub-structures which form in some but not all 496

cyanobacteria (Kunkel 1982 van de Meene et al 2006) First they are not essential since 497

even the curT- mutant still accumulates PSII to ~50 of wild-type levels On the other hand 498

in the mutant assembly of PSII is impaired as revealed by the increased accumulation of early 499

assembly intermediates In addition PSII dimers are almost completely absent in curT- 500

Whether the reduction in PSII dimers is attributable to an assembly problem linked to the 501

absence of biogenesis centers or to a secondary defect in dimer stabilization caused by 502

changes in overall thylakoid membrane ultrastructure remains to be determined Thus 503

biogenesis centers are more likely to represent evolutionary ldquoadd-onsrdquo that facilitated efficient 504

thylakoid biogenesis This is compatible with the fact that some cyanobacteria are devoid of 505

any biogenesis center-related substructures Second their absence compromises PSII but the 506

accumulation of other photosynthetic complexes ie PSI and the Cyt(b6f) complex is not 507

affected by CurT deficiency (Figure 3) This observation agrees with previous findings that 508

neither the PsaA subunit of PSI nor its assembly factor Ycf37 is detectable in isolated PDM 509

fractions (Rengstl et al 2011) 510

In addition to reduced de novo PSII assembly a higher relative stability of D1 in high-511

light experiments has been detected in curT- which suggests that D1 degradation during PSII 512

repair is less efficient in the mutant Photo-damaged D1 is degraded by the FtsH2FtsH3 513

complex which has previously been shown to partly localize to thylakoid convergence zones 514

at the cell periphery ie biogenesis centers (Boehm et al 2012 Sacharz et al 2015) It 515

16

therefore seems possible that the absence of biogenesis centers in curT- leads to 516

mislocalization of the FtsH2FtsH3 complex and less effective D1 degradation 517

Moreover a PSII related-function for CurT is supported by a meta-analysis of the 518

Synechocystis 6803 transcriptome When the CyanoEXpress 22 database (Hernaacutendez-Prieto 519

and Futschik 2012 Hernaacutendez-Prieto et al 2016) was queried for genes co-expressed with 520

curT (slr0483) genes for five PSII subunits ndash psbE psbO psbF psbL and psb30 ndash were 521

found among the first ten hits (Supplemental Table 4) From this we infer that biogenic 522

centers do not play an essential role in the assembly of all photosynthetic complexes but 523

serve to enhance PSII assemblyrepair possibly through the efficient delivery of Mn2+ 524

Residual PSII in curT- cells is likely to be supplied with cytoplasmic Mn2+ via a second 525

independently operating ABC transporter-based system in the plasma membrane named the 526

Mnt pathway (Bartsevich and Pakrasi 1995 Bartsevich and Pakrasi 1996) 527

Formally we cannot exclude that CurT is directly involved in the PSII assembly 528

process However considering CurTrsquos membrane bending capacity and the mutant phenotype 529

(Figure 1D and Figure 2) it appears more likely that CurT forms cellular substructures for 530

efficient PSII biogenesis ie biogenesis centers 531

As mentioned above some ultrastructural features of biogenesis centers have emerged 532

from studies employing EM-based tomography (van de Meene et al 2006) To date however 533

a high-resolution picture of the precise membrane architecture within these centers remains 534

elusive In particular whether or not a direct connection between plasma membrane and 535

thylakoids exists continues to be debated As recently discussed and in line with this gap in 536

knowledge different membrane fractionation techniques have revealed different distributions 537

of PSII-related subunits and assembly factors between plasma and thylakoid membranes 538

(Heinz et al 2016 Liberton et al 2016 Selatildeo et al 2016) The overall picture that emerges 539

is that the initial hypothesis that PSII biogenesis is initiated at the plasma membrane is no 540

longer tenable whereas a specialized thylakoid sub-fraction like the PDMs that make contact 541

with the plasma membrane could explain many of the available data and thus clarify some 542

aspects of the debate (Zak et al 2001 Pisareva et al 2011 Rast et al 2015) Moreover it 543

has previously been hypothesized that ldquoribosome-decorated membrane-like complexesrdquo 544

forming at the innermost thylakoid sheet might represent biogenic compartments (van de 545

Meene et al 2006 Mullineaux 2008) Whether these structures are affected in curT- cannot 546

be judged based on our TEM analysis but requires ultrastructural data of higher resolution 547

However the accessibility of thylakoids for ribosomes should be increased in the less 548

compressed membrane system of curT- (Figure 2B-D) 549

17

A scenario similar to that of Synechocystis 6803 holds for the situation in chloroplasts 550

of the green alga Chlamydomonas reinhardtii in which de novo PSII biogenesis has been 551

shown to be initiated in punctate regions named T-zones located close to the pyrenoid 552

(Uniacke and Zerges 2007) Unlike the mRNAs for the PSII components neither RNAs for 553

PSI subunits nor PSI assembly factors are localized to T-zones indicating that PSI and PSII 554

assembly processes are spatially separated (Uniacke and Zerges 2009 Nickelsen and Zerges 555

2013 Rast et al 2015) Interestingly a recent cryoelectron tomography study demonstrated 556

that next to T-zones at the chloroplast base-lobe junction the inner chloroplast envelope 557

exhibits invaginationsconnections to thylakoids that structurally resemble the organization of 558

cyanobacterial biogenesis centers (Engel et al 2015) For future investigations it will be 559

interesting to see if a homolog of the CURT1 family is involved in the formation of these 560

structures in C reinhardtii 561

562

Evolution of CURT1 function 563

Homologs of the CURT1 protein family can be found throughout cyanobacteria green 564

algae and plants (Armbruster et al 2013) The Arabidopsis CURT1A-D proteins have 565

recently been shown to induce bending of thylakoid membranes at grana margin regions 566

(Armbruster et al 2013) Interestingly and in contrast to the situation in Synechocystis 6803 567

their inactivation did not result in severe photosynthetic deficiencies although the thylakoids 568

formed lacked defined grana stacks Nevertheless the data available support the idea that the 569

function of thylakoid membrane structures that were regarded as being independent ie 570

cyanobacterial biogenesis centers and grana are closely related Intriguingly both of these 571

thylakoid membrane structures are dedicated to aspects of PSII function but do not involve 572

PSI (Pribil et al 2014) In both the prokaryotic and eukaryotic systems CURT1 homologs 573

appear to bend thylakoid membranes as indicated by (i) the distortion of membrane 574

ultrastructure seen in mutants devoid of curved thylakoids (ii) the localization of CURT1 575

homologs at grana margins and their local concentration at biogenesis centers (iii) the in vitro 576

membrane-curving activity of both CURT forms The phenotypic differences between 577

A thaliana and Synechocystis 6803 mutants may however be attributable to the different 578

functions of the membrane sub-compartments affected in the two model organisms Whereas 579

the role of grana is still under debate one function of the cyanobacterial biogenesis centers is 580

the above-mentioned high-throughput uptake of Mn2+ ions for efficient assembly of PSII 581

(Stengel et al 2012 Nickelsen and Rengstl 2013 Pribil et al 2014) However it appears 582

that in both cases the primary function of CURT1 proteins is to generate curved membrane 583

18

regions These discoveries suggest that until now two independently observed structures ie 584

cyanobacterial thylakoid biogenesis centers and chloroplast grana regions are closely related 585

The degree of curvature is much less pronounced in the cyanobacterial system As previously 586

discussed it was probably the subsequent evolution of a membrane-localized light-harvesting 587

system in chloroplasts that made the formation of tightly curved grana thylakoids possible 588

(Mullineaux 2005 Nevo et al 2012 Pribil et al 2014) 589

590

CurT is involved in osmotic stress response 591

One unexpected phenotype of the curT- mutant is its sensitivity to osmotic stress 592

These data revealed that in addition to shaping membranes CurT also influences their 593

functional integrity This latter function might be intrinsic to CurT or could be mediated by 594

the VIPP1 protein which has been shown to be required for membrane maintenance in 595

bacteria and chloroplasts probably by acting as a supplier of lipids (for an overview see 596

Zhang and Sakamoto 2015) Both factors accumulate in the plasma membrane upon osmotic 597

stress but VIPP1 localization is not severely affected by CurT inactivation which suggests 598

that VIPP1 operates independently of CurT In agreement with this repeated co-599

immunoprecipitations revealed no interaction between both proteins Therefore it remains to 600

be established whether a direct functional relationship between them exists 601

Previous investigations of osmotic stress in Synechocystis 6803 showed a kidney-602

shaped form of wild-type cells under very high concentrations of osmotically active 603

compounds (Marin et al 2006) The cells were severely deformed indicating changes in the 604

structure of the cellular envelope Since CurT shifts towards the plasma membrane already 605

under lower osmolyte concentrations we suggest a stabilizing function of CurT in the plasma 606

membrane CurT might be necessary to tolerate the forces trying to deform the cells under 607

osmotic stress 608

In conclusion this analysis has identified a crucial determinant for shaping and 609

maintaining the cyanobacterial thylakoid membrane system ie CurT a homolog of the 610

grana-forming CURT1 protein family from A thaliana In particular CurT is involved in the 611

formation of specific thylakoid substructures close to the plasma membrane at which PSII is 612

assembledrepaired Future work will dissect the precise ultrastructure of these centers and 613

enable us to elaborate a molecular model for the spatiotemporal organization of PSII assembly 614

in cyanobacteria 615

616

19

Methods 617

Strains and growth conditions 618

Wild-type and mutant Synechocystis 6803 cells were grown on solid or in liquid BG 619

11 medium (Rippka et al 1979) supplemented with 5 mM glucose (unless indicated 620

otherwise) at 30degC under continuous illumination at a photon irradiance of 30 μmol m-2 s-1 of 621

white light For growth during high-light experiments for investigation of D1 repair cells 622

were cultivated in a FMT150 photobioreactor (Photon Systems Instruments Draacutesov Czech 623

Republic) at 800 micromol photons m-2 s-1 in the presence or absence of lincomycin (100 microgml) 624

Cell density was monitored photometrically at 750 nm Doubling times were determined after 625

two days of growth To generate the insertion mutant curT- the curT gene (slr0483) was first 626

amplified from wild-type genomic DNA by PCR using the primer pair 04835 627

(GAAGCCTATTTAGCTAAGGCCGAAAG) and 04833 628

(TAGTACCTGGTCTTCCATGGCGT) and the resulting fragment was cloned into the 629

Bluescript pKS vector (Stratagene Waldbronn Germany) A kanamycin resistance cassette 630

was then inserted into the single AgeI restriction site (159 bp downstream of the start codon) 631

and this disruption construct was used to replace the wild-type gene as described (Wilde et al 632

2001) 633

634

Bioinformatic and computational analysis 635

CURT1 sequences of Synechocystis 6803 were obtained from CyanoBase 636

(httpgenomekazusaorjpcyanobaseSynechocystis) and CURT1 homologs in other 637

organisms were retrieved from NCBIBLAST (httpblastncbinlmnihgovBlastcgi) 638

Numbers and positions of putative transmembrane domains in the predicted proteins were 639

determined with TMHMM20 (httpwwwcbsdtudkservicesTMHMM) The sequence for 640

the N-terminal amphipathic helix was predicted by Jpred 3 641

(httpwwwcompbiodundeeacukwww-jpred) and plotted using a helical wheel projection 642

script (httprzlabucreduscriptswheelwheelcgi) The programs ClustalW2 643

(httpwwwebiacuktoolsclustalw2) and GeneDoc (httpwwwpscedubiomedgenedoc) 644

were used to generate multiple alignments of amino acid sequences Quantitative analysis of 645

immunoblots was performed with the AIDA Image Analyzer V325 (Raytest 646

Isotopenmessgeraumlte GmbH Straubenhardt Germany) 647

Co-expression patterns of curT were analyzed using the CyanoEXpress 22 database 648

(httpcyanoexpresssysbiolabeu Hernaacutendez-Prieto and Futschik 2012 Hernaacutendez-Prieto et 649

al 2016) 650

20

651

Measurement of chlorophyll concentration and oxygen production 652

Determination of chlorophyll content was carried out according to Wellburn and 653

Lichtenthaler (1984) For oxygen evolution measurements cells were grown in BG-11 654

without glucose harvested in mid-log phase and diluted to an OD750 nm = 05 Oxygen 655

evolution rates were measured with a Clark-type oxygen electrode (Hansatech Instruments 656

Ltd Kingrsquos Lynn Norfolk UK) at 1000 micromol photons m-2 s-1 (cool white light) after 5 min of 657

dark acclimation Oxygen evolution under saturating light conditions was measured without 658

any additives 659

660

Cell size and cell number estimation 661

Synechocystis 6803 strains were grown in liquid BG11 media containing 5 mM 662

glucose For cell size estimation the cells were analyzed with a confocal laser scanning 663

microscope TCS SP5 (Leica Wetzlar Germany) The diameter of the cells was measured 664

with the LAS AF Lite software (Leica Wetzlar Germany) Cells that were about to divide 665

were not taken into account For the determination of cell number cultures were set to an 666

OD750 = 1 and analyzed by using a Neubauer counting chamber (Paul Marienfeld GmbH amp 667

Co KG Lauda-Koumlnigshofen Germany) Statistical significance was determined by Studentrsquos 668

t-test 669

670

Measurements of P700+ reduction kinetics and relative electron transport rates 671

P700+ reduction kinetics and changes in chlorophyll fluorescence yield at different 672

light intensities were measured at a chlorophyll concentration of 5 microgml with a Dual-PAM-673

100 instrument (Heinz Walz GmbH Effeltrich Germany) Complete P700 oxidation was 674

achieved by a 50-ms multiple turnover pulse (10000 micromol photons m-2 s-1) after 2 min of dark 675

incubation P700+ reduction kinetics were recorded without any additions as well as in the 676

presence of 10 microM DCMU Ten technical replicates were averaged and fitted with single 677

exponential functions Data interpretation was done according to Bernaacutet et al (2009) 678

Light saturation measurements were performed according to Xu et al (2008) The 679

actinic light intensity was increased stepwise from 0 to 665 micromol photons m-2 s-1 with 30-s 680

adaptation periods Maximal fluorescence yields were obtained by applying saturating light 681

pulses (duration 600 ms intensity 10000 micromol photons m-2 s-1) 682

683

Low-temperature fluorescence measurements 684

21

Fluorescence emission spectra were measured with an AMINCO Bowman Series 2 685

Luminescence Spectrometer Wild-type and curT- cells were grown in the presence of 5 mM 686

glucose to mid log-phase and concentrated to 25 microgml chlorophyll adding 2 microM fluorescein 687

as an internal standard Samples (1 ml) were transferred to thin glass tubes dark-adapted for 688

30 min at 30 degC and shock frozen in liquid N2 To quantify chlorophyllfluorescein and 689

phycobilisome-mediated fluorescence samples were excited and emission recorded at 440 690

nm510 nm (chlorophyll and fluorescein excitationmax fluorescein emission) and 580 691

nm685 nm respectively Emission was scanned at 490-800 nm or at 640-800 nm 692

respectively 693

694

Antibody production and protein analysis 695

For generation of an αCurT antibody the N-terminal coding region of curT (amino 696

acid positions 1-58) was amplified by PCR using primers N04835 697

(AAGGATCCGTGGGCCGTAAACATTCAA) and N04833 698

(AAGTCGACGCACTTCCCACACCGGTTGTA) and cloned into the BamHI and XhoI sites 699

of the pGEX-4T-1 vector (GE Healthcare Freiburg Germany) Expression of the GST fusion 700

protein in Escherichia coli BL21(DE3) and subsequent affinity purification on Glutathione-701

Sepharose 4B (GE Healthcare) were carried out as described (Schottkowski et al 2009b) A 702

polyclonal antiserum was raised against this protein fragment in rabbits (Pineda Berlin 703

Germany) Other primary antibodies used in this study have been described previously ie 704

αpD1 (Schottkowski et al 2009b) αD1 (Schottkowski et al 2009b) αD2 (Klinkert et al 705

2006) αPratA (Klinkert et al 2004) αYcf48 (Rengstl et al 2011) αPitt (Schottkowski et 706

al 2009a) αPOR (Schottkowski et al 2009a) αYidC (Ossenbuumlhl et al 2006) αVIPP1 707

(Aseeva et al 2007) αSll0933 (Armbruster et al 2010) and αSlr0151 (Rast et al 2016) or 708

were purchased from Agrisera (Vaumlnnaumls Sweden) ie αCP43 αCP47 αPsaA αCyt f 709

αRbcL αIsiA The αGFP-HRP antibody was acquired from Miltenyi Biotech (Bergisch 710

Gladbach Germany) 711

Protein concentrations were determined according to Bradford (1976) using RotiQuant 712

(Carl Roth GmbH amp Co KG Karlsruhe Germany) Protein extraction membrane 713

fractionation on sucrose-density gradients and quantification of Western signal intensities was 714

performed as described previously (Rengstl et al 2011) Solubility properties of CurT were 715

determined according to Schottkowski et al (2009a) 716

22

Sucrose-density centrifugation separating PDM and thylakoid membrane fractions by 717

two consecutive gradients was carried out as described previously (Schottkowski et al 718

2009b Rengstl et al 2011) 719

Two-dimensional fractionations of cyanobacterial membrane proteins via BNSDS-720

PAGE and of pulse-labeled proteins by BNSDS-PAGE were performed as previously 721

reported (Klinkert et al 2004 Schottkowski et al 2009b Rengstl et al 2013) For the 722

analysis of native complexes in fractions obtained by sucrose-density centrifugation the 723

volume corresponding to 350 microg of protein in fraction 7 was applied to BNSDS-PAGE 724

For isoelectric focusing (IEF) the volume corresponding to 50 microg of protein from 725

fraction 7 in 200 microl of IEF buffer (8 M urea 4 CHAPS 1 IPG buffer pH 4-7 (GE 726

Healthcare)) was applied to an 11-cm Immobiline DryStrip pH 4-7 (GE Healthcare) in a 727

Protean IEF Cell (Bio-Rad Munich Germany) Strips were rehydrated for 12 h at 20 degC and 728

50V Focusing was carried out in the following steps 500 V rapid 1500 Vh 1000 V linear 729

880 Vh 6000 V linear 9680 Vh 6000 V rapid 5390 Vh 50 microA per gel focus temperature 730

20degC Subsequently the strips were incubated in equilibration buffer I (6 M urea 0375 M 731

Tris pH 88 20 glycerol 2 SDS 2 DTT) and equilibration buffer II (6 M urea 0375 732

M Tris pH 88 20 glycerol 2 SDS 25 iodoacetamide) for 10 min in each buffer 733

Then the IEF strips were applied to second-dimension SDS-PAGE 734

735

Transmission electron microscopy and immunogold labeling 736

Sample preparation for transmission electron microscopy including freeze substitution 737

and immunogold labeling of CurT was performed as described previously (Stengel et al 738

2012) Ultrathin sections were cut to thicknesses of 35 - 45 nm and 45 - 65 nm for 739

ultrastructural analyses and immunogold labeling respectively For immunogold labeling 740

sections collected on collodion-coated Ni grids were incubated for 18 h at 4degC with (rabbit) 741

αCurT (diluted 1100 1500 11000 or 14000 in blocking buffer (5 fetal calf serum) with 742

005 Tween 20) and further processed as described previously (Stengel et al 2012) As a 743

negative control wild-type Synechocystis 6803 cells were incubated without the primary 744

antibody and exposed to the gold-labeled anti-rabbit IgG To image the ultrastructure and the 745

immunogold-treated samples a Fei Morgagni 268 transmission electron microscope was used 746

and micrographs were taken at 80 kV 747

To avoid errors in the interpretation of the immunogold labeling experiment only 748

signals which were unambiguously localized to distinctly visible thylakoid membranes were 749

taken into account For each cell different regions (see Figure 10F) were defined and in each 750

23

region the signals on the convex and concave sides of the thylakoid membrane were analyzed 751

separately (see Supplemental Figure 11 for representative counts) Statistical significance was 752

assessed by χ2 test (Zoumlfel 1988) 753

For the analysis of clusters of CurT signals in biogenesis centers a cluster was defined 754

as a minimum of four signals in close proximity Overall 219 biogenesis centers were 755

examined with regard to CurT cluster formation 756

757

Preparation of proteoliposomes 758

Liposomes with a lipid mixture of 25 monogalactosyl diacylglycerol 42 759

digalactosyl diacylglycerol 16 sulfoquinovosyl diacylglycerol and 17 760

phosphatidylglycerol (Lipid Products South Nutfield UK) were prepared as described 761

previously (Armbruster et al 2013) To generate proteoliposomes CurT and CURT1A 762

proteins were expressed in the presence of liposomes for 3 h at 37degC using a PURExpress In 763

Vitro Protein Synthesis Kit (New England Biolabs Ipswich MA USA) The liposomes were 764

separated from the mix by centrifugation in a discontinuous sucrose gradient (100000 g 18 765

h) Subsequently the fraction containing the liposomes was extracted and dialyzed against 20 766

mM HEPES (pH 76) For transmission electron microscopy the proteoliposomes were 767

negatively stained with 1 uranyl acetate on a carbon-coated copper grid Micrographs were 768

taken on a Fei Morgagni 268 TEM at 80 kV 769

770

curT-CFP strain generation 771

Gibson assembly was used for single-step cloning (Gibson 2011) of the slr0483 gene 772

(together with its ~08 kb upstream region) the mTurquoise2 gene fragment the gentamycin-773

resistance cassette (aacC1) and an ~17-kb downstream region of slr0483 into pBR322 774

cleaved with EcoRV and NheI The slr0483 gene was fused in frame to the codon-optimized 775

mTurquoise2 (DNA20) preceded by a linker sequence encoding GSGSG The resulting 776

plasmid was used to transform Synechocystis 6803 as described previously (Zang et al 2007) 777

After ~ 10 days of incubation on BG11-GelRite (15 ) medium in the presence of 2 microgml 778

gentamycin several antibiotic resistant colonies were obtained and streaked out on fresh 779

medium These transformants were then tested for full segregation of the tagged allele by 780

colony PCR with primers flanking the slr0483 gene 781

782

Fluorescence microscopy 783

24

An aliquot of a cell suspension in mid-log phase was placed under a BG11-agarose 784

pad on a glass coverslip (15) and imaged on an inverted microscope (Zeiss 785

AxioObserverZ1) equipped with an ORCA Flash40 V2 (Hamamatsu) camera a Lumenecor 786

SOLA II Light Engine and a Plan-Apochromat 63x140 Oil DIC M27 (NA 14) objective 787

(Zeiss) Image acquisition was done with Zen 21 software in cyan and far-red fluorescence 788

channels (Zeiss Filter Sets 47 HE and 50) as Z-series with a step size of 250 nm and effective 789

pixel size of 103 nm Acquired image files were subsequently deconvolved (Constrained 790

Iterative Method) using a default theoretical Point Spread Function in Zen 20 (Zeiss) 791

Extraction of intensities for line profiles was performed by image thresholding the thylakoid 792

autofluorescence channel and eroding the resulting binary mask in Fiji (Schindelin et al 793

2012) 794

For immunofluorescence analysis cells were grown to mid-log phase as in the case of 795

the cells prepared for live-cell microscopy A 10-ml culture was fixed for 20 min in 37 796

formaldehyde and following extensive washing with phosphate-buffered saline (PBS) cells 797

were first permeabilized in 005 Triton-X for 20 min and then in lysis buffer (50 mM Tris-798

HCl 100 mM NaCl 5 mgml lysozyme) at 37degC for 2 h with gentle shaking To block 799

unspecific binding sites the cell pellet was incubated in 5 bovine serum albumin in PBS at 800

30degC for 1 h The αCurT serum (1500 dilution) was added to cells in fresh blocking buffer 801

for 1 h at 30degC with gentle shaking Cells were then washed three times with blocking buffer 802

and incubated with goat anti-rabbit IgG secondary antibodies conjugated to Oregon Green 488 803

(Invitrogen) (11000 dilution) under the conditions as for the primary antibodies Cells were 804

washed three times with PBS and prepared for microscopy as above Imaging was done as 805

described for live-cell microscopy except that a Colibri2 LED light source was employed for 806

illumination and a CoolSnap HQ camera (Photometrics) was used for image acquisition Cells 807

were imaged as Z-series (step size 280 nm) in the yellow and far-red fluorescent channels 808

(Zeiss Filter Sets 46 HE and 50) using the 505 nm and 625 nm LED modules Effective pixel 809

size in the final image was 102 nm Deconvolution and image analysis was done as described 810

above As judged by the staining intensity of the Oregon Green-conjugated antibodies 811

approximately half of the cells in any given field of view appeared to have been successfully 812

permeabilised a rate that is common in our experience No significant signal was detected in 813

the control sample that had not been exposed to the primary antibodies 814

815

25

Accession numbers 816

Sequence data from this article can be found in the CyanoBase and EMBLGenBank 817

data libraries under accession number slr0483 818

819

Supplemental Data 820

Supplemental Figure 1 Construction of the curT- mutant 821

Supplemental Figure 2 Growth phenotype of curT- 822

Supplemental Figure 3 Expression analysis of the open reading frame slr0482 (located 823

upstream of curT) in the curT- strain 824

Supplemental Figure 4 Absorbance spectra of curT- and wild-type cells 825

Supplemental Figure 5 High-light growth phenotypes of wild-type Synechocystis 6803 and 826

the curT- strain 827

Supplemental Figure 6 Ultrastructure of the TD41 mutant which lacks the psbA transcript 828

and the D1 protein 829

Supplemental Figure 7 Expression and localization of CurT-CFP 830

Supplemental Figure 8 Localization of CurT and CurT-CFP by fluorescence microscopy 831

Supplemental Figure 9 Chlorophyll autofluorescence of curT- 832

Supplemental Figure 10 The curT- mutant as a negative control for immunogold labeling 833

Supplemental Figure 11 Representative counts of immunogold signals 834

Supplemental Table 1 Overview of immunogold signals in curT- cells 835

Supplemental Table 2 Overview of immunogold signals in specific regions of Synechocystis 836

6803 wild-type cells 837

Supplemental Table 3 Statistical analysis of immunogold signals for wild-type 838

Synechocystis 6803 cells 839

Supplemental Table 4 Co-expression of curT 840

Supplemental Movie 1 Scan through the Z-axis of a curT-CFP cell 841

Supplemental Movie 2 Rendered 3D-model of a CurT-CFP detection 842

Supplemental Movie 3 Scan through the Z-axis of a curT-CFP cell with a traversing 843

thylakoid lamella 844

845

Acknowledgements 846

We thank Y Nishiyama for providing αpD1 and J Soll for αVIPP1 and αYidC antibodies 847

respectively and Nina Dyczmons-Nowaczyk for support with the fluorescence measurements 848

This work was supported by grants awarded to JN (Ni3909) MMN (NO 8363) and DL 849

26

(Le126529) by the Deutsche Forschungsgemeinschaft in the context of Research Unit 850

FOR2092 and the Cluster of Excellence RESOLV (EXC 1069) AG is a Howard Hughes 851

Medical Institute postdoctoral fellow in the laboratory of Erin OrsquoShea at Harvard University 852

LS was supported by a PhD fellowship from the Chinese Scholarship Council 853

854

Author Contributions 855

SH AR LS MMN DL and JN designed the research SH AR LS AG ILG EH ML BR 856

SV performed the research all authors contributed to data analysis SH AR and JN wrote the 857

paper 858

859

Competing Financial Interest statement 860

The authors declare no competing financial interests 861

862

We wish to dedicate this paper to Fabrice Rappaport an outstanding colleague and friend who 863

passed away so early 864

865

27

References 866

Allen JF de Paula WBM Puthiyaveetil S and Nield J (2011) A structural 867

phylogenetic map for chloroplast photosynthesis Trends Plant Sci 16 645-655 868

Anderson JM Horton P Kim E-H and Chow WS (2012) Towards elucidation of 869

dynamic structural changes of plant thylakoid architecture Philos Trans R Soc 870

Lond B Biol Sci 367 3515-3524 871

Armbruster U Zuumlhlke J Rengstl B Kreller R Makarenko E Ruumlhle T Schuumlnemann 872

D Jahns P Weisshaar B Nickelsen J and Leister D (2010) The Arabidopsis 873

thylakoid protein PAM68 is required for efficient D1 biogenesis and photosystem II 874

assembly Plant Cell 22 3439-3460 875

Armbruster U Labs M Pribil M Viola S Xu W Scharfenberg M Hertle AP 876

Rojahn U Jensen PE Rappaport F Joliot P Doumlrmann P Wanner G and 877

Leister D (2013) Arabidopsis CURVATURE THYLAKOID1 proteins modify 878

thylakoid architecture by inducing membrane curvature Plant Cell 25 2661-2678 879

Aseeva E Ossenbuumlhl F Sippel C Cho WK Stein B Eichacker LA Meurer J 880

Wanner G Westhoff P Soll J and Vothknecht UC (2007) Vipp1 is required for 881

basic thylakoid membrane formation but not for the assembly of thylakoid protein 882

complexes Plant Physiol Biochem 45 119-128 883

Bartsevich VV and Pakrasi HB (1995) Molecular identification of an ABC transporter 884

complex for manganese analysis of a cyanobacterial mutant strain impaired in the 885

photosynthetic oxygen evolution process EMBO J 14 1845-1853 886

Bartsevich VV and Pakrasi HB (1996) Manganese transport in the cyanobacterium 887

Synechocystis sp PCC 6803 J Biol Chem 271 26057-26061 888

Bernaacutet G Waschewski N and Roumlgner M (2009) Towards efficient hydrogen production 889

the impact of antenna size and external factors on electron transport dynamics in 890

Synechocystis PCC 6803 Photosynth Res 99 205-216 891

Boehm M Yu J Krynicka V Barker M Tichy M Komenda J Nixon PJ and Nield 892

J (2012) Subunit Organization of a Synechocystis Hetero-Oligomeric Thylakoid FtsH893

Complex Involved in Photosystem II Repair Plant Cell 24 3669-3683894

Bradford MM (1976) A rapid and sensitive method for the quantitation of microgram 895

quantities of protein utilizing the principle of protein-dye binding Anal Biochem 72 896

248-254897

28

Chang L Liu X Li Y Liu C-C Yang F Zhao J and Sui S-F (2015) Structural 898

organization of an intact phycobilisome and its association with photosystem II Cell 899

Res 25 726-737 900

Danielsson R Suorsa M Paakkarinen V Albertsson P-Aring Styring S Aro E-M and 901

Mamedov F (2006) Dimeric and monomeric organization of photosystem II 902

Distribution of five distinct complexes in the different domains of the thylakoid 903

membrane J Biol Chem 281 14241-14249 904

Daum B Nicastro D Austin J McIntosh JR and Kuumlhlbrandt W (2010) Arrangement 905

of photosystem II and ATP synthase in chloroplast membranes of Spinach and Pea 906

Plant Cell 22 1299-1312 907

Engel BD Schaffer M Kuhn Cuellar L Villa E Plitzko JM and Baumeister W 908

(2015) Native architecture of the Chlamydomonas chloroplast revealed by in situ 909

cryo-electron tomography eLife 4 e04889 910

Ford MGJ Mills IG Peter BJ Vallis Y Praefcke GJK Evans PR and McMahon 911

HT (2002) Curvature of clathrin-coated pits driven by epsin Nature 419 361-366 912

Fristedt R Willig A Granath P Cregravevecoeur M Rochaix J-D and Vener AV (2009) 913

Phosphorylation of photosystem II controls functional macroscopic folding of 914

photosynthetic membranes in Arabidopsis Plant Cell 21 3950-3964 915

Gallop JL and McMahon HT (2005) BAR domains and membrane curvature bringing 916

your curves to the BAR Biochem Soc Symp 72 223-231 917

Gibson DG (2011) Chapter fifteen - Enzymatic Assembly of Overlapping DNA Fragments 918

In Methods in Enzymology V Christopher ed (Academic Press) pp 349-361 919

Goedhart J von Stetten D Noirclerc-Savoye M Lelimousin M Joosen L Hink MA 920

van Weeren L Gadella TWJ and Royant A (2012) Structure-guided evolution of 921

cyan fluorescent proteins towards a quantum yield of 93 Nat Commun 3 751 922

Heinz S Liauw P Nickelsen J and Nowaczyk M (2016) Analysis of photosystem II 923

biogenesis in cyanobacteria Biochim Biophys Acta 1857 274-287 924

Hernaacutendez-Prieto M and Futschik M (2012) CyanoEXpress A web database for 925

exploration and visualisation of the integrated transcriptome of cyanobacterium 926

Synechocystis sp PCC6803 Bioinformation 8 634-638 927

Hernaacutendez-Prieto MA Semeniuk TA Giner-Lamia J and Futschik ME (2016) The 928

Transcriptional Landscape of the Photosynthetic Model Cyanobacterium 929

Synechocystis sp PCC6803 Sci Rep 6 22168 930

29

Huang F Fulda S Hagemann M and Norling B (2006) Proteomic screening of salt-931

stress-induced changes in plasma membranes of Synechocystis sp strain PCC 6803 932

Proteomics 6 910-920 933

Kirchhoff H (2013) Architectural switches in plant thylakoid membranes Photosynth Res 934

116 481-487 935

Klinkert B Elles I and Nickelsen J (2006) Translation of chloroplast psbD mRNA in 936

Chlamydomonas is controlled by a secondary RNA structure blocking the AUG start 937

codon Nucleic Acids Res 34 386-394 938

Klinkert B Ossenbuumlhl F Sikorski M Berry S Eichacker L and Nickelsen J (2004) 939

PratA a periplasmic tetratricopeptide repeat protein involved in biogenesis of 940

photosystem II in Synechocystis sp PCC 6803 J Biol Chem 279 44639-44644 941

Komenda J Nickelsen J Tichyacute M Praacutešil O Eichacker LA and Nixon PJ (2008) The 942

cyanobacterial homologue of HCF136YCF48 is a component of an early photosystem 943

II assembly complex and is important for both the efficient assembly and repair of 944

photosystem II in Synechocystis sp PCC 6803 J Biol Chem 283 22390-22399 945

Kopf M Klaumlhn S Scholz I Matthiessen JKF Hess WR and Voszlig B (2014) 946

Comparative analysis of the primary transcriptome of Synechocystis sp PCC 6803 947

DNA Res 21 527-539 948

Kunkel DD (1982) Thylakoid centers Structures associated with the cyanobacterial 949

photosynthetic membrane system Arch Microbiol 133 97-99 950

Liberton M Howard Berg R Heuser J Roth R and Pakrasi BH (2006) Ultrastructure 951

of the membrane systems in the unicellular cyanobacterium Synechocystis sp strain 952

PCC 6803 Protoplasma 227 129-138 953

Liberton M Saha R Jacobs JM Nguyen AY Gritsenko MA Smith RD 954

Koppenaal DW and Pakrasi HB (2016) Global Proteomic Analysis Reveals an 955

Exclusive Role of Thylakoid Membranes in Bioenergetics of a Model 956

Cyanobacterium Mol Cell Proteomics 15 2021-2032 957

Luque I and Ochoa de Alda JAG (2014) CURT1CAAD-containing aaRSs thylakoid 958

curvature and gene translation Trends Plant Sci 19 63-66 959

Marin K Stirnberg M Eisenhut M Kraumlmer R and Hagemann M (2006) Osmotic stress 960

in Synechocystis sp PCC 6803 low tolerance towards nonionic osmotic stress results 961

from lacking activation of glucosylglycerol accumulation Microbiology 152 2023-962

2030 963

Mullineaux CW (2005) Function and evolution of grana Trends Plant Sci 10 521-525 964

30

Mullineaux CW (2008) Biogenesis and dynamics of thylakoid membranes and the 965

photosynthetic apparatus In The Cyanobacteria A Herrero and E Flores eds 966

(Norfolk UK Caister Academic Press) pp 289ndash304 967

Nevo R Charuvi D Tsabari O and Reich Z (2012) Composition architecture and 968

dynamics of the photosynthetic apparatus in higher plants Plant J 70 157-176 969

Nickelsen J and Rengstl B (2013) Photosystem II assembly From cyanobacteria to plants 970

Annu Rev Plant Biol 64 609-635 971

Nickelsen J and Zerges W (2013) Thylakoid biogenesis has joined the new era of bacterial 972

cell biology Front Plant Sci 4 458 973

Nilsson F Simpson DJ Jansson C and Andersson B (1992) Ultrastructural and 974

biochemical characterization of a Synechocystis 6803 mutant with inactivated psbA 975

genes Arch Biochem Biophys 295 340-347 976

Odom WR Hodges R Chitnis PR and Guikema JA (1993) Characterization of 977

Synechocystis sp PCC 6803 in iron-supplied and iron-deficient media Plant Mol 978

Biol 23 1255-1264 979

Ossenbuumlhl F Inaba-Sulpice M Meurer J Soll J and Eichacker LA (2006) The 980

Synechocystis sp PCC 6803 Oxa1 homolog is essential for membrane integration of 981

reaction center precursor protein pD1 Plant Cell 18 2236-2246 982

Pisareva T Kwon J Oh J Kim S Ge C Wieslander Aring Choi J-S and Norling B 983

(2011) Model for Membrane Organization and Protein Sorting in the Cyanobacterium 984

Synechocystis sp PCC 6803 Inferred from Proteomics and Multivariate Sequence 985

Analyses J Proteome Res 10 3617-3631 986

Pribil M Labs M and Leister D (2014) Structure and dynamics of thylakoids in land 987

plants J Exp Bot 65 1955-1972 988

Rast A Heinz S and Nickelsen J (2015) Biogenesis of thylakoid membranes Biochim 989

Biophys Acta 1847 821-830 990

Rast A Rengstl B Heinz S Klingl A and Nickelsen J (2016) The role of Slr0151 a 991

tetratricopeptide repeat protein from Synechocystis sp PCC 6803 during Photosystem 992

II assembly and repair Front Plant Sci 7 605 993

Rengstl B Oster U Stengel A and Nickelsen J (2011) An Intermediate Membrane 994

Subfraction in Cyanobacteria Is Involved in an Assembly Network for Photosystem II 995

Biogenesis J Biol Chem 286 21944-21951 996

31

Rengstl B Knoppovaacute J Komenda J and Nickelsen J (2013) Characterization of a 997

Synechocystis double mutant lacking the photosystem II assembly factors YCF48 and 998

Sll0933 Planta 237 471-480 999

Rexroth S Mullineaux CW Ellinger D Sendtko E Roumlgner M and Koenig F (2011) 1000

The Plasma Membrane of the Cyanobacterium Gloeobacter violaceus Contains 1001

Segregated Bioenergetic Domains Plant Cell 23 2379-2390 1002

Rippka R Deruelles J Waterbury JB Herdman M and Stanier RY (1979) Generic 1003

Assignments Strain Histories and Properties of Pure Cultures of Cyanobacteria 1004

Microbiology 111 1-61 1005

Ruumltgers M and Schroda M (2013) A role of VIPP1 as a dynamic structure within 1006

thylakoid centers as sites of photosystem biogenesis Plant Signal Behav 8 e27037 1007

Sacharz J Bryan SJ Yu J Burroughs NJ Spence EM Nixon PJ and Mullineaux 1008

CW (2015) Sub-cellular location of FtsH proteases in the cyanobacterium1009

Synechocystis sp PCC 6803 suggests localised PSII repair zones in the thylakoid1010

membranes Mol Microbiol 96 448-4621011

Sandstroumlm S Park Y-I Oumlquist G and Gustafsson P (2001) CP43prime the isiA Gene 1012

Product Functions as an Excitation Energy Dissipator in the Cyanobacterium 1013

Synechococcus sp PCC 7942 Photochem Photobiol 74 431-437 1014

Schindelin J Arganda-Carreras I Frise E Kaynig V Longair M Pietzsch T 1015

Preibisch S Rueden C Saalfeld S Schmid B Tinevez J-Y White DJ 1016

Hartenstein V Eliceiri K Tomancak P and Cardona A (2012) Fiji an open-1017

source platform for biological-image analysis Nat Methods 9 676-682 1018

Schottkowski M Ratke J Oster U Nowaczyk M and Nickelsen J (2009a) Pitt a novel 1019

tetratricopeptide repeat protein involved in light-dependent chlorophyll biosynthesis 1020

and thylakoid membrane biogenesis in Synechocystis sp PCC 6803 Mol Plant 2 1021

1289-1297 1022

Schottkowski M Gkalympoudis S Tzekova N Stelljes C Schuumlnemann D Ankele E 1023

and Nickelsen J (2009b) Interaction of the periplasmic PratA factor and the PsbA 1024

(D1) protein during biogenesis of photosystem II in Synechocystis sp PCC 6803 J 1025

Biol Chem 284 1813-1819 1026

Selatildeo TT Zhang L Knoppovaaacute J Komenda J and Norling B (2016) Photosystem II 1027

Assembly Steps Take Place in the Thylakoid Membrane of the Cyanobacterium 1028

Synechocystis sp PCC6803 Plant Cell Physiol 57 878 1029

32

Spaumlt P Maček B and Forchhammer K (2015) Phosphoproteome of the cyanobacterium 1030

Synechocystis sp PCC 6803 and its dynamics during nitrogen starvation Front 1031

Microbiol 6 248 1032

Stengel A Guumlgel IL Hilger D Rengstl B Jung H and Nickelsen J (2012) Initial 1033

steps of photosystem II de novo assembly and preloading with manganese take place 1034

in biogenesis centers in Synechocystis Plant Cell 24 660-675 1035

Uniacke J and Zerges W (2007) Photosystem II assembly and repair are differentially 1036

localized in Chlamydomonas Plant Cell 19 3640-3654 1037

Uniacke J and Zerges W (2009) Chloroplast protein targeting involves localized 1038

translation in Chlamydomonas Proc Natl Acad Sci USA 106 1439-1444 1039

van de Meene AL Hohmann-Marriott M Vermaas WJ and Roberson R (2006) The 1040

three-dimensional structure of the cyanobacterium Synechocystis sp PCC 6803 Arch 1041

Microbiol 184 259-270 1042

van de Meene AML Sharp WP McDaniel JH Friedrich H Vermaas WFJ and 1043

Roberson RW (2012) Gross morphological changes in thylakoid membrane 1044

structure are associated with photosystem I deletion in Synechocystis sp PCC 6803 1045

Biochim Biophys Acta 1818 1427-1434 1046

Watanabe M and Ikeuchi M (2013) Phycobilisome architecture of a light-harvesting 1047

supercomplex Photosynth Res 116 265-276 1048

Wellburn AR and Lichtenthaler H (1984) Formulae and Program to Determine Total 1049

Carotenoids and Chlorophylls A and B of Leaf Extracts in Different Solvents In 1050

Advances in Photosynthesis Research Proceedings of the VIth International Congress 1051

on Photosynthesis Brussels Belgium August 1ndash6 1983 C Sybesma ed (Dordrecht 1052

Springer Netherlands) pp 9-12 1053

Wilde A Lunser K Ossenbuumlhl F Nickelsen J and Borner T (2001) Characterization of 1054

the cyanobacterial ycf37 mutation decreases the photosystem I content Biochem J 1055

357 211-216 1056

Wilson A Boulay C Wilde A Kerfeld CA and Kirilovsky D (2007) Light-Induced 1057

Energy Dissipation in Iron-Starved Cyanobacteria Roles of OCP and IsiA Proteins 1058

Plant Cell 19 656-672 1059

Xu M Bernaacutet G Singh A Mi H Roumlgner M Pakrasi HB and Ogawa T (2008) 1060

Properties of Mutants of Synechocystis sp Strain PCC 6803 Lacking Inorganic Carbon 1061

Sequestration Systems Plant Cell Physiol 49 1672-1677 1062

33

Yamamoto T Burke J Autz G and Jagendorf AT (1981) Bound ribosomes of Pea 1063

chloroplast thylakoid membranes location and release in vitro by high salt 1064

puromycin and RNase Plant Physiol 67 940-949 1065

Yang H Liao L Bo T Zhao L Sun X Lu X Norling B and Huang F (2014) 1066

Slr0151 in Synechocystis sp PCC 6803 is required for efficient repair of photosystem 1067

II under high-light condition J Integr Plant Biol 56 1136-1150 1068

Yeremenko N Kouřil R Ihalainen JA DHaene S van Oosterwijk N 1069

Andrizhiyevskaya EG Keegstra W Dekker HL Hagemann M Boekema EJ 1070

Matthijs HCP and Dekker JP (2004) Supramolecular Organization and Dual 1071

Function of the IsiA Chlorophyll-Binding Protein in Cyanobacteria Biochemistry 43 1072

10308-10313 1073

Zak E Norling B Maitra R Huang F Andersson B and Pakrasi HB (2001) The 1074

initial steps of biogenesis of cyanobacterial photosystems occur in plasma membranes 1075

Proc Natl Acad Sci USA 98 13443-13448 1076

Zang X Liu B Liu S Arunakumara KKIU and Zhang X (2007) Optimum 1077

Conditions for Transformation of Synechocystis sp PCC 6803 J Microbiol 45 241-1078

245 1079

Zhang L and Sakamoto W (2015) Possible function of VIPP1 in maintaining chloroplast 1080

membranes Biochim Biophys Acta 1847 831-837 1081

Zimmerberg J and Kozlov MM (2006) How proteins produce cellular membrane 1082

curvature Nat Rev Mol Cell Biol 7 9-19 1083

Zoumlfel P (1988) Statistik in der Praxis (Stuttgart Germany Gustav Fischer Verlag) 1084

1085

34

Figure Legends 1086

Figure 1 General characteristics of CurT A) Sequence alignment of CurT and CURT1A-D 1087

from A thaliana Predicted chloroplast transit-peptide sequences of CURT1A-D are omitted 1088

(Armbruster et al 2013) Positions of predicted C-terminal transmembrane domains (TDM) 1089

are marked (black bar) as is the position of the predicted amphipathic N-terminal helix in 1090

CurT (red bar) The green bar denotes the peptide sequence used for antibody production 1091

Identical and related amino acids that are conserved in 100 80 and 60 of the sequences 1092

are highlighted in black dark grey and light grey respectively B) Helical-wheel 1093

representation of the N-terminal amphipathic helix of CurT (red bar in A) The color code 1094

reflects the physicochemical properties of amino-acid side-chains green polar and 1095

uncharged blue polar and positively charged red polar and negatively charged yellow 1096

hydrophobic C) Solubility of CurT Membrane-associated proteins (50 microg) from wild-type 1097

cells were extracted with 5 mM HEPES (pH 76) containing either 1 M NaCl 01 M Na2CO3 1098

4 M urea 01 Triton X-100 or no additional solute After separation of membrane-bound 1099

(M) and solubilized (S) proteins by centrifugation proteins were fractionated by SDS-PAGE1100

and CurT was immunodetected on immunoblots As a control the integral membrane protein 1101

CP47 from PSII was analyzed in parallel D) Transmission electron micrographs of negatively 1102

stained liposomes Cell-free expression (CFE) of CurT and A thaliana CURT1A was 1103

performed in the presence of liposomes similar in composition to the lipids of the thylakoid 1104

membrane Liposomes before and after cell-free protein expression in the absence of DNA 1105

served as negative controls Black arrowheads indicate tubular connections between 1106

liposomes Scale bars 250 nm 1107

1108

Figure 2 Ultrastructural analysis of curT- cells Transmission electron micrographs of typical 1109

wild-type (A) and curT- (B-D) Synechocystis 6803 cells taken at 44000times (A B) and 28000times 1110

(C D) magnification respectively Ultrathin sections (35 to 45 nm) of cryofixed samples 1111

were stained with osmium tetroxide and post-stained using lead citrate Arrowheads indicate 1112

biogenesis centers Scale bars 200 nm (A B) and 500 nm (C D) respectively 1113

1114

Figure 3 Accumulation of components of photosynthetic complexes in the curT- mutant A) 1115

Whole cell extracts (30 microg protein) from wild-type and curT- strains were fractionated by 1116

SDS-PAGE and analyzed on immunoblots using the indicated antibodies B) The histogram 1117

shows levels of the indicated proteins in curT- extracts relative to wild-type samples (dashed 1118

red line) Data are means plusmn SD of three independent experiments Significant differences from 1119

35

wild-type protein levels according to Studentrsquos t-test with error probabilities of 5 and 1 1120

are indicated by and respectively 1121

1122

Figure 4 P700+ reduction kinetics and high-light effects in curT- cells A) Averaged traces 1123

(10 single measurements) of P700+ decay after complete oxidation by a 50-ms multiple 1124

turnover pulse (10000 micromol photons m-2 s-1) in the absence and presence of 10 microM DCMU 1125

B) Rate constants for P700+ reduction were obtained by fitting of the data with single1126

exponential functions Error bars indicate the SD of three independent measurements C) 1127

Impact of light intensity on the (relative) electron transport rate (rETR) Cells were exposed to 1128

gradually increasing light intensities which resulted in increasing electron transport until the 1129

capacity limit was reached PAR light intensity (micromol photons m-2 s-1) Error bars indicate the 1130

SD of three independent measurements D) D1 protein level in wild-type and curT- after high-1131

light treatment (800 micromol photons m-2s-1) in the presence and absence of lincomycin Samples 1132

were taken every 30 min and processed as in Figure 3 to determine the level of D1 present 1133

100 refers to wild-type D1 level at the beginning of the experiment 1134

1135

Figure 5 PSII assembly in curT- cells A) BNSDS-PAGE of membrane proteins Membrane 1136

fractions from wild-type and curT- cells were solubilized with 13 n-dodecyl-β-maltoside 1137

and proteins were fractionated by two-dimensional BNSDS-PAGE blotted and probed with 1138

antibodies against the PSII subunits D1 D2 CP47 and CP43 Wild-type blots were also 1139

probed with the αCurT antibody The sizes of marker proteins and the positions of PSII 1140

assembly intermediates (RCCII RCCI RC47) are shown above and below each image B) In 1141

vivo pulse labeling of membrane proteins with 35S Pulse-labeled PSII core proteins were 1142

separated via BNSDS-PAGE and visualized by autoradiography 1143

1144

Figure 6 Loss of CurT induces stress A) Low-temperature (77 K) fluorescence emission of 1145

Synechocystis 6803 wild-type (blue) and curT- (red) cells excited at 440 nm The spectra were 1146

normalized to the added fluorescein standard B) Low-temperature (77 K) fluorescence 1147

emission of Synechocystis 6803 wild-type (blue) and curT- (red) excited at 580 nm The 1148

spectra were normalized to 780 nm C) Level of IsiA in the curT- mutant relative to the wild-1149

type A mean value of 368 plusmn 96 (SD) was determined from three independent experiments 1150

1151

Figure 7 Membrane sublocalization of PSII-related factors Cell extracts from wild-type and 1152

curT- cells were fractionated by two consecutive rounds of sucrose-density gradient 1153

36

centrifugation (Schottkowski et al 2009b) The second linear gradient (20-60 sucrose) was 1154

apportioned into 14 fractions which were analyzed by immunoblotting using the indicated 1155

antibodies Fractions 1ndash6 represent PDMs and fractions 7ndash14 thylakoid membranes (TMs) 1156

To facilitate comparison between gradients sample volumes were normalized to the volume 1157

of fraction 7 that contained 40 microg of protein 1158

1159

Figure 8 Live-cell imaging of the curT-CFP strain by fluorescence microscopy In the curT-1160

CFP strain the native curT gene has been replaced by a CFP-tagged version resulting in the 1161

expression of the CurT-CFP fusion protein under the control of the native promotor A) 1162

Close-up views of the mid-cell plane in the CFP and far-red autofluorescence channels shown 1163

in slice 7 in panel B B) Synechocystis 6803 cells expressing CurT C-terminally fused to the 1164

mTurquoise2 variant of CFP from its native chromosomal promoter The two imaging 1165

channels are displayed as Z-axis montages (auto-scaled contrast step size 250 nm) in 1166

grayscale and color composite configuration The thylakoid autofluorescent channel as 1167

imaged in far-red fluorescence is depicted in magenta and CurT signal as imaged in cyan 1168

fluorescence is depicted in cyan C) Fluorescence intensity profiles of the two channels along 1169

the autofluorescent peripheral cell ldquoringrdquo are shown for slice 7 The maximum projection of 1170

the entire Z montage is also shown Scale bars (light grey) 2 microm 1171

1172

Figure 9 Immunofluorescence detection of CurT A) Close-ups of slice 5 in panel B B) 1173

Wild-type Synechocystis 6803 cells labeled with αCurT antibodies and detected with Oregon 1174

Green-conjugated secondary antibodies The Z-axis montages are shown as in Figure 8B 1175

except that the step size is 280 nm (1 to 10) C) Intensity profiles of the two channels along 1176

the autofluorescent peripheral cell ldquoringrdquo are shown for slice 5 The maximum projection of 1177

the entire Z montage is also shown Scale bars (light grey) 2 microm 1178

1179

Figure 10 Subcellular localization of CurT Ultrathin sections of wild-type Synechocystis 1180

6803 cells were incubated with rabbit αCurT prior to incubation with gold-conjugated goat 1181

anti-rabbit IgG A) Negative control (wild-type processed without addition of primary 1182

antibody) B C) Immunogold-labeled sections showing CurT localization at the cytoplasmic 1183

side of the thylakoid membrane D) Cluster formation of CurT signals at a putative biogenesis 1184

center from C E) Biogenesis center from the same cell (C) without any obvious CurT 1185

clustering of gold particles F) Schematic depiction of a wild-type cell (from Figure 2A) with 1186

color-coded curved membranes green = thylakoids that follow the curvature of the cell red = 1187

37

thylakoids that bend away from the plasma membrane yellow = thylakoids that bend toward 1188

the plasma membrane to converge on sites of biogenesis centers G) Relative distribution of 1189

gold signals between convex (dark color) and concave (light color) sides of membranes (n = 1190

1584 signals from a total of 95 cells) The undifferentiated overall signal distribution is given 1191

in blue Bars = 200 nm (overview) and 100 nm (details) 1192

1193

Figure 11 Differentially modified forms of CurT are found in different complexes in PDMs 1194

and thylakoid membranes Samples were isolated by fractionation of wild-type membranes 1195

via two consecutive sucrose density gradients according to Schottkowski et al (2009b) After 1196

density centrifugation samples were applied to BNSDS-PAGE analysis (A) or isoelectric 1197

focusing (B) Numbers on the right indicate the respective fraction from the second gradient 1198

(see Figure 7) Fraction 5 represents the PDMs and fraction 9 the thylakoid membrane 1199

1200

Figure 12 Loss of CurT increases sensitivity to abiotic stress A B) Doubling times of wild-1201

type and curT- under salt stress (A) or osmotic stress (B) Doubling times are means plusmn SD of 1202

three independent cultures C) Localization of CurT-CFP under salt and osmotic stress 1203

Samples were examined as described in Figure 8 Scale bars 1 microm D) Protein levels of wild-1204

type cells after growth in BG11 medium containing 500 mM NaCl Samples were analyzed on 1205

the same gel but unrelated samples between the presented signals were omitted E) 1206

Membrane preparations obtained from wild-type cells wild-type cells grown in the presence 1207

of 500 mM NaCl and curT- cells were subjected to the first gradient step in the membrane 1208

fractionation scheme The gradient was divided into five fractions and 10 of fractions I-IV 1209

and 02 of fraction V were analyzed by SDS-PAGE Fraction II includes the plasma 1210

membrane and fraction V consists of PratA-defined membrane and thylakoid membrane 1211

1212

Figure 13 Model of CurT distribution at convergence zones in Synechocystis 6803 The 1213

distribution of CurT in thylakoid (green) and plasma membranes (brown) is shown The 1214

pattern of localization of CurT in the thylakoid membrane is derived from membrane 1215

fractionation via sucrose density centrifugation fluorescence-based detection of the CurT-1216

CFP fusion and endogenous CurT and immunogold labeling experiments (Figures 7-10) The 1217

different CurT variants a b c and d identified in the IEF experiments (Figure 11) are depicted 1218

in yellow pink blue and black respectively CurT present in the plasma membrane is 1219

highlighted in gray as its precise nature and role remain to be defined (Figure 12) 1220

Membranes are represented as lipid bilayers Convex and concave faces of bent thylakoid 1221

38

sheets are indicated by black arrows The PDM which is dedicated to PSII assembly and 1222

repair is depicted in blue The dotted blue line emphasizes that the ultrastructure in this region 1223

has not yet been fully resolved PP periplasm PM plasma membrane TM thylakoid 1224

membrane L lumen PDM PratA-defined membrane 1225

1226

Tables 1227

Table 1 Physiological characteristics of the curT- mutant 1228

Strain Doubling time [h]

Oxygen Evolution[nmol h-1 OD750

-1]c

Chlorophyll content

[microg OD750-1]

d

Cell size [microm]e

Cell number [ml-1 OD750

-1]f

Wild type 817plusmn017a 1600plusmn042

b 1933plusmn187 251plusmn014 264plusmn020 390plusmn006 x 107

curT- 1259plusmn020a 3226plusmn056

b 1074plusmn20 195plusmn029 274plusmn044 367plusmn016 x 107

1229 abDoubling times in the presence (a) or absence (b) of 5 mM glucose measured under 1230

continuous illumination at 30 micromol photons m-2 s-1 and CO2-limiting conditions cOxygen 1231

evolution is expressed in nmol O2 produced per hour per OD750 unit dChlorophyll content is 1232

expressed in microg OD750-1 eThe diameter of non-dividing cells is presented in microm fCell number 1233

was determined per ml per OD750 Data are means plusmn SD of at least three independent 1234

experiments 1235

1236

Parsed CitationsAllen JF de Paula WBM Puthiyaveetil S and Nield J (2011) A structural phylogenetic map for chloroplast photosynthesisTrends Plant Sci 16 645-655

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Anderson JM Horton P Kim E-H and Chow WS (2012) Towards elucidation of dynamic structural changes of plant thylakoidarchitecture Philos Trans R Soc Lond B Biol Sci 367 3515-3524

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Armbruster U Zuumlhlke J Rengstl B Kreller R Makarenko E Ruumlhle T Schuumlnemann D Jahns P Weisshaar B NickelsenJ and Leister D (2010) The Arabidopsis thylakoid protein PAM68 is required for efficient D1 biogenesis and photosystem IIassembly Plant Cell 22 3439-3460

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Armbruster U Labs M Pribil M Viola S Xu W Scharfenberg M Hertle AP Rojahn U Jensen PE Rappaport F JoliotP Doumlrmann P Wanner G and Leister D (2013) Arabidopsis CURVATURE THYLAKOID1 proteins modify thylakoid architectureby inducing membrane curvature Plant Cell 25 2661-2678

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Aseeva E Ossenbuumlhl F Sippel C Cho WK Stein B Eichacker LA Meurer J Wanner G Westhoff P Soll J andVothknecht UC (2007) Vipp1 is required for basic thylakoid membrane formation but not for the assembly of thylakoid proteincomplexes Plant Physiol Biochem 45 119-128

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Bartsevich VV and Pakrasi HB (1995) Molecular identification of an ABC transporter complex for manganese analysis of acyanobacterial mutant strain impaired in the photosynthetic oxygen evolution process EMBO J 14 1845-1853

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Bartsevich VV and Pakrasi HB (1996) Manganese transport in the cyanobacterium Synechocystis sp PCC 6803 J Biol Chem271 26057-26061

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Bernaacutet G Waschewski N and Roumlgner M (2009) Towards efficient hydrogen production the impact of antenna size andexternal factors on electron transport dynamics in Synechocystis PCC 6803 Photosynth Res 99 205-216

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Boehm M Yu J Krynicka V Barker M Tichy M Komenda J Nixon PJ and Nield J (2012) Subunit Organization of aSynechocystis Hetero-Oligomeric Thylakoid FtsH Complex Involved in Photosystem II Repair Plant Cell 24 3669-3683

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Bradford MM (1976) A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle ofprotein-dye binding Anal Biochem 72 248-254

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Chang L Liu X Li Y Liu C-C Yang F Zhao J and Sui S-F (2015) Structural organization of an intact phycobilisome and itsassociation with photosystem II Cell Res 25 726-737

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Danielsson R Suorsa M Paakkarinen V Albertsson P-Aring Styring S Aro E-M and Mamedov F (2006) Dimeric andmonomeric organization of photosystem II Distribution of five distinct complexes in the different domains of the thylakoidmembrane J Biol Chem 281 14241-14249

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Daum B Nicastro D Austin J McIntosh JR and Kuumlhlbrandt W (2010) Arrangement of photosystem II and ATP synthase in

6

thylakoids appeared as disordered sheets that traversed the cytoplasm and completely lacked 178

the typical convergence zones with the corresponding biogenesis centers at the periphery 179

(Figures 2B-D) This indicates a strict requirement of CurT for the establishment of normal 180

thylakoid membrane architecture in Synechocystis 6803 181

182

Inactivation of curT affects photosynthetic performance 183

The severely altered morphology of the thylakoid membrane system in curT- cells and 184

in particular the lack of PSII-related biogenesis centers prompted us to investigate the 185

photosynthetic performance of the mutant (Stengel et al 2012) The chlorophyll content was 186

reduced by ~20 and absorption spectroscopy also revealed a reduction in phycobilisomes 187

as well as an increase in carotenoid levels (Table 1 Supplemental Figure 4) Despite changes 188

in ultrastructure and pigment levels size and number of curT- cells at OD750 were not 189

significantly different as judged by t-test-based statistical analysis (Table 1) 190

To explore the photosynthetic defects of the mutant in detail immunoblot analyses 191

were performed using antibodies raised against specific subunits of photosynthetic complexes 192

and some of their biogenesis factors In curT- PSII reaction-center subunits including D1 D2 193

CP47 and CP43 were found to be present at 44 42 56 and 45 of the wild-type level 194

respectively (Figure 3) Interestingly amounts of the PSII assemblyrepair factors PratA and 195

Slr0151 as well as the light-dependent protochlorophyllide oxidoreductase (POR) enzyme 196

were also reduced (Figure 3 Yang et al 2014 Rast et al 2016) Levels of the Pitt protein 197

which interacts with POR (Schottkowski et al 2009a) and the Oxa homolog YidC 198

(Ossenbuumlhl et al 2006) were slightly increased in curT- (Figure 3) On the other hand 199

Sll0933 the homolog of the PSII assembly factor PAM68 in A thaliana accumulated to 200

250 of the wild-type level (Armbruster et al 2010) In contrast amounts of both Cytf and 201

PsaA which serve as markers for the Cyt(b6f) and PSI complexes respectively the RbcL 202

subunit of the Rubisco enzyme the PSII assembly factor Ycf48 (Komenda et al 2008) and 203

VIPP1 remained unaltered in curT- (Figure 3) Overall the alterations in protein accumulation 204

indicate that loss of CurT preferentially affects the accumulation of PSII 205

This result was further corroborated by analysis of the photosynthetic performance of 206

curT- The rate of light-dependent oxygen evolution was reduced by approximately 50 in the 207

mutant (Table 1) and analysis of P700+ reduction kinetics revealed impaired electron donation 208

by PSII (Figure 4A) PSII-driven P700+ reduction is slowed down by a factor of three in curT-209

whereas the residual cyclic electron transfer activity in the presence of DCMU is less than 210

5 in both wild-type and curT- (Figure 4B) In contrast the light intensity-dependent electron 211

7

transfer capacity which was measured as relative electron transfer rate (rETR) did not differ 212

significantly between wild-type and curT- (Figure 4C) Both wild-type and curT- cells reach a 213

capacity limit at ~ 250 micromol photons m-2s-1 and the decay of rETR beyond the capacity limit 214

is very similar These results indicate that the point of onset of PSII-related photoinhibition is 215

the same in both strains which in turn implies that electron flow downstream of PSII is 216

unchanged in the mutant 217

Low PSII levels in curT- could be caused either by reduced synthesisbiogenesis or its 218

enhanced degradation To measure the rates of D1 repair the kinetics of D1 accumulation 219

upon induction of photoinhibition by high-light treatment (800 micromol photons m-2s-1) was 220

assayed by immunological means (Figure 4D) In wild-type cells the D1 level decreased to 221

60 (relative to the initial time point) after 90 min of treatment As previously shown the 222

drop is much more pronounced (~35 left) when repair synthesis of D1 is inhibited by the 223

addition of lincomycin (Figure 4D Komenda et al 2008) Surprisingly in curT- the level of 224

residual D1 is rather stable over the same time period and lincomycin treatment induces a 225

more modest decrease to 60 relative to the initial time point (Figure 4D) These data clearly 226

indicate that in absence of CurT residual D1 is less susceptible to degradation even though 227

its absolute amount is reduced In line with this no effect on growth rates was observed when 228

either wild-type or curT- cells were cultivated for two days at 200 micromol photons m-2s-1 229

(Supplemental Figure 5) 230

To assess the role of CurT in the assembly of PSII we compared the two-dimensional 231

profiles of thylakoid membrane proteins from wild-type and mutant cells by Blue-Native 232

(BN)SDS-PAGE PSII assembly intermediates were subsequently visualized via 233

immunodetection of PSII core subunits As shown in Figure 5A dimeric PSII core complexes 234

(RCCII) are drastically underrepresented in curT- whereas relative levels of earlier assembly 235

intermediates including the monomeric CP43-less RC47 complex and non-assembled CP43 236

increase Parallel detection of CurT itself revealed a ldquosmearedrdquo signal in the size range from 237

15 up to 500 kDa suggesting that CurT forms part of high-molecular-weight complexes 238

(Figure 5A) Finally in vivo 35S protein pulse-labeling experiments confirmed that RC and 239

RC47 complexes in particular are efficiently formed in curT- but the transition to RCCI 240

complexes is severely delayed (Figure 5B) As a consequence dimeric RCCII complexes do 241

not incorporate any radioactive label over the experimentrsquos time course of 25 min (Figure 5B) 242

Taken together these data show that curT inactivation has a severe impact on PSII biogenesis 243

but little or no effect on the degradation of the complex 244

8

The data presented so far suggest a PSII-related phenotype for curT- so we explored 245

the effects of curT disruption on photosynthesis further by comparing the low-temperature 246

(77K) fluorescence emission spectra in cell suspensions following excitation of chlorophyll at 247

440 nm (Figure 6A) The signals were normalized to the emission maximum at 514 nm of the 248

external standard fluorescein (Figure 6A) In curT- the PSI emission peak amplitude was 249

similar to that of the wild-type (Figure 6A) The spectra differed however around 685 nm 250

Here we observed an increase in fluorescence in the mutant strain an emission signature that 251

is probably related to the inner antenna protein CP43 (Figure 6A Nilsson et al 1992) 252

Increased chlorophyll fluorescence at 685 nm has previously been shown to be characteristic 253

for cells that are accumulating the stress-induced IsiA protein which shares structural 254

similarities with CP43 (Odom et al 1993 Yeremenko et al 2004 Wilson et al 2007) A 255

second indication for accumulation of IsiA is a diagnostic blue shift of the 725 nm 256

fluorescence peak by approximately 5 nm which is indeed observed in the curT- spectrum 257

(Figure 6A Sandstroumlm et al 2001) We therefore determined the level of IsiA in both wild-258

type and curT- by immunoblot analysis As expected IsiA was strongly induced in curT- 259

suggesting that the mutant suffers from severe stress (Figure 6C) When fluorescence at 77K 260

was recorded after excitation at 580 nm which mainly excites the phycobiliproteins the 261

signal at 685 nm (PSII related) was enhanced in the curT- mutant most likely reflecting IsiA 262

emission andor the presence of uncoupled phycobilisomes (Figure 6B Wilson et al 2007) 263

In contrast the 725 nm peak (PSI related) was reduced in curT- relative to the wild-type 264

suggesting less coupling of phycobilisomes to PSI (Figure 6B) The increase in uncoupled 265

phycobilisomes can be directly attributed to the reduction in RCCII levels found in the curT- 266

mutant (Figure 5A) since phycobilisomes are attached to PSII dimers for efficient light 267

harvesting (Watanabe and Ikeuchi 2013 Chang et al 2015) 268

Thus the curT- mutant exhibits a characteristic set of photosynthetic defects The 269

primary target of the CurT membrane-shaping function appears to be PSII in particular in its 270

biogenic phase However the reduction in PSII content cannot be responsible for the lack of 271

thylakoid convergence zones at the plasma membrane because these structures can still be 272

observed in the psbA- mutant TD41 which is lacking D1 and therefore unable to assemble any 273

PSII complexes (Supplemental Figure 6 Nilsson et al 1992) 274

275

Subcellular localization of CurT 276

We have previously proposed that the initial steps in PSII assembly take place in 277

biogenesis centers located at the interface between plasma and thylakoid membranes (Stengel 278

9

et al 2012) These biogenic membranes (PDMs) are marked by the PSII Mn2+ delivery factor 279

PratA and can be separated from thylakoids by a two-step sucrose-gradient centrifugation 280

procedure (Schottkowski et al 2009b Rengstl et al 2011) When the distributions of various 281

proteins within such membrane fractions from the wild-type and curT- were compared two 282

striking changes were detected in the mutant First the precursor of the D1 subunit of PSII 283

(pD1) is absent from PDMs in the mutant and secondly the inner antenna protein CP47 ndash but 284

not CP43 ndash of PSII shifts towards fractions of lower density (Figure 7) Hence the 285

organization of PDMs appears to be perturbed in curT- In wild-type cells most of the CurT 286

protein was found in thylakoid membranes only a minor fraction similar in amount to that of 287

the PSII assembly factors Ycf48 Pitt and YidC as well as the VIPP1 protein comigrated with 288

PDMs (Figure 7) According to rough estimates based on densitometric signal analysis 25 289

of total cellular CurT is normally found in the PDMs and 75 in the thylakoids (Figure 7) 290

To further analyze the localization of CurT in its cellular context in vivo we 291

constructed a translational fusion in which the monomeric enhanced cyan fluorescent protein 292

(CFP) mTurquoise2 (Goedhart et al 2012) is attached to the C-terminus of CurT and is 293

expressed under the control of the native curT promoter The resulting strain curT-CFP 294

showed a fully restored wild-type growth phenotype indicating that the CFP tag does not 295

affect CurTrsquos function (Supplemental Figure 7A) In agreement with this the fusion protein 296

accumulated to wild-type levels (96 plusmn 16 Supplemental Figure 7B) and localized to the 297

same membrane sub-fractions as does native CurT (Supplemental Figure 7C) The CurT-CFP 298

fluorescence signal was distinctly discernible above the wild-type autofluorescence 299

background (Supplemental Figure 8A) and was distributed in a network-like pattern with 300

concentrated areas at the cell periphery at mid-plane Analysis of CurT-CFP fluorescence in 301

Z-axis montages revealed that these signals often appeared as rod-like structures which 302

seemed to follow the spherical inner surface of the cell (Figure 8A B Supplemental Movie 1 303

and 2) In some cases these structures also appear to extend through the cytoplasm (Figure 304

8A and 8B Supplemental Movie 3) 305

When chlorophyll autofluorescence indicative of thylakoid membranes was visualized 306

in the same cell only a partial overlap with the CurT-CFP signal was observed (Figure 8 307

Supplemental Movie 1-3) Strikingly the peripheral CurT-CFP signals frequently reached 308

their maximal intensity in those areas where chlorophyll fluorescence was low ie where 309

thylakoid convergence zones are expected to form (Sacharz et al 2015) This becomes even 310

clearer when the intensity of a circumferential profile that follows the thylakoidrsquos 311

10

fluorescence signal is quantified separately for each of the two fluorescent channels (Figure 312

8C) 313

In contrast the chlorophyll autofluorescence in the curT- mutant seems to be evenly 314

distributed (Supplemental Figure 9) Following the fluorescence in an intensity profile as in 315

curT-CFP no regions with a similar decline in fluorescence were found most likely due to 316

the absence of biogenesis centers In addition some circular structures presenting chlorophyll 317

autofluorescence were detected in the interior of the cells Hence the disturbed curT- 318

ultrastructure is also reflected in the distribution of chlorophyll pigments (Supplemental 319

Figure 9) 320

To confirm the network-like distribution of CurT-CFP in the cell we used 321

immunofluorescence to detect CurT in the wild-type in situ Synechocystis 6803 cells were 322

fixed and treated with the αCurT antibody and an Oregon Green-conjugated secondary 323

antibody As shown in Figure 9A and B both techniques revealed similar network-like 324

patterns of the CurT signal which coalesced into rod-like structures at the cell surface and 325

essentially filled up the gaps between the autofluorescent thylakoid regions (negative controls 326

shown in Supplemental Figure 8B and 8C) Again regions of low chlorophyll fluorescence 327

typical of biogenesis centers generally exhibited stronger CurT-related fluorescence (Figure 328

8C) Occasionally CurT-CFP signals were also observed near traversing thylakoid lamellae 329

(when these were present in the cell analyzed) but the autofluorescence intensity of such 330

thylakoids is much weaker (see Figure 8B cell b in slice 6 and Supplemental Movie 3) 331

Finally CurT was localized by immunogold labeling experiments on ultrathin sections 332

of wild-type Synechocystis 6803 cells Almost no signals were detected when wild-type and 333

curT- sections were processed in the absence of the primary antibody as a negative control 334

(Figure 10A and Supplemental Figure 10A respectively) When mutant curT- cells were 335

processed in the presence of the αCurT antiserum a low level of randomly distributed 336

background signals was observed (Supplemental Figure 10B Supplemental Table 1) 337

However the number of signals located at the thylakoid membrane was clearly reduced 338

relative to the wild-type Therefore these signals were treated as non-specific background 339

Upon incubation of wild-type cell sections with antibodies directed against the N-terminus of 340

CurT (Figure 1A) the antigen was detected on the cytoplasmic surface of thylakoid 341

membranes (Figure 10B and 10C) This strongly suggests that its N-terminus is oriented 342

towards the cytoplasm Overall CurT signals appeared to be distributed along both thylakoids 343

and PDMs This agrees with the broad distribution of CurT across various fractions in the 344

membrane fractionation experiments (Figure 7) In only a few cases (12 ) however was 345

11

some clustering of immunogold signals at thylakoid convergence regions found (Figure 10D 346

and 10E) Thus the high local concentration of CurT at biogenic centers seen in the 347

fluorescence-based approaches (Figures 8 and 9) was not quantitatively reflected in the 348

immunogold labeling data This is likely due to the fact that immunogold electron microscopy 349

can only detect antigens on the surface of the section This issue is further complicated by the 350

heterogeneity of the CurT assemblies (see below and Discussion section) 351

Nevertheless closer inspection of the immunogold signals revealed an asymmetric 352

distribution of CurT signals with regard to the two faces of thylakoid sheets As illustrated in 353

Figure 10G curved thylakoid sheets possess a longer convex and a shorter concave face 354

When we analyzed a total of approximately 1500 CurT immunogold signals (from a total of 355

95 cells) which were unambiguously located to one side of the thylakoid membrane (for a 356

representative example see Supplemental Figure 11) 561 were found to be located at the 357

convex face while the other 439 localized to the concave side (Figure 10G Supplemental 358

Table 2) When differently curved regions (Figure 10F) including thylakoid lamellae (i) that 359

follow the overall shape of the cell (green) (ii) bend away from the plasma membrane (red) or 360

(iii) towards it ie where thylakoids converge to form biogenesis centers (yellow) were 361

examined separately red and green regions showed a CurT distribution in the range of 55 362

convex to 45 concave (Figure 10G Supplemental Table 2) However at the biogenesis 363

centers (the regions highlighted in yellow in Figure 10F) the uneven distribution of the 364

immunogold signals was more pronounced 61 of signals were found on the convex side 365

and 39 on the concave face of thylakoid lamellae (Figure 10G Supplemental Table 2) 366

Statistical analyses confirmed the significance of these differences in signal distributions 367

along the thylakoid membrane types (Supplemental Table 3) 368

Taken together with the finding that CurT is required for the formation of the 369

convergence sites forming biogenesis centers these data are consistent with the idea that the 370

thylakoid sheets are shaped by CurT which induces membrane curvature via asymmetric 371

intercalation on the two sides of thylakoid sheet 372

373

Different forms of CurT are found in PDMs and thylakoids 374

CurT was found to localize to both highly curved PDMs and less bent thylakoids Its 375

high local concentration at biogenic centers as seen in the fluorescence-based approaches 376

suggests a dosage-dependent effect of CurT on membrane shaping An alternative possibility 377

is that different CurT variants might exist in the two membrane types which could potentially 378

serve different functions To explore this possibility we asked whether CurT is found in 379

12

different complexes by using 2D BNSDS-PAGE to characterize membrane material isolated 380

via two-step sucrose gradient centrifugation (see Figure 7) In accordance with the data in 381

Figure 5A we find several low-molecular-weight complexes containing CurT (Figure 11A) 382

Smaller complexes of ~80 (complex I) and ~100 kDa (complex II) accumulate in membrane 383

fraction 5 (representing PDMs) but these are far less prevalent in fraction 9 representing 384

thylakoids (Figure 11A) In addition CurT-containing sub-complexes of ~140 (complex III) 385

and ~200 kDa (complex IV) are more prominently represented in thylakoids together with 386

even larger complexes ranging up to 670 kDa (Figure 11A) 387

Even more strikingly PDMs and thylakoids also differ with respect to the forms of 388

CurT they contain Thus isoelectric focusing (IEF) analysis of both membrane fractions 389

revealed at least four different CurT isoforms (a-d Figure 11B) PDMs contain mainly forms 390

b and d as well as trace amounts of a while thylakoids apparently possess very low levels of 391

form d and accumulate forms a b and c (Figure 11B) The nature of the underlying CurT 392

modifications still has to be determined Interestingly however CurT has recently been 393

identified as a phosphoprotein in a proteomic study (Spaumlt et al 2015) and the CurT variants 394

in Figure 11B may differ in their phosphorylation states At all events PDMs and thylakoids 395

can be distinguished by their complement of CurT isoforms which potentially play a role in 396

formation of the CurT sub-complexes that define the two membrane fractions 397

398

CurT is involved in the osmotic stress response 399

To further explore the stress-related role of CurT (Figure 6) and its link to IsiA 400

induction the effect of other potential stressors on curT- cells was tested High light levels had 401

a minor effect on curT- growth and its photosynthetic performance (Figure 4 Supplemental 402

Figure 5 and section above) suggesting that other environmental factors induced isiA 403

expression Our search was also motivated by a previous proteomic survey of plasma 404

membrane proteins of Synechocystis 6803 in high salt conditions in which CurT and VIPP1 405

were found among the most highly induced targets (Huang et al 2006) First we cultured 406

wild-type and curT- cells in different salt concentrations and found that growth of curT- was 407

severely affected in high salt (Figure 12A) Wild-type cells were only slightly affected by the 408

addition of salt to the medium The deleterious effect of the loss of curT on growth was even 409

more pronounced when maltose an osmotically active compound was present in the medium 410

(Figure 12B) Indeed curT- cells failed to survive exposure to 150 mM maltose whereas 411

growth of the wild-type was only slightly compromised These findings assign an additional 412

function to CurT ie a protective role during osmotic stress 413

13

When the curT-CFP strain was analyzed under these stress conditions enhanced 414

accumulation of CurT at the cell periphery was found mostly outside the autofluorescent 415

thylakoids and consistent with accumulation at the plasma membrane (Figure 12C) This was 416

further substantiated by membrane fractionation experiments which also revealed an 417

increased relative abundance of CurT in the plasma membrane fraction in the first sucrose 418

gradient (Figure 12E) Determination of total cellular CurT levels demonstrated that its 419

absolute amount did not increase under stress (Figure 12D) Therefore its higher abundance 420

in the plasma membrane under osmotic stress is likely to be due to CurT trafficking towards 421

the plasma membrane instead of increased synthesis 422

The same appears to hold true for VIPP1 which has been implicated in membrane 423

maintenance in both cyanobacteria and chloroplasts (Zhang and Sakamoto 2015) At stress 424

conditions an increase of the VIPP1 signal in the plasma membrane can be monitored in 425

wild-type (Figure 12E) However enhanced accumulation of VIPP1 in plasma membranes is 426

unaffected in the curT- mutant suggesting that thylakoid convergence zones are not strictly 427

required for the localization of VIPP1 428

429

Discussion 430

CurT determines thylakoid architecture 431

This study demonstrates that the protein CurT a homolog of the grana-forming 432

CURT1 proteins in plants is essential for establishing the proper thylakoid membrane 433

architecture in the cyanobacterium Synechocystis 6803 In particular CurTrsquos membrane-434

bending activity is likely to be required for the formation of thylakoid biogenesis centers at 435

points on the cell periphery where thylakoids converge towards the plasma membrane Here 436

PratA-mediated preloading of early PSII assembly intermediates with Mn2+ ions has been 437

proposed to take place together with PSII repair (Stengel et al 2012 Sacharz et al 2015) 438

This idea is supported by the following lines of evidence (i) The curT- mutant is devoid of 439

any thylakoid sectors that have convergence zones at their distal ends instead thylakoid 440

membranes are displaced and disposed as disordered or continuous rings (ii) CurT similarly 441

to CURT1A possesses a membrane-curving activity in vitro and intercalates asymmetrically 442

into thylakoids (iii) A high local concentration of CurT is observed at regions of high 443

curvature where biogenesis centers are found (iv) Lack of CurT affects the formation and 444

accumulation of PSII complexes as well as the abundance of some of its assembly factors 445

The drastic effects of CurT inactivation indicate an important role for this factor in membrane 446

shaping In contrast to the situation for CURT1A from Arabidopsis attempts to stably 447

14

overexpress CurT in Synechocystis 6803 failed Although short-lived transient increases in 448

CurT levels were observed when curT was expressed via strong heterologous promoters 449

wild-type levels of the protein were restored during subsequent rounds of cultivation of 450

transgenic lines Apparently Synechocystis 6803 cells do not tolerate substantial alterations in 451

CurT dosage and counter-select against these 452

This is in agreement with a dosage-dependent membrane-curving activity of CurT 453

which is suggested by its high local concentration at the edges of thylakoid autofluorescent 454

regions which mark the sites of the highly curved thylakoid convergence zones (Figures 8 9 455

and 13 Supplemental Movie 1 2 and 3) In addition some CurT was detected in structures 456

extending through the cytoplasm which most likely represent thylakoid sheets traversing the 457

cell from one thylakoid convergence zone to another (Figures 2A and 8) CurT might be 458

involved in the formation and stabilization of these structures 459

Members of the CURT1 family contain an N-terminal amphipathic α-helix that may 460

be involved in the membrane-bending activity of CurT (Armbruster et al 2013) Several 461

eukaryotic membrane-shaping proteins possess amphipathic helices as part of either an ENTH 462

(epsin N-terminal homology) or an N-BAR (Bin amphiphysin Rvs with N-terminal 463

amphipathic helix) domain (Ford et al 2002 Gallop and McMahon 2005 Zimmerberg and 464

Kozlov 2006) ENTH and N-BAR domains are rather large (~200 amino acids) and it has 465

been shown that amphipatic helices present in those domains insert into one leaflet of the lipid 466

bilayer and thereby induce curvature of the membrane (reviewed by Gallop and McMahon 467

2005 Zimmerberg and Kozlov 2006) However CurT itself is a small protein (149 amino 468

acids) that contains two transmembrane domains which insert into both leaflets of the lipid 469

bilayer (Figure 1A) as already suggested by Armbruster et al (2013) The amphipathic helix 470

faces the cytoplasm in Synechocystis 6803 or the stroma in A thaliana and most likely it 471

fine-tunes the degree of membrane bending mediated by CurT (Armbruster et al 2013) 472

In addition the increase in curvature correlated with CurT accumulation at convex 473

sides of thylakoid lamella (Figure 10 and 13) Hence curving might be mediated by 474

asymmetric integration of CurT into the lipid bilayers forming opposite faces of thylakoid 475

membrane sheets (Figure 13) However the mechanism causing this asymmetry remains 476

elusive 477

The presence of different CurT isoforms and complexes in PDMs and thylakoids adds 478

a further level of complexity and most likely reflects the dynamic regulation of this system 479

(Figure 11) The formation of different complexes might be primed by the phosphorylation of 480

CurT within its N-terminal cytoplasmic part (Spaumlt et al 2015) It seems likely that these 481

15

complexes play distinct roles in mediating the different CurT functions ie membrane 482

bending and maintenance 483

However it remains to be seen how exactly curvature is established maintained and 484

fine-tuned In addition other determinants of membrane topology and their putative interplay 485

with CurT have to be considered eg lipid and protein (complex) composition of 486

membranes cellular turgor pressure and other factors required for membrane 487

biogenesismaintenance eg the VIPP1 protein before precise molecular models of CurTrsquos 488

mode of action can be constructed (Rast et al 2015 and see below) That these other factors 489

can be crucial for membrane architecture is documented by the fact that some marine 490

cyanobacteria such as Prochlorococcus and Synechococcus contain curved thylakoids (but 491

no thylakoid convergence zones at the plasma membrane) although they lack a curT gene 492

493

The role of biogenesis centers 494

The absence of biogenesis centers in the curT- mutant now enables one to answer some 495

questions relating to the role of these thylakoid sub-structures which form in some but not all 496

cyanobacteria (Kunkel 1982 van de Meene et al 2006) First they are not essential since 497

even the curT- mutant still accumulates PSII to ~50 of wild-type levels On the other hand 498

in the mutant assembly of PSII is impaired as revealed by the increased accumulation of early 499

assembly intermediates In addition PSII dimers are almost completely absent in curT- 500

Whether the reduction in PSII dimers is attributable to an assembly problem linked to the 501

absence of biogenesis centers or to a secondary defect in dimer stabilization caused by 502

changes in overall thylakoid membrane ultrastructure remains to be determined Thus 503

biogenesis centers are more likely to represent evolutionary ldquoadd-onsrdquo that facilitated efficient 504

thylakoid biogenesis This is compatible with the fact that some cyanobacteria are devoid of 505

any biogenesis center-related substructures Second their absence compromises PSII but the 506

accumulation of other photosynthetic complexes ie PSI and the Cyt(b6f) complex is not 507

affected by CurT deficiency (Figure 3) This observation agrees with previous findings that 508

neither the PsaA subunit of PSI nor its assembly factor Ycf37 is detectable in isolated PDM 509

fractions (Rengstl et al 2011) 510

In addition to reduced de novo PSII assembly a higher relative stability of D1 in high-511

light experiments has been detected in curT- which suggests that D1 degradation during PSII 512

repair is less efficient in the mutant Photo-damaged D1 is degraded by the FtsH2FtsH3 513

complex which has previously been shown to partly localize to thylakoid convergence zones 514

at the cell periphery ie biogenesis centers (Boehm et al 2012 Sacharz et al 2015) It 515

16

therefore seems possible that the absence of biogenesis centers in curT- leads to 516

mislocalization of the FtsH2FtsH3 complex and less effective D1 degradation 517

Moreover a PSII related-function for CurT is supported by a meta-analysis of the 518

Synechocystis 6803 transcriptome When the CyanoEXpress 22 database (Hernaacutendez-Prieto 519

and Futschik 2012 Hernaacutendez-Prieto et al 2016) was queried for genes co-expressed with 520

curT (slr0483) genes for five PSII subunits ndash psbE psbO psbF psbL and psb30 ndash were 521

found among the first ten hits (Supplemental Table 4) From this we infer that biogenic 522

centers do not play an essential role in the assembly of all photosynthetic complexes but 523

serve to enhance PSII assemblyrepair possibly through the efficient delivery of Mn2+ 524

Residual PSII in curT- cells is likely to be supplied with cytoplasmic Mn2+ via a second 525

independently operating ABC transporter-based system in the plasma membrane named the 526

Mnt pathway (Bartsevich and Pakrasi 1995 Bartsevich and Pakrasi 1996) 527

Formally we cannot exclude that CurT is directly involved in the PSII assembly 528

process However considering CurTrsquos membrane bending capacity and the mutant phenotype 529

(Figure 1D and Figure 2) it appears more likely that CurT forms cellular substructures for 530

efficient PSII biogenesis ie biogenesis centers 531

As mentioned above some ultrastructural features of biogenesis centers have emerged 532

from studies employing EM-based tomography (van de Meene et al 2006) To date however 533

a high-resolution picture of the precise membrane architecture within these centers remains 534

elusive In particular whether or not a direct connection between plasma membrane and 535

thylakoids exists continues to be debated As recently discussed and in line with this gap in 536

knowledge different membrane fractionation techniques have revealed different distributions 537

of PSII-related subunits and assembly factors between plasma and thylakoid membranes 538

(Heinz et al 2016 Liberton et al 2016 Selatildeo et al 2016) The overall picture that emerges 539

is that the initial hypothesis that PSII biogenesis is initiated at the plasma membrane is no 540

longer tenable whereas a specialized thylakoid sub-fraction like the PDMs that make contact 541

with the plasma membrane could explain many of the available data and thus clarify some 542

aspects of the debate (Zak et al 2001 Pisareva et al 2011 Rast et al 2015) Moreover it 543

has previously been hypothesized that ldquoribosome-decorated membrane-like complexesrdquo 544

forming at the innermost thylakoid sheet might represent biogenic compartments (van de 545

Meene et al 2006 Mullineaux 2008) Whether these structures are affected in curT- cannot 546

be judged based on our TEM analysis but requires ultrastructural data of higher resolution 547

However the accessibility of thylakoids for ribosomes should be increased in the less 548

compressed membrane system of curT- (Figure 2B-D) 549

17

A scenario similar to that of Synechocystis 6803 holds for the situation in chloroplasts 550

of the green alga Chlamydomonas reinhardtii in which de novo PSII biogenesis has been 551

shown to be initiated in punctate regions named T-zones located close to the pyrenoid 552

(Uniacke and Zerges 2007) Unlike the mRNAs for the PSII components neither RNAs for 553

PSI subunits nor PSI assembly factors are localized to T-zones indicating that PSI and PSII 554

assembly processes are spatially separated (Uniacke and Zerges 2009 Nickelsen and Zerges 555

2013 Rast et al 2015) Interestingly a recent cryoelectron tomography study demonstrated 556

that next to T-zones at the chloroplast base-lobe junction the inner chloroplast envelope 557

exhibits invaginationsconnections to thylakoids that structurally resemble the organization of 558

cyanobacterial biogenesis centers (Engel et al 2015) For future investigations it will be 559

interesting to see if a homolog of the CURT1 family is involved in the formation of these 560

structures in C reinhardtii 561

562

Evolution of CURT1 function 563

Homologs of the CURT1 protein family can be found throughout cyanobacteria green 564

algae and plants (Armbruster et al 2013) The Arabidopsis CURT1A-D proteins have 565

recently been shown to induce bending of thylakoid membranes at grana margin regions 566

(Armbruster et al 2013) Interestingly and in contrast to the situation in Synechocystis 6803 567

their inactivation did not result in severe photosynthetic deficiencies although the thylakoids 568

formed lacked defined grana stacks Nevertheless the data available support the idea that the 569

function of thylakoid membrane structures that were regarded as being independent ie 570

cyanobacterial biogenesis centers and grana are closely related Intriguingly both of these 571

thylakoid membrane structures are dedicated to aspects of PSII function but do not involve 572

PSI (Pribil et al 2014) In both the prokaryotic and eukaryotic systems CURT1 homologs 573

appear to bend thylakoid membranes as indicated by (i) the distortion of membrane 574

ultrastructure seen in mutants devoid of curved thylakoids (ii) the localization of CURT1 575

homologs at grana margins and their local concentration at biogenesis centers (iii) the in vitro 576

membrane-curving activity of both CURT forms The phenotypic differences between 577

A thaliana and Synechocystis 6803 mutants may however be attributable to the different 578

functions of the membrane sub-compartments affected in the two model organisms Whereas 579

the role of grana is still under debate one function of the cyanobacterial biogenesis centers is 580

the above-mentioned high-throughput uptake of Mn2+ ions for efficient assembly of PSII 581

(Stengel et al 2012 Nickelsen and Rengstl 2013 Pribil et al 2014) However it appears 582

that in both cases the primary function of CURT1 proteins is to generate curved membrane 583

18

regions These discoveries suggest that until now two independently observed structures ie 584

cyanobacterial thylakoid biogenesis centers and chloroplast grana regions are closely related 585

The degree of curvature is much less pronounced in the cyanobacterial system As previously 586

discussed it was probably the subsequent evolution of a membrane-localized light-harvesting 587

system in chloroplasts that made the formation of tightly curved grana thylakoids possible 588

(Mullineaux 2005 Nevo et al 2012 Pribil et al 2014) 589

590

CurT is involved in osmotic stress response 591

One unexpected phenotype of the curT- mutant is its sensitivity to osmotic stress 592

These data revealed that in addition to shaping membranes CurT also influences their 593

functional integrity This latter function might be intrinsic to CurT or could be mediated by 594

the VIPP1 protein which has been shown to be required for membrane maintenance in 595

bacteria and chloroplasts probably by acting as a supplier of lipids (for an overview see 596

Zhang and Sakamoto 2015) Both factors accumulate in the plasma membrane upon osmotic 597

stress but VIPP1 localization is not severely affected by CurT inactivation which suggests 598

that VIPP1 operates independently of CurT In agreement with this repeated co-599

immunoprecipitations revealed no interaction between both proteins Therefore it remains to 600

be established whether a direct functional relationship between them exists 601

Previous investigations of osmotic stress in Synechocystis 6803 showed a kidney-602

shaped form of wild-type cells under very high concentrations of osmotically active 603

compounds (Marin et al 2006) The cells were severely deformed indicating changes in the 604

structure of the cellular envelope Since CurT shifts towards the plasma membrane already 605

under lower osmolyte concentrations we suggest a stabilizing function of CurT in the plasma 606

membrane CurT might be necessary to tolerate the forces trying to deform the cells under 607

osmotic stress 608

In conclusion this analysis has identified a crucial determinant for shaping and 609

maintaining the cyanobacterial thylakoid membrane system ie CurT a homolog of the 610

grana-forming CURT1 protein family from A thaliana In particular CurT is involved in the 611

formation of specific thylakoid substructures close to the plasma membrane at which PSII is 612

assembledrepaired Future work will dissect the precise ultrastructure of these centers and 613

enable us to elaborate a molecular model for the spatiotemporal organization of PSII assembly 614

in cyanobacteria 615

616

19

Methods 617

Strains and growth conditions 618

Wild-type and mutant Synechocystis 6803 cells were grown on solid or in liquid BG 619

11 medium (Rippka et al 1979) supplemented with 5 mM glucose (unless indicated 620

otherwise) at 30degC under continuous illumination at a photon irradiance of 30 μmol m-2 s-1 of 621

white light For growth during high-light experiments for investigation of D1 repair cells 622

were cultivated in a FMT150 photobioreactor (Photon Systems Instruments Draacutesov Czech 623

Republic) at 800 micromol photons m-2 s-1 in the presence or absence of lincomycin (100 microgml) 624

Cell density was monitored photometrically at 750 nm Doubling times were determined after 625

two days of growth To generate the insertion mutant curT- the curT gene (slr0483) was first 626

amplified from wild-type genomic DNA by PCR using the primer pair 04835 627

(GAAGCCTATTTAGCTAAGGCCGAAAG) and 04833 628

(TAGTACCTGGTCTTCCATGGCGT) and the resulting fragment was cloned into the 629

Bluescript pKS vector (Stratagene Waldbronn Germany) A kanamycin resistance cassette 630

was then inserted into the single AgeI restriction site (159 bp downstream of the start codon) 631

and this disruption construct was used to replace the wild-type gene as described (Wilde et al 632

2001) 633

634

Bioinformatic and computational analysis 635

CURT1 sequences of Synechocystis 6803 were obtained from CyanoBase 636

(httpgenomekazusaorjpcyanobaseSynechocystis) and CURT1 homologs in other 637

organisms were retrieved from NCBIBLAST (httpblastncbinlmnihgovBlastcgi) 638

Numbers and positions of putative transmembrane domains in the predicted proteins were 639

determined with TMHMM20 (httpwwwcbsdtudkservicesTMHMM) The sequence for 640

the N-terminal amphipathic helix was predicted by Jpred 3 641

(httpwwwcompbiodundeeacukwww-jpred) and plotted using a helical wheel projection 642

script (httprzlabucreduscriptswheelwheelcgi) The programs ClustalW2 643

(httpwwwebiacuktoolsclustalw2) and GeneDoc (httpwwwpscedubiomedgenedoc) 644

were used to generate multiple alignments of amino acid sequences Quantitative analysis of 645

immunoblots was performed with the AIDA Image Analyzer V325 (Raytest 646

Isotopenmessgeraumlte GmbH Straubenhardt Germany) 647

Co-expression patterns of curT were analyzed using the CyanoEXpress 22 database 648

(httpcyanoexpresssysbiolabeu Hernaacutendez-Prieto and Futschik 2012 Hernaacutendez-Prieto et 649

al 2016) 650

20

651

Measurement of chlorophyll concentration and oxygen production 652

Determination of chlorophyll content was carried out according to Wellburn and 653

Lichtenthaler (1984) For oxygen evolution measurements cells were grown in BG-11 654

without glucose harvested in mid-log phase and diluted to an OD750 nm = 05 Oxygen 655

evolution rates were measured with a Clark-type oxygen electrode (Hansatech Instruments 656

Ltd Kingrsquos Lynn Norfolk UK) at 1000 micromol photons m-2 s-1 (cool white light) after 5 min of 657

dark acclimation Oxygen evolution under saturating light conditions was measured without 658

any additives 659

660

Cell size and cell number estimation 661

Synechocystis 6803 strains were grown in liquid BG11 media containing 5 mM 662

glucose For cell size estimation the cells were analyzed with a confocal laser scanning 663

microscope TCS SP5 (Leica Wetzlar Germany) The diameter of the cells was measured 664

with the LAS AF Lite software (Leica Wetzlar Germany) Cells that were about to divide 665

were not taken into account For the determination of cell number cultures were set to an 666

OD750 = 1 and analyzed by using a Neubauer counting chamber (Paul Marienfeld GmbH amp 667

Co KG Lauda-Koumlnigshofen Germany) Statistical significance was determined by Studentrsquos 668

t-test 669

670

Measurements of P700+ reduction kinetics and relative electron transport rates 671

P700+ reduction kinetics and changes in chlorophyll fluorescence yield at different 672

light intensities were measured at a chlorophyll concentration of 5 microgml with a Dual-PAM-673

100 instrument (Heinz Walz GmbH Effeltrich Germany) Complete P700 oxidation was 674

achieved by a 50-ms multiple turnover pulse (10000 micromol photons m-2 s-1) after 2 min of dark 675

incubation P700+ reduction kinetics were recorded without any additions as well as in the 676

presence of 10 microM DCMU Ten technical replicates were averaged and fitted with single 677

exponential functions Data interpretation was done according to Bernaacutet et al (2009) 678

Light saturation measurements were performed according to Xu et al (2008) The 679

actinic light intensity was increased stepwise from 0 to 665 micromol photons m-2 s-1 with 30-s 680

adaptation periods Maximal fluorescence yields were obtained by applying saturating light 681

pulses (duration 600 ms intensity 10000 micromol photons m-2 s-1) 682

683

Low-temperature fluorescence measurements 684

21

Fluorescence emission spectra were measured with an AMINCO Bowman Series 2 685

Luminescence Spectrometer Wild-type and curT- cells were grown in the presence of 5 mM 686

glucose to mid log-phase and concentrated to 25 microgml chlorophyll adding 2 microM fluorescein 687

as an internal standard Samples (1 ml) were transferred to thin glass tubes dark-adapted for 688

30 min at 30 degC and shock frozen in liquid N2 To quantify chlorophyllfluorescein and 689

phycobilisome-mediated fluorescence samples were excited and emission recorded at 440 690

nm510 nm (chlorophyll and fluorescein excitationmax fluorescein emission) and 580 691

nm685 nm respectively Emission was scanned at 490-800 nm or at 640-800 nm 692

respectively 693

694

Antibody production and protein analysis 695

For generation of an αCurT antibody the N-terminal coding region of curT (amino 696

acid positions 1-58) was amplified by PCR using primers N04835 697

(AAGGATCCGTGGGCCGTAAACATTCAA) and N04833 698

(AAGTCGACGCACTTCCCACACCGGTTGTA) and cloned into the BamHI and XhoI sites 699

of the pGEX-4T-1 vector (GE Healthcare Freiburg Germany) Expression of the GST fusion 700

protein in Escherichia coli BL21(DE3) and subsequent affinity purification on Glutathione-701

Sepharose 4B (GE Healthcare) were carried out as described (Schottkowski et al 2009b) A 702

polyclonal antiserum was raised against this protein fragment in rabbits (Pineda Berlin 703

Germany) Other primary antibodies used in this study have been described previously ie 704

αpD1 (Schottkowski et al 2009b) αD1 (Schottkowski et al 2009b) αD2 (Klinkert et al 705

2006) αPratA (Klinkert et al 2004) αYcf48 (Rengstl et al 2011) αPitt (Schottkowski et 706

al 2009a) αPOR (Schottkowski et al 2009a) αYidC (Ossenbuumlhl et al 2006) αVIPP1 707

(Aseeva et al 2007) αSll0933 (Armbruster et al 2010) and αSlr0151 (Rast et al 2016) or 708

were purchased from Agrisera (Vaumlnnaumls Sweden) ie αCP43 αCP47 αPsaA αCyt f 709

αRbcL αIsiA The αGFP-HRP antibody was acquired from Miltenyi Biotech (Bergisch 710

Gladbach Germany) 711

Protein concentrations were determined according to Bradford (1976) using RotiQuant 712

(Carl Roth GmbH amp Co KG Karlsruhe Germany) Protein extraction membrane 713

fractionation on sucrose-density gradients and quantification of Western signal intensities was 714

performed as described previously (Rengstl et al 2011) Solubility properties of CurT were 715

determined according to Schottkowski et al (2009a) 716

22

Sucrose-density centrifugation separating PDM and thylakoid membrane fractions by 717

two consecutive gradients was carried out as described previously (Schottkowski et al 718

2009b Rengstl et al 2011) 719

Two-dimensional fractionations of cyanobacterial membrane proteins via BNSDS-720

PAGE and of pulse-labeled proteins by BNSDS-PAGE were performed as previously 721

reported (Klinkert et al 2004 Schottkowski et al 2009b Rengstl et al 2013) For the 722

analysis of native complexes in fractions obtained by sucrose-density centrifugation the 723

volume corresponding to 350 microg of protein in fraction 7 was applied to BNSDS-PAGE 724

For isoelectric focusing (IEF) the volume corresponding to 50 microg of protein from 725

fraction 7 in 200 microl of IEF buffer (8 M urea 4 CHAPS 1 IPG buffer pH 4-7 (GE 726

Healthcare)) was applied to an 11-cm Immobiline DryStrip pH 4-7 (GE Healthcare) in a 727

Protean IEF Cell (Bio-Rad Munich Germany) Strips were rehydrated for 12 h at 20 degC and 728

50V Focusing was carried out in the following steps 500 V rapid 1500 Vh 1000 V linear 729

880 Vh 6000 V linear 9680 Vh 6000 V rapid 5390 Vh 50 microA per gel focus temperature 730

20degC Subsequently the strips were incubated in equilibration buffer I (6 M urea 0375 M 731

Tris pH 88 20 glycerol 2 SDS 2 DTT) and equilibration buffer II (6 M urea 0375 732

M Tris pH 88 20 glycerol 2 SDS 25 iodoacetamide) for 10 min in each buffer 733

Then the IEF strips were applied to second-dimension SDS-PAGE 734

735

Transmission electron microscopy and immunogold labeling 736

Sample preparation for transmission electron microscopy including freeze substitution 737

and immunogold labeling of CurT was performed as described previously (Stengel et al 738

2012) Ultrathin sections were cut to thicknesses of 35 - 45 nm and 45 - 65 nm for 739

ultrastructural analyses and immunogold labeling respectively For immunogold labeling 740

sections collected on collodion-coated Ni grids were incubated for 18 h at 4degC with (rabbit) 741

αCurT (diluted 1100 1500 11000 or 14000 in blocking buffer (5 fetal calf serum) with 742

005 Tween 20) and further processed as described previously (Stengel et al 2012) As a 743

negative control wild-type Synechocystis 6803 cells were incubated without the primary 744

antibody and exposed to the gold-labeled anti-rabbit IgG To image the ultrastructure and the 745

immunogold-treated samples a Fei Morgagni 268 transmission electron microscope was used 746

and micrographs were taken at 80 kV 747

To avoid errors in the interpretation of the immunogold labeling experiment only 748

signals which were unambiguously localized to distinctly visible thylakoid membranes were 749

taken into account For each cell different regions (see Figure 10F) were defined and in each 750

23

region the signals on the convex and concave sides of the thylakoid membrane were analyzed 751

separately (see Supplemental Figure 11 for representative counts) Statistical significance was 752

assessed by χ2 test (Zoumlfel 1988) 753

For the analysis of clusters of CurT signals in biogenesis centers a cluster was defined 754

as a minimum of four signals in close proximity Overall 219 biogenesis centers were 755

examined with regard to CurT cluster formation 756

757

Preparation of proteoliposomes 758

Liposomes with a lipid mixture of 25 monogalactosyl diacylglycerol 42 759

digalactosyl diacylglycerol 16 sulfoquinovosyl diacylglycerol and 17 760

phosphatidylglycerol (Lipid Products South Nutfield UK) were prepared as described 761

previously (Armbruster et al 2013) To generate proteoliposomes CurT and CURT1A 762

proteins were expressed in the presence of liposomes for 3 h at 37degC using a PURExpress In 763

Vitro Protein Synthesis Kit (New England Biolabs Ipswich MA USA) The liposomes were 764

separated from the mix by centrifugation in a discontinuous sucrose gradient (100000 g 18 765

h) Subsequently the fraction containing the liposomes was extracted and dialyzed against 20 766

mM HEPES (pH 76) For transmission electron microscopy the proteoliposomes were 767

negatively stained with 1 uranyl acetate on a carbon-coated copper grid Micrographs were 768

taken on a Fei Morgagni 268 TEM at 80 kV 769

770

curT-CFP strain generation 771

Gibson assembly was used for single-step cloning (Gibson 2011) of the slr0483 gene 772

(together with its ~08 kb upstream region) the mTurquoise2 gene fragment the gentamycin-773

resistance cassette (aacC1) and an ~17-kb downstream region of slr0483 into pBR322 774

cleaved with EcoRV and NheI The slr0483 gene was fused in frame to the codon-optimized 775

mTurquoise2 (DNA20) preceded by a linker sequence encoding GSGSG The resulting 776

plasmid was used to transform Synechocystis 6803 as described previously (Zang et al 2007) 777

After ~ 10 days of incubation on BG11-GelRite (15 ) medium in the presence of 2 microgml 778

gentamycin several antibiotic resistant colonies were obtained and streaked out on fresh 779

medium These transformants were then tested for full segregation of the tagged allele by 780

colony PCR with primers flanking the slr0483 gene 781

782

Fluorescence microscopy 783

24

An aliquot of a cell suspension in mid-log phase was placed under a BG11-agarose 784

pad on a glass coverslip (15) and imaged on an inverted microscope (Zeiss 785

AxioObserverZ1) equipped with an ORCA Flash40 V2 (Hamamatsu) camera a Lumenecor 786

SOLA II Light Engine and a Plan-Apochromat 63x140 Oil DIC M27 (NA 14) objective 787

(Zeiss) Image acquisition was done with Zen 21 software in cyan and far-red fluorescence 788

channels (Zeiss Filter Sets 47 HE and 50) as Z-series with a step size of 250 nm and effective 789

pixel size of 103 nm Acquired image files were subsequently deconvolved (Constrained 790

Iterative Method) using a default theoretical Point Spread Function in Zen 20 (Zeiss) 791

Extraction of intensities for line profiles was performed by image thresholding the thylakoid 792

autofluorescence channel and eroding the resulting binary mask in Fiji (Schindelin et al 793

2012) 794

For immunofluorescence analysis cells were grown to mid-log phase as in the case of 795

the cells prepared for live-cell microscopy A 10-ml culture was fixed for 20 min in 37 796

formaldehyde and following extensive washing with phosphate-buffered saline (PBS) cells 797

were first permeabilized in 005 Triton-X for 20 min and then in lysis buffer (50 mM Tris-798

HCl 100 mM NaCl 5 mgml lysozyme) at 37degC for 2 h with gentle shaking To block 799

unspecific binding sites the cell pellet was incubated in 5 bovine serum albumin in PBS at 800

30degC for 1 h The αCurT serum (1500 dilution) was added to cells in fresh blocking buffer 801

for 1 h at 30degC with gentle shaking Cells were then washed three times with blocking buffer 802

and incubated with goat anti-rabbit IgG secondary antibodies conjugated to Oregon Green 488 803

(Invitrogen) (11000 dilution) under the conditions as for the primary antibodies Cells were 804

washed three times with PBS and prepared for microscopy as above Imaging was done as 805

described for live-cell microscopy except that a Colibri2 LED light source was employed for 806

illumination and a CoolSnap HQ camera (Photometrics) was used for image acquisition Cells 807

were imaged as Z-series (step size 280 nm) in the yellow and far-red fluorescent channels 808

(Zeiss Filter Sets 46 HE and 50) using the 505 nm and 625 nm LED modules Effective pixel 809

size in the final image was 102 nm Deconvolution and image analysis was done as described 810

above As judged by the staining intensity of the Oregon Green-conjugated antibodies 811

approximately half of the cells in any given field of view appeared to have been successfully 812

permeabilised a rate that is common in our experience No significant signal was detected in 813

the control sample that had not been exposed to the primary antibodies 814

815

25

Accession numbers 816

Sequence data from this article can be found in the CyanoBase and EMBLGenBank 817

data libraries under accession number slr0483 818

819

Supplemental Data 820

Supplemental Figure 1 Construction of the curT- mutant 821

Supplemental Figure 2 Growth phenotype of curT- 822

Supplemental Figure 3 Expression analysis of the open reading frame slr0482 (located 823

upstream of curT) in the curT- strain 824

Supplemental Figure 4 Absorbance spectra of curT- and wild-type cells 825

Supplemental Figure 5 High-light growth phenotypes of wild-type Synechocystis 6803 and 826

the curT- strain 827

Supplemental Figure 6 Ultrastructure of the TD41 mutant which lacks the psbA transcript 828

and the D1 protein 829

Supplemental Figure 7 Expression and localization of CurT-CFP 830

Supplemental Figure 8 Localization of CurT and CurT-CFP by fluorescence microscopy 831

Supplemental Figure 9 Chlorophyll autofluorescence of curT- 832

Supplemental Figure 10 The curT- mutant as a negative control for immunogold labeling 833

Supplemental Figure 11 Representative counts of immunogold signals 834

Supplemental Table 1 Overview of immunogold signals in curT- cells 835

Supplemental Table 2 Overview of immunogold signals in specific regions of Synechocystis 836

6803 wild-type cells 837

Supplemental Table 3 Statistical analysis of immunogold signals for wild-type 838

Synechocystis 6803 cells 839

Supplemental Table 4 Co-expression of curT 840

Supplemental Movie 1 Scan through the Z-axis of a curT-CFP cell 841

Supplemental Movie 2 Rendered 3D-model of a CurT-CFP detection 842

Supplemental Movie 3 Scan through the Z-axis of a curT-CFP cell with a traversing 843

thylakoid lamella 844

845

Acknowledgements 846

We thank Y Nishiyama for providing αpD1 and J Soll for αVIPP1 and αYidC antibodies 847

respectively and Nina Dyczmons-Nowaczyk for support with the fluorescence measurements 848

This work was supported by grants awarded to JN (Ni3909) MMN (NO 8363) and DL 849

26

(Le126529) by the Deutsche Forschungsgemeinschaft in the context of Research Unit 850

FOR2092 and the Cluster of Excellence RESOLV (EXC 1069) AG is a Howard Hughes 851

Medical Institute postdoctoral fellow in the laboratory of Erin OrsquoShea at Harvard University 852

LS was supported by a PhD fellowship from the Chinese Scholarship Council 853

854

Author Contributions 855

SH AR LS MMN DL and JN designed the research SH AR LS AG ILG EH ML BR 856

SV performed the research all authors contributed to data analysis SH AR and JN wrote the 857

paper 858

859

Competing Financial Interest statement 860

The authors declare no competing financial interests 861

862

We wish to dedicate this paper to Fabrice Rappaport an outstanding colleague and friend who 863

passed away so early 864

865

27

References 866

Allen JF de Paula WBM Puthiyaveetil S and Nield J (2011) A structural 867

phylogenetic map for chloroplast photosynthesis Trends Plant Sci 16 645-655 868

Anderson JM Horton P Kim E-H and Chow WS (2012) Towards elucidation of 869

dynamic structural changes of plant thylakoid architecture Philos Trans R Soc 870

Lond B Biol Sci 367 3515-3524 871

Armbruster U Zuumlhlke J Rengstl B Kreller R Makarenko E Ruumlhle T Schuumlnemann 872

D Jahns P Weisshaar B Nickelsen J and Leister D (2010) The Arabidopsis 873

thylakoid protein PAM68 is required for efficient D1 biogenesis and photosystem II 874

assembly Plant Cell 22 3439-3460 875

Armbruster U Labs M Pribil M Viola S Xu W Scharfenberg M Hertle AP 876

Rojahn U Jensen PE Rappaport F Joliot P Doumlrmann P Wanner G and 877

Leister D (2013) Arabidopsis CURVATURE THYLAKOID1 proteins modify 878

thylakoid architecture by inducing membrane curvature Plant Cell 25 2661-2678 879

Aseeva E Ossenbuumlhl F Sippel C Cho WK Stein B Eichacker LA Meurer J 880

Wanner G Westhoff P Soll J and Vothknecht UC (2007) Vipp1 is required for 881

basic thylakoid membrane formation but not for the assembly of thylakoid protein 882

complexes Plant Physiol Biochem 45 119-128 883

Bartsevich VV and Pakrasi HB (1995) Molecular identification of an ABC transporter 884

complex for manganese analysis of a cyanobacterial mutant strain impaired in the 885

photosynthetic oxygen evolution process EMBO J 14 1845-1853 886

Bartsevich VV and Pakrasi HB (1996) Manganese transport in the cyanobacterium 887

Synechocystis sp PCC 6803 J Biol Chem 271 26057-26061 888

Bernaacutet G Waschewski N and Roumlgner M (2009) Towards efficient hydrogen production 889

the impact of antenna size and external factors on electron transport dynamics in 890

Synechocystis PCC 6803 Photosynth Res 99 205-216 891

Boehm M Yu J Krynicka V Barker M Tichy M Komenda J Nixon PJ and Nield 892

J (2012) Subunit Organization of a Synechocystis Hetero-Oligomeric Thylakoid FtsH893

Complex Involved in Photosystem II Repair Plant Cell 24 3669-3683894

Bradford MM (1976) A rapid and sensitive method for the quantitation of microgram 895

quantities of protein utilizing the principle of protein-dye binding Anal Biochem 72 896

248-254897

28

Chang L Liu X Li Y Liu C-C Yang F Zhao J and Sui S-F (2015) Structural 898

organization of an intact phycobilisome and its association with photosystem II Cell 899

Res 25 726-737 900

Danielsson R Suorsa M Paakkarinen V Albertsson P-Aring Styring S Aro E-M and 901

Mamedov F (2006) Dimeric and monomeric organization of photosystem II 902

Distribution of five distinct complexes in the different domains of the thylakoid 903

membrane J Biol Chem 281 14241-14249 904

Daum B Nicastro D Austin J McIntosh JR and Kuumlhlbrandt W (2010) Arrangement 905

of photosystem II and ATP synthase in chloroplast membranes of Spinach and Pea 906

Plant Cell 22 1299-1312 907

Engel BD Schaffer M Kuhn Cuellar L Villa E Plitzko JM and Baumeister W 908

(2015) Native architecture of the Chlamydomonas chloroplast revealed by in situ 909

cryo-electron tomography eLife 4 e04889 910

Ford MGJ Mills IG Peter BJ Vallis Y Praefcke GJK Evans PR and McMahon 911

HT (2002) Curvature of clathrin-coated pits driven by epsin Nature 419 361-366 912

Fristedt R Willig A Granath P Cregravevecoeur M Rochaix J-D and Vener AV (2009) 913

Phosphorylation of photosystem II controls functional macroscopic folding of 914

photosynthetic membranes in Arabidopsis Plant Cell 21 3950-3964 915

Gallop JL and McMahon HT (2005) BAR domains and membrane curvature bringing 916

your curves to the BAR Biochem Soc Symp 72 223-231 917

Gibson DG (2011) Chapter fifteen - Enzymatic Assembly of Overlapping DNA Fragments 918

In Methods in Enzymology V Christopher ed (Academic Press) pp 349-361 919

Goedhart J von Stetten D Noirclerc-Savoye M Lelimousin M Joosen L Hink MA 920

van Weeren L Gadella TWJ and Royant A (2012) Structure-guided evolution of 921

cyan fluorescent proteins towards a quantum yield of 93 Nat Commun 3 751 922

Heinz S Liauw P Nickelsen J and Nowaczyk M (2016) Analysis of photosystem II 923

biogenesis in cyanobacteria Biochim Biophys Acta 1857 274-287 924

Hernaacutendez-Prieto M and Futschik M (2012) CyanoEXpress A web database for 925

exploration and visualisation of the integrated transcriptome of cyanobacterium 926

Synechocystis sp PCC6803 Bioinformation 8 634-638 927

Hernaacutendez-Prieto MA Semeniuk TA Giner-Lamia J and Futschik ME (2016) The 928

Transcriptional Landscape of the Photosynthetic Model Cyanobacterium 929

Synechocystis sp PCC6803 Sci Rep 6 22168 930

29

Huang F Fulda S Hagemann M and Norling B (2006) Proteomic screening of salt-931

stress-induced changes in plasma membranes of Synechocystis sp strain PCC 6803 932

Proteomics 6 910-920 933

Kirchhoff H (2013) Architectural switches in plant thylakoid membranes Photosynth Res 934

116 481-487 935

Klinkert B Elles I and Nickelsen J (2006) Translation of chloroplast psbD mRNA in 936

Chlamydomonas is controlled by a secondary RNA structure blocking the AUG start 937

codon Nucleic Acids Res 34 386-394 938

Klinkert B Ossenbuumlhl F Sikorski M Berry S Eichacker L and Nickelsen J (2004) 939

PratA a periplasmic tetratricopeptide repeat protein involved in biogenesis of 940

photosystem II in Synechocystis sp PCC 6803 J Biol Chem 279 44639-44644 941

Komenda J Nickelsen J Tichyacute M Praacutešil O Eichacker LA and Nixon PJ (2008) The 942

cyanobacterial homologue of HCF136YCF48 is a component of an early photosystem 943

II assembly complex and is important for both the efficient assembly and repair of 944

photosystem II in Synechocystis sp PCC 6803 J Biol Chem 283 22390-22399 945

Kopf M Klaumlhn S Scholz I Matthiessen JKF Hess WR and Voszlig B (2014) 946

Comparative analysis of the primary transcriptome of Synechocystis sp PCC 6803 947

DNA Res 21 527-539 948

Kunkel DD (1982) Thylakoid centers Structures associated with the cyanobacterial 949

photosynthetic membrane system Arch Microbiol 133 97-99 950

Liberton M Howard Berg R Heuser J Roth R and Pakrasi BH (2006) Ultrastructure 951

of the membrane systems in the unicellular cyanobacterium Synechocystis sp strain 952

PCC 6803 Protoplasma 227 129-138 953

Liberton M Saha R Jacobs JM Nguyen AY Gritsenko MA Smith RD 954

Koppenaal DW and Pakrasi HB (2016) Global Proteomic Analysis Reveals an 955

Exclusive Role of Thylakoid Membranes in Bioenergetics of a Model 956

Cyanobacterium Mol Cell Proteomics 15 2021-2032 957

Luque I and Ochoa de Alda JAG (2014) CURT1CAAD-containing aaRSs thylakoid 958

curvature and gene translation Trends Plant Sci 19 63-66 959

Marin K Stirnberg M Eisenhut M Kraumlmer R and Hagemann M (2006) Osmotic stress 960

in Synechocystis sp PCC 6803 low tolerance towards nonionic osmotic stress results 961

from lacking activation of glucosylglycerol accumulation Microbiology 152 2023-962

2030 963

Mullineaux CW (2005) Function and evolution of grana Trends Plant Sci 10 521-525 964

30

Mullineaux CW (2008) Biogenesis and dynamics of thylakoid membranes and the 965

photosynthetic apparatus In The Cyanobacteria A Herrero and E Flores eds 966

(Norfolk UK Caister Academic Press) pp 289ndash304 967

Nevo R Charuvi D Tsabari O and Reich Z (2012) Composition architecture and 968

dynamics of the photosynthetic apparatus in higher plants Plant J 70 157-176 969

Nickelsen J and Rengstl B (2013) Photosystem II assembly From cyanobacteria to plants 970

Annu Rev Plant Biol 64 609-635 971

Nickelsen J and Zerges W (2013) Thylakoid biogenesis has joined the new era of bacterial 972

cell biology Front Plant Sci 4 458 973

Nilsson F Simpson DJ Jansson C and Andersson B (1992) Ultrastructural and 974

biochemical characterization of a Synechocystis 6803 mutant with inactivated psbA 975

genes Arch Biochem Biophys 295 340-347 976

Odom WR Hodges R Chitnis PR and Guikema JA (1993) Characterization of 977

Synechocystis sp PCC 6803 in iron-supplied and iron-deficient media Plant Mol 978

Biol 23 1255-1264 979

Ossenbuumlhl F Inaba-Sulpice M Meurer J Soll J and Eichacker LA (2006) The 980

Synechocystis sp PCC 6803 Oxa1 homolog is essential for membrane integration of 981

reaction center precursor protein pD1 Plant Cell 18 2236-2246 982

Pisareva T Kwon J Oh J Kim S Ge C Wieslander Aring Choi J-S and Norling B 983

(2011) Model for Membrane Organization and Protein Sorting in the Cyanobacterium 984

Synechocystis sp PCC 6803 Inferred from Proteomics and Multivariate Sequence 985

Analyses J Proteome Res 10 3617-3631 986

Pribil M Labs M and Leister D (2014) Structure and dynamics of thylakoids in land 987

plants J Exp Bot 65 1955-1972 988

Rast A Heinz S and Nickelsen J (2015) Biogenesis of thylakoid membranes Biochim 989

Biophys Acta 1847 821-830 990

Rast A Rengstl B Heinz S Klingl A and Nickelsen J (2016) The role of Slr0151 a 991

tetratricopeptide repeat protein from Synechocystis sp PCC 6803 during Photosystem 992

II assembly and repair Front Plant Sci 7 605 993

Rengstl B Oster U Stengel A and Nickelsen J (2011) An Intermediate Membrane 994

Subfraction in Cyanobacteria Is Involved in an Assembly Network for Photosystem II 995

Biogenesis J Biol Chem 286 21944-21951 996

31

Rengstl B Knoppovaacute J Komenda J and Nickelsen J (2013) Characterization of a 997

Synechocystis double mutant lacking the photosystem II assembly factors YCF48 and 998

Sll0933 Planta 237 471-480 999

Rexroth S Mullineaux CW Ellinger D Sendtko E Roumlgner M and Koenig F (2011) 1000

The Plasma Membrane of the Cyanobacterium Gloeobacter violaceus Contains 1001

Segregated Bioenergetic Domains Plant Cell 23 2379-2390 1002

Rippka R Deruelles J Waterbury JB Herdman M and Stanier RY (1979) Generic 1003

Assignments Strain Histories and Properties of Pure Cultures of Cyanobacteria 1004

Microbiology 111 1-61 1005

Ruumltgers M and Schroda M (2013) A role of VIPP1 as a dynamic structure within 1006

thylakoid centers as sites of photosystem biogenesis Plant Signal Behav 8 e27037 1007

Sacharz J Bryan SJ Yu J Burroughs NJ Spence EM Nixon PJ and Mullineaux 1008

CW (2015) Sub-cellular location of FtsH proteases in the cyanobacterium1009

Synechocystis sp PCC 6803 suggests localised PSII repair zones in the thylakoid1010

membranes Mol Microbiol 96 448-4621011

Sandstroumlm S Park Y-I Oumlquist G and Gustafsson P (2001) CP43prime the isiA Gene 1012

Product Functions as an Excitation Energy Dissipator in the Cyanobacterium 1013

Synechococcus sp PCC 7942 Photochem Photobiol 74 431-437 1014

Schindelin J Arganda-Carreras I Frise E Kaynig V Longair M Pietzsch T 1015

Preibisch S Rueden C Saalfeld S Schmid B Tinevez J-Y White DJ 1016

Hartenstein V Eliceiri K Tomancak P and Cardona A (2012) Fiji an open-1017

source platform for biological-image analysis Nat Methods 9 676-682 1018

Schottkowski M Ratke J Oster U Nowaczyk M and Nickelsen J (2009a) Pitt a novel 1019

tetratricopeptide repeat protein involved in light-dependent chlorophyll biosynthesis 1020

and thylakoid membrane biogenesis in Synechocystis sp PCC 6803 Mol Plant 2 1021

1289-1297 1022

Schottkowski M Gkalympoudis S Tzekova N Stelljes C Schuumlnemann D Ankele E 1023

and Nickelsen J (2009b) Interaction of the periplasmic PratA factor and the PsbA 1024

(D1) protein during biogenesis of photosystem II in Synechocystis sp PCC 6803 J 1025

Biol Chem 284 1813-1819 1026

Selatildeo TT Zhang L Knoppovaaacute J Komenda J and Norling B (2016) Photosystem II 1027

Assembly Steps Take Place in the Thylakoid Membrane of the Cyanobacterium 1028

Synechocystis sp PCC6803 Plant Cell Physiol 57 878 1029

32

Spaumlt P Maček B and Forchhammer K (2015) Phosphoproteome of the cyanobacterium 1030

Synechocystis sp PCC 6803 and its dynamics during nitrogen starvation Front 1031

Microbiol 6 248 1032

Stengel A Guumlgel IL Hilger D Rengstl B Jung H and Nickelsen J (2012) Initial 1033

steps of photosystem II de novo assembly and preloading with manganese take place 1034

in biogenesis centers in Synechocystis Plant Cell 24 660-675 1035

Uniacke J and Zerges W (2007) Photosystem II assembly and repair are differentially 1036

localized in Chlamydomonas Plant Cell 19 3640-3654 1037

Uniacke J and Zerges W (2009) Chloroplast protein targeting involves localized 1038

translation in Chlamydomonas Proc Natl Acad Sci USA 106 1439-1444 1039

van de Meene AL Hohmann-Marriott M Vermaas WJ and Roberson R (2006) The 1040

three-dimensional structure of the cyanobacterium Synechocystis sp PCC 6803 Arch 1041

Microbiol 184 259-270 1042

van de Meene AML Sharp WP McDaniel JH Friedrich H Vermaas WFJ and 1043

Roberson RW (2012) Gross morphological changes in thylakoid membrane 1044

structure are associated with photosystem I deletion in Synechocystis sp PCC 6803 1045

Biochim Biophys Acta 1818 1427-1434 1046

Watanabe M and Ikeuchi M (2013) Phycobilisome architecture of a light-harvesting 1047

supercomplex Photosynth Res 116 265-276 1048

Wellburn AR and Lichtenthaler H (1984) Formulae and Program to Determine Total 1049

Carotenoids and Chlorophylls A and B of Leaf Extracts in Different Solvents In 1050

Advances in Photosynthesis Research Proceedings of the VIth International Congress 1051

on Photosynthesis Brussels Belgium August 1ndash6 1983 C Sybesma ed (Dordrecht 1052

Springer Netherlands) pp 9-12 1053

Wilde A Lunser K Ossenbuumlhl F Nickelsen J and Borner T (2001) Characterization of 1054

the cyanobacterial ycf37 mutation decreases the photosystem I content Biochem J 1055

357 211-216 1056

Wilson A Boulay C Wilde A Kerfeld CA and Kirilovsky D (2007) Light-Induced 1057

Energy Dissipation in Iron-Starved Cyanobacteria Roles of OCP and IsiA Proteins 1058

Plant Cell 19 656-672 1059

Xu M Bernaacutet G Singh A Mi H Roumlgner M Pakrasi HB and Ogawa T (2008) 1060

Properties of Mutants of Synechocystis sp Strain PCC 6803 Lacking Inorganic Carbon 1061

Sequestration Systems Plant Cell Physiol 49 1672-1677 1062

33

Yamamoto T Burke J Autz G and Jagendorf AT (1981) Bound ribosomes of Pea 1063

chloroplast thylakoid membranes location and release in vitro by high salt 1064

puromycin and RNase Plant Physiol 67 940-949 1065

Yang H Liao L Bo T Zhao L Sun X Lu X Norling B and Huang F (2014) 1066

Slr0151 in Synechocystis sp PCC 6803 is required for efficient repair of photosystem 1067

II under high-light condition J Integr Plant Biol 56 1136-1150 1068

Yeremenko N Kouřil R Ihalainen JA DHaene S van Oosterwijk N 1069

Andrizhiyevskaya EG Keegstra W Dekker HL Hagemann M Boekema EJ 1070

Matthijs HCP and Dekker JP (2004) Supramolecular Organization and Dual 1071

Function of the IsiA Chlorophyll-Binding Protein in Cyanobacteria Biochemistry 43 1072

10308-10313 1073

Zak E Norling B Maitra R Huang F Andersson B and Pakrasi HB (2001) The 1074

initial steps of biogenesis of cyanobacterial photosystems occur in plasma membranes 1075

Proc Natl Acad Sci USA 98 13443-13448 1076

Zang X Liu B Liu S Arunakumara KKIU and Zhang X (2007) Optimum 1077

Conditions for Transformation of Synechocystis sp PCC 6803 J Microbiol 45 241-1078

245 1079

Zhang L and Sakamoto W (2015) Possible function of VIPP1 in maintaining chloroplast 1080

membranes Biochim Biophys Acta 1847 831-837 1081

Zimmerberg J and Kozlov MM (2006) How proteins produce cellular membrane 1082

curvature Nat Rev Mol Cell Biol 7 9-19 1083

Zoumlfel P (1988) Statistik in der Praxis (Stuttgart Germany Gustav Fischer Verlag) 1084

1085

34

Figure Legends 1086

Figure 1 General characteristics of CurT A) Sequence alignment of CurT and CURT1A-D 1087

from A thaliana Predicted chloroplast transit-peptide sequences of CURT1A-D are omitted 1088

(Armbruster et al 2013) Positions of predicted C-terminal transmembrane domains (TDM) 1089

are marked (black bar) as is the position of the predicted amphipathic N-terminal helix in 1090

CurT (red bar) The green bar denotes the peptide sequence used for antibody production 1091

Identical and related amino acids that are conserved in 100 80 and 60 of the sequences 1092

are highlighted in black dark grey and light grey respectively B) Helical-wheel 1093

representation of the N-terminal amphipathic helix of CurT (red bar in A) The color code 1094

reflects the physicochemical properties of amino-acid side-chains green polar and 1095

uncharged blue polar and positively charged red polar and negatively charged yellow 1096

hydrophobic C) Solubility of CurT Membrane-associated proteins (50 microg) from wild-type 1097

cells were extracted with 5 mM HEPES (pH 76) containing either 1 M NaCl 01 M Na2CO3 1098

4 M urea 01 Triton X-100 or no additional solute After separation of membrane-bound 1099

(M) and solubilized (S) proteins by centrifugation proteins were fractionated by SDS-PAGE1100

and CurT was immunodetected on immunoblots As a control the integral membrane protein 1101

CP47 from PSII was analyzed in parallel D) Transmission electron micrographs of negatively 1102

stained liposomes Cell-free expression (CFE) of CurT and A thaliana CURT1A was 1103

performed in the presence of liposomes similar in composition to the lipids of the thylakoid 1104

membrane Liposomes before and after cell-free protein expression in the absence of DNA 1105

served as negative controls Black arrowheads indicate tubular connections between 1106

liposomes Scale bars 250 nm 1107

1108

Figure 2 Ultrastructural analysis of curT- cells Transmission electron micrographs of typical 1109

wild-type (A) and curT- (B-D) Synechocystis 6803 cells taken at 44000times (A B) and 28000times 1110

(C D) magnification respectively Ultrathin sections (35 to 45 nm) of cryofixed samples 1111

were stained with osmium tetroxide and post-stained using lead citrate Arrowheads indicate 1112

biogenesis centers Scale bars 200 nm (A B) and 500 nm (C D) respectively 1113

1114

Figure 3 Accumulation of components of photosynthetic complexes in the curT- mutant A) 1115

Whole cell extracts (30 microg protein) from wild-type and curT- strains were fractionated by 1116

SDS-PAGE and analyzed on immunoblots using the indicated antibodies B) The histogram 1117

shows levels of the indicated proteins in curT- extracts relative to wild-type samples (dashed 1118

red line) Data are means plusmn SD of three independent experiments Significant differences from 1119

35

wild-type protein levels according to Studentrsquos t-test with error probabilities of 5 and 1 1120

are indicated by and respectively 1121

1122

Figure 4 P700+ reduction kinetics and high-light effects in curT- cells A) Averaged traces 1123

(10 single measurements) of P700+ decay after complete oxidation by a 50-ms multiple 1124

turnover pulse (10000 micromol photons m-2 s-1) in the absence and presence of 10 microM DCMU 1125

B) Rate constants for P700+ reduction were obtained by fitting of the data with single1126

exponential functions Error bars indicate the SD of three independent measurements C) 1127

Impact of light intensity on the (relative) electron transport rate (rETR) Cells were exposed to 1128

gradually increasing light intensities which resulted in increasing electron transport until the 1129

capacity limit was reached PAR light intensity (micromol photons m-2 s-1) Error bars indicate the 1130

SD of three independent measurements D) D1 protein level in wild-type and curT- after high-1131

light treatment (800 micromol photons m-2s-1) in the presence and absence of lincomycin Samples 1132

were taken every 30 min and processed as in Figure 3 to determine the level of D1 present 1133

100 refers to wild-type D1 level at the beginning of the experiment 1134

1135

Figure 5 PSII assembly in curT- cells A) BNSDS-PAGE of membrane proteins Membrane 1136

fractions from wild-type and curT- cells were solubilized with 13 n-dodecyl-β-maltoside 1137

and proteins were fractionated by two-dimensional BNSDS-PAGE blotted and probed with 1138

antibodies against the PSII subunits D1 D2 CP47 and CP43 Wild-type blots were also 1139

probed with the αCurT antibody The sizes of marker proteins and the positions of PSII 1140

assembly intermediates (RCCII RCCI RC47) are shown above and below each image B) In 1141

vivo pulse labeling of membrane proteins with 35S Pulse-labeled PSII core proteins were 1142

separated via BNSDS-PAGE and visualized by autoradiography 1143

1144

Figure 6 Loss of CurT induces stress A) Low-temperature (77 K) fluorescence emission of 1145

Synechocystis 6803 wild-type (blue) and curT- (red) cells excited at 440 nm The spectra were 1146

normalized to the added fluorescein standard B) Low-temperature (77 K) fluorescence 1147

emission of Synechocystis 6803 wild-type (blue) and curT- (red) excited at 580 nm The 1148

spectra were normalized to 780 nm C) Level of IsiA in the curT- mutant relative to the wild-1149

type A mean value of 368 plusmn 96 (SD) was determined from three independent experiments 1150

1151

Figure 7 Membrane sublocalization of PSII-related factors Cell extracts from wild-type and 1152

curT- cells were fractionated by two consecutive rounds of sucrose-density gradient 1153

36

centrifugation (Schottkowski et al 2009b) The second linear gradient (20-60 sucrose) was 1154

apportioned into 14 fractions which were analyzed by immunoblotting using the indicated 1155

antibodies Fractions 1ndash6 represent PDMs and fractions 7ndash14 thylakoid membranes (TMs) 1156

To facilitate comparison between gradients sample volumes were normalized to the volume 1157

of fraction 7 that contained 40 microg of protein 1158

1159

Figure 8 Live-cell imaging of the curT-CFP strain by fluorescence microscopy In the curT-1160

CFP strain the native curT gene has been replaced by a CFP-tagged version resulting in the 1161

expression of the CurT-CFP fusion protein under the control of the native promotor A) 1162

Close-up views of the mid-cell plane in the CFP and far-red autofluorescence channels shown 1163

in slice 7 in panel B B) Synechocystis 6803 cells expressing CurT C-terminally fused to the 1164

mTurquoise2 variant of CFP from its native chromosomal promoter The two imaging 1165

channels are displayed as Z-axis montages (auto-scaled contrast step size 250 nm) in 1166

grayscale and color composite configuration The thylakoid autofluorescent channel as 1167

imaged in far-red fluorescence is depicted in magenta and CurT signal as imaged in cyan 1168

fluorescence is depicted in cyan C) Fluorescence intensity profiles of the two channels along 1169

the autofluorescent peripheral cell ldquoringrdquo are shown for slice 7 The maximum projection of 1170

the entire Z montage is also shown Scale bars (light grey) 2 microm 1171

1172

Figure 9 Immunofluorescence detection of CurT A) Close-ups of slice 5 in panel B B) 1173

Wild-type Synechocystis 6803 cells labeled with αCurT antibodies and detected with Oregon 1174

Green-conjugated secondary antibodies The Z-axis montages are shown as in Figure 8B 1175

except that the step size is 280 nm (1 to 10) C) Intensity profiles of the two channels along 1176

the autofluorescent peripheral cell ldquoringrdquo are shown for slice 5 The maximum projection of 1177

the entire Z montage is also shown Scale bars (light grey) 2 microm 1178

1179

Figure 10 Subcellular localization of CurT Ultrathin sections of wild-type Synechocystis 1180

6803 cells were incubated with rabbit αCurT prior to incubation with gold-conjugated goat 1181

anti-rabbit IgG A) Negative control (wild-type processed without addition of primary 1182

antibody) B C) Immunogold-labeled sections showing CurT localization at the cytoplasmic 1183

side of the thylakoid membrane D) Cluster formation of CurT signals at a putative biogenesis 1184

center from C E) Biogenesis center from the same cell (C) without any obvious CurT 1185

clustering of gold particles F) Schematic depiction of a wild-type cell (from Figure 2A) with 1186

color-coded curved membranes green = thylakoids that follow the curvature of the cell red = 1187

37

thylakoids that bend away from the plasma membrane yellow = thylakoids that bend toward 1188

the plasma membrane to converge on sites of biogenesis centers G) Relative distribution of 1189

gold signals between convex (dark color) and concave (light color) sides of membranes (n = 1190

1584 signals from a total of 95 cells) The undifferentiated overall signal distribution is given 1191

in blue Bars = 200 nm (overview) and 100 nm (details) 1192

1193

Figure 11 Differentially modified forms of CurT are found in different complexes in PDMs 1194

and thylakoid membranes Samples were isolated by fractionation of wild-type membranes 1195

via two consecutive sucrose density gradients according to Schottkowski et al (2009b) After 1196

density centrifugation samples were applied to BNSDS-PAGE analysis (A) or isoelectric 1197

focusing (B) Numbers on the right indicate the respective fraction from the second gradient 1198

(see Figure 7) Fraction 5 represents the PDMs and fraction 9 the thylakoid membrane 1199

1200

Figure 12 Loss of CurT increases sensitivity to abiotic stress A B) Doubling times of wild-1201

type and curT- under salt stress (A) or osmotic stress (B) Doubling times are means plusmn SD of 1202

three independent cultures C) Localization of CurT-CFP under salt and osmotic stress 1203

Samples were examined as described in Figure 8 Scale bars 1 microm D) Protein levels of wild-1204

type cells after growth in BG11 medium containing 500 mM NaCl Samples were analyzed on 1205

the same gel but unrelated samples between the presented signals were omitted E) 1206

Membrane preparations obtained from wild-type cells wild-type cells grown in the presence 1207

of 500 mM NaCl and curT- cells were subjected to the first gradient step in the membrane 1208

fractionation scheme The gradient was divided into five fractions and 10 of fractions I-IV 1209

and 02 of fraction V were analyzed by SDS-PAGE Fraction II includes the plasma 1210

membrane and fraction V consists of PratA-defined membrane and thylakoid membrane 1211

1212

Figure 13 Model of CurT distribution at convergence zones in Synechocystis 6803 The 1213

distribution of CurT in thylakoid (green) and plasma membranes (brown) is shown The 1214

pattern of localization of CurT in the thylakoid membrane is derived from membrane 1215

fractionation via sucrose density centrifugation fluorescence-based detection of the CurT-1216

CFP fusion and endogenous CurT and immunogold labeling experiments (Figures 7-10) The 1217

different CurT variants a b c and d identified in the IEF experiments (Figure 11) are depicted 1218

in yellow pink blue and black respectively CurT present in the plasma membrane is 1219

highlighted in gray as its precise nature and role remain to be defined (Figure 12) 1220

Membranes are represented as lipid bilayers Convex and concave faces of bent thylakoid 1221

38

sheets are indicated by black arrows The PDM which is dedicated to PSII assembly and 1222

repair is depicted in blue The dotted blue line emphasizes that the ultrastructure in this region 1223

has not yet been fully resolved PP periplasm PM plasma membrane TM thylakoid 1224

membrane L lumen PDM PratA-defined membrane 1225

1226

Tables 1227

Table 1 Physiological characteristics of the curT- mutant 1228

Strain Doubling time [h]

Oxygen Evolution[nmol h-1 OD750

-1]c

Chlorophyll content

[microg OD750-1]

d

Cell size [microm]e

Cell number [ml-1 OD750

-1]f

Wild type 817plusmn017a 1600plusmn042

b 1933plusmn187 251plusmn014 264plusmn020 390plusmn006 x 107

curT- 1259plusmn020a 3226plusmn056

b 1074plusmn20 195plusmn029 274plusmn044 367plusmn016 x 107

1229 abDoubling times in the presence (a) or absence (b) of 5 mM glucose measured under 1230

continuous illumination at 30 micromol photons m-2 s-1 and CO2-limiting conditions cOxygen 1231

evolution is expressed in nmol O2 produced per hour per OD750 unit dChlorophyll content is 1232

expressed in microg OD750-1 eThe diameter of non-dividing cells is presented in microm fCell number 1233

was determined per ml per OD750 Data are means plusmn SD of at least three independent 1234

experiments 1235

1236

Parsed CitationsAllen JF de Paula WBM Puthiyaveetil S and Nield J (2011) A structural phylogenetic map for chloroplast photosynthesisTrends Plant Sci 16 645-655

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Anderson JM Horton P Kim E-H and Chow WS (2012) Towards elucidation of dynamic structural changes of plant thylakoidarchitecture Philos Trans R Soc Lond B Biol Sci 367 3515-3524

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Armbruster U Zuumlhlke J Rengstl B Kreller R Makarenko E Ruumlhle T Schuumlnemann D Jahns P Weisshaar B NickelsenJ and Leister D (2010) The Arabidopsis thylakoid protein PAM68 is required for efficient D1 biogenesis and photosystem IIassembly Plant Cell 22 3439-3460

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Armbruster U Labs M Pribil M Viola S Xu W Scharfenberg M Hertle AP Rojahn U Jensen PE Rappaport F JoliotP Doumlrmann P Wanner G and Leister D (2013) Arabidopsis CURVATURE THYLAKOID1 proteins modify thylakoid architectureby inducing membrane curvature Plant Cell 25 2661-2678

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Aseeva E Ossenbuumlhl F Sippel C Cho WK Stein B Eichacker LA Meurer J Wanner G Westhoff P Soll J andVothknecht UC (2007) Vipp1 is required for basic thylakoid membrane formation but not for the assembly of thylakoid proteincomplexes Plant Physiol Biochem 45 119-128

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Bartsevich VV and Pakrasi HB (1995) Molecular identification of an ABC transporter complex for manganese analysis of acyanobacterial mutant strain impaired in the photosynthetic oxygen evolution process EMBO J 14 1845-1853

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Bartsevich VV and Pakrasi HB (1996) Manganese transport in the cyanobacterium Synechocystis sp PCC 6803 J Biol Chem271 26057-26061

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Bernaacutet G Waschewski N and Roumlgner M (2009) Towards efficient hydrogen production the impact of antenna size andexternal factors on electron transport dynamics in Synechocystis PCC 6803 Photosynth Res 99 205-216

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Boehm M Yu J Krynicka V Barker M Tichy M Komenda J Nixon PJ and Nield J (2012) Subunit Organization of aSynechocystis Hetero-Oligomeric Thylakoid FtsH Complex Involved in Photosystem II Repair Plant Cell 24 3669-3683

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Bradford MM (1976) A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle ofprotein-dye binding Anal Biochem 72 248-254

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Chang L Liu X Li Y Liu C-C Yang F Zhao J and Sui S-F (2015) Structural organization of an intact phycobilisome and itsassociation with photosystem II Cell Res 25 726-737

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Danielsson R Suorsa M Paakkarinen V Albertsson P-Aring Styring S Aro E-M and Mamedov F (2006) Dimeric andmonomeric organization of photosystem II Distribution of five distinct complexes in the different domains of the thylakoidmembrane J Biol Chem 281 14241-14249

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Daum B Nicastro D Austin J McIntosh JR and Kuumlhlbrandt W (2010) Arrangement of photosystem II and ATP synthase in

7

transfer capacity which was measured as relative electron transfer rate (rETR) did not differ 212

significantly between wild-type and curT- (Figure 4C) Both wild-type and curT- cells reach a 213

capacity limit at ~ 250 micromol photons m-2s-1 and the decay of rETR beyond the capacity limit 214

is very similar These results indicate that the point of onset of PSII-related photoinhibition is 215

the same in both strains which in turn implies that electron flow downstream of PSII is 216

unchanged in the mutant 217

Low PSII levels in curT- could be caused either by reduced synthesisbiogenesis or its 218

enhanced degradation To measure the rates of D1 repair the kinetics of D1 accumulation 219

upon induction of photoinhibition by high-light treatment (800 micromol photons m-2s-1) was 220

assayed by immunological means (Figure 4D) In wild-type cells the D1 level decreased to 221

60 (relative to the initial time point) after 90 min of treatment As previously shown the 222

drop is much more pronounced (~35 left) when repair synthesis of D1 is inhibited by the 223

addition of lincomycin (Figure 4D Komenda et al 2008) Surprisingly in curT- the level of 224

residual D1 is rather stable over the same time period and lincomycin treatment induces a 225

more modest decrease to 60 relative to the initial time point (Figure 4D) These data clearly 226

indicate that in absence of CurT residual D1 is less susceptible to degradation even though 227

its absolute amount is reduced In line with this no effect on growth rates was observed when 228

either wild-type or curT- cells were cultivated for two days at 200 micromol photons m-2s-1 229

(Supplemental Figure 5) 230

To assess the role of CurT in the assembly of PSII we compared the two-dimensional 231

profiles of thylakoid membrane proteins from wild-type and mutant cells by Blue-Native 232

(BN)SDS-PAGE PSII assembly intermediates were subsequently visualized via 233

immunodetection of PSII core subunits As shown in Figure 5A dimeric PSII core complexes 234

(RCCII) are drastically underrepresented in curT- whereas relative levels of earlier assembly 235

intermediates including the monomeric CP43-less RC47 complex and non-assembled CP43 236

increase Parallel detection of CurT itself revealed a ldquosmearedrdquo signal in the size range from 237

15 up to 500 kDa suggesting that CurT forms part of high-molecular-weight complexes 238

(Figure 5A) Finally in vivo 35S protein pulse-labeling experiments confirmed that RC and 239

RC47 complexes in particular are efficiently formed in curT- but the transition to RCCI 240

complexes is severely delayed (Figure 5B) As a consequence dimeric RCCII complexes do 241

not incorporate any radioactive label over the experimentrsquos time course of 25 min (Figure 5B) 242

Taken together these data show that curT inactivation has a severe impact on PSII biogenesis 243

but little or no effect on the degradation of the complex 244

8

The data presented so far suggest a PSII-related phenotype for curT- so we explored 245

the effects of curT disruption on photosynthesis further by comparing the low-temperature 246

(77K) fluorescence emission spectra in cell suspensions following excitation of chlorophyll at 247

440 nm (Figure 6A) The signals were normalized to the emission maximum at 514 nm of the 248

external standard fluorescein (Figure 6A) In curT- the PSI emission peak amplitude was 249

similar to that of the wild-type (Figure 6A) The spectra differed however around 685 nm 250

Here we observed an increase in fluorescence in the mutant strain an emission signature that 251

is probably related to the inner antenna protein CP43 (Figure 6A Nilsson et al 1992) 252

Increased chlorophyll fluorescence at 685 nm has previously been shown to be characteristic 253

for cells that are accumulating the stress-induced IsiA protein which shares structural 254

similarities with CP43 (Odom et al 1993 Yeremenko et al 2004 Wilson et al 2007) A 255

second indication for accumulation of IsiA is a diagnostic blue shift of the 725 nm 256

fluorescence peak by approximately 5 nm which is indeed observed in the curT- spectrum 257

(Figure 6A Sandstroumlm et al 2001) We therefore determined the level of IsiA in both wild-258

type and curT- by immunoblot analysis As expected IsiA was strongly induced in curT- 259

suggesting that the mutant suffers from severe stress (Figure 6C) When fluorescence at 77K 260

was recorded after excitation at 580 nm which mainly excites the phycobiliproteins the 261

signal at 685 nm (PSII related) was enhanced in the curT- mutant most likely reflecting IsiA 262

emission andor the presence of uncoupled phycobilisomes (Figure 6B Wilson et al 2007) 263

In contrast the 725 nm peak (PSI related) was reduced in curT- relative to the wild-type 264

suggesting less coupling of phycobilisomes to PSI (Figure 6B) The increase in uncoupled 265

phycobilisomes can be directly attributed to the reduction in RCCII levels found in the curT- 266

mutant (Figure 5A) since phycobilisomes are attached to PSII dimers for efficient light 267

harvesting (Watanabe and Ikeuchi 2013 Chang et al 2015) 268

Thus the curT- mutant exhibits a characteristic set of photosynthetic defects The 269

primary target of the CurT membrane-shaping function appears to be PSII in particular in its 270

biogenic phase However the reduction in PSII content cannot be responsible for the lack of 271

thylakoid convergence zones at the plasma membrane because these structures can still be 272

observed in the psbA- mutant TD41 which is lacking D1 and therefore unable to assemble any 273

PSII complexes (Supplemental Figure 6 Nilsson et al 1992) 274

275

Subcellular localization of CurT 276

We have previously proposed that the initial steps in PSII assembly take place in 277

biogenesis centers located at the interface between plasma and thylakoid membranes (Stengel 278

9

et al 2012) These biogenic membranes (PDMs) are marked by the PSII Mn2+ delivery factor 279

PratA and can be separated from thylakoids by a two-step sucrose-gradient centrifugation 280

procedure (Schottkowski et al 2009b Rengstl et al 2011) When the distributions of various 281

proteins within such membrane fractions from the wild-type and curT- were compared two 282

striking changes were detected in the mutant First the precursor of the D1 subunit of PSII 283

(pD1) is absent from PDMs in the mutant and secondly the inner antenna protein CP47 ndash but 284

not CP43 ndash of PSII shifts towards fractions of lower density (Figure 7) Hence the 285

organization of PDMs appears to be perturbed in curT- In wild-type cells most of the CurT 286

protein was found in thylakoid membranes only a minor fraction similar in amount to that of 287

the PSII assembly factors Ycf48 Pitt and YidC as well as the VIPP1 protein comigrated with 288

PDMs (Figure 7) According to rough estimates based on densitometric signal analysis 25 289

of total cellular CurT is normally found in the PDMs and 75 in the thylakoids (Figure 7) 290

To further analyze the localization of CurT in its cellular context in vivo we 291

constructed a translational fusion in which the monomeric enhanced cyan fluorescent protein 292

(CFP) mTurquoise2 (Goedhart et al 2012) is attached to the C-terminus of CurT and is 293

expressed under the control of the native curT promoter The resulting strain curT-CFP 294

showed a fully restored wild-type growth phenotype indicating that the CFP tag does not 295

affect CurTrsquos function (Supplemental Figure 7A) In agreement with this the fusion protein 296

accumulated to wild-type levels (96 plusmn 16 Supplemental Figure 7B) and localized to the 297

same membrane sub-fractions as does native CurT (Supplemental Figure 7C) The CurT-CFP 298

fluorescence signal was distinctly discernible above the wild-type autofluorescence 299

background (Supplemental Figure 8A) and was distributed in a network-like pattern with 300

concentrated areas at the cell periphery at mid-plane Analysis of CurT-CFP fluorescence in 301

Z-axis montages revealed that these signals often appeared as rod-like structures which 302

seemed to follow the spherical inner surface of the cell (Figure 8A B Supplemental Movie 1 303

and 2) In some cases these structures also appear to extend through the cytoplasm (Figure 304

8A and 8B Supplemental Movie 3) 305

When chlorophyll autofluorescence indicative of thylakoid membranes was visualized 306

in the same cell only a partial overlap with the CurT-CFP signal was observed (Figure 8 307

Supplemental Movie 1-3) Strikingly the peripheral CurT-CFP signals frequently reached 308

their maximal intensity in those areas where chlorophyll fluorescence was low ie where 309

thylakoid convergence zones are expected to form (Sacharz et al 2015) This becomes even 310

clearer when the intensity of a circumferential profile that follows the thylakoidrsquos 311

10

fluorescence signal is quantified separately for each of the two fluorescent channels (Figure 312

8C) 313

In contrast the chlorophyll autofluorescence in the curT- mutant seems to be evenly 314

distributed (Supplemental Figure 9) Following the fluorescence in an intensity profile as in 315

curT-CFP no regions with a similar decline in fluorescence were found most likely due to 316

the absence of biogenesis centers In addition some circular structures presenting chlorophyll 317

autofluorescence were detected in the interior of the cells Hence the disturbed curT- 318

ultrastructure is also reflected in the distribution of chlorophyll pigments (Supplemental 319

Figure 9) 320

To confirm the network-like distribution of CurT-CFP in the cell we used 321

immunofluorescence to detect CurT in the wild-type in situ Synechocystis 6803 cells were 322

fixed and treated with the αCurT antibody and an Oregon Green-conjugated secondary 323

antibody As shown in Figure 9A and B both techniques revealed similar network-like 324

patterns of the CurT signal which coalesced into rod-like structures at the cell surface and 325

essentially filled up the gaps between the autofluorescent thylakoid regions (negative controls 326

shown in Supplemental Figure 8B and 8C) Again regions of low chlorophyll fluorescence 327

typical of biogenesis centers generally exhibited stronger CurT-related fluorescence (Figure 328

8C) Occasionally CurT-CFP signals were also observed near traversing thylakoid lamellae 329

(when these were present in the cell analyzed) but the autofluorescence intensity of such 330

thylakoids is much weaker (see Figure 8B cell b in slice 6 and Supplemental Movie 3) 331

Finally CurT was localized by immunogold labeling experiments on ultrathin sections 332

of wild-type Synechocystis 6803 cells Almost no signals were detected when wild-type and 333

curT- sections were processed in the absence of the primary antibody as a negative control 334

(Figure 10A and Supplemental Figure 10A respectively) When mutant curT- cells were 335

processed in the presence of the αCurT antiserum a low level of randomly distributed 336

background signals was observed (Supplemental Figure 10B Supplemental Table 1) 337

However the number of signals located at the thylakoid membrane was clearly reduced 338

relative to the wild-type Therefore these signals were treated as non-specific background 339

Upon incubation of wild-type cell sections with antibodies directed against the N-terminus of 340

CurT (Figure 1A) the antigen was detected on the cytoplasmic surface of thylakoid 341

membranes (Figure 10B and 10C) This strongly suggests that its N-terminus is oriented 342

towards the cytoplasm Overall CurT signals appeared to be distributed along both thylakoids 343

and PDMs This agrees with the broad distribution of CurT across various fractions in the 344

membrane fractionation experiments (Figure 7) In only a few cases (12 ) however was 345

11

some clustering of immunogold signals at thylakoid convergence regions found (Figure 10D 346

and 10E) Thus the high local concentration of CurT at biogenic centers seen in the 347

fluorescence-based approaches (Figures 8 and 9) was not quantitatively reflected in the 348

immunogold labeling data This is likely due to the fact that immunogold electron microscopy 349

can only detect antigens on the surface of the section This issue is further complicated by the 350

heterogeneity of the CurT assemblies (see below and Discussion section) 351

Nevertheless closer inspection of the immunogold signals revealed an asymmetric 352

distribution of CurT signals with regard to the two faces of thylakoid sheets As illustrated in 353

Figure 10G curved thylakoid sheets possess a longer convex and a shorter concave face 354

When we analyzed a total of approximately 1500 CurT immunogold signals (from a total of 355

95 cells) which were unambiguously located to one side of the thylakoid membrane (for a 356

representative example see Supplemental Figure 11) 561 were found to be located at the 357

convex face while the other 439 localized to the concave side (Figure 10G Supplemental 358

Table 2) When differently curved regions (Figure 10F) including thylakoid lamellae (i) that 359

follow the overall shape of the cell (green) (ii) bend away from the plasma membrane (red) or 360

(iii) towards it ie where thylakoids converge to form biogenesis centers (yellow) were 361

examined separately red and green regions showed a CurT distribution in the range of 55 362

convex to 45 concave (Figure 10G Supplemental Table 2) However at the biogenesis 363

centers (the regions highlighted in yellow in Figure 10F) the uneven distribution of the 364

immunogold signals was more pronounced 61 of signals were found on the convex side 365

and 39 on the concave face of thylakoid lamellae (Figure 10G Supplemental Table 2) 366

Statistical analyses confirmed the significance of these differences in signal distributions 367

along the thylakoid membrane types (Supplemental Table 3) 368

Taken together with the finding that CurT is required for the formation of the 369

convergence sites forming biogenesis centers these data are consistent with the idea that the 370

thylakoid sheets are shaped by CurT which induces membrane curvature via asymmetric 371

intercalation on the two sides of thylakoid sheet 372

373

Different forms of CurT are found in PDMs and thylakoids 374

CurT was found to localize to both highly curved PDMs and less bent thylakoids Its 375

high local concentration at biogenic centers as seen in the fluorescence-based approaches 376

suggests a dosage-dependent effect of CurT on membrane shaping An alternative possibility 377

is that different CurT variants might exist in the two membrane types which could potentially 378

serve different functions To explore this possibility we asked whether CurT is found in 379

12

different complexes by using 2D BNSDS-PAGE to characterize membrane material isolated 380

via two-step sucrose gradient centrifugation (see Figure 7) In accordance with the data in 381

Figure 5A we find several low-molecular-weight complexes containing CurT (Figure 11A) 382

Smaller complexes of ~80 (complex I) and ~100 kDa (complex II) accumulate in membrane 383

fraction 5 (representing PDMs) but these are far less prevalent in fraction 9 representing 384

thylakoids (Figure 11A) In addition CurT-containing sub-complexes of ~140 (complex III) 385

and ~200 kDa (complex IV) are more prominently represented in thylakoids together with 386

even larger complexes ranging up to 670 kDa (Figure 11A) 387

Even more strikingly PDMs and thylakoids also differ with respect to the forms of 388

CurT they contain Thus isoelectric focusing (IEF) analysis of both membrane fractions 389

revealed at least four different CurT isoforms (a-d Figure 11B) PDMs contain mainly forms 390

b and d as well as trace amounts of a while thylakoids apparently possess very low levels of 391

form d and accumulate forms a b and c (Figure 11B) The nature of the underlying CurT 392

modifications still has to be determined Interestingly however CurT has recently been 393

identified as a phosphoprotein in a proteomic study (Spaumlt et al 2015) and the CurT variants 394

in Figure 11B may differ in their phosphorylation states At all events PDMs and thylakoids 395

can be distinguished by their complement of CurT isoforms which potentially play a role in 396

formation of the CurT sub-complexes that define the two membrane fractions 397

398

CurT is involved in the osmotic stress response 399

To further explore the stress-related role of CurT (Figure 6) and its link to IsiA 400

induction the effect of other potential stressors on curT- cells was tested High light levels had 401

a minor effect on curT- growth and its photosynthetic performance (Figure 4 Supplemental 402

Figure 5 and section above) suggesting that other environmental factors induced isiA 403

expression Our search was also motivated by a previous proteomic survey of plasma 404

membrane proteins of Synechocystis 6803 in high salt conditions in which CurT and VIPP1 405

were found among the most highly induced targets (Huang et al 2006) First we cultured 406

wild-type and curT- cells in different salt concentrations and found that growth of curT- was 407

severely affected in high salt (Figure 12A) Wild-type cells were only slightly affected by the 408

addition of salt to the medium The deleterious effect of the loss of curT on growth was even 409

more pronounced when maltose an osmotically active compound was present in the medium 410

(Figure 12B) Indeed curT- cells failed to survive exposure to 150 mM maltose whereas 411

growth of the wild-type was only slightly compromised These findings assign an additional 412

function to CurT ie a protective role during osmotic stress 413

13

When the curT-CFP strain was analyzed under these stress conditions enhanced 414

accumulation of CurT at the cell periphery was found mostly outside the autofluorescent 415

thylakoids and consistent with accumulation at the plasma membrane (Figure 12C) This was 416

further substantiated by membrane fractionation experiments which also revealed an 417

increased relative abundance of CurT in the plasma membrane fraction in the first sucrose 418

gradient (Figure 12E) Determination of total cellular CurT levels demonstrated that its 419

absolute amount did not increase under stress (Figure 12D) Therefore its higher abundance 420

in the plasma membrane under osmotic stress is likely to be due to CurT trafficking towards 421

the plasma membrane instead of increased synthesis 422

The same appears to hold true for VIPP1 which has been implicated in membrane 423

maintenance in both cyanobacteria and chloroplasts (Zhang and Sakamoto 2015) At stress 424

conditions an increase of the VIPP1 signal in the plasma membrane can be monitored in 425

wild-type (Figure 12E) However enhanced accumulation of VIPP1 in plasma membranes is 426

unaffected in the curT- mutant suggesting that thylakoid convergence zones are not strictly 427

required for the localization of VIPP1 428

429

Discussion 430

CurT determines thylakoid architecture 431

This study demonstrates that the protein CurT a homolog of the grana-forming 432

CURT1 proteins in plants is essential for establishing the proper thylakoid membrane 433

architecture in the cyanobacterium Synechocystis 6803 In particular CurTrsquos membrane-434

bending activity is likely to be required for the formation of thylakoid biogenesis centers at 435

points on the cell periphery where thylakoids converge towards the plasma membrane Here 436

PratA-mediated preloading of early PSII assembly intermediates with Mn2+ ions has been 437

proposed to take place together with PSII repair (Stengel et al 2012 Sacharz et al 2015) 438

This idea is supported by the following lines of evidence (i) The curT- mutant is devoid of 439

any thylakoid sectors that have convergence zones at their distal ends instead thylakoid 440

membranes are displaced and disposed as disordered or continuous rings (ii) CurT similarly 441

to CURT1A possesses a membrane-curving activity in vitro and intercalates asymmetrically 442

into thylakoids (iii) A high local concentration of CurT is observed at regions of high 443

curvature where biogenesis centers are found (iv) Lack of CurT affects the formation and 444

accumulation of PSII complexes as well as the abundance of some of its assembly factors 445

The drastic effects of CurT inactivation indicate an important role for this factor in membrane 446

shaping In contrast to the situation for CURT1A from Arabidopsis attempts to stably 447

14

overexpress CurT in Synechocystis 6803 failed Although short-lived transient increases in 448

CurT levels were observed when curT was expressed via strong heterologous promoters 449

wild-type levels of the protein were restored during subsequent rounds of cultivation of 450

transgenic lines Apparently Synechocystis 6803 cells do not tolerate substantial alterations in 451

CurT dosage and counter-select against these 452

This is in agreement with a dosage-dependent membrane-curving activity of CurT 453

which is suggested by its high local concentration at the edges of thylakoid autofluorescent 454

regions which mark the sites of the highly curved thylakoid convergence zones (Figures 8 9 455

and 13 Supplemental Movie 1 2 and 3) In addition some CurT was detected in structures 456

extending through the cytoplasm which most likely represent thylakoid sheets traversing the 457

cell from one thylakoid convergence zone to another (Figures 2A and 8) CurT might be 458

involved in the formation and stabilization of these structures 459

Members of the CURT1 family contain an N-terminal amphipathic α-helix that may 460

be involved in the membrane-bending activity of CurT (Armbruster et al 2013) Several 461

eukaryotic membrane-shaping proteins possess amphipathic helices as part of either an ENTH 462

(epsin N-terminal homology) or an N-BAR (Bin amphiphysin Rvs with N-terminal 463

amphipathic helix) domain (Ford et al 2002 Gallop and McMahon 2005 Zimmerberg and 464

Kozlov 2006) ENTH and N-BAR domains are rather large (~200 amino acids) and it has 465

been shown that amphipatic helices present in those domains insert into one leaflet of the lipid 466

bilayer and thereby induce curvature of the membrane (reviewed by Gallop and McMahon 467

2005 Zimmerberg and Kozlov 2006) However CurT itself is a small protein (149 amino 468

acids) that contains two transmembrane domains which insert into both leaflets of the lipid 469

bilayer (Figure 1A) as already suggested by Armbruster et al (2013) The amphipathic helix 470

faces the cytoplasm in Synechocystis 6803 or the stroma in A thaliana and most likely it 471

fine-tunes the degree of membrane bending mediated by CurT (Armbruster et al 2013) 472

In addition the increase in curvature correlated with CurT accumulation at convex 473

sides of thylakoid lamella (Figure 10 and 13) Hence curving might be mediated by 474

asymmetric integration of CurT into the lipid bilayers forming opposite faces of thylakoid 475

membrane sheets (Figure 13) However the mechanism causing this asymmetry remains 476

elusive 477

The presence of different CurT isoforms and complexes in PDMs and thylakoids adds 478

a further level of complexity and most likely reflects the dynamic regulation of this system 479

(Figure 11) The formation of different complexes might be primed by the phosphorylation of 480

CurT within its N-terminal cytoplasmic part (Spaumlt et al 2015) It seems likely that these 481

15

complexes play distinct roles in mediating the different CurT functions ie membrane 482

bending and maintenance 483

However it remains to be seen how exactly curvature is established maintained and 484

fine-tuned In addition other determinants of membrane topology and their putative interplay 485

with CurT have to be considered eg lipid and protein (complex) composition of 486

membranes cellular turgor pressure and other factors required for membrane 487

biogenesismaintenance eg the VIPP1 protein before precise molecular models of CurTrsquos 488

mode of action can be constructed (Rast et al 2015 and see below) That these other factors 489

can be crucial for membrane architecture is documented by the fact that some marine 490

cyanobacteria such as Prochlorococcus and Synechococcus contain curved thylakoids (but 491

no thylakoid convergence zones at the plasma membrane) although they lack a curT gene 492

493

The role of biogenesis centers 494

The absence of biogenesis centers in the curT- mutant now enables one to answer some 495

questions relating to the role of these thylakoid sub-structures which form in some but not all 496

cyanobacteria (Kunkel 1982 van de Meene et al 2006) First they are not essential since 497

even the curT- mutant still accumulates PSII to ~50 of wild-type levels On the other hand 498

in the mutant assembly of PSII is impaired as revealed by the increased accumulation of early 499

assembly intermediates In addition PSII dimers are almost completely absent in curT- 500

Whether the reduction in PSII dimers is attributable to an assembly problem linked to the 501

absence of biogenesis centers or to a secondary defect in dimer stabilization caused by 502

changes in overall thylakoid membrane ultrastructure remains to be determined Thus 503

biogenesis centers are more likely to represent evolutionary ldquoadd-onsrdquo that facilitated efficient 504

thylakoid biogenesis This is compatible with the fact that some cyanobacteria are devoid of 505

any biogenesis center-related substructures Second their absence compromises PSII but the 506

accumulation of other photosynthetic complexes ie PSI and the Cyt(b6f) complex is not 507

affected by CurT deficiency (Figure 3) This observation agrees with previous findings that 508

neither the PsaA subunit of PSI nor its assembly factor Ycf37 is detectable in isolated PDM 509

fractions (Rengstl et al 2011) 510

In addition to reduced de novo PSII assembly a higher relative stability of D1 in high-511

light experiments has been detected in curT- which suggests that D1 degradation during PSII 512

repair is less efficient in the mutant Photo-damaged D1 is degraded by the FtsH2FtsH3 513

complex which has previously been shown to partly localize to thylakoid convergence zones 514

at the cell periphery ie biogenesis centers (Boehm et al 2012 Sacharz et al 2015) It 515

16

therefore seems possible that the absence of biogenesis centers in curT- leads to 516

mislocalization of the FtsH2FtsH3 complex and less effective D1 degradation 517

Moreover a PSII related-function for CurT is supported by a meta-analysis of the 518

Synechocystis 6803 transcriptome When the CyanoEXpress 22 database (Hernaacutendez-Prieto 519

and Futschik 2012 Hernaacutendez-Prieto et al 2016) was queried for genes co-expressed with 520

curT (slr0483) genes for five PSII subunits ndash psbE psbO psbF psbL and psb30 ndash were 521

found among the first ten hits (Supplemental Table 4) From this we infer that biogenic 522

centers do not play an essential role in the assembly of all photosynthetic complexes but 523

serve to enhance PSII assemblyrepair possibly through the efficient delivery of Mn2+ 524

Residual PSII in curT- cells is likely to be supplied with cytoplasmic Mn2+ via a second 525

independently operating ABC transporter-based system in the plasma membrane named the 526

Mnt pathway (Bartsevich and Pakrasi 1995 Bartsevich and Pakrasi 1996) 527

Formally we cannot exclude that CurT is directly involved in the PSII assembly 528

process However considering CurTrsquos membrane bending capacity and the mutant phenotype 529

(Figure 1D and Figure 2) it appears more likely that CurT forms cellular substructures for 530

efficient PSII biogenesis ie biogenesis centers 531

As mentioned above some ultrastructural features of biogenesis centers have emerged 532

from studies employing EM-based tomography (van de Meene et al 2006) To date however 533

a high-resolution picture of the precise membrane architecture within these centers remains 534

elusive In particular whether or not a direct connection between plasma membrane and 535

thylakoids exists continues to be debated As recently discussed and in line with this gap in 536

knowledge different membrane fractionation techniques have revealed different distributions 537

of PSII-related subunits and assembly factors between plasma and thylakoid membranes 538

(Heinz et al 2016 Liberton et al 2016 Selatildeo et al 2016) The overall picture that emerges 539

is that the initial hypothesis that PSII biogenesis is initiated at the plasma membrane is no 540

longer tenable whereas a specialized thylakoid sub-fraction like the PDMs that make contact 541

with the plasma membrane could explain many of the available data and thus clarify some 542

aspects of the debate (Zak et al 2001 Pisareva et al 2011 Rast et al 2015) Moreover it 543

has previously been hypothesized that ldquoribosome-decorated membrane-like complexesrdquo 544

forming at the innermost thylakoid sheet might represent biogenic compartments (van de 545

Meene et al 2006 Mullineaux 2008) Whether these structures are affected in curT- cannot 546

be judged based on our TEM analysis but requires ultrastructural data of higher resolution 547

However the accessibility of thylakoids for ribosomes should be increased in the less 548

compressed membrane system of curT- (Figure 2B-D) 549

17

A scenario similar to that of Synechocystis 6803 holds for the situation in chloroplasts 550

of the green alga Chlamydomonas reinhardtii in which de novo PSII biogenesis has been 551

shown to be initiated in punctate regions named T-zones located close to the pyrenoid 552

(Uniacke and Zerges 2007) Unlike the mRNAs for the PSII components neither RNAs for 553

PSI subunits nor PSI assembly factors are localized to T-zones indicating that PSI and PSII 554

assembly processes are spatially separated (Uniacke and Zerges 2009 Nickelsen and Zerges 555

2013 Rast et al 2015) Interestingly a recent cryoelectron tomography study demonstrated 556

that next to T-zones at the chloroplast base-lobe junction the inner chloroplast envelope 557

exhibits invaginationsconnections to thylakoids that structurally resemble the organization of 558

cyanobacterial biogenesis centers (Engel et al 2015) For future investigations it will be 559

interesting to see if a homolog of the CURT1 family is involved in the formation of these 560

structures in C reinhardtii 561

562

Evolution of CURT1 function 563

Homologs of the CURT1 protein family can be found throughout cyanobacteria green 564

algae and plants (Armbruster et al 2013) The Arabidopsis CURT1A-D proteins have 565

recently been shown to induce bending of thylakoid membranes at grana margin regions 566

(Armbruster et al 2013) Interestingly and in contrast to the situation in Synechocystis 6803 567

their inactivation did not result in severe photosynthetic deficiencies although the thylakoids 568

formed lacked defined grana stacks Nevertheless the data available support the idea that the 569

function of thylakoid membrane structures that were regarded as being independent ie 570

cyanobacterial biogenesis centers and grana are closely related Intriguingly both of these 571

thylakoid membrane structures are dedicated to aspects of PSII function but do not involve 572

PSI (Pribil et al 2014) In both the prokaryotic and eukaryotic systems CURT1 homologs 573

appear to bend thylakoid membranes as indicated by (i) the distortion of membrane 574

ultrastructure seen in mutants devoid of curved thylakoids (ii) the localization of CURT1 575

homologs at grana margins and their local concentration at biogenesis centers (iii) the in vitro 576

membrane-curving activity of both CURT forms The phenotypic differences between 577

A thaliana and Synechocystis 6803 mutants may however be attributable to the different 578

functions of the membrane sub-compartments affected in the two model organisms Whereas 579

the role of grana is still under debate one function of the cyanobacterial biogenesis centers is 580

the above-mentioned high-throughput uptake of Mn2+ ions for efficient assembly of PSII 581

(Stengel et al 2012 Nickelsen and Rengstl 2013 Pribil et al 2014) However it appears 582

that in both cases the primary function of CURT1 proteins is to generate curved membrane 583

18

regions These discoveries suggest that until now two independently observed structures ie 584

cyanobacterial thylakoid biogenesis centers and chloroplast grana regions are closely related 585

The degree of curvature is much less pronounced in the cyanobacterial system As previously 586

discussed it was probably the subsequent evolution of a membrane-localized light-harvesting 587

system in chloroplasts that made the formation of tightly curved grana thylakoids possible 588

(Mullineaux 2005 Nevo et al 2012 Pribil et al 2014) 589

590

CurT is involved in osmotic stress response 591

One unexpected phenotype of the curT- mutant is its sensitivity to osmotic stress 592

These data revealed that in addition to shaping membranes CurT also influences their 593

functional integrity This latter function might be intrinsic to CurT or could be mediated by 594

the VIPP1 protein which has been shown to be required for membrane maintenance in 595

bacteria and chloroplasts probably by acting as a supplier of lipids (for an overview see 596

Zhang and Sakamoto 2015) Both factors accumulate in the plasma membrane upon osmotic 597

stress but VIPP1 localization is not severely affected by CurT inactivation which suggests 598

that VIPP1 operates independently of CurT In agreement with this repeated co-599

immunoprecipitations revealed no interaction between both proteins Therefore it remains to 600

be established whether a direct functional relationship between them exists 601

Previous investigations of osmotic stress in Synechocystis 6803 showed a kidney-602

shaped form of wild-type cells under very high concentrations of osmotically active 603

compounds (Marin et al 2006) The cells were severely deformed indicating changes in the 604

structure of the cellular envelope Since CurT shifts towards the plasma membrane already 605

under lower osmolyte concentrations we suggest a stabilizing function of CurT in the plasma 606

membrane CurT might be necessary to tolerate the forces trying to deform the cells under 607

osmotic stress 608

In conclusion this analysis has identified a crucial determinant for shaping and 609

maintaining the cyanobacterial thylakoid membrane system ie CurT a homolog of the 610

grana-forming CURT1 protein family from A thaliana In particular CurT is involved in the 611

formation of specific thylakoid substructures close to the plasma membrane at which PSII is 612

assembledrepaired Future work will dissect the precise ultrastructure of these centers and 613

enable us to elaborate a molecular model for the spatiotemporal organization of PSII assembly 614

in cyanobacteria 615

616

19

Methods 617

Strains and growth conditions 618

Wild-type and mutant Synechocystis 6803 cells were grown on solid or in liquid BG 619

11 medium (Rippka et al 1979) supplemented with 5 mM glucose (unless indicated 620

otherwise) at 30degC under continuous illumination at a photon irradiance of 30 μmol m-2 s-1 of 621

white light For growth during high-light experiments for investigation of D1 repair cells 622

were cultivated in a FMT150 photobioreactor (Photon Systems Instruments Draacutesov Czech 623

Republic) at 800 micromol photons m-2 s-1 in the presence or absence of lincomycin (100 microgml) 624

Cell density was monitored photometrically at 750 nm Doubling times were determined after 625

two days of growth To generate the insertion mutant curT- the curT gene (slr0483) was first 626

amplified from wild-type genomic DNA by PCR using the primer pair 04835 627

(GAAGCCTATTTAGCTAAGGCCGAAAG) and 04833 628

(TAGTACCTGGTCTTCCATGGCGT) and the resulting fragment was cloned into the 629

Bluescript pKS vector (Stratagene Waldbronn Germany) A kanamycin resistance cassette 630

was then inserted into the single AgeI restriction site (159 bp downstream of the start codon) 631

and this disruption construct was used to replace the wild-type gene as described (Wilde et al 632

2001) 633

634

Bioinformatic and computational analysis 635

CURT1 sequences of Synechocystis 6803 were obtained from CyanoBase 636

(httpgenomekazusaorjpcyanobaseSynechocystis) and CURT1 homologs in other 637

organisms were retrieved from NCBIBLAST (httpblastncbinlmnihgovBlastcgi) 638

Numbers and positions of putative transmembrane domains in the predicted proteins were 639

determined with TMHMM20 (httpwwwcbsdtudkservicesTMHMM) The sequence for 640

the N-terminal amphipathic helix was predicted by Jpred 3 641

(httpwwwcompbiodundeeacukwww-jpred) and plotted using a helical wheel projection 642

script (httprzlabucreduscriptswheelwheelcgi) The programs ClustalW2 643

(httpwwwebiacuktoolsclustalw2) and GeneDoc (httpwwwpscedubiomedgenedoc) 644

were used to generate multiple alignments of amino acid sequences Quantitative analysis of 645

immunoblots was performed with the AIDA Image Analyzer V325 (Raytest 646

Isotopenmessgeraumlte GmbH Straubenhardt Germany) 647

Co-expression patterns of curT were analyzed using the CyanoEXpress 22 database 648

(httpcyanoexpresssysbiolabeu Hernaacutendez-Prieto and Futschik 2012 Hernaacutendez-Prieto et 649

al 2016) 650

20

651

Measurement of chlorophyll concentration and oxygen production 652

Determination of chlorophyll content was carried out according to Wellburn and 653

Lichtenthaler (1984) For oxygen evolution measurements cells were grown in BG-11 654

without glucose harvested in mid-log phase and diluted to an OD750 nm = 05 Oxygen 655

evolution rates were measured with a Clark-type oxygen electrode (Hansatech Instruments 656

Ltd Kingrsquos Lynn Norfolk UK) at 1000 micromol photons m-2 s-1 (cool white light) after 5 min of 657

dark acclimation Oxygen evolution under saturating light conditions was measured without 658

any additives 659

660

Cell size and cell number estimation 661

Synechocystis 6803 strains were grown in liquid BG11 media containing 5 mM 662

glucose For cell size estimation the cells were analyzed with a confocal laser scanning 663

microscope TCS SP5 (Leica Wetzlar Germany) The diameter of the cells was measured 664

with the LAS AF Lite software (Leica Wetzlar Germany) Cells that were about to divide 665

were not taken into account For the determination of cell number cultures were set to an 666

OD750 = 1 and analyzed by using a Neubauer counting chamber (Paul Marienfeld GmbH amp 667

Co KG Lauda-Koumlnigshofen Germany) Statistical significance was determined by Studentrsquos 668

t-test 669

670

Measurements of P700+ reduction kinetics and relative electron transport rates 671

P700+ reduction kinetics and changes in chlorophyll fluorescence yield at different 672

light intensities were measured at a chlorophyll concentration of 5 microgml with a Dual-PAM-673

100 instrument (Heinz Walz GmbH Effeltrich Germany) Complete P700 oxidation was 674

achieved by a 50-ms multiple turnover pulse (10000 micromol photons m-2 s-1) after 2 min of dark 675

incubation P700+ reduction kinetics were recorded without any additions as well as in the 676

presence of 10 microM DCMU Ten technical replicates were averaged and fitted with single 677

exponential functions Data interpretation was done according to Bernaacutet et al (2009) 678

Light saturation measurements were performed according to Xu et al (2008) The 679

actinic light intensity was increased stepwise from 0 to 665 micromol photons m-2 s-1 with 30-s 680

adaptation periods Maximal fluorescence yields were obtained by applying saturating light 681

pulses (duration 600 ms intensity 10000 micromol photons m-2 s-1) 682

683

Low-temperature fluorescence measurements 684

21

Fluorescence emission spectra were measured with an AMINCO Bowman Series 2 685

Luminescence Spectrometer Wild-type and curT- cells were grown in the presence of 5 mM 686

glucose to mid log-phase and concentrated to 25 microgml chlorophyll adding 2 microM fluorescein 687

as an internal standard Samples (1 ml) were transferred to thin glass tubes dark-adapted for 688

30 min at 30 degC and shock frozen in liquid N2 To quantify chlorophyllfluorescein and 689

phycobilisome-mediated fluorescence samples were excited and emission recorded at 440 690

nm510 nm (chlorophyll and fluorescein excitationmax fluorescein emission) and 580 691

nm685 nm respectively Emission was scanned at 490-800 nm or at 640-800 nm 692

respectively 693

694

Antibody production and protein analysis 695

For generation of an αCurT antibody the N-terminal coding region of curT (amino 696

acid positions 1-58) was amplified by PCR using primers N04835 697

(AAGGATCCGTGGGCCGTAAACATTCAA) and N04833 698

(AAGTCGACGCACTTCCCACACCGGTTGTA) and cloned into the BamHI and XhoI sites 699

of the pGEX-4T-1 vector (GE Healthcare Freiburg Germany) Expression of the GST fusion 700

protein in Escherichia coli BL21(DE3) and subsequent affinity purification on Glutathione-701

Sepharose 4B (GE Healthcare) were carried out as described (Schottkowski et al 2009b) A 702

polyclonal antiserum was raised against this protein fragment in rabbits (Pineda Berlin 703

Germany) Other primary antibodies used in this study have been described previously ie 704

αpD1 (Schottkowski et al 2009b) αD1 (Schottkowski et al 2009b) αD2 (Klinkert et al 705

2006) αPratA (Klinkert et al 2004) αYcf48 (Rengstl et al 2011) αPitt (Schottkowski et 706

al 2009a) αPOR (Schottkowski et al 2009a) αYidC (Ossenbuumlhl et al 2006) αVIPP1 707

(Aseeva et al 2007) αSll0933 (Armbruster et al 2010) and αSlr0151 (Rast et al 2016) or 708

were purchased from Agrisera (Vaumlnnaumls Sweden) ie αCP43 αCP47 αPsaA αCyt f 709

αRbcL αIsiA The αGFP-HRP antibody was acquired from Miltenyi Biotech (Bergisch 710

Gladbach Germany) 711

Protein concentrations were determined according to Bradford (1976) using RotiQuant 712

(Carl Roth GmbH amp Co KG Karlsruhe Germany) Protein extraction membrane 713

fractionation on sucrose-density gradients and quantification of Western signal intensities was 714

performed as described previously (Rengstl et al 2011) Solubility properties of CurT were 715

determined according to Schottkowski et al (2009a) 716

22

Sucrose-density centrifugation separating PDM and thylakoid membrane fractions by 717

two consecutive gradients was carried out as described previously (Schottkowski et al 718

2009b Rengstl et al 2011) 719

Two-dimensional fractionations of cyanobacterial membrane proteins via BNSDS-720

PAGE and of pulse-labeled proteins by BNSDS-PAGE were performed as previously 721

reported (Klinkert et al 2004 Schottkowski et al 2009b Rengstl et al 2013) For the 722

analysis of native complexes in fractions obtained by sucrose-density centrifugation the 723

volume corresponding to 350 microg of protein in fraction 7 was applied to BNSDS-PAGE 724

For isoelectric focusing (IEF) the volume corresponding to 50 microg of protein from 725

fraction 7 in 200 microl of IEF buffer (8 M urea 4 CHAPS 1 IPG buffer pH 4-7 (GE 726

Healthcare)) was applied to an 11-cm Immobiline DryStrip pH 4-7 (GE Healthcare) in a 727

Protean IEF Cell (Bio-Rad Munich Germany) Strips were rehydrated for 12 h at 20 degC and 728

50V Focusing was carried out in the following steps 500 V rapid 1500 Vh 1000 V linear 729

880 Vh 6000 V linear 9680 Vh 6000 V rapid 5390 Vh 50 microA per gel focus temperature 730

20degC Subsequently the strips were incubated in equilibration buffer I (6 M urea 0375 M 731

Tris pH 88 20 glycerol 2 SDS 2 DTT) and equilibration buffer II (6 M urea 0375 732

M Tris pH 88 20 glycerol 2 SDS 25 iodoacetamide) for 10 min in each buffer 733

Then the IEF strips were applied to second-dimension SDS-PAGE 734

735

Transmission electron microscopy and immunogold labeling 736

Sample preparation for transmission electron microscopy including freeze substitution 737

and immunogold labeling of CurT was performed as described previously (Stengel et al 738

2012) Ultrathin sections were cut to thicknesses of 35 - 45 nm and 45 - 65 nm for 739

ultrastructural analyses and immunogold labeling respectively For immunogold labeling 740

sections collected on collodion-coated Ni grids were incubated for 18 h at 4degC with (rabbit) 741

αCurT (diluted 1100 1500 11000 or 14000 in blocking buffer (5 fetal calf serum) with 742

005 Tween 20) and further processed as described previously (Stengel et al 2012) As a 743

negative control wild-type Synechocystis 6803 cells were incubated without the primary 744

antibody and exposed to the gold-labeled anti-rabbit IgG To image the ultrastructure and the 745

immunogold-treated samples a Fei Morgagni 268 transmission electron microscope was used 746

and micrographs were taken at 80 kV 747

To avoid errors in the interpretation of the immunogold labeling experiment only 748

signals which were unambiguously localized to distinctly visible thylakoid membranes were 749

taken into account For each cell different regions (see Figure 10F) were defined and in each 750

23

region the signals on the convex and concave sides of the thylakoid membrane were analyzed 751

separately (see Supplemental Figure 11 for representative counts) Statistical significance was 752

assessed by χ2 test (Zoumlfel 1988) 753

For the analysis of clusters of CurT signals in biogenesis centers a cluster was defined 754

as a minimum of four signals in close proximity Overall 219 biogenesis centers were 755

examined with regard to CurT cluster formation 756

757

Preparation of proteoliposomes 758

Liposomes with a lipid mixture of 25 monogalactosyl diacylglycerol 42 759

digalactosyl diacylglycerol 16 sulfoquinovosyl diacylglycerol and 17 760

phosphatidylglycerol (Lipid Products South Nutfield UK) were prepared as described 761

previously (Armbruster et al 2013) To generate proteoliposomes CurT and CURT1A 762

proteins were expressed in the presence of liposomes for 3 h at 37degC using a PURExpress In 763

Vitro Protein Synthesis Kit (New England Biolabs Ipswich MA USA) The liposomes were 764

separated from the mix by centrifugation in a discontinuous sucrose gradient (100000 g 18 765

h) Subsequently the fraction containing the liposomes was extracted and dialyzed against 20 766

mM HEPES (pH 76) For transmission electron microscopy the proteoliposomes were 767

negatively stained with 1 uranyl acetate on a carbon-coated copper grid Micrographs were 768

taken on a Fei Morgagni 268 TEM at 80 kV 769

770

curT-CFP strain generation 771

Gibson assembly was used for single-step cloning (Gibson 2011) of the slr0483 gene 772

(together with its ~08 kb upstream region) the mTurquoise2 gene fragment the gentamycin-773

resistance cassette (aacC1) and an ~17-kb downstream region of slr0483 into pBR322 774

cleaved with EcoRV and NheI The slr0483 gene was fused in frame to the codon-optimized 775

mTurquoise2 (DNA20) preceded by a linker sequence encoding GSGSG The resulting 776

plasmid was used to transform Synechocystis 6803 as described previously (Zang et al 2007) 777

After ~ 10 days of incubation on BG11-GelRite (15 ) medium in the presence of 2 microgml 778

gentamycin several antibiotic resistant colonies were obtained and streaked out on fresh 779

medium These transformants were then tested for full segregation of the tagged allele by 780

colony PCR with primers flanking the slr0483 gene 781

782

Fluorescence microscopy 783

24

An aliquot of a cell suspension in mid-log phase was placed under a BG11-agarose 784

pad on a glass coverslip (15) and imaged on an inverted microscope (Zeiss 785

AxioObserverZ1) equipped with an ORCA Flash40 V2 (Hamamatsu) camera a Lumenecor 786

SOLA II Light Engine and a Plan-Apochromat 63x140 Oil DIC M27 (NA 14) objective 787

(Zeiss) Image acquisition was done with Zen 21 software in cyan and far-red fluorescence 788

channels (Zeiss Filter Sets 47 HE and 50) as Z-series with a step size of 250 nm and effective 789

pixel size of 103 nm Acquired image files were subsequently deconvolved (Constrained 790

Iterative Method) using a default theoretical Point Spread Function in Zen 20 (Zeiss) 791

Extraction of intensities for line profiles was performed by image thresholding the thylakoid 792

autofluorescence channel and eroding the resulting binary mask in Fiji (Schindelin et al 793

2012) 794

For immunofluorescence analysis cells were grown to mid-log phase as in the case of 795

the cells prepared for live-cell microscopy A 10-ml culture was fixed for 20 min in 37 796

formaldehyde and following extensive washing with phosphate-buffered saline (PBS) cells 797

were first permeabilized in 005 Triton-X for 20 min and then in lysis buffer (50 mM Tris-798

HCl 100 mM NaCl 5 mgml lysozyme) at 37degC for 2 h with gentle shaking To block 799

unspecific binding sites the cell pellet was incubated in 5 bovine serum albumin in PBS at 800

30degC for 1 h The αCurT serum (1500 dilution) was added to cells in fresh blocking buffer 801

for 1 h at 30degC with gentle shaking Cells were then washed three times with blocking buffer 802

and incubated with goat anti-rabbit IgG secondary antibodies conjugated to Oregon Green 488 803

(Invitrogen) (11000 dilution) under the conditions as for the primary antibodies Cells were 804

washed three times with PBS and prepared for microscopy as above Imaging was done as 805

described for live-cell microscopy except that a Colibri2 LED light source was employed for 806

illumination and a CoolSnap HQ camera (Photometrics) was used for image acquisition Cells 807

were imaged as Z-series (step size 280 nm) in the yellow and far-red fluorescent channels 808

(Zeiss Filter Sets 46 HE and 50) using the 505 nm and 625 nm LED modules Effective pixel 809

size in the final image was 102 nm Deconvolution and image analysis was done as described 810

above As judged by the staining intensity of the Oregon Green-conjugated antibodies 811

approximately half of the cells in any given field of view appeared to have been successfully 812

permeabilised a rate that is common in our experience No significant signal was detected in 813

the control sample that had not been exposed to the primary antibodies 814

815

25

Accession numbers 816

Sequence data from this article can be found in the CyanoBase and EMBLGenBank 817

data libraries under accession number slr0483 818

819

Supplemental Data 820

Supplemental Figure 1 Construction of the curT- mutant 821

Supplemental Figure 2 Growth phenotype of curT- 822

Supplemental Figure 3 Expression analysis of the open reading frame slr0482 (located 823

upstream of curT) in the curT- strain 824

Supplemental Figure 4 Absorbance spectra of curT- and wild-type cells 825

Supplemental Figure 5 High-light growth phenotypes of wild-type Synechocystis 6803 and 826

the curT- strain 827

Supplemental Figure 6 Ultrastructure of the TD41 mutant which lacks the psbA transcript 828

and the D1 protein 829

Supplemental Figure 7 Expression and localization of CurT-CFP 830

Supplemental Figure 8 Localization of CurT and CurT-CFP by fluorescence microscopy 831

Supplemental Figure 9 Chlorophyll autofluorescence of curT- 832

Supplemental Figure 10 The curT- mutant as a negative control for immunogold labeling 833

Supplemental Figure 11 Representative counts of immunogold signals 834

Supplemental Table 1 Overview of immunogold signals in curT- cells 835

Supplemental Table 2 Overview of immunogold signals in specific regions of Synechocystis 836

6803 wild-type cells 837

Supplemental Table 3 Statistical analysis of immunogold signals for wild-type 838

Synechocystis 6803 cells 839

Supplemental Table 4 Co-expression of curT 840

Supplemental Movie 1 Scan through the Z-axis of a curT-CFP cell 841

Supplemental Movie 2 Rendered 3D-model of a CurT-CFP detection 842

Supplemental Movie 3 Scan through the Z-axis of a curT-CFP cell with a traversing 843

thylakoid lamella 844

845

Acknowledgements 846

We thank Y Nishiyama for providing αpD1 and J Soll for αVIPP1 and αYidC antibodies 847

respectively and Nina Dyczmons-Nowaczyk for support with the fluorescence measurements 848

This work was supported by grants awarded to JN (Ni3909) MMN (NO 8363) and DL 849

26

(Le126529) by the Deutsche Forschungsgemeinschaft in the context of Research Unit 850

FOR2092 and the Cluster of Excellence RESOLV (EXC 1069) AG is a Howard Hughes 851

Medical Institute postdoctoral fellow in the laboratory of Erin OrsquoShea at Harvard University 852

LS was supported by a PhD fellowship from the Chinese Scholarship Council 853

854

Author Contributions 855

SH AR LS MMN DL and JN designed the research SH AR LS AG ILG EH ML BR 856

SV performed the research all authors contributed to data analysis SH AR and JN wrote the 857

paper 858

859

Competing Financial Interest statement 860

The authors declare no competing financial interests 861

862

We wish to dedicate this paper to Fabrice Rappaport an outstanding colleague and friend who 863

passed away so early 864

865

27

References 866

Allen JF de Paula WBM Puthiyaveetil S and Nield J (2011) A structural 867

phylogenetic map for chloroplast photosynthesis Trends Plant Sci 16 645-655 868

Anderson JM Horton P Kim E-H and Chow WS (2012) Towards elucidation of 869

dynamic structural changes of plant thylakoid architecture Philos Trans R Soc 870

Lond B Biol Sci 367 3515-3524 871

Armbruster U Zuumlhlke J Rengstl B Kreller R Makarenko E Ruumlhle T Schuumlnemann 872

D Jahns P Weisshaar B Nickelsen J and Leister D (2010) The Arabidopsis 873

thylakoid protein PAM68 is required for efficient D1 biogenesis and photosystem II 874

assembly Plant Cell 22 3439-3460 875

Armbruster U Labs M Pribil M Viola S Xu W Scharfenberg M Hertle AP 876

Rojahn U Jensen PE Rappaport F Joliot P Doumlrmann P Wanner G and 877

Leister D (2013) Arabidopsis CURVATURE THYLAKOID1 proteins modify 878

thylakoid architecture by inducing membrane curvature Plant Cell 25 2661-2678 879

Aseeva E Ossenbuumlhl F Sippel C Cho WK Stein B Eichacker LA Meurer J 880

Wanner G Westhoff P Soll J and Vothknecht UC (2007) Vipp1 is required for 881

basic thylakoid membrane formation but not for the assembly of thylakoid protein 882

complexes Plant Physiol Biochem 45 119-128 883

Bartsevich VV and Pakrasi HB (1995) Molecular identification of an ABC transporter 884

complex for manganese analysis of a cyanobacterial mutant strain impaired in the 885

photosynthetic oxygen evolution process EMBO J 14 1845-1853 886

Bartsevich VV and Pakrasi HB (1996) Manganese transport in the cyanobacterium 887

Synechocystis sp PCC 6803 J Biol Chem 271 26057-26061 888

Bernaacutet G Waschewski N and Roumlgner M (2009) Towards efficient hydrogen production 889

the impact of antenna size and external factors on electron transport dynamics in 890

Synechocystis PCC 6803 Photosynth Res 99 205-216 891

Boehm M Yu J Krynicka V Barker M Tichy M Komenda J Nixon PJ and Nield 892

J (2012) Subunit Organization of a Synechocystis Hetero-Oligomeric Thylakoid FtsH893

Complex Involved in Photosystem II Repair Plant Cell 24 3669-3683894

Bradford MM (1976) A rapid and sensitive method for the quantitation of microgram 895

quantities of protein utilizing the principle of protein-dye binding Anal Biochem 72 896

248-254897

28

Chang L Liu X Li Y Liu C-C Yang F Zhao J and Sui S-F (2015) Structural 898

organization of an intact phycobilisome and its association with photosystem II Cell 899

Res 25 726-737 900

Danielsson R Suorsa M Paakkarinen V Albertsson P-Aring Styring S Aro E-M and 901

Mamedov F (2006) Dimeric and monomeric organization of photosystem II 902

Distribution of five distinct complexes in the different domains of the thylakoid 903

membrane J Biol Chem 281 14241-14249 904

Daum B Nicastro D Austin J McIntosh JR and Kuumlhlbrandt W (2010) Arrangement 905

of photosystem II and ATP synthase in chloroplast membranes of Spinach and Pea 906

Plant Cell 22 1299-1312 907

Engel BD Schaffer M Kuhn Cuellar L Villa E Plitzko JM and Baumeister W 908

(2015) Native architecture of the Chlamydomonas chloroplast revealed by in situ 909

cryo-electron tomography eLife 4 e04889 910

Ford MGJ Mills IG Peter BJ Vallis Y Praefcke GJK Evans PR and McMahon 911

HT (2002) Curvature of clathrin-coated pits driven by epsin Nature 419 361-366 912

Fristedt R Willig A Granath P Cregravevecoeur M Rochaix J-D and Vener AV (2009) 913

Phosphorylation of photosystem II controls functional macroscopic folding of 914

photosynthetic membranes in Arabidopsis Plant Cell 21 3950-3964 915

Gallop JL and McMahon HT (2005) BAR domains and membrane curvature bringing 916

your curves to the BAR Biochem Soc Symp 72 223-231 917

Gibson DG (2011) Chapter fifteen - Enzymatic Assembly of Overlapping DNA Fragments 918

In Methods in Enzymology V Christopher ed (Academic Press) pp 349-361 919

Goedhart J von Stetten D Noirclerc-Savoye M Lelimousin M Joosen L Hink MA 920

van Weeren L Gadella TWJ and Royant A (2012) Structure-guided evolution of 921

cyan fluorescent proteins towards a quantum yield of 93 Nat Commun 3 751 922

Heinz S Liauw P Nickelsen J and Nowaczyk M (2016) Analysis of photosystem II 923

biogenesis in cyanobacteria Biochim Biophys Acta 1857 274-287 924

Hernaacutendez-Prieto M and Futschik M (2012) CyanoEXpress A web database for 925

exploration and visualisation of the integrated transcriptome of cyanobacterium 926

Synechocystis sp PCC6803 Bioinformation 8 634-638 927

Hernaacutendez-Prieto MA Semeniuk TA Giner-Lamia J and Futschik ME (2016) The 928

Transcriptional Landscape of the Photosynthetic Model Cyanobacterium 929

Synechocystis sp PCC6803 Sci Rep 6 22168 930

29

Huang F Fulda S Hagemann M and Norling B (2006) Proteomic screening of salt-931

stress-induced changes in plasma membranes of Synechocystis sp strain PCC 6803 932

Proteomics 6 910-920 933

Kirchhoff H (2013) Architectural switches in plant thylakoid membranes Photosynth Res 934

116 481-487 935

Klinkert B Elles I and Nickelsen J (2006) Translation of chloroplast psbD mRNA in 936

Chlamydomonas is controlled by a secondary RNA structure blocking the AUG start 937

codon Nucleic Acids Res 34 386-394 938

Klinkert B Ossenbuumlhl F Sikorski M Berry S Eichacker L and Nickelsen J (2004) 939

PratA a periplasmic tetratricopeptide repeat protein involved in biogenesis of 940

photosystem II in Synechocystis sp PCC 6803 J Biol Chem 279 44639-44644 941

Komenda J Nickelsen J Tichyacute M Praacutešil O Eichacker LA and Nixon PJ (2008) The 942

cyanobacterial homologue of HCF136YCF48 is a component of an early photosystem 943

II assembly complex and is important for both the efficient assembly and repair of 944

photosystem II in Synechocystis sp PCC 6803 J Biol Chem 283 22390-22399 945

Kopf M Klaumlhn S Scholz I Matthiessen JKF Hess WR and Voszlig B (2014) 946

Comparative analysis of the primary transcriptome of Synechocystis sp PCC 6803 947

DNA Res 21 527-539 948

Kunkel DD (1982) Thylakoid centers Structures associated with the cyanobacterial 949

photosynthetic membrane system Arch Microbiol 133 97-99 950

Liberton M Howard Berg R Heuser J Roth R and Pakrasi BH (2006) Ultrastructure 951

of the membrane systems in the unicellular cyanobacterium Synechocystis sp strain 952

PCC 6803 Protoplasma 227 129-138 953

Liberton M Saha R Jacobs JM Nguyen AY Gritsenko MA Smith RD 954

Koppenaal DW and Pakrasi HB (2016) Global Proteomic Analysis Reveals an 955

Exclusive Role of Thylakoid Membranes in Bioenergetics of a Model 956

Cyanobacterium Mol Cell Proteomics 15 2021-2032 957

Luque I and Ochoa de Alda JAG (2014) CURT1CAAD-containing aaRSs thylakoid 958

curvature and gene translation Trends Plant Sci 19 63-66 959

Marin K Stirnberg M Eisenhut M Kraumlmer R and Hagemann M (2006) Osmotic stress 960

in Synechocystis sp PCC 6803 low tolerance towards nonionic osmotic stress results 961

from lacking activation of glucosylglycerol accumulation Microbiology 152 2023-962

2030 963

Mullineaux CW (2005) Function and evolution of grana Trends Plant Sci 10 521-525 964

30

Mullineaux CW (2008) Biogenesis and dynamics of thylakoid membranes and the 965

photosynthetic apparatus In The Cyanobacteria A Herrero and E Flores eds 966

(Norfolk UK Caister Academic Press) pp 289ndash304 967

Nevo R Charuvi D Tsabari O and Reich Z (2012) Composition architecture and 968

dynamics of the photosynthetic apparatus in higher plants Plant J 70 157-176 969

Nickelsen J and Rengstl B (2013) Photosystem II assembly From cyanobacteria to plants 970

Annu Rev Plant Biol 64 609-635 971

Nickelsen J and Zerges W (2013) Thylakoid biogenesis has joined the new era of bacterial 972

cell biology Front Plant Sci 4 458 973

Nilsson F Simpson DJ Jansson C and Andersson B (1992) Ultrastructural and 974

biochemical characterization of a Synechocystis 6803 mutant with inactivated psbA 975

genes Arch Biochem Biophys 295 340-347 976

Odom WR Hodges R Chitnis PR and Guikema JA (1993) Characterization of 977

Synechocystis sp PCC 6803 in iron-supplied and iron-deficient media Plant Mol 978

Biol 23 1255-1264 979

Ossenbuumlhl F Inaba-Sulpice M Meurer J Soll J and Eichacker LA (2006) The 980

Synechocystis sp PCC 6803 Oxa1 homolog is essential for membrane integration of 981

reaction center precursor protein pD1 Plant Cell 18 2236-2246 982

Pisareva T Kwon J Oh J Kim S Ge C Wieslander Aring Choi J-S and Norling B 983

(2011) Model for Membrane Organization and Protein Sorting in the Cyanobacterium 984

Synechocystis sp PCC 6803 Inferred from Proteomics and Multivariate Sequence 985

Analyses J Proteome Res 10 3617-3631 986

Pribil M Labs M and Leister D (2014) Structure and dynamics of thylakoids in land 987

plants J Exp Bot 65 1955-1972 988

Rast A Heinz S and Nickelsen J (2015) Biogenesis of thylakoid membranes Biochim 989

Biophys Acta 1847 821-830 990

Rast A Rengstl B Heinz S Klingl A and Nickelsen J (2016) The role of Slr0151 a 991

tetratricopeptide repeat protein from Synechocystis sp PCC 6803 during Photosystem 992

II assembly and repair Front Plant Sci 7 605 993

Rengstl B Oster U Stengel A and Nickelsen J (2011) An Intermediate Membrane 994

Subfraction in Cyanobacteria Is Involved in an Assembly Network for Photosystem II 995

Biogenesis J Biol Chem 286 21944-21951 996

31

Rengstl B Knoppovaacute J Komenda J and Nickelsen J (2013) Characterization of a 997

Synechocystis double mutant lacking the photosystem II assembly factors YCF48 and 998

Sll0933 Planta 237 471-480 999

Rexroth S Mullineaux CW Ellinger D Sendtko E Roumlgner M and Koenig F (2011) 1000

The Plasma Membrane of the Cyanobacterium Gloeobacter violaceus Contains 1001

Segregated Bioenergetic Domains Plant Cell 23 2379-2390 1002

Rippka R Deruelles J Waterbury JB Herdman M and Stanier RY (1979) Generic 1003

Assignments Strain Histories and Properties of Pure Cultures of Cyanobacteria 1004

Microbiology 111 1-61 1005

Ruumltgers M and Schroda M (2013) A role of VIPP1 as a dynamic structure within 1006

thylakoid centers as sites of photosystem biogenesis Plant Signal Behav 8 e27037 1007

Sacharz J Bryan SJ Yu J Burroughs NJ Spence EM Nixon PJ and Mullineaux 1008

CW (2015) Sub-cellular location of FtsH proteases in the cyanobacterium1009

Synechocystis sp PCC 6803 suggests localised PSII repair zones in the thylakoid1010

membranes Mol Microbiol 96 448-4621011

Sandstroumlm S Park Y-I Oumlquist G and Gustafsson P (2001) CP43prime the isiA Gene 1012

Product Functions as an Excitation Energy Dissipator in the Cyanobacterium 1013

Synechococcus sp PCC 7942 Photochem Photobiol 74 431-437 1014

Schindelin J Arganda-Carreras I Frise E Kaynig V Longair M Pietzsch T 1015

Preibisch S Rueden C Saalfeld S Schmid B Tinevez J-Y White DJ 1016

Hartenstein V Eliceiri K Tomancak P and Cardona A (2012) Fiji an open-1017

source platform for biological-image analysis Nat Methods 9 676-682 1018

Schottkowski M Ratke J Oster U Nowaczyk M and Nickelsen J (2009a) Pitt a novel 1019

tetratricopeptide repeat protein involved in light-dependent chlorophyll biosynthesis 1020

and thylakoid membrane biogenesis in Synechocystis sp PCC 6803 Mol Plant 2 1021

1289-1297 1022

Schottkowski M Gkalympoudis S Tzekova N Stelljes C Schuumlnemann D Ankele E 1023

and Nickelsen J (2009b) Interaction of the periplasmic PratA factor and the PsbA 1024

(D1) protein during biogenesis of photosystem II in Synechocystis sp PCC 6803 J 1025

Biol Chem 284 1813-1819 1026

Selatildeo TT Zhang L Knoppovaaacute J Komenda J and Norling B (2016) Photosystem II 1027

Assembly Steps Take Place in the Thylakoid Membrane of the Cyanobacterium 1028

Synechocystis sp PCC6803 Plant Cell Physiol 57 878 1029

32

Spaumlt P Maček B and Forchhammer K (2015) Phosphoproteome of the cyanobacterium 1030

Synechocystis sp PCC 6803 and its dynamics during nitrogen starvation Front 1031

Microbiol 6 248 1032

Stengel A Guumlgel IL Hilger D Rengstl B Jung H and Nickelsen J (2012) Initial 1033

steps of photosystem II de novo assembly and preloading with manganese take place 1034

in biogenesis centers in Synechocystis Plant Cell 24 660-675 1035

Uniacke J and Zerges W (2007) Photosystem II assembly and repair are differentially 1036

localized in Chlamydomonas Plant Cell 19 3640-3654 1037

Uniacke J and Zerges W (2009) Chloroplast protein targeting involves localized 1038

translation in Chlamydomonas Proc Natl Acad Sci USA 106 1439-1444 1039

van de Meene AL Hohmann-Marriott M Vermaas WJ and Roberson R (2006) The 1040

three-dimensional structure of the cyanobacterium Synechocystis sp PCC 6803 Arch 1041

Microbiol 184 259-270 1042

van de Meene AML Sharp WP McDaniel JH Friedrich H Vermaas WFJ and 1043

Roberson RW (2012) Gross morphological changes in thylakoid membrane 1044

structure are associated with photosystem I deletion in Synechocystis sp PCC 6803 1045

Biochim Biophys Acta 1818 1427-1434 1046

Watanabe M and Ikeuchi M (2013) Phycobilisome architecture of a light-harvesting 1047

supercomplex Photosynth Res 116 265-276 1048

Wellburn AR and Lichtenthaler H (1984) Formulae and Program to Determine Total 1049

Carotenoids and Chlorophylls A and B of Leaf Extracts in Different Solvents In 1050

Advances in Photosynthesis Research Proceedings of the VIth International Congress 1051

on Photosynthesis Brussels Belgium August 1ndash6 1983 C Sybesma ed (Dordrecht 1052

Springer Netherlands) pp 9-12 1053

Wilde A Lunser K Ossenbuumlhl F Nickelsen J and Borner T (2001) Characterization of 1054

the cyanobacterial ycf37 mutation decreases the photosystem I content Biochem J 1055

357 211-216 1056

Wilson A Boulay C Wilde A Kerfeld CA and Kirilovsky D (2007) Light-Induced 1057

Energy Dissipation in Iron-Starved Cyanobacteria Roles of OCP and IsiA Proteins 1058

Plant Cell 19 656-672 1059

Xu M Bernaacutet G Singh A Mi H Roumlgner M Pakrasi HB and Ogawa T (2008) 1060

Properties of Mutants of Synechocystis sp Strain PCC 6803 Lacking Inorganic Carbon 1061

Sequestration Systems Plant Cell Physiol 49 1672-1677 1062

33

Yamamoto T Burke J Autz G and Jagendorf AT (1981) Bound ribosomes of Pea 1063

chloroplast thylakoid membranes location and release in vitro by high salt 1064

puromycin and RNase Plant Physiol 67 940-949 1065

Yang H Liao L Bo T Zhao L Sun X Lu X Norling B and Huang F (2014) 1066

Slr0151 in Synechocystis sp PCC 6803 is required for efficient repair of photosystem 1067

II under high-light condition J Integr Plant Biol 56 1136-1150 1068

Yeremenko N Kouřil R Ihalainen JA DHaene S van Oosterwijk N 1069

Andrizhiyevskaya EG Keegstra W Dekker HL Hagemann M Boekema EJ 1070

Matthijs HCP and Dekker JP (2004) Supramolecular Organization and Dual 1071

Function of the IsiA Chlorophyll-Binding Protein in Cyanobacteria Biochemistry 43 1072

10308-10313 1073

Zak E Norling B Maitra R Huang F Andersson B and Pakrasi HB (2001) The 1074

initial steps of biogenesis of cyanobacterial photosystems occur in plasma membranes 1075

Proc Natl Acad Sci USA 98 13443-13448 1076

Zang X Liu B Liu S Arunakumara KKIU and Zhang X (2007) Optimum 1077

Conditions for Transformation of Synechocystis sp PCC 6803 J Microbiol 45 241-1078

245 1079

Zhang L and Sakamoto W (2015) Possible function of VIPP1 in maintaining chloroplast 1080

membranes Biochim Biophys Acta 1847 831-837 1081

Zimmerberg J and Kozlov MM (2006) How proteins produce cellular membrane 1082

curvature Nat Rev Mol Cell Biol 7 9-19 1083

Zoumlfel P (1988) Statistik in der Praxis (Stuttgart Germany Gustav Fischer Verlag) 1084

1085

34

Figure Legends 1086

Figure 1 General characteristics of CurT A) Sequence alignment of CurT and CURT1A-D 1087

from A thaliana Predicted chloroplast transit-peptide sequences of CURT1A-D are omitted 1088

(Armbruster et al 2013) Positions of predicted C-terminal transmembrane domains (TDM) 1089

are marked (black bar) as is the position of the predicted amphipathic N-terminal helix in 1090

CurT (red bar) The green bar denotes the peptide sequence used for antibody production 1091

Identical and related amino acids that are conserved in 100 80 and 60 of the sequences 1092

are highlighted in black dark grey and light grey respectively B) Helical-wheel 1093

representation of the N-terminal amphipathic helix of CurT (red bar in A) The color code 1094

reflects the physicochemical properties of amino-acid side-chains green polar and 1095

uncharged blue polar and positively charged red polar and negatively charged yellow 1096

hydrophobic C) Solubility of CurT Membrane-associated proteins (50 microg) from wild-type 1097

cells were extracted with 5 mM HEPES (pH 76) containing either 1 M NaCl 01 M Na2CO3 1098

4 M urea 01 Triton X-100 or no additional solute After separation of membrane-bound 1099

(M) and solubilized (S) proteins by centrifugation proteins were fractionated by SDS-PAGE1100

and CurT was immunodetected on immunoblots As a control the integral membrane protein 1101

CP47 from PSII was analyzed in parallel D) Transmission electron micrographs of negatively 1102

stained liposomes Cell-free expression (CFE) of CurT and A thaliana CURT1A was 1103

performed in the presence of liposomes similar in composition to the lipids of the thylakoid 1104

membrane Liposomes before and after cell-free protein expression in the absence of DNA 1105

served as negative controls Black arrowheads indicate tubular connections between 1106

liposomes Scale bars 250 nm 1107

1108

Figure 2 Ultrastructural analysis of curT- cells Transmission electron micrographs of typical 1109

wild-type (A) and curT- (B-D) Synechocystis 6803 cells taken at 44000times (A B) and 28000times 1110

(C D) magnification respectively Ultrathin sections (35 to 45 nm) of cryofixed samples 1111

were stained with osmium tetroxide and post-stained using lead citrate Arrowheads indicate 1112

biogenesis centers Scale bars 200 nm (A B) and 500 nm (C D) respectively 1113

1114

Figure 3 Accumulation of components of photosynthetic complexes in the curT- mutant A) 1115

Whole cell extracts (30 microg protein) from wild-type and curT- strains were fractionated by 1116

SDS-PAGE and analyzed on immunoblots using the indicated antibodies B) The histogram 1117

shows levels of the indicated proteins in curT- extracts relative to wild-type samples (dashed 1118

red line) Data are means plusmn SD of three independent experiments Significant differences from 1119

35

wild-type protein levels according to Studentrsquos t-test with error probabilities of 5 and 1 1120

are indicated by and respectively 1121

1122

Figure 4 P700+ reduction kinetics and high-light effects in curT- cells A) Averaged traces 1123

(10 single measurements) of P700+ decay after complete oxidation by a 50-ms multiple 1124

turnover pulse (10000 micromol photons m-2 s-1) in the absence and presence of 10 microM DCMU 1125

B) Rate constants for P700+ reduction were obtained by fitting of the data with single1126

exponential functions Error bars indicate the SD of three independent measurements C) 1127

Impact of light intensity on the (relative) electron transport rate (rETR) Cells were exposed to 1128

gradually increasing light intensities which resulted in increasing electron transport until the 1129

capacity limit was reached PAR light intensity (micromol photons m-2 s-1) Error bars indicate the 1130

SD of three independent measurements D) D1 protein level in wild-type and curT- after high-1131

light treatment (800 micromol photons m-2s-1) in the presence and absence of lincomycin Samples 1132

were taken every 30 min and processed as in Figure 3 to determine the level of D1 present 1133

100 refers to wild-type D1 level at the beginning of the experiment 1134

1135

Figure 5 PSII assembly in curT- cells A) BNSDS-PAGE of membrane proteins Membrane 1136

fractions from wild-type and curT- cells were solubilized with 13 n-dodecyl-β-maltoside 1137

and proteins were fractionated by two-dimensional BNSDS-PAGE blotted and probed with 1138

antibodies against the PSII subunits D1 D2 CP47 and CP43 Wild-type blots were also 1139

probed with the αCurT antibody The sizes of marker proteins and the positions of PSII 1140

assembly intermediates (RCCII RCCI RC47) are shown above and below each image B) In 1141

vivo pulse labeling of membrane proteins with 35S Pulse-labeled PSII core proteins were 1142

separated via BNSDS-PAGE and visualized by autoradiography 1143

1144

Figure 6 Loss of CurT induces stress A) Low-temperature (77 K) fluorescence emission of 1145

Synechocystis 6803 wild-type (blue) and curT- (red) cells excited at 440 nm The spectra were 1146

normalized to the added fluorescein standard B) Low-temperature (77 K) fluorescence 1147

emission of Synechocystis 6803 wild-type (blue) and curT- (red) excited at 580 nm The 1148

spectra were normalized to 780 nm C) Level of IsiA in the curT- mutant relative to the wild-1149

type A mean value of 368 plusmn 96 (SD) was determined from three independent experiments 1150

1151

Figure 7 Membrane sublocalization of PSII-related factors Cell extracts from wild-type and 1152

curT- cells were fractionated by two consecutive rounds of sucrose-density gradient 1153

36

centrifugation (Schottkowski et al 2009b) The second linear gradient (20-60 sucrose) was 1154

apportioned into 14 fractions which were analyzed by immunoblotting using the indicated 1155

antibodies Fractions 1ndash6 represent PDMs and fractions 7ndash14 thylakoid membranes (TMs) 1156

To facilitate comparison between gradients sample volumes were normalized to the volume 1157

of fraction 7 that contained 40 microg of protein 1158

1159

Figure 8 Live-cell imaging of the curT-CFP strain by fluorescence microscopy In the curT-1160

CFP strain the native curT gene has been replaced by a CFP-tagged version resulting in the 1161

expression of the CurT-CFP fusion protein under the control of the native promotor A) 1162

Close-up views of the mid-cell plane in the CFP and far-red autofluorescence channels shown 1163

in slice 7 in panel B B) Synechocystis 6803 cells expressing CurT C-terminally fused to the 1164

mTurquoise2 variant of CFP from its native chromosomal promoter The two imaging 1165

channels are displayed as Z-axis montages (auto-scaled contrast step size 250 nm) in 1166

grayscale and color composite configuration The thylakoid autofluorescent channel as 1167

imaged in far-red fluorescence is depicted in magenta and CurT signal as imaged in cyan 1168

fluorescence is depicted in cyan C) Fluorescence intensity profiles of the two channels along 1169

the autofluorescent peripheral cell ldquoringrdquo are shown for slice 7 The maximum projection of 1170

the entire Z montage is also shown Scale bars (light grey) 2 microm 1171

1172

Figure 9 Immunofluorescence detection of CurT A) Close-ups of slice 5 in panel B B) 1173

Wild-type Synechocystis 6803 cells labeled with αCurT antibodies and detected with Oregon 1174

Green-conjugated secondary antibodies The Z-axis montages are shown as in Figure 8B 1175

except that the step size is 280 nm (1 to 10) C) Intensity profiles of the two channels along 1176

the autofluorescent peripheral cell ldquoringrdquo are shown for slice 5 The maximum projection of 1177

the entire Z montage is also shown Scale bars (light grey) 2 microm 1178

1179

Figure 10 Subcellular localization of CurT Ultrathin sections of wild-type Synechocystis 1180

6803 cells were incubated with rabbit αCurT prior to incubation with gold-conjugated goat 1181

anti-rabbit IgG A) Negative control (wild-type processed without addition of primary 1182

antibody) B C) Immunogold-labeled sections showing CurT localization at the cytoplasmic 1183

side of the thylakoid membrane D) Cluster formation of CurT signals at a putative biogenesis 1184

center from C E) Biogenesis center from the same cell (C) without any obvious CurT 1185

clustering of gold particles F) Schematic depiction of a wild-type cell (from Figure 2A) with 1186

color-coded curved membranes green = thylakoids that follow the curvature of the cell red = 1187

37

thylakoids that bend away from the plasma membrane yellow = thylakoids that bend toward 1188

the plasma membrane to converge on sites of biogenesis centers G) Relative distribution of 1189

gold signals between convex (dark color) and concave (light color) sides of membranes (n = 1190

1584 signals from a total of 95 cells) The undifferentiated overall signal distribution is given 1191

in blue Bars = 200 nm (overview) and 100 nm (details) 1192

1193

Figure 11 Differentially modified forms of CurT are found in different complexes in PDMs 1194

and thylakoid membranes Samples were isolated by fractionation of wild-type membranes 1195

via two consecutive sucrose density gradients according to Schottkowski et al (2009b) After 1196

density centrifugation samples were applied to BNSDS-PAGE analysis (A) or isoelectric 1197

focusing (B) Numbers on the right indicate the respective fraction from the second gradient 1198

(see Figure 7) Fraction 5 represents the PDMs and fraction 9 the thylakoid membrane 1199

1200

Figure 12 Loss of CurT increases sensitivity to abiotic stress A B) Doubling times of wild-1201

type and curT- under salt stress (A) or osmotic stress (B) Doubling times are means plusmn SD of 1202

three independent cultures C) Localization of CurT-CFP under salt and osmotic stress 1203

Samples were examined as described in Figure 8 Scale bars 1 microm D) Protein levels of wild-1204

type cells after growth in BG11 medium containing 500 mM NaCl Samples were analyzed on 1205

the same gel but unrelated samples between the presented signals were omitted E) 1206

Membrane preparations obtained from wild-type cells wild-type cells grown in the presence 1207

of 500 mM NaCl and curT- cells were subjected to the first gradient step in the membrane 1208

fractionation scheme The gradient was divided into five fractions and 10 of fractions I-IV 1209

and 02 of fraction V were analyzed by SDS-PAGE Fraction II includes the plasma 1210

membrane and fraction V consists of PratA-defined membrane and thylakoid membrane 1211

1212

Figure 13 Model of CurT distribution at convergence zones in Synechocystis 6803 The 1213

distribution of CurT in thylakoid (green) and plasma membranes (brown) is shown The 1214

pattern of localization of CurT in the thylakoid membrane is derived from membrane 1215

fractionation via sucrose density centrifugation fluorescence-based detection of the CurT-1216

CFP fusion and endogenous CurT and immunogold labeling experiments (Figures 7-10) The 1217

different CurT variants a b c and d identified in the IEF experiments (Figure 11) are depicted 1218

in yellow pink blue and black respectively CurT present in the plasma membrane is 1219

highlighted in gray as its precise nature and role remain to be defined (Figure 12) 1220

Membranes are represented as lipid bilayers Convex and concave faces of bent thylakoid 1221

38

sheets are indicated by black arrows The PDM which is dedicated to PSII assembly and 1222

repair is depicted in blue The dotted blue line emphasizes that the ultrastructure in this region 1223

has not yet been fully resolved PP periplasm PM plasma membrane TM thylakoid 1224

membrane L lumen PDM PratA-defined membrane 1225

1226

Tables 1227

Table 1 Physiological characteristics of the curT- mutant 1228

Strain Doubling time [h]

Oxygen Evolution[nmol h-1 OD750

-1]c

Chlorophyll content

[microg OD750-1]

d

Cell size [microm]e

Cell number [ml-1 OD750

-1]f

Wild type 817plusmn017a 1600plusmn042

b 1933plusmn187 251plusmn014 264plusmn020 390plusmn006 x 107

curT- 1259plusmn020a 3226plusmn056

b 1074plusmn20 195plusmn029 274plusmn044 367plusmn016 x 107

1229 abDoubling times in the presence (a) or absence (b) of 5 mM glucose measured under 1230

continuous illumination at 30 micromol photons m-2 s-1 and CO2-limiting conditions cOxygen 1231

evolution is expressed in nmol O2 produced per hour per OD750 unit dChlorophyll content is 1232

expressed in microg OD750-1 eThe diameter of non-dividing cells is presented in microm fCell number 1233

was determined per ml per OD750 Data are means plusmn SD of at least three independent 1234

experiments 1235

1236

Parsed CitationsAllen JF de Paula WBM Puthiyaveetil S and Nield J (2011) A structural phylogenetic map for chloroplast photosynthesisTrends Plant Sci 16 645-655

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Anderson JM Horton P Kim E-H and Chow WS (2012) Towards elucidation of dynamic structural changes of plant thylakoidarchitecture Philos Trans R Soc Lond B Biol Sci 367 3515-3524

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Armbruster U Zuumlhlke J Rengstl B Kreller R Makarenko E Ruumlhle T Schuumlnemann D Jahns P Weisshaar B NickelsenJ and Leister D (2010) The Arabidopsis thylakoid protein PAM68 is required for efficient D1 biogenesis and photosystem IIassembly Plant Cell 22 3439-3460

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Armbruster U Labs M Pribil M Viola S Xu W Scharfenberg M Hertle AP Rojahn U Jensen PE Rappaport F JoliotP Doumlrmann P Wanner G and Leister D (2013) Arabidopsis CURVATURE THYLAKOID1 proteins modify thylakoid architectureby inducing membrane curvature Plant Cell 25 2661-2678

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Aseeva E Ossenbuumlhl F Sippel C Cho WK Stein B Eichacker LA Meurer J Wanner G Westhoff P Soll J andVothknecht UC (2007) Vipp1 is required for basic thylakoid membrane formation but not for the assembly of thylakoid proteincomplexes Plant Physiol Biochem 45 119-128

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Bartsevich VV and Pakrasi HB (1995) Molecular identification of an ABC transporter complex for manganese analysis of acyanobacterial mutant strain impaired in the photosynthetic oxygen evolution process EMBO J 14 1845-1853

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Bartsevich VV and Pakrasi HB (1996) Manganese transport in the cyanobacterium Synechocystis sp PCC 6803 J Biol Chem271 26057-26061

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Bernaacutet G Waschewski N and Roumlgner M (2009) Towards efficient hydrogen production the impact of antenna size andexternal factors on electron transport dynamics in Synechocystis PCC 6803 Photosynth Res 99 205-216

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Boehm M Yu J Krynicka V Barker M Tichy M Komenda J Nixon PJ and Nield J (2012) Subunit Organization of aSynechocystis Hetero-Oligomeric Thylakoid FtsH Complex Involved in Photosystem II Repair Plant Cell 24 3669-3683

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Bradford MM (1976) A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle ofprotein-dye binding Anal Biochem 72 248-254

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Chang L Liu X Li Y Liu C-C Yang F Zhao J and Sui S-F (2015) Structural organization of an intact phycobilisome and itsassociation with photosystem II Cell Res 25 726-737

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Danielsson R Suorsa M Paakkarinen V Albertsson P-Aring Styring S Aro E-M and Mamedov F (2006) Dimeric andmonomeric organization of photosystem II Distribution of five distinct complexes in the different domains of the thylakoidmembrane J Biol Chem 281 14241-14249

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Daum B Nicastro D Austin J McIntosh JR and Kuumlhlbrandt W (2010) Arrangement of photosystem II and ATP synthase in

8

The data presented so far suggest a PSII-related phenotype for curT- so we explored 245

the effects of curT disruption on photosynthesis further by comparing the low-temperature 246

(77K) fluorescence emission spectra in cell suspensions following excitation of chlorophyll at 247

440 nm (Figure 6A) The signals were normalized to the emission maximum at 514 nm of the 248

external standard fluorescein (Figure 6A) In curT- the PSI emission peak amplitude was 249

similar to that of the wild-type (Figure 6A) The spectra differed however around 685 nm 250

Here we observed an increase in fluorescence in the mutant strain an emission signature that 251

is probably related to the inner antenna protein CP43 (Figure 6A Nilsson et al 1992) 252

Increased chlorophyll fluorescence at 685 nm has previously been shown to be characteristic 253

for cells that are accumulating the stress-induced IsiA protein which shares structural 254

similarities with CP43 (Odom et al 1993 Yeremenko et al 2004 Wilson et al 2007) A 255

second indication for accumulation of IsiA is a diagnostic blue shift of the 725 nm 256

fluorescence peak by approximately 5 nm which is indeed observed in the curT- spectrum 257

(Figure 6A Sandstroumlm et al 2001) We therefore determined the level of IsiA in both wild-258

type and curT- by immunoblot analysis As expected IsiA was strongly induced in curT- 259

suggesting that the mutant suffers from severe stress (Figure 6C) When fluorescence at 77K 260

was recorded after excitation at 580 nm which mainly excites the phycobiliproteins the 261

signal at 685 nm (PSII related) was enhanced in the curT- mutant most likely reflecting IsiA 262

emission andor the presence of uncoupled phycobilisomes (Figure 6B Wilson et al 2007) 263

In contrast the 725 nm peak (PSI related) was reduced in curT- relative to the wild-type 264

suggesting less coupling of phycobilisomes to PSI (Figure 6B) The increase in uncoupled 265

phycobilisomes can be directly attributed to the reduction in RCCII levels found in the curT- 266

mutant (Figure 5A) since phycobilisomes are attached to PSII dimers for efficient light 267

harvesting (Watanabe and Ikeuchi 2013 Chang et al 2015) 268

Thus the curT- mutant exhibits a characteristic set of photosynthetic defects The 269

primary target of the CurT membrane-shaping function appears to be PSII in particular in its 270

biogenic phase However the reduction in PSII content cannot be responsible for the lack of 271

thylakoid convergence zones at the plasma membrane because these structures can still be 272

observed in the psbA- mutant TD41 which is lacking D1 and therefore unable to assemble any 273

PSII complexes (Supplemental Figure 6 Nilsson et al 1992) 274

275

Subcellular localization of CurT 276

We have previously proposed that the initial steps in PSII assembly take place in 277

biogenesis centers located at the interface between plasma and thylakoid membranes (Stengel 278

9

et al 2012) These biogenic membranes (PDMs) are marked by the PSII Mn2+ delivery factor 279

PratA and can be separated from thylakoids by a two-step sucrose-gradient centrifugation 280

procedure (Schottkowski et al 2009b Rengstl et al 2011) When the distributions of various 281

proteins within such membrane fractions from the wild-type and curT- were compared two 282

striking changes were detected in the mutant First the precursor of the D1 subunit of PSII 283

(pD1) is absent from PDMs in the mutant and secondly the inner antenna protein CP47 ndash but 284

not CP43 ndash of PSII shifts towards fractions of lower density (Figure 7) Hence the 285

organization of PDMs appears to be perturbed in curT- In wild-type cells most of the CurT 286

protein was found in thylakoid membranes only a minor fraction similar in amount to that of 287

the PSII assembly factors Ycf48 Pitt and YidC as well as the VIPP1 protein comigrated with 288

PDMs (Figure 7) According to rough estimates based on densitometric signal analysis 25 289

of total cellular CurT is normally found in the PDMs and 75 in the thylakoids (Figure 7) 290

To further analyze the localization of CurT in its cellular context in vivo we 291

constructed a translational fusion in which the monomeric enhanced cyan fluorescent protein 292

(CFP) mTurquoise2 (Goedhart et al 2012) is attached to the C-terminus of CurT and is 293

expressed under the control of the native curT promoter The resulting strain curT-CFP 294

showed a fully restored wild-type growth phenotype indicating that the CFP tag does not 295

affect CurTrsquos function (Supplemental Figure 7A) In agreement with this the fusion protein 296

accumulated to wild-type levels (96 plusmn 16 Supplemental Figure 7B) and localized to the 297

same membrane sub-fractions as does native CurT (Supplemental Figure 7C) The CurT-CFP 298

fluorescence signal was distinctly discernible above the wild-type autofluorescence 299

background (Supplemental Figure 8A) and was distributed in a network-like pattern with 300

concentrated areas at the cell periphery at mid-plane Analysis of CurT-CFP fluorescence in 301

Z-axis montages revealed that these signals often appeared as rod-like structures which 302

seemed to follow the spherical inner surface of the cell (Figure 8A B Supplemental Movie 1 303

and 2) In some cases these structures also appear to extend through the cytoplasm (Figure 304

8A and 8B Supplemental Movie 3) 305

When chlorophyll autofluorescence indicative of thylakoid membranes was visualized 306

in the same cell only a partial overlap with the CurT-CFP signal was observed (Figure 8 307

Supplemental Movie 1-3) Strikingly the peripheral CurT-CFP signals frequently reached 308

their maximal intensity in those areas where chlorophyll fluorescence was low ie where 309

thylakoid convergence zones are expected to form (Sacharz et al 2015) This becomes even 310

clearer when the intensity of a circumferential profile that follows the thylakoidrsquos 311

10

fluorescence signal is quantified separately for each of the two fluorescent channels (Figure 312

8C) 313

In contrast the chlorophyll autofluorescence in the curT- mutant seems to be evenly 314

distributed (Supplemental Figure 9) Following the fluorescence in an intensity profile as in 315

curT-CFP no regions with a similar decline in fluorescence were found most likely due to 316

the absence of biogenesis centers In addition some circular structures presenting chlorophyll 317

autofluorescence were detected in the interior of the cells Hence the disturbed curT- 318

ultrastructure is also reflected in the distribution of chlorophyll pigments (Supplemental 319

Figure 9) 320

To confirm the network-like distribution of CurT-CFP in the cell we used 321

immunofluorescence to detect CurT in the wild-type in situ Synechocystis 6803 cells were 322

fixed and treated with the αCurT antibody and an Oregon Green-conjugated secondary 323

antibody As shown in Figure 9A and B both techniques revealed similar network-like 324

patterns of the CurT signal which coalesced into rod-like structures at the cell surface and 325

essentially filled up the gaps between the autofluorescent thylakoid regions (negative controls 326

shown in Supplemental Figure 8B and 8C) Again regions of low chlorophyll fluorescence 327

typical of biogenesis centers generally exhibited stronger CurT-related fluorescence (Figure 328

8C) Occasionally CurT-CFP signals were also observed near traversing thylakoid lamellae 329

(when these were present in the cell analyzed) but the autofluorescence intensity of such 330

thylakoids is much weaker (see Figure 8B cell b in slice 6 and Supplemental Movie 3) 331

Finally CurT was localized by immunogold labeling experiments on ultrathin sections 332

of wild-type Synechocystis 6803 cells Almost no signals were detected when wild-type and 333

curT- sections were processed in the absence of the primary antibody as a negative control 334

(Figure 10A and Supplemental Figure 10A respectively) When mutant curT- cells were 335

processed in the presence of the αCurT antiserum a low level of randomly distributed 336

background signals was observed (Supplemental Figure 10B Supplemental Table 1) 337

However the number of signals located at the thylakoid membrane was clearly reduced 338

relative to the wild-type Therefore these signals were treated as non-specific background 339

Upon incubation of wild-type cell sections with antibodies directed against the N-terminus of 340

CurT (Figure 1A) the antigen was detected on the cytoplasmic surface of thylakoid 341

membranes (Figure 10B and 10C) This strongly suggests that its N-terminus is oriented 342

towards the cytoplasm Overall CurT signals appeared to be distributed along both thylakoids 343

and PDMs This agrees with the broad distribution of CurT across various fractions in the 344

membrane fractionation experiments (Figure 7) In only a few cases (12 ) however was 345

11

some clustering of immunogold signals at thylakoid convergence regions found (Figure 10D 346

and 10E) Thus the high local concentration of CurT at biogenic centers seen in the 347

fluorescence-based approaches (Figures 8 and 9) was not quantitatively reflected in the 348

immunogold labeling data This is likely due to the fact that immunogold electron microscopy 349

can only detect antigens on the surface of the section This issue is further complicated by the 350

heterogeneity of the CurT assemblies (see below and Discussion section) 351

Nevertheless closer inspection of the immunogold signals revealed an asymmetric 352

distribution of CurT signals with regard to the two faces of thylakoid sheets As illustrated in 353

Figure 10G curved thylakoid sheets possess a longer convex and a shorter concave face 354

When we analyzed a total of approximately 1500 CurT immunogold signals (from a total of 355

95 cells) which were unambiguously located to one side of the thylakoid membrane (for a 356

representative example see Supplemental Figure 11) 561 were found to be located at the 357

convex face while the other 439 localized to the concave side (Figure 10G Supplemental 358

Table 2) When differently curved regions (Figure 10F) including thylakoid lamellae (i) that 359

follow the overall shape of the cell (green) (ii) bend away from the plasma membrane (red) or 360

(iii) towards it ie where thylakoids converge to form biogenesis centers (yellow) were 361

examined separately red and green regions showed a CurT distribution in the range of 55 362

convex to 45 concave (Figure 10G Supplemental Table 2) However at the biogenesis 363

centers (the regions highlighted in yellow in Figure 10F) the uneven distribution of the 364

immunogold signals was more pronounced 61 of signals were found on the convex side 365

and 39 on the concave face of thylakoid lamellae (Figure 10G Supplemental Table 2) 366

Statistical analyses confirmed the significance of these differences in signal distributions 367

along the thylakoid membrane types (Supplemental Table 3) 368

Taken together with the finding that CurT is required for the formation of the 369

convergence sites forming biogenesis centers these data are consistent with the idea that the 370

thylakoid sheets are shaped by CurT which induces membrane curvature via asymmetric 371

intercalation on the two sides of thylakoid sheet 372

373

Different forms of CurT are found in PDMs and thylakoids 374

CurT was found to localize to both highly curved PDMs and less bent thylakoids Its 375

high local concentration at biogenic centers as seen in the fluorescence-based approaches 376

suggests a dosage-dependent effect of CurT on membrane shaping An alternative possibility 377

is that different CurT variants might exist in the two membrane types which could potentially 378

serve different functions To explore this possibility we asked whether CurT is found in 379

12

different complexes by using 2D BNSDS-PAGE to characterize membrane material isolated 380

via two-step sucrose gradient centrifugation (see Figure 7) In accordance with the data in 381

Figure 5A we find several low-molecular-weight complexes containing CurT (Figure 11A) 382

Smaller complexes of ~80 (complex I) and ~100 kDa (complex II) accumulate in membrane 383

fraction 5 (representing PDMs) but these are far less prevalent in fraction 9 representing 384

thylakoids (Figure 11A) In addition CurT-containing sub-complexes of ~140 (complex III) 385

and ~200 kDa (complex IV) are more prominently represented in thylakoids together with 386

even larger complexes ranging up to 670 kDa (Figure 11A) 387

Even more strikingly PDMs and thylakoids also differ with respect to the forms of 388

CurT they contain Thus isoelectric focusing (IEF) analysis of both membrane fractions 389

revealed at least four different CurT isoforms (a-d Figure 11B) PDMs contain mainly forms 390

b and d as well as trace amounts of a while thylakoids apparently possess very low levels of 391

form d and accumulate forms a b and c (Figure 11B) The nature of the underlying CurT 392

modifications still has to be determined Interestingly however CurT has recently been 393

identified as a phosphoprotein in a proteomic study (Spaumlt et al 2015) and the CurT variants 394

in Figure 11B may differ in their phosphorylation states At all events PDMs and thylakoids 395

can be distinguished by their complement of CurT isoforms which potentially play a role in 396

formation of the CurT sub-complexes that define the two membrane fractions 397

398

CurT is involved in the osmotic stress response 399

To further explore the stress-related role of CurT (Figure 6) and its link to IsiA 400

induction the effect of other potential stressors on curT- cells was tested High light levels had 401

a minor effect on curT- growth and its photosynthetic performance (Figure 4 Supplemental 402

Figure 5 and section above) suggesting that other environmental factors induced isiA 403

expression Our search was also motivated by a previous proteomic survey of plasma 404

membrane proteins of Synechocystis 6803 in high salt conditions in which CurT and VIPP1 405

were found among the most highly induced targets (Huang et al 2006) First we cultured 406

wild-type and curT- cells in different salt concentrations and found that growth of curT- was 407

severely affected in high salt (Figure 12A) Wild-type cells were only slightly affected by the 408

addition of salt to the medium The deleterious effect of the loss of curT on growth was even 409

more pronounced when maltose an osmotically active compound was present in the medium 410

(Figure 12B) Indeed curT- cells failed to survive exposure to 150 mM maltose whereas 411

growth of the wild-type was only slightly compromised These findings assign an additional 412

function to CurT ie a protective role during osmotic stress 413

13

When the curT-CFP strain was analyzed under these stress conditions enhanced 414

accumulation of CurT at the cell periphery was found mostly outside the autofluorescent 415

thylakoids and consistent with accumulation at the plasma membrane (Figure 12C) This was 416

further substantiated by membrane fractionation experiments which also revealed an 417

increased relative abundance of CurT in the plasma membrane fraction in the first sucrose 418

gradient (Figure 12E) Determination of total cellular CurT levels demonstrated that its 419

absolute amount did not increase under stress (Figure 12D) Therefore its higher abundance 420

in the plasma membrane under osmotic stress is likely to be due to CurT trafficking towards 421

the plasma membrane instead of increased synthesis 422

The same appears to hold true for VIPP1 which has been implicated in membrane 423

maintenance in both cyanobacteria and chloroplasts (Zhang and Sakamoto 2015) At stress 424

conditions an increase of the VIPP1 signal in the plasma membrane can be monitored in 425

wild-type (Figure 12E) However enhanced accumulation of VIPP1 in plasma membranes is 426

unaffected in the curT- mutant suggesting that thylakoid convergence zones are not strictly 427

required for the localization of VIPP1 428

429

Discussion 430

CurT determines thylakoid architecture 431

This study demonstrates that the protein CurT a homolog of the grana-forming 432

CURT1 proteins in plants is essential for establishing the proper thylakoid membrane 433

architecture in the cyanobacterium Synechocystis 6803 In particular CurTrsquos membrane-434

bending activity is likely to be required for the formation of thylakoid biogenesis centers at 435

points on the cell periphery where thylakoids converge towards the plasma membrane Here 436

PratA-mediated preloading of early PSII assembly intermediates with Mn2+ ions has been 437

proposed to take place together with PSII repair (Stengel et al 2012 Sacharz et al 2015) 438

This idea is supported by the following lines of evidence (i) The curT- mutant is devoid of 439

any thylakoid sectors that have convergence zones at their distal ends instead thylakoid 440

membranes are displaced and disposed as disordered or continuous rings (ii) CurT similarly 441

to CURT1A possesses a membrane-curving activity in vitro and intercalates asymmetrically 442

into thylakoids (iii) A high local concentration of CurT is observed at regions of high 443

curvature where biogenesis centers are found (iv) Lack of CurT affects the formation and 444

accumulation of PSII complexes as well as the abundance of some of its assembly factors 445

The drastic effects of CurT inactivation indicate an important role for this factor in membrane 446

shaping In contrast to the situation for CURT1A from Arabidopsis attempts to stably 447

14

overexpress CurT in Synechocystis 6803 failed Although short-lived transient increases in 448

CurT levels were observed when curT was expressed via strong heterologous promoters 449

wild-type levels of the protein were restored during subsequent rounds of cultivation of 450

transgenic lines Apparently Synechocystis 6803 cells do not tolerate substantial alterations in 451

CurT dosage and counter-select against these 452

This is in agreement with a dosage-dependent membrane-curving activity of CurT 453

which is suggested by its high local concentration at the edges of thylakoid autofluorescent 454

regions which mark the sites of the highly curved thylakoid convergence zones (Figures 8 9 455

and 13 Supplemental Movie 1 2 and 3) In addition some CurT was detected in structures 456

extending through the cytoplasm which most likely represent thylakoid sheets traversing the 457

cell from one thylakoid convergence zone to another (Figures 2A and 8) CurT might be 458

involved in the formation and stabilization of these structures 459

Members of the CURT1 family contain an N-terminal amphipathic α-helix that may 460

be involved in the membrane-bending activity of CurT (Armbruster et al 2013) Several 461

eukaryotic membrane-shaping proteins possess amphipathic helices as part of either an ENTH 462

(epsin N-terminal homology) or an N-BAR (Bin amphiphysin Rvs with N-terminal 463

amphipathic helix) domain (Ford et al 2002 Gallop and McMahon 2005 Zimmerberg and 464

Kozlov 2006) ENTH and N-BAR domains are rather large (~200 amino acids) and it has 465

been shown that amphipatic helices present in those domains insert into one leaflet of the lipid 466

bilayer and thereby induce curvature of the membrane (reviewed by Gallop and McMahon 467

2005 Zimmerberg and Kozlov 2006) However CurT itself is a small protein (149 amino 468

acids) that contains two transmembrane domains which insert into both leaflets of the lipid 469

bilayer (Figure 1A) as already suggested by Armbruster et al (2013) The amphipathic helix 470

faces the cytoplasm in Synechocystis 6803 or the stroma in A thaliana and most likely it 471

fine-tunes the degree of membrane bending mediated by CurT (Armbruster et al 2013) 472

In addition the increase in curvature correlated with CurT accumulation at convex 473

sides of thylakoid lamella (Figure 10 and 13) Hence curving might be mediated by 474

asymmetric integration of CurT into the lipid bilayers forming opposite faces of thylakoid 475

membrane sheets (Figure 13) However the mechanism causing this asymmetry remains 476

elusive 477

The presence of different CurT isoforms and complexes in PDMs and thylakoids adds 478

a further level of complexity and most likely reflects the dynamic regulation of this system 479

(Figure 11) The formation of different complexes might be primed by the phosphorylation of 480

CurT within its N-terminal cytoplasmic part (Spaumlt et al 2015) It seems likely that these 481

15

complexes play distinct roles in mediating the different CurT functions ie membrane 482

bending and maintenance 483

However it remains to be seen how exactly curvature is established maintained and 484

fine-tuned In addition other determinants of membrane topology and their putative interplay 485

with CurT have to be considered eg lipid and protein (complex) composition of 486

membranes cellular turgor pressure and other factors required for membrane 487

biogenesismaintenance eg the VIPP1 protein before precise molecular models of CurTrsquos 488

mode of action can be constructed (Rast et al 2015 and see below) That these other factors 489

can be crucial for membrane architecture is documented by the fact that some marine 490

cyanobacteria such as Prochlorococcus and Synechococcus contain curved thylakoids (but 491

no thylakoid convergence zones at the plasma membrane) although they lack a curT gene 492

493

The role of biogenesis centers 494

The absence of biogenesis centers in the curT- mutant now enables one to answer some 495

questions relating to the role of these thylakoid sub-structures which form in some but not all 496

cyanobacteria (Kunkel 1982 van de Meene et al 2006) First they are not essential since 497

even the curT- mutant still accumulates PSII to ~50 of wild-type levels On the other hand 498

in the mutant assembly of PSII is impaired as revealed by the increased accumulation of early 499

assembly intermediates In addition PSII dimers are almost completely absent in curT- 500

Whether the reduction in PSII dimers is attributable to an assembly problem linked to the 501

absence of biogenesis centers or to a secondary defect in dimer stabilization caused by 502

changes in overall thylakoid membrane ultrastructure remains to be determined Thus 503

biogenesis centers are more likely to represent evolutionary ldquoadd-onsrdquo that facilitated efficient 504

thylakoid biogenesis This is compatible with the fact that some cyanobacteria are devoid of 505

any biogenesis center-related substructures Second their absence compromises PSII but the 506

accumulation of other photosynthetic complexes ie PSI and the Cyt(b6f) complex is not 507

affected by CurT deficiency (Figure 3) This observation agrees with previous findings that 508

neither the PsaA subunit of PSI nor its assembly factor Ycf37 is detectable in isolated PDM 509

fractions (Rengstl et al 2011) 510

In addition to reduced de novo PSII assembly a higher relative stability of D1 in high-511

light experiments has been detected in curT- which suggests that D1 degradation during PSII 512

repair is less efficient in the mutant Photo-damaged D1 is degraded by the FtsH2FtsH3 513

complex which has previously been shown to partly localize to thylakoid convergence zones 514

at the cell periphery ie biogenesis centers (Boehm et al 2012 Sacharz et al 2015) It 515

16

therefore seems possible that the absence of biogenesis centers in curT- leads to 516

mislocalization of the FtsH2FtsH3 complex and less effective D1 degradation 517

Moreover a PSII related-function for CurT is supported by a meta-analysis of the 518

Synechocystis 6803 transcriptome When the CyanoEXpress 22 database (Hernaacutendez-Prieto 519

and Futschik 2012 Hernaacutendez-Prieto et al 2016) was queried for genes co-expressed with 520

curT (slr0483) genes for five PSII subunits ndash psbE psbO psbF psbL and psb30 ndash were 521

found among the first ten hits (Supplemental Table 4) From this we infer that biogenic 522

centers do not play an essential role in the assembly of all photosynthetic complexes but 523

serve to enhance PSII assemblyrepair possibly through the efficient delivery of Mn2+ 524

Residual PSII in curT- cells is likely to be supplied with cytoplasmic Mn2+ via a second 525

independently operating ABC transporter-based system in the plasma membrane named the 526

Mnt pathway (Bartsevich and Pakrasi 1995 Bartsevich and Pakrasi 1996) 527

Formally we cannot exclude that CurT is directly involved in the PSII assembly 528

process However considering CurTrsquos membrane bending capacity and the mutant phenotype 529

(Figure 1D and Figure 2) it appears more likely that CurT forms cellular substructures for 530

efficient PSII biogenesis ie biogenesis centers 531

As mentioned above some ultrastructural features of biogenesis centers have emerged 532

from studies employing EM-based tomography (van de Meene et al 2006) To date however 533

a high-resolution picture of the precise membrane architecture within these centers remains 534

elusive In particular whether or not a direct connection between plasma membrane and 535

thylakoids exists continues to be debated As recently discussed and in line with this gap in 536

knowledge different membrane fractionation techniques have revealed different distributions 537

of PSII-related subunits and assembly factors between plasma and thylakoid membranes 538

(Heinz et al 2016 Liberton et al 2016 Selatildeo et al 2016) The overall picture that emerges 539

is that the initial hypothesis that PSII biogenesis is initiated at the plasma membrane is no 540

longer tenable whereas a specialized thylakoid sub-fraction like the PDMs that make contact 541

with the plasma membrane could explain many of the available data and thus clarify some 542

aspects of the debate (Zak et al 2001 Pisareva et al 2011 Rast et al 2015) Moreover it 543

has previously been hypothesized that ldquoribosome-decorated membrane-like complexesrdquo 544

forming at the innermost thylakoid sheet might represent biogenic compartments (van de 545

Meene et al 2006 Mullineaux 2008) Whether these structures are affected in curT- cannot 546

be judged based on our TEM analysis but requires ultrastructural data of higher resolution 547

However the accessibility of thylakoids for ribosomes should be increased in the less 548

compressed membrane system of curT- (Figure 2B-D) 549

17

A scenario similar to that of Synechocystis 6803 holds for the situation in chloroplasts 550

of the green alga Chlamydomonas reinhardtii in which de novo PSII biogenesis has been 551

shown to be initiated in punctate regions named T-zones located close to the pyrenoid 552

(Uniacke and Zerges 2007) Unlike the mRNAs for the PSII components neither RNAs for 553

PSI subunits nor PSI assembly factors are localized to T-zones indicating that PSI and PSII 554

assembly processes are spatially separated (Uniacke and Zerges 2009 Nickelsen and Zerges 555

2013 Rast et al 2015) Interestingly a recent cryoelectron tomography study demonstrated 556

that next to T-zones at the chloroplast base-lobe junction the inner chloroplast envelope 557

exhibits invaginationsconnections to thylakoids that structurally resemble the organization of 558

cyanobacterial biogenesis centers (Engel et al 2015) For future investigations it will be 559

interesting to see if a homolog of the CURT1 family is involved in the formation of these 560

structures in C reinhardtii 561

562

Evolution of CURT1 function 563

Homologs of the CURT1 protein family can be found throughout cyanobacteria green 564

algae and plants (Armbruster et al 2013) The Arabidopsis CURT1A-D proteins have 565

recently been shown to induce bending of thylakoid membranes at grana margin regions 566

(Armbruster et al 2013) Interestingly and in contrast to the situation in Synechocystis 6803 567

their inactivation did not result in severe photosynthetic deficiencies although the thylakoids 568

formed lacked defined grana stacks Nevertheless the data available support the idea that the 569

function of thylakoid membrane structures that were regarded as being independent ie 570

cyanobacterial biogenesis centers and grana are closely related Intriguingly both of these 571

thylakoid membrane structures are dedicated to aspects of PSII function but do not involve 572

PSI (Pribil et al 2014) In both the prokaryotic and eukaryotic systems CURT1 homologs 573

appear to bend thylakoid membranes as indicated by (i) the distortion of membrane 574

ultrastructure seen in mutants devoid of curved thylakoids (ii) the localization of CURT1 575

homologs at grana margins and their local concentration at biogenesis centers (iii) the in vitro 576

membrane-curving activity of both CURT forms The phenotypic differences between 577

A thaliana and Synechocystis 6803 mutants may however be attributable to the different 578

functions of the membrane sub-compartments affected in the two model organisms Whereas 579

the role of grana is still under debate one function of the cyanobacterial biogenesis centers is 580

the above-mentioned high-throughput uptake of Mn2+ ions for efficient assembly of PSII 581

(Stengel et al 2012 Nickelsen and Rengstl 2013 Pribil et al 2014) However it appears 582

that in both cases the primary function of CURT1 proteins is to generate curved membrane 583

18

regions These discoveries suggest that until now two independently observed structures ie 584

cyanobacterial thylakoid biogenesis centers and chloroplast grana regions are closely related 585

The degree of curvature is much less pronounced in the cyanobacterial system As previously 586

discussed it was probably the subsequent evolution of a membrane-localized light-harvesting 587

system in chloroplasts that made the formation of tightly curved grana thylakoids possible 588

(Mullineaux 2005 Nevo et al 2012 Pribil et al 2014) 589

590

CurT is involved in osmotic stress response 591

One unexpected phenotype of the curT- mutant is its sensitivity to osmotic stress 592

These data revealed that in addition to shaping membranes CurT also influences their 593

functional integrity This latter function might be intrinsic to CurT or could be mediated by 594

the VIPP1 protein which has been shown to be required for membrane maintenance in 595

bacteria and chloroplasts probably by acting as a supplier of lipids (for an overview see 596

Zhang and Sakamoto 2015) Both factors accumulate in the plasma membrane upon osmotic 597

stress but VIPP1 localization is not severely affected by CurT inactivation which suggests 598

that VIPP1 operates independently of CurT In agreement with this repeated co-599

immunoprecipitations revealed no interaction between both proteins Therefore it remains to 600

be established whether a direct functional relationship between them exists 601

Previous investigations of osmotic stress in Synechocystis 6803 showed a kidney-602

shaped form of wild-type cells under very high concentrations of osmotically active 603

compounds (Marin et al 2006) The cells were severely deformed indicating changes in the 604

structure of the cellular envelope Since CurT shifts towards the plasma membrane already 605

under lower osmolyte concentrations we suggest a stabilizing function of CurT in the plasma 606

membrane CurT might be necessary to tolerate the forces trying to deform the cells under 607

osmotic stress 608

In conclusion this analysis has identified a crucial determinant for shaping and 609

maintaining the cyanobacterial thylakoid membrane system ie CurT a homolog of the 610

grana-forming CURT1 protein family from A thaliana In particular CurT is involved in the 611

formation of specific thylakoid substructures close to the plasma membrane at which PSII is 612

assembledrepaired Future work will dissect the precise ultrastructure of these centers and 613

enable us to elaborate a molecular model for the spatiotemporal organization of PSII assembly 614

in cyanobacteria 615

616

19

Methods 617

Strains and growth conditions 618

Wild-type and mutant Synechocystis 6803 cells were grown on solid or in liquid BG 619

11 medium (Rippka et al 1979) supplemented with 5 mM glucose (unless indicated 620

otherwise) at 30degC under continuous illumination at a photon irradiance of 30 μmol m-2 s-1 of 621

white light For growth during high-light experiments for investigation of D1 repair cells 622

were cultivated in a FMT150 photobioreactor (Photon Systems Instruments Draacutesov Czech 623

Republic) at 800 micromol photons m-2 s-1 in the presence or absence of lincomycin (100 microgml) 624

Cell density was monitored photometrically at 750 nm Doubling times were determined after 625

two days of growth To generate the insertion mutant curT- the curT gene (slr0483) was first 626

amplified from wild-type genomic DNA by PCR using the primer pair 04835 627

(GAAGCCTATTTAGCTAAGGCCGAAAG) and 04833 628

(TAGTACCTGGTCTTCCATGGCGT) and the resulting fragment was cloned into the 629

Bluescript pKS vector (Stratagene Waldbronn Germany) A kanamycin resistance cassette 630

was then inserted into the single AgeI restriction site (159 bp downstream of the start codon) 631

and this disruption construct was used to replace the wild-type gene as described (Wilde et al 632

2001) 633

634

Bioinformatic and computational analysis 635

CURT1 sequences of Synechocystis 6803 were obtained from CyanoBase 636

(httpgenomekazusaorjpcyanobaseSynechocystis) and CURT1 homologs in other 637

organisms were retrieved from NCBIBLAST (httpblastncbinlmnihgovBlastcgi) 638

Numbers and positions of putative transmembrane domains in the predicted proteins were 639

determined with TMHMM20 (httpwwwcbsdtudkservicesTMHMM) The sequence for 640

the N-terminal amphipathic helix was predicted by Jpred 3 641

(httpwwwcompbiodundeeacukwww-jpred) and plotted using a helical wheel projection 642

script (httprzlabucreduscriptswheelwheelcgi) The programs ClustalW2 643

(httpwwwebiacuktoolsclustalw2) and GeneDoc (httpwwwpscedubiomedgenedoc) 644

were used to generate multiple alignments of amino acid sequences Quantitative analysis of 645

immunoblots was performed with the AIDA Image Analyzer V325 (Raytest 646

Isotopenmessgeraumlte GmbH Straubenhardt Germany) 647

Co-expression patterns of curT were analyzed using the CyanoEXpress 22 database 648

(httpcyanoexpresssysbiolabeu Hernaacutendez-Prieto and Futschik 2012 Hernaacutendez-Prieto et 649

al 2016) 650

20

651

Measurement of chlorophyll concentration and oxygen production 652

Determination of chlorophyll content was carried out according to Wellburn and 653

Lichtenthaler (1984) For oxygen evolution measurements cells were grown in BG-11 654

without glucose harvested in mid-log phase and diluted to an OD750 nm = 05 Oxygen 655

evolution rates were measured with a Clark-type oxygen electrode (Hansatech Instruments 656

Ltd Kingrsquos Lynn Norfolk UK) at 1000 micromol photons m-2 s-1 (cool white light) after 5 min of 657

dark acclimation Oxygen evolution under saturating light conditions was measured without 658

any additives 659

660

Cell size and cell number estimation 661

Synechocystis 6803 strains were grown in liquid BG11 media containing 5 mM 662

glucose For cell size estimation the cells were analyzed with a confocal laser scanning 663

microscope TCS SP5 (Leica Wetzlar Germany) The diameter of the cells was measured 664

with the LAS AF Lite software (Leica Wetzlar Germany) Cells that were about to divide 665

were not taken into account For the determination of cell number cultures were set to an 666

OD750 = 1 and analyzed by using a Neubauer counting chamber (Paul Marienfeld GmbH amp 667

Co KG Lauda-Koumlnigshofen Germany) Statistical significance was determined by Studentrsquos 668

t-test 669

670

Measurements of P700+ reduction kinetics and relative electron transport rates 671

P700+ reduction kinetics and changes in chlorophyll fluorescence yield at different 672

light intensities were measured at a chlorophyll concentration of 5 microgml with a Dual-PAM-673

100 instrument (Heinz Walz GmbH Effeltrich Germany) Complete P700 oxidation was 674

achieved by a 50-ms multiple turnover pulse (10000 micromol photons m-2 s-1) after 2 min of dark 675

incubation P700+ reduction kinetics were recorded without any additions as well as in the 676

presence of 10 microM DCMU Ten technical replicates were averaged and fitted with single 677

exponential functions Data interpretation was done according to Bernaacutet et al (2009) 678

Light saturation measurements were performed according to Xu et al (2008) The 679

actinic light intensity was increased stepwise from 0 to 665 micromol photons m-2 s-1 with 30-s 680

adaptation periods Maximal fluorescence yields were obtained by applying saturating light 681

pulses (duration 600 ms intensity 10000 micromol photons m-2 s-1) 682

683

Low-temperature fluorescence measurements 684

21

Fluorescence emission spectra were measured with an AMINCO Bowman Series 2 685

Luminescence Spectrometer Wild-type and curT- cells were grown in the presence of 5 mM 686

glucose to mid log-phase and concentrated to 25 microgml chlorophyll adding 2 microM fluorescein 687

as an internal standard Samples (1 ml) were transferred to thin glass tubes dark-adapted for 688

30 min at 30 degC and shock frozen in liquid N2 To quantify chlorophyllfluorescein and 689

phycobilisome-mediated fluorescence samples were excited and emission recorded at 440 690

nm510 nm (chlorophyll and fluorescein excitationmax fluorescein emission) and 580 691

nm685 nm respectively Emission was scanned at 490-800 nm or at 640-800 nm 692

respectively 693

694

Antibody production and protein analysis 695

For generation of an αCurT antibody the N-terminal coding region of curT (amino 696

acid positions 1-58) was amplified by PCR using primers N04835 697

(AAGGATCCGTGGGCCGTAAACATTCAA) and N04833 698

(AAGTCGACGCACTTCCCACACCGGTTGTA) and cloned into the BamHI and XhoI sites 699

of the pGEX-4T-1 vector (GE Healthcare Freiburg Germany) Expression of the GST fusion 700

protein in Escherichia coli BL21(DE3) and subsequent affinity purification on Glutathione-701

Sepharose 4B (GE Healthcare) were carried out as described (Schottkowski et al 2009b) A 702

polyclonal antiserum was raised against this protein fragment in rabbits (Pineda Berlin 703

Germany) Other primary antibodies used in this study have been described previously ie 704

αpD1 (Schottkowski et al 2009b) αD1 (Schottkowski et al 2009b) αD2 (Klinkert et al 705

2006) αPratA (Klinkert et al 2004) αYcf48 (Rengstl et al 2011) αPitt (Schottkowski et 706

al 2009a) αPOR (Schottkowski et al 2009a) αYidC (Ossenbuumlhl et al 2006) αVIPP1 707

(Aseeva et al 2007) αSll0933 (Armbruster et al 2010) and αSlr0151 (Rast et al 2016) or 708

were purchased from Agrisera (Vaumlnnaumls Sweden) ie αCP43 αCP47 αPsaA αCyt f 709

αRbcL αIsiA The αGFP-HRP antibody was acquired from Miltenyi Biotech (Bergisch 710

Gladbach Germany) 711

Protein concentrations were determined according to Bradford (1976) using RotiQuant 712

(Carl Roth GmbH amp Co KG Karlsruhe Germany) Protein extraction membrane 713

fractionation on sucrose-density gradients and quantification of Western signal intensities was 714

performed as described previously (Rengstl et al 2011) Solubility properties of CurT were 715

determined according to Schottkowski et al (2009a) 716

22

Sucrose-density centrifugation separating PDM and thylakoid membrane fractions by 717

two consecutive gradients was carried out as described previously (Schottkowski et al 718

2009b Rengstl et al 2011) 719

Two-dimensional fractionations of cyanobacterial membrane proteins via BNSDS-720

PAGE and of pulse-labeled proteins by BNSDS-PAGE were performed as previously 721

reported (Klinkert et al 2004 Schottkowski et al 2009b Rengstl et al 2013) For the 722

analysis of native complexes in fractions obtained by sucrose-density centrifugation the 723

volume corresponding to 350 microg of protein in fraction 7 was applied to BNSDS-PAGE 724

For isoelectric focusing (IEF) the volume corresponding to 50 microg of protein from 725

fraction 7 in 200 microl of IEF buffer (8 M urea 4 CHAPS 1 IPG buffer pH 4-7 (GE 726

Healthcare)) was applied to an 11-cm Immobiline DryStrip pH 4-7 (GE Healthcare) in a 727

Protean IEF Cell (Bio-Rad Munich Germany) Strips were rehydrated for 12 h at 20 degC and 728

50V Focusing was carried out in the following steps 500 V rapid 1500 Vh 1000 V linear 729

880 Vh 6000 V linear 9680 Vh 6000 V rapid 5390 Vh 50 microA per gel focus temperature 730

20degC Subsequently the strips were incubated in equilibration buffer I (6 M urea 0375 M 731

Tris pH 88 20 glycerol 2 SDS 2 DTT) and equilibration buffer II (6 M urea 0375 732

M Tris pH 88 20 glycerol 2 SDS 25 iodoacetamide) for 10 min in each buffer 733

Then the IEF strips were applied to second-dimension SDS-PAGE 734

735

Transmission electron microscopy and immunogold labeling 736

Sample preparation for transmission electron microscopy including freeze substitution 737

and immunogold labeling of CurT was performed as described previously (Stengel et al 738

2012) Ultrathin sections were cut to thicknesses of 35 - 45 nm and 45 - 65 nm for 739

ultrastructural analyses and immunogold labeling respectively For immunogold labeling 740

sections collected on collodion-coated Ni grids were incubated for 18 h at 4degC with (rabbit) 741

αCurT (diluted 1100 1500 11000 or 14000 in blocking buffer (5 fetal calf serum) with 742

005 Tween 20) and further processed as described previously (Stengel et al 2012) As a 743

negative control wild-type Synechocystis 6803 cells were incubated without the primary 744

antibody and exposed to the gold-labeled anti-rabbit IgG To image the ultrastructure and the 745

immunogold-treated samples a Fei Morgagni 268 transmission electron microscope was used 746

and micrographs were taken at 80 kV 747

To avoid errors in the interpretation of the immunogold labeling experiment only 748

signals which were unambiguously localized to distinctly visible thylakoid membranes were 749

taken into account For each cell different regions (see Figure 10F) were defined and in each 750

23

region the signals on the convex and concave sides of the thylakoid membrane were analyzed 751

separately (see Supplemental Figure 11 for representative counts) Statistical significance was 752

assessed by χ2 test (Zoumlfel 1988) 753

For the analysis of clusters of CurT signals in biogenesis centers a cluster was defined 754

as a minimum of four signals in close proximity Overall 219 biogenesis centers were 755

examined with regard to CurT cluster formation 756

757

Preparation of proteoliposomes 758

Liposomes with a lipid mixture of 25 monogalactosyl diacylglycerol 42 759

digalactosyl diacylglycerol 16 sulfoquinovosyl diacylglycerol and 17 760

phosphatidylglycerol (Lipid Products South Nutfield UK) were prepared as described 761

previously (Armbruster et al 2013) To generate proteoliposomes CurT and CURT1A 762

proteins were expressed in the presence of liposomes for 3 h at 37degC using a PURExpress In 763

Vitro Protein Synthesis Kit (New England Biolabs Ipswich MA USA) The liposomes were 764

separated from the mix by centrifugation in a discontinuous sucrose gradient (100000 g 18 765

h) Subsequently the fraction containing the liposomes was extracted and dialyzed against 20 766

mM HEPES (pH 76) For transmission electron microscopy the proteoliposomes were 767

negatively stained with 1 uranyl acetate on a carbon-coated copper grid Micrographs were 768

taken on a Fei Morgagni 268 TEM at 80 kV 769

770

curT-CFP strain generation 771

Gibson assembly was used for single-step cloning (Gibson 2011) of the slr0483 gene 772

(together with its ~08 kb upstream region) the mTurquoise2 gene fragment the gentamycin-773

resistance cassette (aacC1) and an ~17-kb downstream region of slr0483 into pBR322 774

cleaved with EcoRV and NheI The slr0483 gene was fused in frame to the codon-optimized 775

mTurquoise2 (DNA20) preceded by a linker sequence encoding GSGSG The resulting 776

plasmid was used to transform Synechocystis 6803 as described previously (Zang et al 2007) 777

After ~ 10 days of incubation on BG11-GelRite (15 ) medium in the presence of 2 microgml 778

gentamycin several antibiotic resistant colonies were obtained and streaked out on fresh 779

medium These transformants were then tested for full segregation of the tagged allele by 780

colony PCR with primers flanking the slr0483 gene 781

782

Fluorescence microscopy 783

24

An aliquot of a cell suspension in mid-log phase was placed under a BG11-agarose 784

pad on a glass coverslip (15) and imaged on an inverted microscope (Zeiss 785

AxioObserverZ1) equipped with an ORCA Flash40 V2 (Hamamatsu) camera a Lumenecor 786

SOLA II Light Engine and a Plan-Apochromat 63x140 Oil DIC M27 (NA 14) objective 787

(Zeiss) Image acquisition was done with Zen 21 software in cyan and far-red fluorescence 788

channels (Zeiss Filter Sets 47 HE and 50) as Z-series with a step size of 250 nm and effective 789

pixel size of 103 nm Acquired image files were subsequently deconvolved (Constrained 790

Iterative Method) using a default theoretical Point Spread Function in Zen 20 (Zeiss) 791

Extraction of intensities for line profiles was performed by image thresholding the thylakoid 792

autofluorescence channel and eroding the resulting binary mask in Fiji (Schindelin et al 793

2012) 794

For immunofluorescence analysis cells were grown to mid-log phase as in the case of 795

the cells prepared for live-cell microscopy A 10-ml culture was fixed for 20 min in 37 796

formaldehyde and following extensive washing with phosphate-buffered saline (PBS) cells 797

were first permeabilized in 005 Triton-X for 20 min and then in lysis buffer (50 mM Tris-798

HCl 100 mM NaCl 5 mgml lysozyme) at 37degC for 2 h with gentle shaking To block 799

unspecific binding sites the cell pellet was incubated in 5 bovine serum albumin in PBS at 800

30degC for 1 h The αCurT serum (1500 dilution) was added to cells in fresh blocking buffer 801

for 1 h at 30degC with gentle shaking Cells were then washed three times with blocking buffer 802

and incubated with goat anti-rabbit IgG secondary antibodies conjugated to Oregon Green 488 803

(Invitrogen) (11000 dilution) under the conditions as for the primary antibodies Cells were 804

washed three times with PBS and prepared for microscopy as above Imaging was done as 805

described for live-cell microscopy except that a Colibri2 LED light source was employed for 806

illumination and a CoolSnap HQ camera (Photometrics) was used for image acquisition Cells 807

were imaged as Z-series (step size 280 nm) in the yellow and far-red fluorescent channels 808

(Zeiss Filter Sets 46 HE and 50) using the 505 nm and 625 nm LED modules Effective pixel 809

size in the final image was 102 nm Deconvolution and image analysis was done as described 810

above As judged by the staining intensity of the Oregon Green-conjugated antibodies 811

approximately half of the cells in any given field of view appeared to have been successfully 812

permeabilised a rate that is common in our experience No significant signal was detected in 813

the control sample that had not been exposed to the primary antibodies 814

815

25

Accession numbers 816

Sequence data from this article can be found in the CyanoBase and EMBLGenBank 817

data libraries under accession number slr0483 818

819

Supplemental Data 820

Supplemental Figure 1 Construction of the curT- mutant 821

Supplemental Figure 2 Growth phenotype of curT- 822

Supplemental Figure 3 Expression analysis of the open reading frame slr0482 (located 823

upstream of curT) in the curT- strain 824

Supplemental Figure 4 Absorbance spectra of curT- and wild-type cells 825

Supplemental Figure 5 High-light growth phenotypes of wild-type Synechocystis 6803 and 826

the curT- strain 827

Supplemental Figure 6 Ultrastructure of the TD41 mutant which lacks the psbA transcript 828

and the D1 protein 829

Supplemental Figure 7 Expression and localization of CurT-CFP 830

Supplemental Figure 8 Localization of CurT and CurT-CFP by fluorescence microscopy 831

Supplemental Figure 9 Chlorophyll autofluorescence of curT- 832

Supplemental Figure 10 The curT- mutant as a negative control for immunogold labeling 833

Supplemental Figure 11 Representative counts of immunogold signals 834

Supplemental Table 1 Overview of immunogold signals in curT- cells 835

Supplemental Table 2 Overview of immunogold signals in specific regions of Synechocystis 836

6803 wild-type cells 837

Supplemental Table 3 Statistical analysis of immunogold signals for wild-type 838

Synechocystis 6803 cells 839

Supplemental Table 4 Co-expression of curT 840

Supplemental Movie 1 Scan through the Z-axis of a curT-CFP cell 841

Supplemental Movie 2 Rendered 3D-model of a CurT-CFP detection 842

Supplemental Movie 3 Scan through the Z-axis of a curT-CFP cell with a traversing 843

thylakoid lamella 844

845

Acknowledgements 846

We thank Y Nishiyama for providing αpD1 and J Soll for αVIPP1 and αYidC antibodies 847

respectively and Nina Dyczmons-Nowaczyk for support with the fluorescence measurements 848

This work was supported by grants awarded to JN (Ni3909) MMN (NO 8363) and DL 849

26

(Le126529) by the Deutsche Forschungsgemeinschaft in the context of Research Unit 850

FOR2092 and the Cluster of Excellence RESOLV (EXC 1069) AG is a Howard Hughes 851

Medical Institute postdoctoral fellow in the laboratory of Erin OrsquoShea at Harvard University 852

LS was supported by a PhD fellowship from the Chinese Scholarship Council 853

854

Author Contributions 855

SH AR LS MMN DL and JN designed the research SH AR LS AG ILG EH ML BR 856

SV performed the research all authors contributed to data analysis SH AR and JN wrote the 857

paper 858

859

Competing Financial Interest statement 860

The authors declare no competing financial interests 861

862

We wish to dedicate this paper to Fabrice Rappaport an outstanding colleague and friend who 863

passed away so early 864

865

27

References 866

Allen JF de Paula WBM Puthiyaveetil S and Nield J (2011) A structural 867

phylogenetic map for chloroplast photosynthesis Trends Plant Sci 16 645-655 868

Anderson JM Horton P Kim E-H and Chow WS (2012) Towards elucidation of 869

dynamic structural changes of plant thylakoid architecture Philos Trans R Soc 870

Lond B Biol Sci 367 3515-3524 871

Armbruster U Zuumlhlke J Rengstl B Kreller R Makarenko E Ruumlhle T Schuumlnemann 872

D Jahns P Weisshaar B Nickelsen J and Leister D (2010) The Arabidopsis 873

thylakoid protein PAM68 is required for efficient D1 biogenesis and photosystem II 874

assembly Plant Cell 22 3439-3460 875

Armbruster U Labs M Pribil M Viola S Xu W Scharfenberg M Hertle AP 876

Rojahn U Jensen PE Rappaport F Joliot P Doumlrmann P Wanner G and 877

Leister D (2013) Arabidopsis CURVATURE THYLAKOID1 proteins modify 878

thylakoid architecture by inducing membrane curvature Plant Cell 25 2661-2678 879

Aseeva E Ossenbuumlhl F Sippel C Cho WK Stein B Eichacker LA Meurer J 880

Wanner G Westhoff P Soll J and Vothknecht UC (2007) Vipp1 is required for 881

basic thylakoid membrane formation but not for the assembly of thylakoid protein 882

complexes Plant Physiol Biochem 45 119-128 883

Bartsevich VV and Pakrasi HB (1995) Molecular identification of an ABC transporter 884

complex for manganese analysis of a cyanobacterial mutant strain impaired in the 885

photosynthetic oxygen evolution process EMBO J 14 1845-1853 886

Bartsevich VV and Pakrasi HB (1996) Manganese transport in the cyanobacterium 887

Synechocystis sp PCC 6803 J Biol Chem 271 26057-26061 888

Bernaacutet G Waschewski N and Roumlgner M (2009) Towards efficient hydrogen production 889

the impact of antenna size and external factors on electron transport dynamics in 890

Synechocystis PCC 6803 Photosynth Res 99 205-216 891

Boehm M Yu J Krynicka V Barker M Tichy M Komenda J Nixon PJ and Nield 892

J (2012) Subunit Organization of a Synechocystis Hetero-Oligomeric Thylakoid FtsH893

Complex Involved in Photosystem II Repair Plant Cell 24 3669-3683894

Bradford MM (1976) A rapid and sensitive method for the quantitation of microgram 895

quantities of protein utilizing the principle of protein-dye binding Anal Biochem 72 896

248-254897

28

Chang L Liu X Li Y Liu C-C Yang F Zhao J and Sui S-F (2015) Structural 898

organization of an intact phycobilisome and its association with photosystem II Cell 899

Res 25 726-737 900

Danielsson R Suorsa M Paakkarinen V Albertsson P-Aring Styring S Aro E-M and 901

Mamedov F (2006) Dimeric and monomeric organization of photosystem II 902

Distribution of five distinct complexes in the different domains of the thylakoid 903

membrane J Biol Chem 281 14241-14249 904

Daum B Nicastro D Austin J McIntosh JR and Kuumlhlbrandt W (2010) Arrangement 905

of photosystem II and ATP synthase in chloroplast membranes of Spinach and Pea 906

Plant Cell 22 1299-1312 907

Engel BD Schaffer M Kuhn Cuellar L Villa E Plitzko JM and Baumeister W 908

(2015) Native architecture of the Chlamydomonas chloroplast revealed by in situ 909

cryo-electron tomography eLife 4 e04889 910

Ford MGJ Mills IG Peter BJ Vallis Y Praefcke GJK Evans PR and McMahon 911

HT (2002) Curvature of clathrin-coated pits driven by epsin Nature 419 361-366 912

Fristedt R Willig A Granath P Cregravevecoeur M Rochaix J-D and Vener AV (2009) 913

Phosphorylation of photosystem II controls functional macroscopic folding of 914

photosynthetic membranes in Arabidopsis Plant Cell 21 3950-3964 915

Gallop JL and McMahon HT (2005) BAR domains and membrane curvature bringing 916

your curves to the BAR Biochem Soc Symp 72 223-231 917

Gibson DG (2011) Chapter fifteen - Enzymatic Assembly of Overlapping DNA Fragments 918

In Methods in Enzymology V Christopher ed (Academic Press) pp 349-361 919

Goedhart J von Stetten D Noirclerc-Savoye M Lelimousin M Joosen L Hink MA 920

van Weeren L Gadella TWJ and Royant A (2012) Structure-guided evolution of 921

cyan fluorescent proteins towards a quantum yield of 93 Nat Commun 3 751 922

Heinz S Liauw P Nickelsen J and Nowaczyk M (2016) Analysis of photosystem II 923

biogenesis in cyanobacteria Biochim Biophys Acta 1857 274-287 924

Hernaacutendez-Prieto M and Futschik M (2012) CyanoEXpress A web database for 925

exploration and visualisation of the integrated transcriptome of cyanobacterium 926

Synechocystis sp PCC6803 Bioinformation 8 634-638 927

Hernaacutendez-Prieto MA Semeniuk TA Giner-Lamia J and Futschik ME (2016) The 928

Transcriptional Landscape of the Photosynthetic Model Cyanobacterium 929

Synechocystis sp PCC6803 Sci Rep 6 22168 930

29

Huang F Fulda S Hagemann M and Norling B (2006) Proteomic screening of salt-931

stress-induced changes in plasma membranes of Synechocystis sp strain PCC 6803 932

Proteomics 6 910-920 933

Kirchhoff H (2013) Architectural switches in plant thylakoid membranes Photosynth Res 934

116 481-487 935

Klinkert B Elles I and Nickelsen J (2006) Translation of chloroplast psbD mRNA in 936

Chlamydomonas is controlled by a secondary RNA structure blocking the AUG start 937

codon Nucleic Acids Res 34 386-394 938

Klinkert B Ossenbuumlhl F Sikorski M Berry S Eichacker L and Nickelsen J (2004) 939

PratA a periplasmic tetratricopeptide repeat protein involved in biogenesis of 940

photosystem II in Synechocystis sp PCC 6803 J Biol Chem 279 44639-44644 941

Komenda J Nickelsen J Tichyacute M Praacutešil O Eichacker LA and Nixon PJ (2008) The 942

cyanobacterial homologue of HCF136YCF48 is a component of an early photosystem 943

II assembly complex and is important for both the efficient assembly and repair of 944

photosystem II in Synechocystis sp PCC 6803 J Biol Chem 283 22390-22399 945

Kopf M Klaumlhn S Scholz I Matthiessen JKF Hess WR and Voszlig B (2014) 946

Comparative analysis of the primary transcriptome of Synechocystis sp PCC 6803 947

DNA Res 21 527-539 948

Kunkel DD (1982) Thylakoid centers Structures associated with the cyanobacterial 949

photosynthetic membrane system Arch Microbiol 133 97-99 950

Liberton M Howard Berg R Heuser J Roth R and Pakrasi BH (2006) Ultrastructure 951

of the membrane systems in the unicellular cyanobacterium Synechocystis sp strain 952

PCC 6803 Protoplasma 227 129-138 953

Liberton M Saha R Jacobs JM Nguyen AY Gritsenko MA Smith RD 954

Koppenaal DW and Pakrasi HB (2016) Global Proteomic Analysis Reveals an 955

Exclusive Role of Thylakoid Membranes in Bioenergetics of a Model 956

Cyanobacterium Mol Cell Proteomics 15 2021-2032 957

Luque I and Ochoa de Alda JAG (2014) CURT1CAAD-containing aaRSs thylakoid 958

curvature and gene translation Trends Plant Sci 19 63-66 959

Marin K Stirnberg M Eisenhut M Kraumlmer R and Hagemann M (2006) Osmotic stress 960

in Synechocystis sp PCC 6803 low tolerance towards nonionic osmotic stress results 961

from lacking activation of glucosylglycerol accumulation Microbiology 152 2023-962

2030 963

Mullineaux CW (2005) Function and evolution of grana Trends Plant Sci 10 521-525 964

30

Mullineaux CW (2008) Biogenesis and dynamics of thylakoid membranes and the 965

photosynthetic apparatus In The Cyanobacteria A Herrero and E Flores eds 966

(Norfolk UK Caister Academic Press) pp 289ndash304 967

Nevo R Charuvi D Tsabari O and Reich Z (2012) Composition architecture and 968

dynamics of the photosynthetic apparatus in higher plants Plant J 70 157-176 969

Nickelsen J and Rengstl B (2013) Photosystem II assembly From cyanobacteria to plants 970

Annu Rev Plant Biol 64 609-635 971

Nickelsen J and Zerges W (2013) Thylakoid biogenesis has joined the new era of bacterial 972

cell biology Front Plant Sci 4 458 973

Nilsson F Simpson DJ Jansson C and Andersson B (1992) Ultrastructural and 974

biochemical characterization of a Synechocystis 6803 mutant with inactivated psbA 975

genes Arch Biochem Biophys 295 340-347 976

Odom WR Hodges R Chitnis PR and Guikema JA (1993) Characterization of 977

Synechocystis sp PCC 6803 in iron-supplied and iron-deficient media Plant Mol 978

Biol 23 1255-1264 979

Ossenbuumlhl F Inaba-Sulpice M Meurer J Soll J and Eichacker LA (2006) The 980

Synechocystis sp PCC 6803 Oxa1 homolog is essential for membrane integration of 981

reaction center precursor protein pD1 Plant Cell 18 2236-2246 982

Pisareva T Kwon J Oh J Kim S Ge C Wieslander Aring Choi J-S and Norling B 983

(2011) Model for Membrane Organization and Protein Sorting in the Cyanobacterium 984

Synechocystis sp PCC 6803 Inferred from Proteomics and Multivariate Sequence 985

Analyses J Proteome Res 10 3617-3631 986

Pribil M Labs M and Leister D (2014) Structure and dynamics of thylakoids in land 987

plants J Exp Bot 65 1955-1972 988

Rast A Heinz S and Nickelsen J (2015) Biogenesis of thylakoid membranes Biochim 989

Biophys Acta 1847 821-830 990

Rast A Rengstl B Heinz S Klingl A and Nickelsen J (2016) The role of Slr0151 a 991

tetratricopeptide repeat protein from Synechocystis sp PCC 6803 during Photosystem 992

II assembly and repair Front Plant Sci 7 605 993

Rengstl B Oster U Stengel A and Nickelsen J (2011) An Intermediate Membrane 994

Subfraction in Cyanobacteria Is Involved in an Assembly Network for Photosystem II 995

Biogenesis J Biol Chem 286 21944-21951 996

31

Rengstl B Knoppovaacute J Komenda J and Nickelsen J (2013) Characterization of a 997

Synechocystis double mutant lacking the photosystem II assembly factors YCF48 and 998

Sll0933 Planta 237 471-480 999

Rexroth S Mullineaux CW Ellinger D Sendtko E Roumlgner M and Koenig F (2011) 1000

The Plasma Membrane of the Cyanobacterium Gloeobacter violaceus Contains 1001

Segregated Bioenergetic Domains Plant Cell 23 2379-2390 1002

Rippka R Deruelles J Waterbury JB Herdman M and Stanier RY (1979) Generic 1003

Assignments Strain Histories and Properties of Pure Cultures of Cyanobacteria 1004

Microbiology 111 1-61 1005

Ruumltgers M and Schroda M (2013) A role of VIPP1 as a dynamic structure within 1006

thylakoid centers as sites of photosystem biogenesis Plant Signal Behav 8 e27037 1007

Sacharz J Bryan SJ Yu J Burroughs NJ Spence EM Nixon PJ and Mullineaux 1008

CW (2015) Sub-cellular location of FtsH proteases in the cyanobacterium1009

Synechocystis sp PCC 6803 suggests localised PSII repair zones in the thylakoid1010

membranes Mol Microbiol 96 448-4621011

Sandstroumlm S Park Y-I Oumlquist G and Gustafsson P (2001) CP43prime the isiA Gene 1012

Product Functions as an Excitation Energy Dissipator in the Cyanobacterium 1013

Synechococcus sp PCC 7942 Photochem Photobiol 74 431-437 1014

Schindelin J Arganda-Carreras I Frise E Kaynig V Longair M Pietzsch T 1015

Preibisch S Rueden C Saalfeld S Schmid B Tinevez J-Y White DJ 1016

Hartenstein V Eliceiri K Tomancak P and Cardona A (2012) Fiji an open-1017

source platform for biological-image analysis Nat Methods 9 676-682 1018

Schottkowski M Ratke J Oster U Nowaczyk M and Nickelsen J (2009a) Pitt a novel 1019

tetratricopeptide repeat protein involved in light-dependent chlorophyll biosynthesis 1020

and thylakoid membrane biogenesis in Synechocystis sp PCC 6803 Mol Plant 2 1021

1289-1297 1022

Schottkowski M Gkalympoudis S Tzekova N Stelljes C Schuumlnemann D Ankele E 1023

and Nickelsen J (2009b) Interaction of the periplasmic PratA factor and the PsbA 1024

(D1) protein during biogenesis of photosystem II in Synechocystis sp PCC 6803 J 1025

Biol Chem 284 1813-1819 1026

Selatildeo TT Zhang L Knoppovaaacute J Komenda J and Norling B (2016) Photosystem II 1027

Assembly Steps Take Place in the Thylakoid Membrane of the Cyanobacterium 1028

Synechocystis sp PCC6803 Plant Cell Physiol 57 878 1029

32

Spaumlt P Maček B and Forchhammer K (2015) Phosphoproteome of the cyanobacterium 1030

Synechocystis sp PCC 6803 and its dynamics during nitrogen starvation Front 1031

Microbiol 6 248 1032

Stengel A Guumlgel IL Hilger D Rengstl B Jung H and Nickelsen J (2012) Initial 1033

steps of photosystem II de novo assembly and preloading with manganese take place 1034

in biogenesis centers in Synechocystis Plant Cell 24 660-675 1035

Uniacke J and Zerges W (2007) Photosystem II assembly and repair are differentially 1036

localized in Chlamydomonas Plant Cell 19 3640-3654 1037

Uniacke J and Zerges W (2009) Chloroplast protein targeting involves localized 1038

translation in Chlamydomonas Proc Natl Acad Sci USA 106 1439-1444 1039

van de Meene AL Hohmann-Marriott M Vermaas WJ and Roberson R (2006) The 1040

three-dimensional structure of the cyanobacterium Synechocystis sp PCC 6803 Arch 1041

Microbiol 184 259-270 1042

van de Meene AML Sharp WP McDaniel JH Friedrich H Vermaas WFJ and 1043

Roberson RW (2012) Gross morphological changes in thylakoid membrane 1044

structure are associated with photosystem I deletion in Synechocystis sp PCC 6803 1045

Biochim Biophys Acta 1818 1427-1434 1046

Watanabe M and Ikeuchi M (2013) Phycobilisome architecture of a light-harvesting 1047

supercomplex Photosynth Res 116 265-276 1048

Wellburn AR and Lichtenthaler H (1984) Formulae and Program to Determine Total 1049

Carotenoids and Chlorophylls A and B of Leaf Extracts in Different Solvents In 1050

Advances in Photosynthesis Research Proceedings of the VIth International Congress 1051

on Photosynthesis Brussels Belgium August 1ndash6 1983 C Sybesma ed (Dordrecht 1052

Springer Netherlands) pp 9-12 1053

Wilde A Lunser K Ossenbuumlhl F Nickelsen J and Borner T (2001) Characterization of 1054

the cyanobacterial ycf37 mutation decreases the photosystem I content Biochem J 1055

357 211-216 1056

Wilson A Boulay C Wilde A Kerfeld CA and Kirilovsky D (2007) Light-Induced 1057

Energy Dissipation in Iron-Starved Cyanobacteria Roles of OCP and IsiA Proteins 1058

Plant Cell 19 656-672 1059

Xu M Bernaacutet G Singh A Mi H Roumlgner M Pakrasi HB and Ogawa T (2008) 1060

Properties of Mutants of Synechocystis sp Strain PCC 6803 Lacking Inorganic Carbon 1061

Sequestration Systems Plant Cell Physiol 49 1672-1677 1062

33

Yamamoto T Burke J Autz G and Jagendorf AT (1981) Bound ribosomes of Pea 1063

chloroplast thylakoid membranes location and release in vitro by high salt 1064

puromycin and RNase Plant Physiol 67 940-949 1065

Yang H Liao L Bo T Zhao L Sun X Lu X Norling B and Huang F (2014) 1066

Slr0151 in Synechocystis sp PCC 6803 is required for efficient repair of photosystem 1067

II under high-light condition J Integr Plant Biol 56 1136-1150 1068

Yeremenko N Kouřil R Ihalainen JA DHaene S van Oosterwijk N 1069

Andrizhiyevskaya EG Keegstra W Dekker HL Hagemann M Boekema EJ 1070

Matthijs HCP and Dekker JP (2004) Supramolecular Organization and Dual 1071

Function of the IsiA Chlorophyll-Binding Protein in Cyanobacteria Biochemistry 43 1072

10308-10313 1073

Zak E Norling B Maitra R Huang F Andersson B and Pakrasi HB (2001) The 1074

initial steps of biogenesis of cyanobacterial photosystems occur in plasma membranes 1075

Proc Natl Acad Sci USA 98 13443-13448 1076

Zang X Liu B Liu S Arunakumara KKIU and Zhang X (2007) Optimum 1077

Conditions for Transformation of Synechocystis sp PCC 6803 J Microbiol 45 241-1078

245 1079

Zhang L and Sakamoto W (2015) Possible function of VIPP1 in maintaining chloroplast 1080

membranes Biochim Biophys Acta 1847 831-837 1081

Zimmerberg J and Kozlov MM (2006) How proteins produce cellular membrane 1082

curvature Nat Rev Mol Cell Biol 7 9-19 1083

Zoumlfel P (1988) Statistik in der Praxis (Stuttgart Germany Gustav Fischer Verlag) 1084

1085

34

Figure Legends 1086

Figure 1 General characteristics of CurT A) Sequence alignment of CurT and CURT1A-D 1087

from A thaliana Predicted chloroplast transit-peptide sequences of CURT1A-D are omitted 1088

(Armbruster et al 2013) Positions of predicted C-terminal transmembrane domains (TDM) 1089

are marked (black bar) as is the position of the predicted amphipathic N-terminal helix in 1090

CurT (red bar) The green bar denotes the peptide sequence used for antibody production 1091

Identical and related amino acids that are conserved in 100 80 and 60 of the sequences 1092

are highlighted in black dark grey and light grey respectively B) Helical-wheel 1093

representation of the N-terminal amphipathic helix of CurT (red bar in A) The color code 1094

reflects the physicochemical properties of amino-acid side-chains green polar and 1095

uncharged blue polar and positively charged red polar and negatively charged yellow 1096

hydrophobic C) Solubility of CurT Membrane-associated proteins (50 microg) from wild-type 1097

cells were extracted with 5 mM HEPES (pH 76) containing either 1 M NaCl 01 M Na2CO3 1098

4 M urea 01 Triton X-100 or no additional solute After separation of membrane-bound 1099

(M) and solubilized (S) proteins by centrifugation proteins were fractionated by SDS-PAGE1100

and CurT was immunodetected on immunoblots As a control the integral membrane protein 1101

CP47 from PSII was analyzed in parallel D) Transmission electron micrographs of negatively 1102

stained liposomes Cell-free expression (CFE) of CurT and A thaliana CURT1A was 1103

performed in the presence of liposomes similar in composition to the lipids of the thylakoid 1104

membrane Liposomes before and after cell-free protein expression in the absence of DNA 1105

served as negative controls Black arrowheads indicate tubular connections between 1106

liposomes Scale bars 250 nm 1107

1108

Figure 2 Ultrastructural analysis of curT- cells Transmission electron micrographs of typical 1109

wild-type (A) and curT- (B-D) Synechocystis 6803 cells taken at 44000times (A B) and 28000times 1110

(C D) magnification respectively Ultrathin sections (35 to 45 nm) of cryofixed samples 1111

were stained with osmium tetroxide and post-stained using lead citrate Arrowheads indicate 1112

biogenesis centers Scale bars 200 nm (A B) and 500 nm (C D) respectively 1113

1114

Figure 3 Accumulation of components of photosynthetic complexes in the curT- mutant A) 1115

Whole cell extracts (30 microg protein) from wild-type and curT- strains were fractionated by 1116

SDS-PAGE and analyzed on immunoblots using the indicated antibodies B) The histogram 1117

shows levels of the indicated proteins in curT- extracts relative to wild-type samples (dashed 1118

red line) Data are means plusmn SD of three independent experiments Significant differences from 1119

35

wild-type protein levels according to Studentrsquos t-test with error probabilities of 5 and 1 1120

are indicated by and respectively 1121

1122

Figure 4 P700+ reduction kinetics and high-light effects in curT- cells A) Averaged traces 1123

(10 single measurements) of P700+ decay after complete oxidation by a 50-ms multiple 1124

turnover pulse (10000 micromol photons m-2 s-1) in the absence and presence of 10 microM DCMU 1125

B) Rate constants for P700+ reduction were obtained by fitting of the data with single1126

exponential functions Error bars indicate the SD of three independent measurements C) 1127

Impact of light intensity on the (relative) electron transport rate (rETR) Cells were exposed to 1128

gradually increasing light intensities which resulted in increasing electron transport until the 1129

capacity limit was reached PAR light intensity (micromol photons m-2 s-1) Error bars indicate the 1130

SD of three independent measurements D) D1 protein level in wild-type and curT- after high-1131

light treatment (800 micromol photons m-2s-1) in the presence and absence of lincomycin Samples 1132

were taken every 30 min and processed as in Figure 3 to determine the level of D1 present 1133

100 refers to wild-type D1 level at the beginning of the experiment 1134

1135

Figure 5 PSII assembly in curT- cells A) BNSDS-PAGE of membrane proteins Membrane 1136

fractions from wild-type and curT- cells were solubilized with 13 n-dodecyl-β-maltoside 1137

and proteins were fractionated by two-dimensional BNSDS-PAGE blotted and probed with 1138

antibodies against the PSII subunits D1 D2 CP47 and CP43 Wild-type blots were also 1139

probed with the αCurT antibody The sizes of marker proteins and the positions of PSII 1140

assembly intermediates (RCCII RCCI RC47) are shown above and below each image B) In 1141

vivo pulse labeling of membrane proteins with 35S Pulse-labeled PSII core proteins were 1142

separated via BNSDS-PAGE and visualized by autoradiography 1143

1144

Figure 6 Loss of CurT induces stress A) Low-temperature (77 K) fluorescence emission of 1145

Synechocystis 6803 wild-type (blue) and curT- (red) cells excited at 440 nm The spectra were 1146

normalized to the added fluorescein standard B) Low-temperature (77 K) fluorescence 1147

emission of Synechocystis 6803 wild-type (blue) and curT- (red) excited at 580 nm The 1148

spectra were normalized to 780 nm C) Level of IsiA in the curT- mutant relative to the wild-1149

type A mean value of 368 plusmn 96 (SD) was determined from three independent experiments 1150

1151

Figure 7 Membrane sublocalization of PSII-related factors Cell extracts from wild-type and 1152

curT- cells were fractionated by two consecutive rounds of sucrose-density gradient 1153

36

centrifugation (Schottkowski et al 2009b) The second linear gradient (20-60 sucrose) was 1154

apportioned into 14 fractions which were analyzed by immunoblotting using the indicated 1155

antibodies Fractions 1ndash6 represent PDMs and fractions 7ndash14 thylakoid membranes (TMs) 1156

To facilitate comparison between gradients sample volumes were normalized to the volume 1157

of fraction 7 that contained 40 microg of protein 1158

1159

Figure 8 Live-cell imaging of the curT-CFP strain by fluorescence microscopy In the curT-1160

CFP strain the native curT gene has been replaced by a CFP-tagged version resulting in the 1161

expression of the CurT-CFP fusion protein under the control of the native promotor A) 1162

Close-up views of the mid-cell plane in the CFP and far-red autofluorescence channels shown 1163

in slice 7 in panel B B) Synechocystis 6803 cells expressing CurT C-terminally fused to the 1164

mTurquoise2 variant of CFP from its native chromosomal promoter The two imaging 1165

channels are displayed as Z-axis montages (auto-scaled contrast step size 250 nm) in 1166

grayscale and color composite configuration The thylakoid autofluorescent channel as 1167

imaged in far-red fluorescence is depicted in magenta and CurT signal as imaged in cyan 1168

fluorescence is depicted in cyan C) Fluorescence intensity profiles of the two channels along 1169

the autofluorescent peripheral cell ldquoringrdquo are shown for slice 7 The maximum projection of 1170

the entire Z montage is also shown Scale bars (light grey) 2 microm 1171

1172

Figure 9 Immunofluorescence detection of CurT A) Close-ups of slice 5 in panel B B) 1173

Wild-type Synechocystis 6803 cells labeled with αCurT antibodies and detected with Oregon 1174

Green-conjugated secondary antibodies The Z-axis montages are shown as in Figure 8B 1175

except that the step size is 280 nm (1 to 10) C) Intensity profiles of the two channels along 1176

the autofluorescent peripheral cell ldquoringrdquo are shown for slice 5 The maximum projection of 1177

the entire Z montage is also shown Scale bars (light grey) 2 microm 1178

1179

Figure 10 Subcellular localization of CurT Ultrathin sections of wild-type Synechocystis 1180

6803 cells were incubated with rabbit αCurT prior to incubation with gold-conjugated goat 1181

anti-rabbit IgG A) Negative control (wild-type processed without addition of primary 1182

antibody) B C) Immunogold-labeled sections showing CurT localization at the cytoplasmic 1183

side of the thylakoid membrane D) Cluster formation of CurT signals at a putative biogenesis 1184

center from C E) Biogenesis center from the same cell (C) without any obvious CurT 1185

clustering of gold particles F) Schematic depiction of a wild-type cell (from Figure 2A) with 1186

color-coded curved membranes green = thylakoids that follow the curvature of the cell red = 1187

37

thylakoids that bend away from the plasma membrane yellow = thylakoids that bend toward 1188

the plasma membrane to converge on sites of biogenesis centers G) Relative distribution of 1189

gold signals between convex (dark color) and concave (light color) sides of membranes (n = 1190

1584 signals from a total of 95 cells) The undifferentiated overall signal distribution is given 1191

in blue Bars = 200 nm (overview) and 100 nm (details) 1192

1193

Figure 11 Differentially modified forms of CurT are found in different complexes in PDMs 1194

and thylakoid membranes Samples were isolated by fractionation of wild-type membranes 1195

via two consecutive sucrose density gradients according to Schottkowski et al (2009b) After 1196

density centrifugation samples were applied to BNSDS-PAGE analysis (A) or isoelectric 1197

focusing (B) Numbers on the right indicate the respective fraction from the second gradient 1198

(see Figure 7) Fraction 5 represents the PDMs and fraction 9 the thylakoid membrane 1199

1200

Figure 12 Loss of CurT increases sensitivity to abiotic stress A B) Doubling times of wild-1201

type and curT- under salt stress (A) or osmotic stress (B) Doubling times are means plusmn SD of 1202

three independent cultures C) Localization of CurT-CFP under salt and osmotic stress 1203

Samples were examined as described in Figure 8 Scale bars 1 microm D) Protein levels of wild-1204

type cells after growth in BG11 medium containing 500 mM NaCl Samples were analyzed on 1205

the same gel but unrelated samples between the presented signals were omitted E) 1206

Membrane preparations obtained from wild-type cells wild-type cells grown in the presence 1207

of 500 mM NaCl and curT- cells were subjected to the first gradient step in the membrane 1208

fractionation scheme The gradient was divided into five fractions and 10 of fractions I-IV 1209

and 02 of fraction V were analyzed by SDS-PAGE Fraction II includes the plasma 1210

membrane and fraction V consists of PratA-defined membrane and thylakoid membrane 1211

1212

Figure 13 Model of CurT distribution at convergence zones in Synechocystis 6803 The 1213

distribution of CurT in thylakoid (green) and plasma membranes (brown) is shown The 1214

pattern of localization of CurT in the thylakoid membrane is derived from membrane 1215

fractionation via sucrose density centrifugation fluorescence-based detection of the CurT-1216

CFP fusion and endogenous CurT and immunogold labeling experiments (Figures 7-10) The 1217

different CurT variants a b c and d identified in the IEF experiments (Figure 11) are depicted 1218

in yellow pink blue and black respectively CurT present in the plasma membrane is 1219

highlighted in gray as its precise nature and role remain to be defined (Figure 12) 1220

Membranes are represented as lipid bilayers Convex and concave faces of bent thylakoid 1221

38

sheets are indicated by black arrows The PDM which is dedicated to PSII assembly and 1222

repair is depicted in blue The dotted blue line emphasizes that the ultrastructure in this region 1223

has not yet been fully resolved PP periplasm PM plasma membrane TM thylakoid 1224

membrane L lumen PDM PratA-defined membrane 1225

1226

Tables 1227

Table 1 Physiological characteristics of the curT- mutant 1228

Strain Doubling time [h]

Oxygen Evolution[nmol h-1 OD750

-1]c

Chlorophyll content

[microg OD750-1]

d

Cell size [microm]e

Cell number [ml-1 OD750

-1]f

Wild type 817plusmn017a 1600plusmn042

b 1933plusmn187 251plusmn014 264plusmn020 390plusmn006 x 107

curT- 1259plusmn020a 3226plusmn056

b 1074plusmn20 195plusmn029 274plusmn044 367plusmn016 x 107

1229 abDoubling times in the presence (a) or absence (b) of 5 mM glucose measured under 1230

continuous illumination at 30 micromol photons m-2 s-1 and CO2-limiting conditions cOxygen 1231

evolution is expressed in nmol O2 produced per hour per OD750 unit dChlorophyll content is 1232

expressed in microg OD750-1 eThe diameter of non-dividing cells is presented in microm fCell number 1233

was determined per ml per OD750 Data are means plusmn SD of at least three independent 1234

experiments 1235

1236

Parsed CitationsAllen JF de Paula WBM Puthiyaveetil S and Nield J (2011) A structural phylogenetic map for chloroplast photosynthesisTrends Plant Sci 16 645-655

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Anderson JM Horton P Kim E-H and Chow WS (2012) Towards elucidation of dynamic structural changes of plant thylakoidarchitecture Philos Trans R Soc Lond B Biol Sci 367 3515-3524

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Armbruster U Zuumlhlke J Rengstl B Kreller R Makarenko E Ruumlhle T Schuumlnemann D Jahns P Weisshaar B NickelsenJ and Leister D (2010) The Arabidopsis thylakoid protein PAM68 is required for efficient D1 biogenesis and photosystem IIassembly Plant Cell 22 3439-3460

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Armbruster U Labs M Pribil M Viola S Xu W Scharfenberg M Hertle AP Rojahn U Jensen PE Rappaport F JoliotP Doumlrmann P Wanner G and Leister D (2013) Arabidopsis CURVATURE THYLAKOID1 proteins modify thylakoid architectureby inducing membrane curvature Plant Cell 25 2661-2678

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Aseeva E Ossenbuumlhl F Sippel C Cho WK Stein B Eichacker LA Meurer J Wanner G Westhoff P Soll J andVothknecht UC (2007) Vipp1 is required for basic thylakoid membrane formation but not for the assembly of thylakoid proteincomplexes Plant Physiol Biochem 45 119-128

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Bartsevich VV and Pakrasi HB (1995) Molecular identification of an ABC transporter complex for manganese analysis of acyanobacterial mutant strain impaired in the photosynthetic oxygen evolution process EMBO J 14 1845-1853

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Bartsevich VV and Pakrasi HB (1996) Manganese transport in the cyanobacterium Synechocystis sp PCC 6803 J Biol Chem271 26057-26061

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Bernaacutet G Waschewski N and Roumlgner M (2009) Towards efficient hydrogen production the impact of antenna size andexternal factors on electron transport dynamics in Synechocystis PCC 6803 Photosynth Res 99 205-216

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Boehm M Yu J Krynicka V Barker M Tichy M Komenda J Nixon PJ and Nield J (2012) Subunit Organization of aSynechocystis Hetero-Oligomeric Thylakoid FtsH Complex Involved in Photosystem II Repair Plant Cell 24 3669-3683

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Bradford MM (1976) A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle ofprotein-dye binding Anal Biochem 72 248-254

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Chang L Liu X Li Y Liu C-C Yang F Zhao J and Sui S-F (2015) Structural organization of an intact phycobilisome and itsassociation with photosystem II Cell Res 25 726-737

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Danielsson R Suorsa M Paakkarinen V Albertsson P-Aring Styring S Aro E-M and Mamedov F (2006) Dimeric andmonomeric organization of photosystem II Distribution of five distinct complexes in the different domains of the thylakoidmembrane J Biol Chem 281 14241-14249

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Daum B Nicastro D Austin J McIntosh JR and Kuumlhlbrandt W (2010) Arrangement of photosystem II and ATP synthase in

9

et al 2012) These biogenic membranes (PDMs) are marked by the PSII Mn2+ delivery factor 279

PratA and can be separated from thylakoids by a two-step sucrose-gradient centrifugation 280

procedure (Schottkowski et al 2009b Rengstl et al 2011) When the distributions of various 281

proteins within such membrane fractions from the wild-type and curT- were compared two 282

striking changes were detected in the mutant First the precursor of the D1 subunit of PSII 283

(pD1) is absent from PDMs in the mutant and secondly the inner antenna protein CP47 ndash but 284

not CP43 ndash of PSII shifts towards fractions of lower density (Figure 7) Hence the 285

organization of PDMs appears to be perturbed in curT- In wild-type cells most of the CurT 286

protein was found in thylakoid membranes only a minor fraction similar in amount to that of 287

the PSII assembly factors Ycf48 Pitt and YidC as well as the VIPP1 protein comigrated with 288

PDMs (Figure 7) According to rough estimates based on densitometric signal analysis 25 289

of total cellular CurT is normally found in the PDMs and 75 in the thylakoids (Figure 7) 290

To further analyze the localization of CurT in its cellular context in vivo we 291

constructed a translational fusion in which the monomeric enhanced cyan fluorescent protein 292

(CFP) mTurquoise2 (Goedhart et al 2012) is attached to the C-terminus of CurT and is 293

expressed under the control of the native curT promoter The resulting strain curT-CFP 294

showed a fully restored wild-type growth phenotype indicating that the CFP tag does not 295

affect CurTrsquos function (Supplemental Figure 7A) In agreement with this the fusion protein 296

accumulated to wild-type levels (96 plusmn 16 Supplemental Figure 7B) and localized to the 297

same membrane sub-fractions as does native CurT (Supplemental Figure 7C) The CurT-CFP 298

fluorescence signal was distinctly discernible above the wild-type autofluorescence 299

background (Supplemental Figure 8A) and was distributed in a network-like pattern with 300

concentrated areas at the cell periphery at mid-plane Analysis of CurT-CFP fluorescence in 301

Z-axis montages revealed that these signals often appeared as rod-like structures which 302

seemed to follow the spherical inner surface of the cell (Figure 8A B Supplemental Movie 1 303

and 2) In some cases these structures also appear to extend through the cytoplasm (Figure 304

8A and 8B Supplemental Movie 3) 305

When chlorophyll autofluorescence indicative of thylakoid membranes was visualized 306

in the same cell only a partial overlap with the CurT-CFP signal was observed (Figure 8 307

Supplemental Movie 1-3) Strikingly the peripheral CurT-CFP signals frequently reached 308

their maximal intensity in those areas where chlorophyll fluorescence was low ie where 309

thylakoid convergence zones are expected to form (Sacharz et al 2015) This becomes even 310

clearer when the intensity of a circumferential profile that follows the thylakoidrsquos 311

10

fluorescence signal is quantified separately for each of the two fluorescent channels (Figure 312

8C) 313

In contrast the chlorophyll autofluorescence in the curT- mutant seems to be evenly 314

distributed (Supplemental Figure 9) Following the fluorescence in an intensity profile as in 315

curT-CFP no regions with a similar decline in fluorescence were found most likely due to 316

the absence of biogenesis centers In addition some circular structures presenting chlorophyll 317

autofluorescence were detected in the interior of the cells Hence the disturbed curT- 318

ultrastructure is also reflected in the distribution of chlorophyll pigments (Supplemental 319

Figure 9) 320

To confirm the network-like distribution of CurT-CFP in the cell we used 321

immunofluorescence to detect CurT in the wild-type in situ Synechocystis 6803 cells were 322

fixed and treated with the αCurT antibody and an Oregon Green-conjugated secondary 323

antibody As shown in Figure 9A and B both techniques revealed similar network-like 324

patterns of the CurT signal which coalesced into rod-like structures at the cell surface and 325

essentially filled up the gaps between the autofluorescent thylakoid regions (negative controls 326

shown in Supplemental Figure 8B and 8C) Again regions of low chlorophyll fluorescence 327

typical of biogenesis centers generally exhibited stronger CurT-related fluorescence (Figure 328

8C) Occasionally CurT-CFP signals were also observed near traversing thylakoid lamellae 329

(when these were present in the cell analyzed) but the autofluorescence intensity of such 330

thylakoids is much weaker (see Figure 8B cell b in slice 6 and Supplemental Movie 3) 331

Finally CurT was localized by immunogold labeling experiments on ultrathin sections 332

of wild-type Synechocystis 6803 cells Almost no signals were detected when wild-type and 333

curT- sections were processed in the absence of the primary antibody as a negative control 334

(Figure 10A and Supplemental Figure 10A respectively) When mutant curT- cells were 335

processed in the presence of the αCurT antiserum a low level of randomly distributed 336

background signals was observed (Supplemental Figure 10B Supplemental Table 1) 337

However the number of signals located at the thylakoid membrane was clearly reduced 338

relative to the wild-type Therefore these signals were treated as non-specific background 339

Upon incubation of wild-type cell sections with antibodies directed against the N-terminus of 340

CurT (Figure 1A) the antigen was detected on the cytoplasmic surface of thylakoid 341

membranes (Figure 10B and 10C) This strongly suggests that its N-terminus is oriented 342

towards the cytoplasm Overall CurT signals appeared to be distributed along both thylakoids 343

and PDMs This agrees with the broad distribution of CurT across various fractions in the 344

membrane fractionation experiments (Figure 7) In only a few cases (12 ) however was 345

11

some clustering of immunogold signals at thylakoid convergence regions found (Figure 10D 346

and 10E) Thus the high local concentration of CurT at biogenic centers seen in the 347

fluorescence-based approaches (Figures 8 and 9) was not quantitatively reflected in the 348

immunogold labeling data This is likely due to the fact that immunogold electron microscopy 349

can only detect antigens on the surface of the section This issue is further complicated by the 350

heterogeneity of the CurT assemblies (see below and Discussion section) 351

Nevertheless closer inspection of the immunogold signals revealed an asymmetric 352

distribution of CurT signals with regard to the two faces of thylakoid sheets As illustrated in 353

Figure 10G curved thylakoid sheets possess a longer convex and a shorter concave face 354

When we analyzed a total of approximately 1500 CurT immunogold signals (from a total of 355

95 cells) which were unambiguously located to one side of the thylakoid membrane (for a 356

representative example see Supplemental Figure 11) 561 were found to be located at the 357

convex face while the other 439 localized to the concave side (Figure 10G Supplemental 358

Table 2) When differently curved regions (Figure 10F) including thylakoid lamellae (i) that 359

follow the overall shape of the cell (green) (ii) bend away from the plasma membrane (red) or 360

(iii) towards it ie where thylakoids converge to form biogenesis centers (yellow) were 361

examined separately red and green regions showed a CurT distribution in the range of 55 362

convex to 45 concave (Figure 10G Supplemental Table 2) However at the biogenesis 363

centers (the regions highlighted in yellow in Figure 10F) the uneven distribution of the 364

immunogold signals was more pronounced 61 of signals were found on the convex side 365

and 39 on the concave face of thylakoid lamellae (Figure 10G Supplemental Table 2) 366

Statistical analyses confirmed the significance of these differences in signal distributions 367

along the thylakoid membrane types (Supplemental Table 3) 368

Taken together with the finding that CurT is required for the formation of the 369

convergence sites forming biogenesis centers these data are consistent with the idea that the 370

thylakoid sheets are shaped by CurT which induces membrane curvature via asymmetric 371

intercalation on the two sides of thylakoid sheet 372

373

Different forms of CurT are found in PDMs and thylakoids 374

CurT was found to localize to both highly curved PDMs and less bent thylakoids Its 375

high local concentration at biogenic centers as seen in the fluorescence-based approaches 376

suggests a dosage-dependent effect of CurT on membrane shaping An alternative possibility 377

is that different CurT variants might exist in the two membrane types which could potentially 378

serve different functions To explore this possibility we asked whether CurT is found in 379

12

different complexes by using 2D BNSDS-PAGE to characterize membrane material isolated 380

via two-step sucrose gradient centrifugation (see Figure 7) In accordance with the data in 381

Figure 5A we find several low-molecular-weight complexes containing CurT (Figure 11A) 382

Smaller complexes of ~80 (complex I) and ~100 kDa (complex II) accumulate in membrane 383

fraction 5 (representing PDMs) but these are far less prevalent in fraction 9 representing 384

thylakoids (Figure 11A) In addition CurT-containing sub-complexes of ~140 (complex III) 385

and ~200 kDa (complex IV) are more prominently represented in thylakoids together with 386

even larger complexes ranging up to 670 kDa (Figure 11A) 387

Even more strikingly PDMs and thylakoids also differ with respect to the forms of 388

CurT they contain Thus isoelectric focusing (IEF) analysis of both membrane fractions 389

revealed at least four different CurT isoforms (a-d Figure 11B) PDMs contain mainly forms 390

b and d as well as trace amounts of a while thylakoids apparently possess very low levels of 391

form d and accumulate forms a b and c (Figure 11B) The nature of the underlying CurT 392

modifications still has to be determined Interestingly however CurT has recently been 393

identified as a phosphoprotein in a proteomic study (Spaumlt et al 2015) and the CurT variants 394

in Figure 11B may differ in their phosphorylation states At all events PDMs and thylakoids 395

can be distinguished by their complement of CurT isoforms which potentially play a role in 396

formation of the CurT sub-complexes that define the two membrane fractions 397

398

CurT is involved in the osmotic stress response 399

To further explore the stress-related role of CurT (Figure 6) and its link to IsiA 400

induction the effect of other potential stressors on curT- cells was tested High light levels had 401

a minor effect on curT- growth and its photosynthetic performance (Figure 4 Supplemental 402

Figure 5 and section above) suggesting that other environmental factors induced isiA 403

expression Our search was also motivated by a previous proteomic survey of plasma 404

membrane proteins of Synechocystis 6803 in high salt conditions in which CurT and VIPP1 405

were found among the most highly induced targets (Huang et al 2006) First we cultured 406

wild-type and curT- cells in different salt concentrations and found that growth of curT- was 407

severely affected in high salt (Figure 12A) Wild-type cells were only slightly affected by the 408

addition of salt to the medium The deleterious effect of the loss of curT on growth was even 409

more pronounced when maltose an osmotically active compound was present in the medium 410

(Figure 12B) Indeed curT- cells failed to survive exposure to 150 mM maltose whereas 411

growth of the wild-type was only slightly compromised These findings assign an additional 412

function to CurT ie a protective role during osmotic stress 413

13

When the curT-CFP strain was analyzed under these stress conditions enhanced 414

accumulation of CurT at the cell periphery was found mostly outside the autofluorescent 415

thylakoids and consistent with accumulation at the plasma membrane (Figure 12C) This was 416

further substantiated by membrane fractionation experiments which also revealed an 417

increased relative abundance of CurT in the plasma membrane fraction in the first sucrose 418

gradient (Figure 12E) Determination of total cellular CurT levels demonstrated that its 419

absolute amount did not increase under stress (Figure 12D) Therefore its higher abundance 420

in the plasma membrane under osmotic stress is likely to be due to CurT trafficking towards 421

the plasma membrane instead of increased synthesis 422

The same appears to hold true for VIPP1 which has been implicated in membrane 423

maintenance in both cyanobacteria and chloroplasts (Zhang and Sakamoto 2015) At stress 424

conditions an increase of the VIPP1 signal in the plasma membrane can be monitored in 425

wild-type (Figure 12E) However enhanced accumulation of VIPP1 in plasma membranes is 426

unaffected in the curT- mutant suggesting that thylakoid convergence zones are not strictly 427

required for the localization of VIPP1 428

429

Discussion 430

CurT determines thylakoid architecture 431

This study demonstrates that the protein CurT a homolog of the grana-forming 432

CURT1 proteins in plants is essential for establishing the proper thylakoid membrane 433

architecture in the cyanobacterium Synechocystis 6803 In particular CurTrsquos membrane-434

bending activity is likely to be required for the formation of thylakoid biogenesis centers at 435

points on the cell periphery where thylakoids converge towards the plasma membrane Here 436

PratA-mediated preloading of early PSII assembly intermediates with Mn2+ ions has been 437

proposed to take place together with PSII repair (Stengel et al 2012 Sacharz et al 2015) 438

This idea is supported by the following lines of evidence (i) The curT- mutant is devoid of 439

any thylakoid sectors that have convergence zones at their distal ends instead thylakoid 440

membranes are displaced and disposed as disordered or continuous rings (ii) CurT similarly 441

to CURT1A possesses a membrane-curving activity in vitro and intercalates asymmetrically 442

into thylakoids (iii) A high local concentration of CurT is observed at regions of high 443

curvature where biogenesis centers are found (iv) Lack of CurT affects the formation and 444

accumulation of PSII complexes as well as the abundance of some of its assembly factors 445

The drastic effects of CurT inactivation indicate an important role for this factor in membrane 446

shaping In contrast to the situation for CURT1A from Arabidopsis attempts to stably 447

14

overexpress CurT in Synechocystis 6803 failed Although short-lived transient increases in 448

CurT levels were observed when curT was expressed via strong heterologous promoters 449

wild-type levels of the protein were restored during subsequent rounds of cultivation of 450

transgenic lines Apparently Synechocystis 6803 cells do not tolerate substantial alterations in 451

CurT dosage and counter-select against these 452

This is in agreement with a dosage-dependent membrane-curving activity of CurT 453

which is suggested by its high local concentration at the edges of thylakoid autofluorescent 454

regions which mark the sites of the highly curved thylakoid convergence zones (Figures 8 9 455

and 13 Supplemental Movie 1 2 and 3) In addition some CurT was detected in structures 456

extending through the cytoplasm which most likely represent thylakoid sheets traversing the 457

cell from one thylakoid convergence zone to another (Figures 2A and 8) CurT might be 458

involved in the formation and stabilization of these structures 459

Members of the CURT1 family contain an N-terminal amphipathic α-helix that may 460

be involved in the membrane-bending activity of CurT (Armbruster et al 2013) Several 461

eukaryotic membrane-shaping proteins possess amphipathic helices as part of either an ENTH 462

(epsin N-terminal homology) or an N-BAR (Bin amphiphysin Rvs with N-terminal 463

amphipathic helix) domain (Ford et al 2002 Gallop and McMahon 2005 Zimmerberg and 464

Kozlov 2006) ENTH and N-BAR domains are rather large (~200 amino acids) and it has 465

been shown that amphipatic helices present in those domains insert into one leaflet of the lipid 466

bilayer and thereby induce curvature of the membrane (reviewed by Gallop and McMahon 467

2005 Zimmerberg and Kozlov 2006) However CurT itself is a small protein (149 amino 468

acids) that contains two transmembrane domains which insert into both leaflets of the lipid 469

bilayer (Figure 1A) as already suggested by Armbruster et al (2013) The amphipathic helix 470

faces the cytoplasm in Synechocystis 6803 or the stroma in A thaliana and most likely it 471

fine-tunes the degree of membrane bending mediated by CurT (Armbruster et al 2013) 472

In addition the increase in curvature correlated with CurT accumulation at convex 473

sides of thylakoid lamella (Figure 10 and 13) Hence curving might be mediated by 474

asymmetric integration of CurT into the lipid bilayers forming opposite faces of thylakoid 475

membrane sheets (Figure 13) However the mechanism causing this asymmetry remains 476

elusive 477

The presence of different CurT isoforms and complexes in PDMs and thylakoids adds 478

a further level of complexity and most likely reflects the dynamic regulation of this system 479

(Figure 11) The formation of different complexes might be primed by the phosphorylation of 480

CurT within its N-terminal cytoplasmic part (Spaumlt et al 2015) It seems likely that these 481

15

complexes play distinct roles in mediating the different CurT functions ie membrane 482

bending and maintenance 483

However it remains to be seen how exactly curvature is established maintained and 484

fine-tuned In addition other determinants of membrane topology and their putative interplay 485

with CurT have to be considered eg lipid and protein (complex) composition of 486

membranes cellular turgor pressure and other factors required for membrane 487

biogenesismaintenance eg the VIPP1 protein before precise molecular models of CurTrsquos 488

mode of action can be constructed (Rast et al 2015 and see below) That these other factors 489

can be crucial for membrane architecture is documented by the fact that some marine 490

cyanobacteria such as Prochlorococcus and Synechococcus contain curved thylakoids (but 491

no thylakoid convergence zones at the plasma membrane) although they lack a curT gene 492

493

The role of biogenesis centers 494

The absence of biogenesis centers in the curT- mutant now enables one to answer some 495

questions relating to the role of these thylakoid sub-structures which form in some but not all 496

cyanobacteria (Kunkel 1982 van de Meene et al 2006) First they are not essential since 497

even the curT- mutant still accumulates PSII to ~50 of wild-type levels On the other hand 498

in the mutant assembly of PSII is impaired as revealed by the increased accumulation of early 499

assembly intermediates In addition PSII dimers are almost completely absent in curT- 500

Whether the reduction in PSII dimers is attributable to an assembly problem linked to the 501

absence of biogenesis centers or to a secondary defect in dimer stabilization caused by 502

changes in overall thylakoid membrane ultrastructure remains to be determined Thus 503

biogenesis centers are more likely to represent evolutionary ldquoadd-onsrdquo that facilitated efficient 504

thylakoid biogenesis This is compatible with the fact that some cyanobacteria are devoid of 505

any biogenesis center-related substructures Second their absence compromises PSII but the 506

accumulation of other photosynthetic complexes ie PSI and the Cyt(b6f) complex is not 507

affected by CurT deficiency (Figure 3) This observation agrees with previous findings that 508

neither the PsaA subunit of PSI nor its assembly factor Ycf37 is detectable in isolated PDM 509

fractions (Rengstl et al 2011) 510

In addition to reduced de novo PSII assembly a higher relative stability of D1 in high-511

light experiments has been detected in curT- which suggests that D1 degradation during PSII 512

repair is less efficient in the mutant Photo-damaged D1 is degraded by the FtsH2FtsH3 513

complex which has previously been shown to partly localize to thylakoid convergence zones 514

at the cell periphery ie biogenesis centers (Boehm et al 2012 Sacharz et al 2015) It 515

16

therefore seems possible that the absence of biogenesis centers in curT- leads to 516

mislocalization of the FtsH2FtsH3 complex and less effective D1 degradation 517

Moreover a PSII related-function for CurT is supported by a meta-analysis of the 518

Synechocystis 6803 transcriptome When the CyanoEXpress 22 database (Hernaacutendez-Prieto 519

and Futschik 2012 Hernaacutendez-Prieto et al 2016) was queried for genes co-expressed with 520

curT (slr0483) genes for five PSII subunits ndash psbE psbO psbF psbL and psb30 ndash were 521

found among the first ten hits (Supplemental Table 4) From this we infer that biogenic 522

centers do not play an essential role in the assembly of all photosynthetic complexes but 523

serve to enhance PSII assemblyrepair possibly through the efficient delivery of Mn2+ 524

Residual PSII in curT- cells is likely to be supplied with cytoplasmic Mn2+ via a second 525

independently operating ABC transporter-based system in the plasma membrane named the 526

Mnt pathway (Bartsevich and Pakrasi 1995 Bartsevich and Pakrasi 1996) 527

Formally we cannot exclude that CurT is directly involved in the PSII assembly 528

process However considering CurTrsquos membrane bending capacity and the mutant phenotype 529

(Figure 1D and Figure 2) it appears more likely that CurT forms cellular substructures for 530

efficient PSII biogenesis ie biogenesis centers 531

As mentioned above some ultrastructural features of biogenesis centers have emerged 532

from studies employing EM-based tomography (van de Meene et al 2006) To date however 533

a high-resolution picture of the precise membrane architecture within these centers remains 534

elusive In particular whether or not a direct connection between plasma membrane and 535

thylakoids exists continues to be debated As recently discussed and in line with this gap in 536

knowledge different membrane fractionation techniques have revealed different distributions 537

of PSII-related subunits and assembly factors between plasma and thylakoid membranes 538

(Heinz et al 2016 Liberton et al 2016 Selatildeo et al 2016) The overall picture that emerges 539

is that the initial hypothesis that PSII biogenesis is initiated at the plasma membrane is no 540

longer tenable whereas a specialized thylakoid sub-fraction like the PDMs that make contact 541

with the plasma membrane could explain many of the available data and thus clarify some 542

aspects of the debate (Zak et al 2001 Pisareva et al 2011 Rast et al 2015) Moreover it 543

has previously been hypothesized that ldquoribosome-decorated membrane-like complexesrdquo 544

forming at the innermost thylakoid sheet might represent biogenic compartments (van de 545

Meene et al 2006 Mullineaux 2008) Whether these structures are affected in curT- cannot 546

be judged based on our TEM analysis but requires ultrastructural data of higher resolution 547

However the accessibility of thylakoids for ribosomes should be increased in the less 548

compressed membrane system of curT- (Figure 2B-D) 549

17

A scenario similar to that of Synechocystis 6803 holds for the situation in chloroplasts 550

of the green alga Chlamydomonas reinhardtii in which de novo PSII biogenesis has been 551

shown to be initiated in punctate regions named T-zones located close to the pyrenoid 552

(Uniacke and Zerges 2007) Unlike the mRNAs for the PSII components neither RNAs for 553

PSI subunits nor PSI assembly factors are localized to T-zones indicating that PSI and PSII 554

assembly processes are spatially separated (Uniacke and Zerges 2009 Nickelsen and Zerges 555

2013 Rast et al 2015) Interestingly a recent cryoelectron tomography study demonstrated 556

that next to T-zones at the chloroplast base-lobe junction the inner chloroplast envelope 557

exhibits invaginationsconnections to thylakoids that structurally resemble the organization of 558

cyanobacterial biogenesis centers (Engel et al 2015) For future investigations it will be 559

interesting to see if a homolog of the CURT1 family is involved in the formation of these 560

structures in C reinhardtii 561

562

Evolution of CURT1 function 563

Homologs of the CURT1 protein family can be found throughout cyanobacteria green 564

algae and plants (Armbruster et al 2013) The Arabidopsis CURT1A-D proteins have 565

recently been shown to induce bending of thylakoid membranes at grana margin regions 566

(Armbruster et al 2013) Interestingly and in contrast to the situation in Synechocystis 6803 567

their inactivation did not result in severe photosynthetic deficiencies although the thylakoids 568

formed lacked defined grana stacks Nevertheless the data available support the idea that the 569

function of thylakoid membrane structures that were regarded as being independent ie 570

cyanobacterial biogenesis centers and grana are closely related Intriguingly both of these 571

thylakoid membrane structures are dedicated to aspects of PSII function but do not involve 572

PSI (Pribil et al 2014) In both the prokaryotic and eukaryotic systems CURT1 homologs 573

appear to bend thylakoid membranes as indicated by (i) the distortion of membrane 574

ultrastructure seen in mutants devoid of curved thylakoids (ii) the localization of CURT1 575

homologs at grana margins and their local concentration at biogenesis centers (iii) the in vitro 576

membrane-curving activity of both CURT forms The phenotypic differences between 577

A thaliana and Synechocystis 6803 mutants may however be attributable to the different 578

functions of the membrane sub-compartments affected in the two model organisms Whereas 579

the role of grana is still under debate one function of the cyanobacterial biogenesis centers is 580

the above-mentioned high-throughput uptake of Mn2+ ions for efficient assembly of PSII 581

(Stengel et al 2012 Nickelsen and Rengstl 2013 Pribil et al 2014) However it appears 582

that in both cases the primary function of CURT1 proteins is to generate curved membrane 583

18

regions These discoveries suggest that until now two independently observed structures ie 584

cyanobacterial thylakoid biogenesis centers and chloroplast grana regions are closely related 585

The degree of curvature is much less pronounced in the cyanobacterial system As previously 586

discussed it was probably the subsequent evolution of a membrane-localized light-harvesting 587

system in chloroplasts that made the formation of tightly curved grana thylakoids possible 588

(Mullineaux 2005 Nevo et al 2012 Pribil et al 2014) 589

590

CurT is involved in osmotic stress response 591

One unexpected phenotype of the curT- mutant is its sensitivity to osmotic stress 592

These data revealed that in addition to shaping membranes CurT also influences their 593

functional integrity This latter function might be intrinsic to CurT or could be mediated by 594

the VIPP1 protein which has been shown to be required for membrane maintenance in 595

bacteria and chloroplasts probably by acting as a supplier of lipids (for an overview see 596

Zhang and Sakamoto 2015) Both factors accumulate in the plasma membrane upon osmotic 597

stress but VIPP1 localization is not severely affected by CurT inactivation which suggests 598

that VIPP1 operates independently of CurT In agreement with this repeated co-599

immunoprecipitations revealed no interaction between both proteins Therefore it remains to 600

be established whether a direct functional relationship between them exists 601

Previous investigations of osmotic stress in Synechocystis 6803 showed a kidney-602

shaped form of wild-type cells under very high concentrations of osmotically active 603

compounds (Marin et al 2006) The cells were severely deformed indicating changes in the 604

structure of the cellular envelope Since CurT shifts towards the plasma membrane already 605

under lower osmolyte concentrations we suggest a stabilizing function of CurT in the plasma 606

membrane CurT might be necessary to tolerate the forces trying to deform the cells under 607

osmotic stress 608

In conclusion this analysis has identified a crucial determinant for shaping and 609

maintaining the cyanobacterial thylakoid membrane system ie CurT a homolog of the 610

grana-forming CURT1 protein family from A thaliana In particular CurT is involved in the 611

formation of specific thylakoid substructures close to the plasma membrane at which PSII is 612

assembledrepaired Future work will dissect the precise ultrastructure of these centers and 613

enable us to elaborate a molecular model for the spatiotemporal organization of PSII assembly 614

in cyanobacteria 615

616

19

Methods 617

Strains and growth conditions 618

Wild-type and mutant Synechocystis 6803 cells were grown on solid or in liquid BG 619

11 medium (Rippka et al 1979) supplemented with 5 mM glucose (unless indicated 620

otherwise) at 30degC under continuous illumination at a photon irradiance of 30 μmol m-2 s-1 of 621

white light For growth during high-light experiments for investigation of D1 repair cells 622

were cultivated in a FMT150 photobioreactor (Photon Systems Instruments Draacutesov Czech 623

Republic) at 800 micromol photons m-2 s-1 in the presence or absence of lincomycin (100 microgml) 624

Cell density was monitored photometrically at 750 nm Doubling times were determined after 625

two days of growth To generate the insertion mutant curT- the curT gene (slr0483) was first 626

amplified from wild-type genomic DNA by PCR using the primer pair 04835 627

(GAAGCCTATTTAGCTAAGGCCGAAAG) and 04833 628

(TAGTACCTGGTCTTCCATGGCGT) and the resulting fragment was cloned into the 629

Bluescript pKS vector (Stratagene Waldbronn Germany) A kanamycin resistance cassette 630

was then inserted into the single AgeI restriction site (159 bp downstream of the start codon) 631

and this disruption construct was used to replace the wild-type gene as described (Wilde et al 632

2001) 633

634

Bioinformatic and computational analysis 635

CURT1 sequences of Synechocystis 6803 were obtained from CyanoBase 636

(httpgenomekazusaorjpcyanobaseSynechocystis) and CURT1 homologs in other 637

organisms were retrieved from NCBIBLAST (httpblastncbinlmnihgovBlastcgi) 638

Numbers and positions of putative transmembrane domains in the predicted proteins were 639

determined with TMHMM20 (httpwwwcbsdtudkservicesTMHMM) The sequence for 640

the N-terminal amphipathic helix was predicted by Jpred 3 641

(httpwwwcompbiodundeeacukwww-jpred) and plotted using a helical wheel projection 642

script (httprzlabucreduscriptswheelwheelcgi) The programs ClustalW2 643

(httpwwwebiacuktoolsclustalw2) and GeneDoc (httpwwwpscedubiomedgenedoc) 644

were used to generate multiple alignments of amino acid sequences Quantitative analysis of 645

immunoblots was performed with the AIDA Image Analyzer V325 (Raytest 646

Isotopenmessgeraumlte GmbH Straubenhardt Germany) 647

Co-expression patterns of curT were analyzed using the CyanoEXpress 22 database 648

(httpcyanoexpresssysbiolabeu Hernaacutendez-Prieto and Futschik 2012 Hernaacutendez-Prieto et 649

al 2016) 650

20

651

Measurement of chlorophyll concentration and oxygen production 652

Determination of chlorophyll content was carried out according to Wellburn and 653

Lichtenthaler (1984) For oxygen evolution measurements cells were grown in BG-11 654

without glucose harvested in mid-log phase and diluted to an OD750 nm = 05 Oxygen 655

evolution rates were measured with a Clark-type oxygen electrode (Hansatech Instruments 656

Ltd Kingrsquos Lynn Norfolk UK) at 1000 micromol photons m-2 s-1 (cool white light) after 5 min of 657

dark acclimation Oxygen evolution under saturating light conditions was measured without 658

any additives 659

660

Cell size and cell number estimation 661

Synechocystis 6803 strains were grown in liquid BG11 media containing 5 mM 662

glucose For cell size estimation the cells were analyzed with a confocal laser scanning 663

microscope TCS SP5 (Leica Wetzlar Germany) The diameter of the cells was measured 664

with the LAS AF Lite software (Leica Wetzlar Germany) Cells that were about to divide 665

were not taken into account For the determination of cell number cultures were set to an 666

OD750 = 1 and analyzed by using a Neubauer counting chamber (Paul Marienfeld GmbH amp 667

Co KG Lauda-Koumlnigshofen Germany) Statistical significance was determined by Studentrsquos 668

t-test 669

670

Measurements of P700+ reduction kinetics and relative electron transport rates 671

P700+ reduction kinetics and changes in chlorophyll fluorescence yield at different 672

light intensities were measured at a chlorophyll concentration of 5 microgml with a Dual-PAM-673

100 instrument (Heinz Walz GmbH Effeltrich Germany) Complete P700 oxidation was 674

achieved by a 50-ms multiple turnover pulse (10000 micromol photons m-2 s-1) after 2 min of dark 675

incubation P700+ reduction kinetics were recorded without any additions as well as in the 676

presence of 10 microM DCMU Ten technical replicates were averaged and fitted with single 677

exponential functions Data interpretation was done according to Bernaacutet et al (2009) 678

Light saturation measurements were performed according to Xu et al (2008) The 679

actinic light intensity was increased stepwise from 0 to 665 micromol photons m-2 s-1 with 30-s 680

adaptation periods Maximal fluorescence yields were obtained by applying saturating light 681

pulses (duration 600 ms intensity 10000 micromol photons m-2 s-1) 682

683

Low-temperature fluorescence measurements 684

21

Fluorescence emission spectra were measured with an AMINCO Bowman Series 2 685

Luminescence Spectrometer Wild-type and curT- cells were grown in the presence of 5 mM 686

glucose to mid log-phase and concentrated to 25 microgml chlorophyll adding 2 microM fluorescein 687

as an internal standard Samples (1 ml) were transferred to thin glass tubes dark-adapted for 688

30 min at 30 degC and shock frozen in liquid N2 To quantify chlorophyllfluorescein and 689

phycobilisome-mediated fluorescence samples were excited and emission recorded at 440 690

nm510 nm (chlorophyll and fluorescein excitationmax fluorescein emission) and 580 691

nm685 nm respectively Emission was scanned at 490-800 nm or at 640-800 nm 692

respectively 693

694

Antibody production and protein analysis 695

For generation of an αCurT antibody the N-terminal coding region of curT (amino 696

acid positions 1-58) was amplified by PCR using primers N04835 697

(AAGGATCCGTGGGCCGTAAACATTCAA) and N04833 698

(AAGTCGACGCACTTCCCACACCGGTTGTA) and cloned into the BamHI and XhoI sites 699

of the pGEX-4T-1 vector (GE Healthcare Freiburg Germany) Expression of the GST fusion 700

protein in Escherichia coli BL21(DE3) and subsequent affinity purification on Glutathione-701

Sepharose 4B (GE Healthcare) were carried out as described (Schottkowski et al 2009b) A 702

polyclonal antiserum was raised against this protein fragment in rabbits (Pineda Berlin 703

Germany) Other primary antibodies used in this study have been described previously ie 704

αpD1 (Schottkowski et al 2009b) αD1 (Schottkowski et al 2009b) αD2 (Klinkert et al 705

2006) αPratA (Klinkert et al 2004) αYcf48 (Rengstl et al 2011) αPitt (Schottkowski et 706

al 2009a) αPOR (Schottkowski et al 2009a) αYidC (Ossenbuumlhl et al 2006) αVIPP1 707

(Aseeva et al 2007) αSll0933 (Armbruster et al 2010) and αSlr0151 (Rast et al 2016) or 708

were purchased from Agrisera (Vaumlnnaumls Sweden) ie αCP43 αCP47 αPsaA αCyt f 709

αRbcL αIsiA The αGFP-HRP antibody was acquired from Miltenyi Biotech (Bergisch 710

Gladbach Germany) 711

Protein concentrations were determined according to Bradford (1976) using RotiQuant 712

(Carl Roth GmbH amp Co KG Karlsruhe Germany) Protein extraction membrane 713

fractionation on sucrose-density gradients and quantification of Western signal intensities was 714

performed as described previously (Rengstl et al 2011) Solubility properties of CurT were 715

determined according to Schottkowski et al (2009a) 716

22

Sucrose-density centrifugation separating PDM and thylakoid membrane fractions by 717

two consecutive gradients was carried out as described previously (Schottkowski et al 718

2009b Rengstl et al 2011) 719

Two-dimensional fractionations of cyanobacterial membrane proteins via BNSDS-720

PAGE and of pulse-labeled proteins by BNSDS-PAGE were performed as previously 721

reported (Klinkert et al 2004 Schottkowski et al 2009b Rengstl et al 2013) For the 722

analysis of native complexes in fractions obtained by sucrose-density centrifugation the 723

volume corresponding to 350 microg of protein in fraction 7 was applied to BNSDS-PAGE 724

For isoelectric focusing (IEF) the volume corresponding to 50 microg of protein from 725

fraction 7 in 200 microl of IEF buffer (8 M urea 4 CHAPS 1 IPG buffer pH 4-7 (GE 726

Healthcare)) was applied to an 11-cm Immobiline DryStrip pH 4-7 (GE Healthcare) in a 727

Protean IEF Cell (Bio-Rad Munich Germany) Strips were rehydrated for 12 h at 20 degC and 728

50V Focusing was carried out in the following steps 500 V rapid 1500 Vh 1000 V linear 729

880 Vh 6000 V linear 9680 Vh 6000 V rapid 5390 Vh 50 microA per gel focus temperature 730

20degC Subsequently the strips were incubated in equilibration buffer I (6 M urea 0375 M 731

Tris pH 88 20 glycerol 2 SDS 2 DTT) and equilibration buffer II (6 M urea 0375 732

M Tris pH 88 20 glycerol 2 SDS 25 iodoacetamide) for 10 min in each buffer 733

Then the IEF strips were applied to second-dimension SDS-PAGE 734

735

Transmission electron microscopy and immunogold labeling 736

Sample preparation for transmission electron microscopy including freeze substitution 737

and immunogold labeling of CurT was performed as described previously (Stengel et al 738

2012) Ultrathin sections were cut to thicknesses of 35 - 45 nm and 45 - 65 nm for 739

ultrastructural analyses and immunogold labeling respectively For immunogold labeling 740

sections collected on collodion-coated Ni grids were incubated for 18 h at 4degC with (rabbit) 741

αCurT (diluted 1100 1500 11000 or 14000 in blocking buffer (5 fetal calf serum) with 742

005 Tween 20) and further processed as described previously (Stengel et al 2012) As a 743

negative control wild-type Synechocystis 6803 cells were incubated without the primary 744

antibody and exposed to the gold-labeled anti-rabbit IgG To image the ultrastructure and the 745

immunogold-treated samples a Fei Morgagni 268 transmission electron microscope was used 746

and micrographs were taken at 80 kV 747

To avoid errors in the interpretation of the immunogold labeling experiment only 748

signals which were unambiguously localized to distinctly visible thylakoid membranes were 749

taken into account For each cell different regions (see Figure 10F) were defined and in each 750

23

region the signals on the convex and concave sides of the thylakoid membrane were analyzed 751

separately (see Supplemental Figure 11 for representative counts) Statistical significance was 752

assessed by χ2 test (Zoumlfel 1988) 753

For the analysis of clusters of CurT signals in biogenesis centers a cluster was defined 754

as a minimum of four signals in close proximity Overall 219 biogenesis centers were 755

examined with regard to CurT cluster formation 756

757

Preparation of proteoliposomes 758

Liposomes with a lipid mixture of 25 monogalactosyl diacylglycerol 42 759

digalactosyl diacylglycerol 16 sulfoquinovosyl diacylglycerol and 17 760

phosphatidylglycerol (Lipid Products South Nutfield UK) were prepared as described 761

previously (Armbruster et al 2013) To generate proteoliposomes CurT and CURT1A 762

proteins were expressed in the presence of liposomes for 3 h at 37degC using a PURExpress In 763

Vitro Protein Synthesis Kit (New England Biolabs Ipswich MA USA) The liposomes were 764

separated from the mix by centrifugation in a discontinuous sucrose gradient (100000 g 18 765

h) Subsequently the fraction containing the liposomes was extracted and dialyzed against 20 766

mM HEPES (pH 76) For transmission electron microscopy the proteoliposomes were 767

negatively stained with 1 uranyl acetate on a carbon-coated copper grid Micrographs were 768

taken on a Fei Morgagni 268 TEM at 80 kV 769

770

curT-CFP strain generation 771

Gibson assembly was used for single-step cloning (Gibson 2011) of the slr0483 gene 772

(together with its ~08 kb upstream region) the mTurquoise2 gene fragment the gentamycin-773

resistance cassette (aacC1) and an ~17-kb downstream region of slr0483 into pBR322 774

cleaved with EcoRV and NheI The slr0483 gene was fused in frame to the codon-optimized 775

mTurquoise2 (DNA20) preceded by a linker sequence encoding GSGSG The resulting 776

plasmid was used to transform Synechocystis 6803 as described previously (Zang et al 2007) 777

After ~ 10 days of incubation on BG11-GelRite (15 ) medium in the presence of 2 microgml 778

gentamycin several antibiotic resistant colonies were obtained and streaked out on fresh 779

medium These transformants were then tested for full segregation of the tagged allele by 780

colony PCR with primers flanking the slr0483 gene 781

782

Fluorescence microscopy 783

24

An aliquot of a cell suspension in mid-log phase was placed under a BG11-agarose 784

pad on a glass coverslip (15) and imaged on an inverted microscope (Zeiss 785

AxioObserverZ1) equipped with an ORCA Flash40 V2 (Hamamatsu) camera a Lumenecor 786

SOLA II Light Engine and a Plan-Apochromat 63x140 Oil DIC M27 (NA 14) objective 787

(Zeiss) Image acquisition was done with Zen 21 software in cyan and far-red fluorescence 788

channels (Zeiss Filter Sets 47 HE and 50) as Z-series with a step size of 250 nm and effective 789

pixel size of 103 nm Acquired image files were subsequently deconvolved (Constrained 790

Iterative Method) using a default theoretical Point Spread Function in Zen 20 (Zeiss) 791

Extraction of intensities for line profiles was performed by image thresholding the thylakoid 792

autofluorescence channel and eroding the resulting binary mask in Fiji (Schindelin et al 793

2012) 794

For immunofluorescence analysis cells were grown to mid-log phase as in the case of 795

the cells prepared for live-cell microscopy A 10-ml culture was fixed for 20 min in 37 796

formaldehyde and following extensive washing with phosphate-buffered saline (PBS) cells 797

were first permeabilized in 005 Triton-X for 20 min and then in lysis buffer (50 mM Tris-798

HCl 100 mM NaCl 5 mgml lysozyme) at 37degC for 2 h with gentle shaking To block 799

unspecific binding sites the cell pellet was incubated in 5 bovine serum albumin in PBS at 800

30degC for 1 h The αCurT serum (1500 dilution) was added to cells in fresh blocking buffer 801

for 1 h at 30degC with gentle shaking Cells were then washed three times with blocking buffer 802

and incubated with goat anti-rabbit IgG secondary antibodies conjugated to Oregon Green 488 803

(Invitrogen) (11000 dilution) under the conditions as for the primary antibodies Cells were 804

washed three times with PBS and prepared for microscopy as above Imaging was done as 805

described for live-cell microscopy except that a Colibri2 LED light source was employed for 806

illumination and a CoolSnap HQ camera (Photometrics) was used for image acquisition Cells 807

were imaged as Z-series (step size 280 nm) in the yellow and far-red fluorescent channels 808

(Zeiss Filter Sets 46 HE and 50) using the 505 nm and 625 nm LED modules Effective pixel 809

size in the final image was 102 nm Deconvolution and image analysis was done as described 810

above As judged by the staining intensity of the Oregon Green-conjugated antibodies 811

approximately half of the cells in any given field of view appeared to have been successfully 812

permeabilised a rate that is common in our experience No significant signal was detected in 813

the control sample that had not been exposed to the primary antibodies 814

815

25

Accession numbers 816

Sequence data from this article can be found in the CyanoBase and EMBLGenBank 817

data libraries under accession number slr0483 818

819

Supplemental Data 820

Supplemental Figure 1 Construction of the curT- mutant 821

Supplemental Figure 2 Growth phenotype of curT- 822

Supplemental Figure 3 Expression analysis of the open reading frame slr0482 (located 823

upstream of curT) in the curT- strain 824

Supplemental Figure 4 Absorbance spectra of curT- and wild-type cells 825

Supplemental Figure 5 High-light growth phenotypes of wild-type Synechocystis 6803 and 826

the curT- strain 827

Supplemental Figure 6 Ultrastructure of the TD41 mutant which lacks the psbA transcript 828

and the D1 protein 829

Supplemental Figure 7 Expression and localization of CurT-CFP 830

Supplemental Figure 8 Localization of CurT and CurT-CFP by fluorescence microscopy 831

Supplemental Figure 9 Chlorophyll autofluorescence of curT- 832

Supplemental Figure 10 The curT- mutant as a negative control for immunogold labeling 833

Supplemental Figure 11 Representative counts of immunogold signals 834

Supplemental Table 1 Overview of immunogold signals in curT- cells 835

Supplemental Table 2 Overview of immunogold signals in specific regions of Synechocystis 836

6803 wild-type cells 837

Supplemental Table 3 Statistical analysis of immunogold signals for wild-type 838

Synechocystis 6803 cells 839

Supplemental Table 4 Co-expression of curT 840

Supplemental Movie 1 Scan through the Z-axis of a curT-CFP cell 841

Supplemental Movie 2 Rendered 3D-model of a CurT-CFP detection 842

Supplemental Movie 3 Scan through the Z-axis of a curT-CFP cell with a traversing 843

thylakoid lamella 844

845

Acknowledgements 846

We thank Y Nishiyama for providing αpD1 and J Soll for αVIPP1 and αYidC antibodies 847

respectively and Nina Dyczmons-Nowaczyk for support with the fluorescence measurements 848

This work was supported by grants awarded to JN (Ni3909) MMN (NO 8363) and DL 849

26

(Le126529) by the Deutsche Forschungsgemeinschaft in the context of Research Unit 850

FOR2092 and the Cluster of Excellence RESOLV (EXC 1069) AG is a Howard Hughes 851

Medical Institute postdoctoral fellow in the laboratory of Erin OrsquoShea at Harvard University 852

LS was supported by a PhD fellowship from the Chinese Scholarship Council 853

854

Author Contributions 855

SH AR LS MMN DL and JN designed the research SH AR LS AG ILG EH ML BR 856

SV performed the research all authors contributed to data analysis SH AR and JN wrote the 857

paper 858

859

Competing Financial Interest statement 860

The authors declare no competing financial interests 861

862

We wish to dedicate this paper to Fabrice Rappaport an outstanding colleague and friend who 863

passed away so early 864

865

27

References 866

Allen JF de Paula WBM Puthiyaveetil S and Nield J (2011) A structural 867

phylogenetic map for chloroplast photosynthesis Trends Plant Sci 16 645-655 868

Anderson JM Horton P Kim E-H and Chow WS (2012) Towards elucidation of 869

dynamic structural changes of plant thylakoid architecture Philos Trans R Soc 870

Lond B Biol Sci 367 3515-3524 871

Armbruster U Zuumlhlke J Rengstl B Kreller R Makarenko E Ruumlhle T Schuumlnemann 872

D Jahns P Weisshaar B Nickelsen J and Leister D (2010) The Arabidopsis 873

thylakoid protein PAM68 is required for efficient D1 biogenesis and photosystem II 874

assembly Plant Cell 22 3439-3460 875

Armbruster U Labs M Pribil M Viola S Xu W Scharfenberg M Hertle AP 876

Rojahn U Jensen PE Rappaport F Joliot P Doumlrmann P Wanner G and 877

Leister D (2013) Arabidopsis CURVATURE THYLAKOID1 proteins modify 878

thylakoid architecture by inducing membrane curvature Plant Cell 25 2661-2678 879

Aseeva E Ossenbuumlhl F Sippel C Cho WK Stein B Eichacker LA Meurer J 880

Wanner G Westhoff P Soll J and Vothknecht UC (2007) Vipp1 is required for 881

basic thylakoid membrane formation but not for the assembly of thylakoid protein 882

complexes Plant Physiol Biochem 45 119-128 883

Bartsevich VV and Pakrasi HB (1995) Molecular identification of an ABC transporter 884

complex for manganese analysis of a cyanobacterial mutant strain impaired in the 885

photosynthetic oxygen evolution process EMBO J 14 1845-1853 886

Bartsevich VV and Pakrasi HB (1996) Manganese transport in the cyanobacterium 887

Synechocystis sp PCC 6803 J Biol Chem 271 26057-26061 888

Bernaacutet G Waschewski N and Roumlgner M (2009) Towards efficient hydrogen production 889

the impact of antenna size and external factors on electron transport dynamics in 890

Synechocystis PCC 6803 Photosynth Res 99 205-216 891

Boehm M Yu J Krynicka V Barker M Tichy M Komenda J Nixon PJ and Nield 892

J (2012) Subunit Organization of a Synechocystis Hetero-Oligomeric Thylakoid FtsH893

Complex Involved in Photosystem II Repair Plant Cell 24 3669-3683894

Bradford MM (1976) A rapid and sensitive method for the quantitation of microgram 895

quantities of protein utilizing the principle of protein-dye binding Anal Biochem 72 896

248-254897

28

Chang L Liu X Li Y Liu C-C Yang F Zhao J and Sui S-F (2015) Structural 898

organization of an intact phycobilisome and its association with photosystem II Cell 899

Res 25 726-737 900

Danielsson R Suorsa M Paakkarinen V Albertsson P-Aring Styring S Aro E-M and 901

Mamedov F (2006) Dimeric and monomeric organization of photosystem II 902

Distribution of five distinct complexes in the different domains of the thylakoid 903

membrane J Biol Chem 281 14241-14249 904

Daum B Nicastro D Austin J McIntosh JR and Kuumlhlbrandt W (2010) Arrangement 905

of photosystem II and ATP synthase in chloroplast membranes of Spinach and Pea 906

Plant Cell 22 1299-1312 907

Engel BD Schaffer M Kuhn Cuellar L Villa E Plitzko JM and Baumeister W 908

(2015) Native architecture of the Chlamydomonas chloroplast revealed by in situ 909

cryo-electron tomography eLife 4 e04889 910

Ford MGJ Mills IG Peter BJ Vallis Y Praefcke GJK Evans PR and McMahon 911

HT (2002) Curvature of clathrin-coated pits driven by epsin Nature 419 361-366 912

Fristedt R Willig A Granath P Cregravevecoeur M Rochaix J-D and Vener AV (2009) 913

Phosphorylation of photosystem II controls functional macroscopic folding of 914

photosynthetic membranes in Arabidopsis Plant Cell 21 3950-3964 915

Gallop JL and McMahon HT (2005) BAR domains and membrane curvature bringing 916

your curves to the BAR Biochem Soc Symp 72 223-231 917

Gibson DG (2011) Chapter fifteen - Enzymatic Assembly of Overlapping DNA Fragments 918

In Methods in Enzymology V Christopher ed (Academic Press) pp 349-361 919

Goedhart J von Stetten D Noirclerc-Savoye M Lelimousin M Joosen L Hink MA 920

van Weeren L Gadella TWJ and Royant A (2012) Structure-guided evolution of 921

cyan fluorescent proteins towards a quantum yield of 93 Nat Commun 3 751 922

Heinz S Liauw P Nickelsen J and Nowaczyk M (2016) Analysis of photosystem II 923

biogenesis in cyanobacteria Biochim Biophys Acta 1857 274-287 924

Hernaacutendez-Prieto M and Futschik M (2012) CyanoEXpress A web database for 925

exploration and visualisation of the integrated transcriptome of cyanobacterium 926

Synechocystis sp PCC6803 Bioinformation 8 634-638 927

Hernaacutendez-Prieto MA Semeniuk TA Giner-Lamia J and Futschik ME (2016) The 928

Transcriptional Landscape of the Photosynthetic Model Cyanobacterium 929

Synechocystis sp PCC6803 Sci Rep 6 22168 930

29

Huang F Fulda S Hagemann M and Norling B (2006) Proteomic screening of salt-931

stress-induced changes in plasma membranes of Synechocystis sp strain PCC 6803 932

Proteomics 6 910-920 933

Kirchhoff H (2013) Architectural switches in plant thylakoid membranes Photosynth Res 934

116 481-487 935

Klinkert B Elles I and Nickelsen J (2006) Translation of chloroplast psbD mRNA in 936

Chlamydomonas is controlled by a secondary RNA structure blocking the AUG start 937

codon Nucleic Acids Res 34 386-394 938

Klinkert B Ossenbuumlhl F Sikorski M Berry S Eichacker L and Nickelsen J (2004) 939

PratA a periplasmic tetratricopeptide repeat protein involved in biogenesis of 940

photosystem II in Synechocystis sp PCC 6803 J Biol Chem 279 44639-44644 941

Komenda J Nickelsen J Tichyacute M Praacutešil O Eichacker LA and Nixon PJ (2008) The 942

cyanobacterial homologue of HCF136YCF48 is a component of an early photosystem 943

II assembly complex and is important for both the efficient assembly and repair of 944

photosystem II in Synechocystis sp PCC 6803 J Biol Chem 283 22390-22399 945

Kopf M Klaumlhn S Scholz I Matthiessen JKF Hess WR and Voszlig B (2014) 946

Comparative analysis of the primary transcriptome of Synechocystis sp PCC 6803 947

DNA Res 21 527-539 948

Kunkel DD (1982) Thylakoid centers Structures associated with the cyanobacterial 949

photosynthetic membrane system Arch Microbiol 133 97-99 950

Liberton M Howard Berg R Heuser J Roth R and Pakrasi BH (2006) Ultrastructure 951

of the membrane systems in the unicellular cyanobacterium Synechocystis sp strain 952

PCC 6803 Protoplasma 227 129-138 953

Liberton M Saha R Jacobs JM Nguyen AY Gritsenko MA Smith RD 954

Koppenaal DW and Pakrasi HB (2016) Global Proteomic Analysis Reveals an 955

Exclusive Role of Thylakoid Membranes in Bioenergetics of a Model 956

Cyanobacterium Mol Cell Proteomics 15 2021-2032 957

Luque I and Ochoa de Alda JAG (2014) CURT1CAAD-containing aaRSs thylakoid 958

curvature and gene translation Trends Plant Sci 19 63-66 959

Marin K Stirnberg M Eisenhut M Kraumlmer R and Hagemann M (2006) Osmotic stress 960

in Synechocystis sp PCC 6803 low tolerance towards nonionic osmotic stress results 961

from lacking activation of glucosylglycerol accumulation Microbiology 152 2023-962

2030 963

Mullineaux CW (2005) Function and evolution of grana Trends Plant Sci 10 521-525 964

30

Mullineaux CW (2008) Biogenesis and dynamics of thylakoid membranes and the 965

photosynthetic apparatus In The Cyanobacteria A Herrero and E Flores eds 966

(Norfolk UK Caister Academic Press) pp 289ndash304 967

Nevo R Charuvi D Tsabari O and Reich Z (2012) Composition architecture and 968

dynamics of the photosynthetic apparatus in higher plants Plant J 70 157-176 969

Nickelsen J and Rengstl B (2013) Photosystem II assembly From cyanobacteria to plants 970

Annu Rev Plant Biol 64 609-635 971

Nickelsen J and Zerges W (2013) Thylakoid biogenesis has joined the new era of bacterial 972

cell biology Front Plant Sci 4 458 973

Nilsson F Simpson DJ Jansson C and Andersson B (1992) Ultrastructural and 974

biochemical characterization of a Synechocystis 6803 mutant with inactivated psbA 975

genes Arch Biochem Biophys 295 340-347 976

Odom WR Hodges R Chitnis PR and Guikema JA (1993) Characterization of 977

Synechocystis sp PCC 6803 in iron-supplied and iron-deficient media Plant Mol 978

Biol 23 1255-1264 979

Ossenbuumlhl F Inaba-Sulpice M Meurer J Soll J and Eichacker LA (2006) The 980

Synechocystis sp PCC 6803 Oxa1 homolog is essential for membrane integration of 981

reaction center precursor protein pD1 Plant Cell 18 2236-2246 982

Pisareva T Kwon J Oh J Kim S Ge C Wieslander Aring Choi J-S and Norling B 983

(2011) Model for Membrane Organization and Protein Sorting in the Cyanobacterium 984

Synechocystis sp PCC 6803 Inferred from Proteomics and Multivariate Sequence 985

Analyses J Proteome Res 10 3617-3631 986

Pribil M Labs M and Leister D (2014) Structure and dynamics of thylakoids in land 987

plants J Exp Bot 65 1955-1972 988

Rast A Heinz S and Nickelsen J (2015) Biogenesis of thylakoid membranes Biochim 989

Biophys Acta 1847 821-830 990

Rast A Rengstl B Heinz S Klingl A and Nickelsen J (2016) The role of Slr0151 a 991

tetratricopeptide repeat protein from Synechocystis sp PCC 6803 during Photosystem 992

II assembly and repair Front Plant Sci 7 605 993

Rengstl B Oster U Stengel A and Nickelsen J (2011) An Intermediate Membrane 994

Subfraction in Cyanobacteria Is Involved in an Assembly Network for Photosystem II 995

Biogenesis J Biol Chem 286 21944-21951 996

31

Rengstl B Knoppovaacute J Komenda J and Nickelsen J (2013) Characterization of a 997

Synechocystis double mutant lacking the photosystem II assembly factors YCF48 and 998

Sll0933 Planta 237 471-480 999

Rexroth S Mullineaux CW Ellinger D Sendtko E Roumlgner M and Koenig F (2011) 1000

The Plasma Membrane of the Cyanobacterium Gloeobacter violaceus Contains 1001

Segregated Bioenergetic Domains Plant Cell 23 2379-2390 1002

Rippka R Deruelles J Waterbury JB Herdman M and Stanier RY (1979) Generic 1003

Assignments Strain Histories and Properties of Pure Cultures of Cyanobacteria 1004

Microbiology 111 1-61 1005

Ruumltgers M and Schroda M (2013) A role of VIPP1 as a dynamic structure within 1006

thylakoid centers as sites of photosystem biogenesis Plant Signal Behav 8 e27037 1007

Sacharz J Bryan SJ Yu J Burroughs NJ Spence EM Nixon PJ and Mullineaux 1008

CW (2015) Sub-cellular location of FtsH proteases in the cyanobacterium1009

Synechocystis sp PCC 6803 suggests localised PSII repair zones in the thylakoid1010

membranes Mol Microbiol 96 448-4621011

Sandstroumlm S Park Y-I Oumlquist G and Gustafsson P (2001) CP43prime the isiA Gene 1012

Product Functions as an Excitation Energy Dissipator in the Cyanobacterium 1013

Synechococcus sp PCC 7942 Photochem Photobiol 74 431-437 1014

Schindelin J Arganda-Carreras I Frise E Kaynig V Longair M Pietzsch T 1015

Preibisch S Rueden C Saalfeld S Schmid B Tinevez J-Y White DJ 1016

Hartenstein V Eliceiri K Tomancak P and Cardona A (2012) Fiji an open-1017

source platform for biological-image analysis Nat Methods 9 676-682 1018

Schottkowski M Ratke J Oster U Nowaczyk M and Nickelsen J (2009a) Pitt a novel 1019

tetratricopeptide repeat protein involved in light-dependent chlorophyll biosynthesis 1020

and thylakoid membrane biogenesis in Synechocystis sp PCC 6803 Mol Plant 2 1021

1289-1297 1022

Schottkowski M Gkalympoudis S Tzekova N Stelljes C Schuumlnemann D Ankele E 1023

and Nickelsen J (2009b) Interaction of the periplasmic PratA factor and the PsbA 1024

(D1) protein during biogenesis of photosystem II in Synechocystis sp PCC 6803 J 1025

Biol Chem 284 1813-1819 1026

Selatildeo TT Zhang L Knoppovaaacute J Komenda J and Norling B (2016) Photosystem II 1027

Assembly Steps Take Place in the Thylakoid Membrane of the Cyanobacterium 1028

Synechocystis sp PCC6803 Plant Cell Physiol 57 878 1029

32

Spaumlt P Maček B and Forchhammer K (2015) Phosphoproteome of the cyanobacterium 1030

Synechocystis sp PCC 6803 and its dynamics during nitrogen starvation Front 1031

Microbiol 6 248 1032

Stengel A Guumlgel IL Hilger D Rengstl B Jung H and Nickelsen J (2012) Initial 1033

steps of photosystem II de novo assembly and preloading with manganese take place 1034

in biogenesis centers in Synechocystis Plant Cell 24 660-675 1035

Uniacke J and Zerges W (2007) Photosystem II assembly and repair are differentially 1036

localized in Chlamydomonas Plant Cell 19 3640-3654 1037

Uniacke J and Zerges W (2009) Chloroplast protein targeting involves localized 1038

translation in Chlamydomonas Proc Natl Acad Sci USA 106 1439-1444 1039

van de Meene AL Hohmann-Marriott M Vermaas WJ and Roberson R (2006) The 1040

three-dimensional structure of the cyanobacterium Synechocystis sp PCC 6803 Arch 1041

Microbiol 184 259-270 1042

van de Meene AML Sharp WP McDaniel JH Friedrich H Vermaas WFJ and 1043

Roberson RW (2012) Gross morphological changes in thylakoid membrane 1044

structure are associated with photosystem I deletion in Synechocystis sp PCC 6803 1045

Biochim Biophys Acta 1818 1427-1434 1046

Watanabe M and Ikeuchi M (2013) Phycobilisome architecture of a light-harvesting 1047

supercomplex Photosynth Res 116 265-276 1048

Wellburn AR and Lichtenthaler H (1984) Formulae and Program to Determine Total 1049

Carotenoids and Chlorophylls A and B of Leaf Extracts in Different Solvents In 1050

Advances in Photosynthesis Research Proceedings of the VIth International Congress 1051

on Photosynthesis Brussels Belgium August 1ndash6 1983 C Sybesma ed (Dordrecht 1052

Springer Netherlands) pp 9-12 1053

Wilde A Lunser K Ossenbuumlhl F Nickelsen J and Borner T (2001) Characterization of 1054

the cyanobacterial ycf37 mutation decreases the photosystem I content Biochem J 1055

357 211-216 1056

Wilson A Boulay C Wilde A Kerfeld CA and Kirilovsky D (2007) Light-Induced 1057

Energy Dissipation in Iron-Starved Cyanobacteria Roles of OCP and IsiA Proteins 1058

Plant Cell 19 656-672 1059

Xu M Bernaacutet G Singh A Mi H Roumlgner M Pakrasi HB and Ogawa T (2008) 1060

Properties of Mutants of Synechocystis sp Strain PCC 6803 Lacking Inorganic Carbon 1061

Sequestration Systems Plant Cell Physiol 49 1672-1677 1062

33

Yamamoto T Burke J Autz G and Jagendorf AT (1981) Bound ribosomes of Pea 1063

chloroplast thylakoid membranes location and release in vitro by high salt 1064

puromycin and RNase Plant Physiol 67 940-949 1065

Yang H Liao L Bo T Zhao L Sun X Lu X Norling B and Huang F (2014) 1066

Slr0151 in Synechocystis sp PCC 6803 is required for efficient repair of photosystem 1067

II under high-light condition J Integr Plant Biol 56 1136-1150 1068

Yeremenko N Kouřil R Ihalainen JA DHaene S van Oosterwijk N 1069

Andrizhiyevskaya EG Keegstra W Dekker HL Hagemann M Boekema EJ 1070

Matthijs HCP and Dekker JP (2004) Supramolecular Organization and Dual 1071

Function of the IsiA Chlorophyll-Binding Protein in Cyanobacteria Biochemistry 43 1072

10308-10313 1073

Zak E Norling B Maitra R Huang F Andersson B and Pakrasi HB (2001) The 1074

initial steps of biogenesis of cyanobacterial photosystems occur in plasma membranes 1075

Proc Natl Acad Sci USA 98 13443-13448 1076

Zang X Liu B Liu S Arunakumara KKIU and Zhang X (2007) Optimum 1077

Conditions for Transformation of Synechocystis sp PCC 6803 J Microbiol 45 241-1078

245 1079

Zhang L and Sakamoto W (2015) Possible function of VIPP1 in maintaining chloroplast 1080

membranes Biochim Biophys Acta 1847 831-837 1081

Zimmerberg J and Kozlov MM (2006) How proteins produce cellular membrane 1082

curvature Nat Rev Mol Cell Biol 7 9-19 1083

Zoumlfel P (1988) Statistik in der Praxis (Stuttgart Germany Gustav Fischer Verlag) 1084

1085

34

Figure Legends 1086

Figure 1 General characteristics of CurT A) Sequence alignment of CurT and CURT1A-D 1087

from A thaliana Predicted chloroplast transit-peptide sequences of CURT1A-D are omitted 1088

(Armbruster et al 2013) Positions of predicted C-terminal transmembrane domains (TDM) 1089

are marked (black bar) as is the position of the predicted amphipathic N-terminal helix in 1090

CurT (red bar) The green bar denotes the peptide sequence used for antibody production 1091

Identical and related amino acids that are conserved in 100 80 and 60 of the sequences 1092

are highlighted in black dark grey and light grey respectively B) Helical-wheel 1093

representation of the N-terminal amphipathic helix of CurT (red bar in A) The color code 1094

reflects the physicochemical properties of amino-acid side-chains green polar and 1095

uncharged blue polar and positively charged red polar and negatively charged yellow 1096

hydrophobic C) Solubility of CurT Membrane-associated proteins (50 microg) from wild-type 1097

cells were extracted with 5 mM HEPES (pH 76) containing either 1 M NaCl 01 M Na2CO3 1098

4 M urea 01 Triton X-100 or no additional solute After separation of membrane-bound 1099

(M) and solubilized (S) proteins by centrifugation proteins were fractionated by SDS-PAGE1100

and CurT was immunodetected on immunoblots As a control the integral membrane protein 1101

CP47 from PSII was analyzed in parallel D) Transmission electron micrographs of negatively 1102

stained liposomes Cell-free expression (CFE) of CurT and A thaliana CURT1A was 1103

performed in the presence of liposomes similar in composition to the lipids of the thylakoid 1104

membrane Liposomes before and after cell-free protein expression in the absence of DNA 1105

served as negative controls Black arrowheads indicate tubular connections between 1106

liposomes Scale bars 250 nm 1107

1108

Figure 2 Ultrastructural analysis of curT- cells Transmission electron micrographs of typical 1109

wild-type (A) and curT- (B-D) Synechocystis 6803 cells taken at 44000times (A B) and 28000times 1110

(C D) magnification respectively Ultrathin sections (35 to 45 nm) of cryofixed samples 1111

were stained with osmium tetroxide and post-stained using lead citrate Arrowheads indicate 1112

biogenesis centers Scale bars 200 nm (A B) and 500 nm (C D) respectively 1113

1114

Figure 3 Accumulation of components of photosynthetic complexes in the curT- mutant A) 1115

Whole cell extracts (30 microg protein) from wild-type and curT- strains were fractionated by 1116

SDS-PAGE and analyzed on immunoblots using the indicated antibodies B) The histogram 1117

shows levels of the indicated proteins in curT- extracts relative to wild-type samples (dashed 1118

red line) Data are means plusmn SD of three independent experiments Significant differences from 1119

35

wild-type protein levels according to Studentrsquos t-test with error probabilities of 5 and 1 1120

are indicated by and respectively 1121

1122

Figure 4 P700+ reduction kinetics and high-light effects in curT- cells A) Averaged traces 1123

(10 single measurements) of P700+ decay after complete oxidation by a 50-ms multiple 1124

turnover pulse (10000 micromol photons m-2 s-1) in the absence and presence of 10 microM DCMU 1125

B) Rate constants for P700+ reduction were obtained by fitting of the data with single1126

exponential functions Error bars indicate the SD of three independent measurements C) 1127

Impact of light intensity on the (relative) electron transport rate (rETR) Cells were exposed to 1128

gradually increasing light intensities which resulted in increasing electron transport until the 1129

capacity limit was reached PAR light intensity (micromol photons m-2 s-1) Error bars indicate the 1130

SD of three independent measurements D) D1 protein level in wild-type and curT- after high-1131

light treatment (800 micromol photons m-2s-1) in the presence and absence of lincomycin Samples 1132

were taken every 30 min and processed as in Figure 3 to determine the level of D1 present 1133

100 refers to wild-type D1 level at the beginning of the experiment 1134

1135

Figure 5 PSII assembly in curT- cells A) BNSDS-PAGE of membrane proteins Membrane 1136

fractions from wild-type and curT- cells were solubilized with 13 n-dodecyl-β-maltoside 1137

and proteins were fractionated by two-dimensional BNSDS-PAGE blotted and probed with 1138

antibodies against the PSII subunits D1 D2 CP47 and CP43 Wild-type blots were also 1139

probed with the αCurT antibody The sizes of marker proteins and the positions of PSII 1140

assembly intermediates (RCCII RCCI RC47) are shown above and below each image B) In 1141

vivo pulse labeling of membrane proteins with 35S Pulse-labeled PSII core proteins were 1142

separated via BNSDS-PAGE and visualized by autoradiography 1143

1144

Figure 6 Loss of CurT induces stress A) Low-temperature (77 K) fluorescence emission of 1145

Synechocystis 6803 wild-type (blue) and curT- (red) cells excited at 440 nm The spectra were 1146

normalized to the added fluorescein standard B) Low-temperature (77 K) fluorescence 1147

emission of Synechocystis 6803 wild-type (blue) and curT- (red) excited at 580 nm The 1148

spectra were normalized to 780 nm C) Level of IsiA in the curT- mutant relative to the wild-1149

type A mean value of 368 plusmn 96 (SD) was determined from three independent experiments 1150

1151

Figure 7 Membrane sublocalization of PSII-related factors Cell extracts from wild-type and 1152

curT- cells were fractionated by two consecutive rounds of sucrose-density gradient 1153

36

centrifugation (Schottkowski et al 2009b) The second linear gradient (20-60 sucrose) was 1154

apportioned into 14 fractions which were analyzed by immunoblotting using the indicated 1155

antibodies Fractions 1ndash6 represent PDMs and fractions 7ndash14 thylakoid membranes (TMs) 1156

To facilitate comparison between gradients sample volumes were normalized to the volume 1157

of fraction 7 that contained 40 microg of protein 1158

1159

Figure 8 Live-cell imaging of the curT-CFP strain by fluorescence microscopy In the curT-1160

CFP strain the native curT gene has been replaced by a CFP-tagged version resulting in the 1161

expression of the CurT-CFP fusion protein under the control of the native promotor A) 1162

Close-up views of the mid-cell plane in the CFP and far-red autofluorescence channels shown 1163

in slice 7 in panel B B) Synechocystis 6803 cells expressing CurT C-terminally fused to the 1164

mTurquoise2 variant of CFP from its native chromosomal promoter The two imaging 1165

channels are displayed as Z-axis montages (auto-scaled contrast step size 250 nm) in 1166

grayscale and color composite configuration The thylakoid autofluorescent channel as 1167

imaged in far-red fluorescence is depicted in magenta and CurT signal as imaged in cyan 1168

fluorescence is depicted in cyan C) Fluorescence intensity profiles of the two channels along 1169

the autofluorescent peripheral cell ldquoringrdquo are shown for slice 7 The maximum projection of 1170

the entire Z montage is also shown Scale bars (light grey) 2 microm 1171

1172

Figure 9 Immunofluorescence detection of CurT A) Close-ups of slice 5 in panel B B) 1173

Wild-type Synechocystis 6803 cells labeled with αCurT antibodies and detected with Oregon 1174

Green-conjugated secondary antibodies The Z-axis montages are shown as in Figure 8B 1175

except that the step size is 280 nm (1 to 10) C) Intensity profiles of the two channels along 1176

the autofluorescent peripheral cell ldquoringrdquo are shown for slice 5 The maximum projection of 1177

the entire Z montage is also shown Scale bars (light grey) 2 microm 1178

1179

Figure 10 Subcellular localization of CurT Ultrathin sections of wild-type Synechocystis 1180

6803 cells were incubated with rabbit αCurT prior to incubation with gold-conjugated goat 1181

anti-rabbit IgG A) Negative control (wild-type processed without addition of primary 1182

antibody) B C) Immunogold-labeled sections showing CurT localization at the cytoplasmic 1183

side of the thylakoid membrane D) Cluster formation of CurT signals at a putative biogenesis 1184

center from C E) Biogenesis center from the same cell (C) without any obvious CurT 1185

clustering of gold particles F) Schematic depiction of a wild-type cell (from Figure 2A) with 1186

color-coded curved membranes green = thylakoids that follow the curvature of the cell red = 1187

37

thylakoids that bend away from the plasma membrane yellow = thylakoids that bend toward 1188

the plasma membrane to converge on sites of biogenesis centers G) Relative distribution of 1189

gold signals between convex (dark color) and concave (light color) sides of membranes (n = 1190

1584 signals from a total of 95 cells) The undifferentiated overall signal distribution is given 1191

in blue Bars = 200 nm (overview) and 100 nm (details) 1192

1193

Figure 11 Differentially modified forms of CurT are found in different complexes in PDMs 1194

and thylakoid membranes Samples were isolated by fractionation of wild-type membranes 1195

via two consecutive sucrose density gradients according to Schottkowski et al (2009b) After 1196

density centrifugation samples were applied to BNSDS-PAGE analysis (A) or isoelectric 1197

focusing (B) Numbers on the right indicate the respective fraction from the second gradient 1198

(see Figure 7) Fraction 5 represents the PDMs and fraction 9 the thylakoid membrane 1199

1200

Figure 12 Loss of CurT increases sensitivity to abiotic stress A B) Doubling times of wild-1201

type and curT- under salt stress (A) or osmotic stress (B) Doubling times are means plusmn SD of 1202

three independent cultures C) Localization of CurT-CFP under salt and osmotic stress 1203

Samples were examined as described in Figure 8 Scale bars 1 microm D) Protein levels of wild-1204

type cells after growth in BG11 medium containing 500 mM NaCl Samples were analyzed on 1205

the same gel but unrelated samples between the presented signals were omitted E) 1206

Membrane preparations obtained from wild-type cells wild-type cells grown in the presence 1207

of 500 mM NaCl and curT- cells were subjected to the first gradient step in the membrane 1208

fractionation scheme The gradient was divided into five fractions and 10 of fractions I-IV 1209

and 02 of fraction V were analyzed by SDS-PAGE Fraction II includes the plasma 1210

membrane and fraction V consists of PratA-defined membrane and thylakoid membrane 1211

1212

Figure 13 Model of CurT distribution at convergence zones in Synechocystis 6803 The 1213

distribution of CurT in thylakoid (green) and plasma membranes (brown) is shown The 1214

pattern of localization of CurT in the thylakoid membrane is derived from membrane 1215

fractionation via sucrose density centrifugation fluorescence-based detection of the CurT-1216

CFP fusion and endogenous CurT and immunogold labeling experiments (Figures 7-10) The 1217

different CurT variants a b c and d identified in the IEF experiments (Figure 11) are depicted 1218

in yellow pink blue and black respectively CurT present in the plasma membrane is 1219

highlighted in gray as its precise nature and role remain to be defined (Figure 12) 1220

Membranes are represented as lipid bilayers Convex and concave faces of bent thylakoid 1221

38

sheets are indicated by black arrows The PDM which is dedicated to PSII assembly and 1222

repair is depicted in blue The dotted blue line emphasizes that the ultrastructure in this region 1223

has not yet been fully resolved PP periplasm PM plasma membrane TM thylakoid 1224

membrane L lumen PDM PratA-defined membrane 1225

1226

Tables 1227

Table 1 Physiological characteristics of the curT- mutant 1228

Strain Doubling time [h]

Oxygen Evolution[nmol h-1 OD750

-1]c

Chlorophyll content

[microg OD750-1]

d

Cell size [microm]e

Cell number [ml-1 OD750

-1]f

Wild type 817plusmn017a 1600plusmn042

b 1933plusmn187 251plusmn014 264plusmn020 390plusmn006 x 107

curT- 1259plusmn020a 3226plusmn056

b 1074plusmn20 195plusmn029 274plusmn044 367plusmn016 x 107

1229 abDoubling times in the presence (a) or absence (b) of 5 mM glucose measured under 1230

continuous illumination at 30 micromol photons m-2 s-1 and CO2-limiting conditions cOxygen 1231

evolution is expressed in nmol O2 produced per hour per OD750 unit dChlorophyll content is 1232

expressed in microg OD750-1 eThe diameter of non-dividing cells is presented in microm fCell number 1233

was determined per ml per OD750 Data are means plusmn SD of at least three independent 1234

experiments 1235

1236

Parsed CitationsAllen JF de Paula WBM Puthiyaveetil S and Nield J (2011) A structural phylogenetic map for chloroplast photosynthesisTrends Plant Sci 16 645-655

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Anderson JM Horton P Kim E-H and Chow WS (2012) Towards elucidation of dynamic structural changes of plant thylakoidarchitecture Philos Trans R Soc Lond B Biol Sci 367 3515-3524

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Armbruster U Zuumlhlke J Rengstl B Kreller R Makarenko E Ruumlhle T Schuumlnemann D Jahns P Weisshaar B NickelsenJ and Leister D (2010) The Arabidopsis thylakoid protein PAM68 is required for efficient D1 biogenesis and photosystem IIassembly Plant Cell 22 3439-3460

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Armbruster U Labs M Pribil M Viola S Xu W Scharfenberg M Hertle AP Rojahn U Jensen PE Rappaport F JoliotP Doumlrmann P Wanner G and Leister D (2013) Arabidopsis CURVATURE THYLAKOID1 proteins modify thylakoid architectureby inducing membrane curvature Plant Cell 25 2661-2678

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Aseeva E Ossenbuumlhl F Sippel C Cho WK Stein B Eichacker LA Meurer J Wanner G Westhoff P Soll J andVothknecht UC (2007) Vipp1 is required for basic thylakoid membrane formation but not for the assembly of thylakoid proteincomplexes Plant Physiol Biochem 45 119-128

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Bartsevich VV and Pakrasi HB (1995) Molecular identification of an ABC transporter complex for manganese analysis of acyanobacterial mutant strain impaired in the photosynthetic oxygen evolution process EMBO J 14 1845-1853

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Bartsevich VV and Pakrasi HB (1996) Manganese transport in the cyanobacterium Synechocystis sp PCC 6803 J Biol Chem271 26057-26061

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Bernaacutet G Waschewski N and Roumlgner M (2009) Towards efficient hydrogen production the impact of antenna size andexternal factors on electron transport dynamics in Synechocystis PCC 6803 Photosynth Res 99 205-216

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Boehm M Yu J Krynicka V Barker M Tichy M Komenda J Nixon PJ and Nield J (2012) Subunit Organization of aSynechocystis Hetero-Oligomeric Thylakoid FtsH Complex Involved in Photosystem II Repair Plant Cell 24 3669-3683

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Bradford MM (1976) A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle ofprotein-dye binding Anal Biochem 72 248-254

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Chang L Liu X Li Y Liu C-C Yang F Zhao J and Sui S-F (2015) Structural organization of an intact phycobilisome and itsassociation with photosystem II Cell Res 25 726-737

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Danielsson R Suorsa M Paakkarinen V Albertsson P-Aring Styring S Aro E-M and Mamedov F (2006) Dimeric andmonomeric organization of photosystem II Distribution of five distinct complexes in the different domains of the thylakoidmembrane J Biol Chem 281 14241-14249

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Daum B Nicastro D Austin J McIntosh JR and Kuumlhlbrandt W (2010) Arrangement of photosystem II and ATP synthase in

10

fluorescence signal is quantified separately for each of the two fluorescent channels (Figure 312

8C) 313

In contrast the chlorophyll autofluorescence in the curT- mutant seems to be evenly 314

distributed (Supplemental Figure 9) Following the fluorescence in an intensity profile as in 315

curT-CFP no regions with a similar decline in fluorescence were found most likely due to 316

the absence of biogenesis centers In addition some circular structures presenting chlorophyll 317

autofluorescence were detected in the interior of the cells Hence the disturbed curT- 318

ultrastructure is also reflected in the distribution of chlorophyll pigments (Supplemental 319

Figure 9) 320

To confirm the network-like distribution of CurT-CFP in the cell we used 321

immunofluorescence to detect CurT in the wild-type in situ Synechocystis 6803 cells were 322

fixed and treated with the αCurT antibody and an Oregon Green-conjugated secondary 323

antibody As shown in Figure 9A and B both techniques revealed similar network-like 324

patterns of the CurT signal which coalesced into rod-like structures at the cell surface and 325

essentially filled up the gaps between the autofluorescent thylakoid regions (negative controls 326

shown in Supplemental Figure 8B and 8C) Again regions of low chlorophyll fluorescence 327

typical of biogenesis centers generally exhibited stronger CurT-related fluorescence (Figure 328

8C) Occasionally CurT-CFP signals were also observed near traversing thylakoid lamellae 329

(when these were present in the cell analyzed) but the autofluorescence intensity of such 330

thylakoids is much weaker (see Figure 8B cell b in slice 6 and Supplemental Movie 3) 331

Finally CurT was localized by immunogold labeling experiments on ultrathin sections 332

of wild-type Synechocystis 6803 cells Almost no signals were detected when wild-type and 333

curT- sections were processed in the absence of the primary antibody as a negative control 334

(Figure 10A and Supplemental Figure 10A respectively) When mutant curT- cells were 335

processed in the presence of the αCurT antiserum a low level of randomly distributed 336

background signals was observed (Supplemental Figure 10B Supplemental Table 1) 337

However the number of signals located at the thylakoid membrane was clearly reduced 338

relative to the wild-type Therefore these signals were treated as non-specific background 339

Upon incubation of wild-type cell sections with antibodies directed against the N-terminus of 340

CurT (Figure 1A) the antigen was detected on the cytoplasmic surface of thylakoid 341

membranes (Figure 10B and 10C) This strongly suggests that its N-terminus is oriented 342

towards the cytoplasm Overall CurT signals appeared to be distributed along both thylakoids 343

and PDMs This agrees with the broad distribution of CurT across various fractions in the 344

membrane fractionation experiments (Figure 7) In only a few cases (12 ) however was 345

11

some clustering of immunogold signals at thylakoid convergence regions found (Figure 10D 346

and 10E) Thus the high local concentration of CurT at biogenic centers seen in the 347

fluorescence-based approaches (Figures 8 and 9) was not quantitatively reflected in the 348

immunogold labeling data This is likely due to the fact that immunogold electron microscopy 349

can only detect antigens on the surface of the section This issue is further complicated by the 350

heterogeneity of the CurT assemblies (see below and Discussion section) 351

Nevertheless closer inspection of the immunogold signals revealed an asymmetric 352

distribution of CurT signals with regard to the two faces of thylakoid sheets As illustrated in 353

Figure 10G curved thylakoid sheets possess a longer convex and a shorter concave face 354

When we analyzed a total of approximately 1500 CurT immunogold signals (from a total of 355

95 cells) which were unambiguously located to one side of the thylakoid membrane (for a 356

representative example see Supplemental Figure 11) 561 were found to be located at the 357

convex face while the other 439 localized to the concave side (Figure 10G Supplemental 358

Table 2) When differently curved regions (Figure 10F) including thylakoid lamellae (i) that 359

follow the overall shape of the cell (green) (ii) bend away from the plasma membrane (red) or 360

(iii) towards it ie where thylakoids converge to form biogenesis centers (yellow) were 361

examined separately red and green regions showed a CurT distribution in the range of 55 362

convex to 45 concave (Figure 10G Supplemental Table 2) However at the biogenesis 363

centers (the regions highlighted in yellow in Figure 10F) the uneven distribution of the 364

immunogold signals was more pronounced 61 of signals were found on the convex side 365

and 39 on the concave face of thylakoid lamellae (Figure 10G Supplemental Table 2) 366

Statistical analyses confirmed the significance of these differences in signal distributions 367

along the thylakoid membrane types (Supplemental Table 3) 368

Taken together with the finding that CurT is required for the formation of the 369

convergence sites forming biogenesis centers these data are consistent with the idea that the 370

thylakoid sheets are shaped by CurT which induces membrane curvature via asymmetric 371

intercalation on the two sides of thylakoid sheet 372

373

Different forms of CurT are found in PDMs and thylakoids 374

CurT was found to localize to both highly curved PDMs and less bent thylakoids Its 375

high local concentration at biogenic centers as seen in the fluorescence-based approaches 376

suggests a dosage-dependent effect of CurT on membrane shaping An alternative possibility 377

is that different CurT variants might exist in the two membrane types which could potentially 378

serve different functions To explore this possibility we asked whether CurT is found in 379

12

different complexes by using 2D BNSDS-PAGE to characterize membrane material isolated 380

via two-step sucrose gradient centrifugation (see Figure 7) In accordance with the data in 381

Figure 5A we find several low-molecular-weight complexes containing CurT (Figure 11A) 382

Smaller complexes of ~80 (complex I) and ~100 kDa (complex II) accumulate in membrane 383

fraction 5 (representing PDMs) but these are far less prevalent in fraction 9 representing 384

thylakoids (Figure 11A) In addition CurT-containing sub-complexes of ~140 (complex III) 385

and ~200 kDa (complex IV) are more prominently represented in thylakoids together with 386

even larger complexes ranging up to 670 kDa (Figure 11A) 387

Even more strikingly PDMs and thylakoids also differ with respect to the forms of 388

CurT they contain Thus isoelectric focusing (IEF) analysis of both membrane fractions 389

revealed at least four different CurT isoforms (a-d Figure 11B) PDMs contain mainly forms 390

b and d as well as trace amounts of a while thylakoids apparently possess very low levels of 391

form d and accumulate forms a b and c (Figure 11B) The nature of the underlying CurT 392

modifications still has to be determined Interestingly however CurT has recently been 393

identified as a phosphoprotein in a proteomic study (Spaumlt et al 2015) and the CurT variants 394

in Figure 11B may differ in their phosphorylation states At all events PDMs and thylakoids 395

can be distinguished by their complement of CurT isoforms which potentially play a role in 396

formation of the CurT sub-complexes that define the two membrane fractions 397

398

CurT is involved in the osmotic stress response 399

To further explore the stress-related role of CurT (Figure 6) and its link to IsiA 400

induction the effect of other potential stressors on curT- cells was tested High light levels had 401

a minor effect on curT- growth and its photosynthetic performance (Figure 4 Supplemental 402

Figure 5 and section above) suggesting that other environmental factors induced isiA 403

expression Our search was also motivated by a previous proteomic survey of plasma 404

membrane proteins of Synechocystis 6803 in high salt conditions in which CurT and VIPP1 405

were found among the most highly induced targets (Huang et al 2006) First we cultured 406

wild-type and curT- cells in different salt concentrations and found that growth of curT- was 407

severely affected in high salt (Figure 12A) Wild-type cells were only slightly affected by the 408

addition of salt to the medium The deleterious effect of the loss of curT on growth was even 409

more pronounced when maltose an osmotically active compound was present in the medium 410

(Figure 12B) Indeed curT- cells failed to survive exposure to 150 mM maltose whereas 411

growth of the wild-type was only slightly compromised These findings assign an additional 412

function to CurT ie a protective role during osmotic stress 413

13

When the curT-CFP strain was analyzed under these stress conditions enhanced 414

accumulation of CurT at the cell periphery was found mostly outside the autofluorescent 415

thylakoids and consistent with accumulation at the plasma membrane (Figure 12C) This was 416

further substantiated by membrane fractionation experiments which also revealed an 417

increased relative abundance of CurT in the plasma membrane fraction in the first sucrose 418

gradient (Figure 12E) Determination of total cellular CurT levels demonstrated that its 419

absolute amount did not increase under stress (Figure 12D) Therefore its higher abundance 420

in the plasma membrane under osmotic stress is likely to be due to CurT trafficking towards 421

the plasma membrane instead of increased synthesis 422

The same appears to hold true for VIPP1 which has been implicated in membrane 423

maintenance in both cyanobacteria and chloroplasts (Zhang and Sakamoto 2015) At stress 424

conditions an increase of the VIPP1 signal in the plasma membrane can be monitored in 425

wild-type (Figure 12E) However enhanced accumulation of VIPP1 in plasma membranes is 426

unaffected in the curT- mutant suggesting that thylakoid convergence zones are not strictly 427

required for the localization of VIPP1 428

429

Discussion 430

CurT determines thylakoid architecture 431

This study demonstrates that the protein CurT a homolog of the grana-forming 432

CURT1 proteins in plants is essential for establishing the proper thylakoid membrane 433

architecture in the cyanobacterium Synechocystis 6803 In particular CurTrsquos membrane-434

bending activity is likely to be required for the formation of thylakoid biogenesis centers at 435

points on the cell periphery where thylakoids converge towards the plasma membrane Here 436

PratA-mediated preloading of early PSII assembly intermediates with Mn2+ ions has been 437

proposed to take place together with PSII repair (Stengel et al 2012 Sacharz et al 2015) 438

This idea is supported by the following lines of evidence (i) The curT- mutant is devoid of 439

any thylakoid sectors that have convergence zones at their distal ends instead thylakoid 440

membranes are displaced and disposed as disordered or continuous rings (ii) CurT similarly 441

to CURT1A possesses a membrane-curving activity in vitro and intercalates asymmetrically 442

into thylakoids (iii) A high local concentration of CurT is observed at regions of high 443

curvature where biogenesis centers are found (iv) Lack of CurT affects the formation and 444

accumulation of PSII complexes as well as the abundance of some of its assembly factors 445

The drastic effects of CurT inactivation indicate an important role for this factor in membrane 446

shaping In contrast to the situation for CURT1A from Arabidopsis attempts to stably 447

14

overexpress CurT in Synechocystis 6803 failed Although short-lived transient increases in 448

CurT levels were observed when curT was expressed via strong heterologous promoters 449

wild-type levels of the protein were restored during subsequent rounds of cultivation of 450

transgenic lines Apparently Synechocystis 6803 cells do not tolerate substantial alterations in 451

CurT dosage and counter-select against these 452

This is in agreement with a dosage-dependent membrane-curving activity of CurT 453

which is suggested by its high local concentration at the edges of thylakoid autofluorescent 454

regions which mark the sites of the highly curved thylakoid convergence zones (Figures 8 9 455

and 13 Supplemental Movie 1 2 and 3) In addition some CurT was detected in structures 456

extending through the cytoplasm which most likely represent thylakoid sheets traversing the 457

cell from one thylakoid convergence zone to another (Figures 2A and 8) CurT might be 458

involved in the formation and stabilization of these structures 459

Members of the CURT1 family contain an N-terminal amphipathic α-helix that may 460

be involved in the membrane-bending activity of CurT (Armbruster et al 2013) Several 461

eukaryotic membrane-shaping proteins possess amphipathic helices as part of either an ENTH 462

(epsin N-terminal homology) or an N-BAR (Bin amphiphysin Rvs with N-terminal 463

amphipathic helix) domain (Ford et al 2002 Gallop and McMahon 2005 Zimmerberg and 464

Kozlov 2006) ENTH and N-BAR domains are rather large (~200 amino acids) and it has 465

been shown that amphipatic helices present in those domains insert into one leaflet of the lipid 466

bilayer and thereby induce curvature of the membrane (reviewed by Gallop and McMahon 467

2005 Zimmerberg and Kozlov 2006) However CurT itself is a small protein (149 amino 468

acids) that contains two transmembrane domains which insert into both leaflets of the lipid 469

bilayer (Figure 1A) as already suggested by Armbruster et al (2013) The amphipathic helix 470

faces the cytoplasm in Synechocystis 6803 or the stroma in A thaliana and most likely it 471

fine-tunes the degree of membrane bending mediated by CurT (Armbruster et al 2013) 472

In addition the increase in curvature correlated with CurT accumulation at convex 473

sides of thylakoid lamella (Figure 10 and 13) Hence curving might be mediated by 474

asymmetric integration of CurT into the lipid bilayers forming opposite faces of thylakoid 475

membrane sheets (Figure 13) However the mechanism causing this asymmetry remains 476

elusive 477

The presence of different CurT isoforms and complexes in PDMs and thylakoids adds 478

a further level of complexity and most likely reflects the dynamic regulation of this system 479

(Figure 11) The formation of different complexes might be primed by the phosphorylation of 480

CurT within its N-terminal cytoplasmic part (Spaumlt et al 2015) It seems likely that these 481

15

complexes play distinct roles in mediating the different CurT functions ie membrane 482

bending and maintenance 483

However it remains to be seen how exactly curvature is established maintained and 484

fine-tuned In addition other determinants of membrane topology and their putative interplay 485

with CurT have to be considered eg lipid and protein (complex) composition of 486

membranes cellular turgor pressure and other factors required for membrane 487

biogenesismaintenance eg the VIPP1 protein before precise molecular models of CurTrsquos 488

mode of action can be constructed (Rast et al 2015 and see below) That these other factors 489

can be crucial for membrane architecture is documented by the fact that some marine 490

cyanobacteria such as Prochlorococcus and Synechococcus contain curved thylakoids (but 491

no thylakoid convergence zones at the plasma membrane) although they lack a curT gene 492

493

The role of biogenesis centers 494

The absence of biogenesis centers in the curT- mutant now enables one to answer some 495

questions relating to the role of these thylakoid sub-structures which form in some but not all 496

cyanobacteria (Kunkel 1982 van de Meene et al 2006) First they are not essential since 497

even the curT- mutant still accumulates PSII to ~50 of wild-type levels On the other hand 498

in the mutant assembly of PSII is impaired as revealed by the increased accumulation of early 499

assembly intermediates In addition PSII dimers are almost completely absent in curT- 500

Whether the reduction in PSII dimers is attributable to an assembly problem linked to the 501

absence of biogenesis centers or to a secondary defect in dimer stabilization caused by 502

changes in overall thylakoid membrane ultrastructure remains to be determined Thus 503

biogenesis centers are more likely to represent evolutionary ldquoadd-onsrdquo that facilitated efficient 504

thylakoid biogenesis This is compatible with the fact that some cyanobacteria are devoid of 505

any biogenesis center-related substructures Second their absence compromises PSII but the 506

accumulation of other photosynthetic complexes ie PSI and the Cyt(b6f) complex is not 507

affected by CurT deficiency (Figure 3) This observation agrees with previous findings that 508

neither the PsaA subunit of PSI nor its assembly factor Ycf37 is detectable in isolated PDM 509

fractions (Rengstl et al 2011) 510

In addition to reduced de novo PSII assembly a higher relative stability of D1 in high-511

light experiments has been detected in curT- which suggests that D1 degradation during PSII 512

repair is less efficient in the mutant Photo-damaged D1 is degraded by the FtsH2FtsH3 513

complex which has previously been shown to partly localize to thylakoid convergence zones 514

at the cell periphery ie biogenesis centers (Boehm et al 2012 Sacharz et al 2015) It 515

16

therefore seems possible that the absence of biogenesis centers in curT- leads to 516

mislocalization of the FtsH2FtsH3 complex and less effective D1 degradation 517

Moreover a PSII related-function for CurT is supported by a meta-analysis of the 518

Synechocystis 6803 transcriptome When the CyanoEXpress 22 database (Hernaacutendez-Prieto 519

and Futschik 2012 Hernaacutendez-Prieto et al 2016) was queried for genes co-expressed with 520

curT (slr0483) genes for five PSII subunits ndash psbE psbO psbF psbL and psb30 ndash were 521

found among the first ten hits (Supplemental Table 4) From this we infer that biogenic 522

centers do not play an essential role in the assembly of all photosynthetic complexes but 523

serve to enhance PSII assemblyrepair possibly through the efficient delivery of Mn2+ 524

Residual PSII in curT- cells is likely to be supplied with cytoplasmic Mn2+ via a second 525

independently operating ABC transporter-based system in the plasma membrane named the 526

Mnt pathway (Bartsevich and Pakrasi 1995 Bartsevich and Pakrasi 1996) 527

Formally we cannot exclude that CurT is directly involved in the PSII assembly 528

process However considering CurTrsquos membrane bending capacity and the mutant phenotype 529

(Figure 1D and Figure 2) it appears more likely that CurT forms cellular substructures for 530

efficient PSII biogenesis ie biogenesis centers 531

As mentioned above some ultrastructural features of biogenesis centers have emerged 532

from studies employing EM-based tomography (van de Meene et al 2006) To date however 533

a high-resolution picture of the precise membrane architecture within these centers remains 534

elusive In particular whether or not a direct connection between plasma membrane and 535

thylakoids exists continues to be debated As recently discussed and in line with this gap in 536

knowledge different membrane fractionation techniques have revealed different distributions 537

of PSII-related subunits and assembly factors between plasma and thylakoid membranes 538

(Heinz et al 2016 Liberton et al 2016 Selatildeo et al 2016) The overall picture that emerges 539

is that the initial hypothesis that PSII biogenesis is initiated at the plasma membrane is no 540

longer tenable whereas a specialized thylakoid sub-fraction like the PDMs that make contact 541

with the plasma membrane could explain many of the available data and thus clarify some 542

aspects of the debate (Zak et al 2001 Pisareva et al 2011 Rast et al 2015) Moreover it 543

has previously been hypothesized that ldquoribosome-decorated membrane-like complexesrdquo 544

forming at the innermost thylakoid sheet might represent biogenic compartments (van de 545

Meene et al 2006 Mullineaux 2008) Whether these structures are affected in curT- cannot 546

be judged based on our TEM analysis but requires ultrastructural data of higher resolution 547

However the accessibility of thylakoids for ribosomes should be increased in the less 548

compressed membrane system of curT- (Figure 2B-D) 549

17

A scenario similar to that of Synechocystis 6803 holds for the situation in chloroplasts 550

of the green alga Chlamydomonas reinhardtii in which de novo PSII biogenesis has been 551

shown to be initiated in punctate regions named T-zones located close to the pyrenoid 552

(Uniacke and Zerges 2007) Unlike the mRNAs for the PSII components neither RNAs for 553

PSI subunits nor PSI assembly factors are localized to T-zones indicating that PSI and PSII 554

assembly processes are spatially separated (Uniacke and Zerges 2009 Nickelsen and Zerges 555

2013 Rast et al 2015) Interestingly a recent cryoelectron tomography study demonstrated 556

that next to T-zones at the chloroplast base-lobe junction the inner chloroplast envelope 557

exhibits invaginationsconnections to thylakoids that structurally resemble the organization of 558

cyanobacterial biogenesis centers (Engel et al 2015) For future investigations it will be 559

interesting to see if a homolog of the CURT1 family is involved in the formation of these 560

structures in C reinhardtii 561

562

Evolution of CURT1 function 563

Homologs of the CURT1 protein family can be found throughout cyanobacteria green 564

algae and plants (Armbruster et al 2013) The Arabidopsis CURT1A-D proteins have 565

recently been shown to induce bending of thylakoid membranes at grana margin regions 566

(Armbruster et al 2013) Interestingly and in contrast to the situation in Synechocystis 6803 567

their inactivation did not result in severe photosynthetic deficiencies although the thylakoids 568

formed lacked defined grana stacks Nevertheless the data available support the idea that the 569

function of thylakoid membrane structures that were regarded as being independent ie 570

cyanobacterial biogenesis centers and grana are closely related Intriguingly both of these 571

thylakoid membrane structures are dedicated to aspects of PSII function but do not involve 572

PSI (Pribil et al 2014) In both the prokaryotic and eukaryotic systems CURT1 homologs 573

appear to bend thylakoid membranes as indicated by (i) the distortion of membrane 574

ultrastructure seen in mutants devoid of curved thylakoids (ii) the localization of CURT1 575

homologs at grana margins and their local concentration at biogenesis centers (iii) the in vitro 576

membrane-curving activity of both CURT forms The phenotypic differences between 577

A thaliana and Synechocystis 6803 mutants may however be attributable to the different 578

functions of the membrane sub-compartments affected in the two model organisms Whereas 579

the role of grana is still under debate one function of the cyanobacterial biogenesis centers is 580

the above-mentioned high-throughput uptake of Mn2+ ions for efficient assembly of PSII 581

(Stengel et al 2012 Nickelsen and Rengstl 2013 Pribil et al 2014) However it appears 582

that in both cases the primary function of CURT1 proteins is to generate curved membrane 583

18

regions These discoveries suggest that until now two independently observed structures ie 584

cyanobacterial thylakoid biogenesis centers and chloroplast grana regions are closely related 585

The degree of curvature is much less pronounced in the cyanobacterial system As previously 586

discussed it was probably the subsequent evolution of a membrane-localized light-harvesting 587

system in chloroplasts that made the formation of tightly curved grana thylakoids possible 588

(Mullineaux 2005 Nevo et al 2012 Pribil et al 2014) 589

590

CurT is involved in osmotic stress response 591

One unexpected phenotype of the curT- mutant is its sensitivity to osmotic stress 592

These data revealed that in addition to shaping membranes CurT also influences their 593

functional integrity This latter function might be intrinsic to CurT or could be mediated by 594

the VIPP1 protein which has been shown to be required for membrane maintenance in 595

bacteria and chloroplasts probably by acting as a supplier of lipids (for an overview see 596

Zhang and Sakamoto 2015) Both factors accumulate in the plasma membrane upon osmotic 597

stress but VIPP1 localization is not severely affected by CurT inactivation which suggests 598

that VIPP1 operates independently of CurT In agreement with this repeated co-599

immunoprecipitations revealed no interaction between both proteins Therefore it remains to 600

be established whether a direct functional relationship between them exists 601

Previous investigations of osmotic stress in Synechocystis 6803 showed a kidney-602

shaped form of wild-type cells under very high concentrations of osmotically active 603

compounds (Marin et al 2006) The cells were severely deformed indicating changes in the 604

structure of the cellular envelope Since CurT shifts towards the plasma membrane already 605

under lower osmolyte concentrations we suggest a stabilizing function of CurT in the plasma 606

membrane CurT might be necessary to tolerate the forces trying to deform the cells under 607

osmotic stress 608

In conclusion this analysis has identified a crucial determinant for shaping and 609

maintaining the cyanobacterial thylakoid membrane system ie CurT a homolog of the 610

grana-forming CURT1 protein family from A thaliana In particular CurT is involved in the 611

formation of specific thylakoid substructures close to the plasma membrane at which PSII is 612

assembledrepaired Future work will dissect the precise ultrastructure of these centers and 613

enable us to elaborate a molecular model for the spatiotemporal organization of PSII assembly 614

in cyanobacteria 615

616

19

Methods 617

Strains and growth conditions 618

Wild-type and mutant Synechocystis 6803 cells were grown on solid or in liquid BG 619

11 medium (Rippka et al 1979) supplemented with 5 mM glucose (unless indicated 620

otherwise) at 30degC under continuous illumination at a photon irradiance of 30 μmol m-2 s-1 of 621

white light For growth during high-light experiments for investigation of D1 repair cells 622

were cultivated in a FMT150 photobioreactor (Photon Systems Instruments Draacutesov Czech 623

Republic) at 800 micromol photons m-2 s-1 in the presence or absence of lincomycin (100 microgml) 624

Cell density was monitored photometrically at 750 nm Doubling times were determined after 625

two days of growth To generate the insertion mutant curT- the curT gene (slr0483) was first 626

amplified from wild-type genomic DNA by PCR using the primer pair 04835 627

(GAAGCCTATTTAGCTAAGGCCGAAAG) and 04833 628

(TAGTACCTGGTCTTCCATGGCGT) and the resulting fragment was cloned into the 629

Bluescript pKS vector (Stratagene Waldbronn Germany) A kanamycin resistance cassette 630

was then inserted into the single AgeI restriction site (159 bp downstream of the start codon) 631

and this disruption construct was used to replace the wild-type gene as described (Wilde et al 632

2001) 633

634

Bioinformatic and computational analysis 635

CURT1 sequences of Synechocystis 6803 were obtained from CyanoBase 636

(httpgenomekazusaorjpcyanobaseSynechocystis) and CURT1 homologs in other 637

organisms were retrieved from NCBIBLAST (httpblastncbinlmnihgovBlastcgi) 638

Numbers and positions of putative transmembrane domains in the predicted proteins were 639

determined with TMHMM20 (httpwwwcbsdtudkservicesTMHMM) The sequence for 640

the N-terminal amphipathic helix was predicted by Jpred 3 641

(httpwwwcompbiodundeeacukwww-jpred) and plotted using a helical wheel projection 642

script (httprzlabucreduscriptswheelwheelcgi) The programs ClustalW2 643

(httpwwwebiacuktoolsclustalw2) and GeneDoc (httpwwwpscedubiomedgenedoc) 644

were used to generate multiple alignments of amino acid sequences Quantitative analysis of 645

immunoblots was performed with the AIDA Image Analyzer V325 (Raytest 646

Isotopenmessgeraumlte GmbH Straubenhardt Germany) 647

Co-expression patterns of curT were analyzed using the CyanoEXpress 22 database 648

(httpcyanoexpresssysbiolabeu Hernaacutendez-Prieto and Futschik 2012 Hernaacutendez-Prieto et 649

al 2016) 650

20

651

Measurement of chlorophyll concentration and oxygen production 652

Determination of chlorophyll content was carried out according to Wellburn and 653

Lichtenthaler (1984) For oxygen evolution measurements cells were grown in BG-11 654

without glucose harvested in mid-log phase and diluted to an OD750 nm = 05 Oxygen 655

evolution rates were measured with a Clark-type oxygen electrode (Hansatech Instruments 656

Ltd Kingrsquos Lynn Norfolk UK) at 1000 micromol photons m-2 s-1 (cool white light) after 5 min of 657

dark acclimation Oxygen evolution under saturating light conditions was measured without 658

any additives 659

660

Cell size and cell number estimation 661

Synechocystis 6803 strains were grown in liquid BG11 media containing 5 mM 662

glucose For cell size estimation the cells were analyzed with a confocal laser scanning 663

microscope TCS SP5 (Leica Wetzlar Germany) The diameter of the cells was measured 664

with the LAS AF Lite software (Leica Wetzlar Germany) Cells that were about to divide 665

were not taken into account For the determination of cell number cultures were set to an 666

OD750 = 1 and analyzed by using a Neubauer counting chamber (Paul Marienfeld GmbH amp 667

Co KG Lauda-Koumlnigshofen Germany) Statistical significance was determined by Studentrsquos 668

t-test 669

670

Measurements of P700+ reduction kinetics and relative electron transport rates 671

P700+ reduction kinetics and changes in chlorophyll fluorescence yield at different 672

light intensities were measured at a chlorophyll concentration of 5 microgml with a Dual-PAM-673

100 instrument (Heinz Walz GmbH Effeltrich Germany) Complete P700 oxidation was 674

achieved by a 50-ms multiple turnover pulse (10000 micromol photons m-2 s-1) after 2 min of dark 675

incubation P700+ reduction kinetics were recorded without any additions as well as in the 676

presence of 10 microM DCMU Ten technical replicates were averaged and fitted with single 677

exponential functions Data interpretation was done according to Bernaacutet et al (2009) 678

Light saturation measurements were performed according to Xu et al (2008) The 679

actinic light intensity was increased stepwise from 0 to 665 micromol photons m-2 s-1 with 30-s 680

adaptation periods Maximal fluorescence yields were obtained by applying saturating light 681

pulses (duration 600 ms intensity 10000 micromol photons m-2 s-1) 682

683

Low-temperature fluorescence measurements 684

21

Fluorescence emission spectra were measured with an AMINCO Bowman Series 2 685

Luminescence Spectrometer Wild-type and curT- cells were grown in the presence of 5 mM 686

glucose to mid log-phase and concentrated to 25 microgml chlorophyll adding 2 microM fluorescein 687

as an internal standard Samples (1 ml) were transferred to thin glass tubes dark-adapted for 688

30 min at 30 degC and shock frozen in liquid N2 To quantify chlorophyllfluorescein and 689

phycobilisome-mediated fluorescence samples were excited and emission recorded at 440 690

nm510 nm (chlorophyll and fluorescein excitationmax fluorescein emission) and 580 691

nm685 nm respectively Emission was scanned at 490-800 nm or at 640-800 nm 692

respectively 693

694

Antibody production and protein analysis 695

For generation of an αCurT antibody the N-terminal coding region of curT (amino 696

acid positions 1-58) was amplified by PCR using primers N04835 697

(AAGGATCCGTGGGCCGTAAACATTCAA) and N04833 698

(AAGTCGACGCACTTCCCACACCGGTTGTA) and cloned into the BamHI and XhoI sites 699

of the pGEX-4T-1 vector (GE Healthcare Freiburg Germany) Expression of the GST fusion 700

protein in Escherichia coli BL21(DE3) and subsequent affinity purification on Glutathione-701

Sepharose 4B (GE Healthcare) were carried out as described (Schottkowski et al 2009b) A 702

polyclonal antiserum was raised against this protein fragment in rabbits (Pineda Berlin 703

Germany) Other primary antibodies used in this study have been described previously ie 704

αpD1 (Schottkowski et al 2009b) αD1 (Schottkowski et al 2009b) αD2 (Klinkert et al 705

2006) αPratA (Klinkert et al 2004) αYcf48 (Rengstl et al 2011) αPitt (Schottkowski et 706

al 2009a) αPOR (Schottkowski et al 2009a) αYidC (Ossenbuumlhl et al 2006) αVIPP1 707

(Aseeva et al 2007) αSll0933 (Armbruster et al 2010) and αSlr0151 (Rast et al 2016) or 708

were purchased from Agrisera (Vaumlnnaumls Sweden) ie αCP43 αCP47 αPsaA αCyt f 709

αRbcL αIsiA The αGFP-HRP antibody was acquired from Miltenyi Biotech (Bergisch 710

Gladbach Germany) 711

Protein concentrations were determined according to Bradford (1976) using RotiQuant 712

(Carl Roth GmbH amp Co KG Karlsruhe Germany) Protein extraction membrane 713

fractionation on sucrose-density gradients and quantification of Western signal intensities was 714

performed as described previously (Rengstl et al 2011) Solubility properties of CurT were 715

determined according to Schottkowski et al (2009a) 716

22

Sucrose-density centrifugation separating PDM and thylakoid membrane fractions by 717

two consecutive gradients was carried out as described previously (Schottkowski et al 718

2009b Rengstl et al 2011) 719

Two-dimensional fractionations of cyanobacterial membrane proteins via BNSDS-720

PAGE and of pulse-labeled proteins by BNSDS-PAGE were performed as previously 721

reported (Klinkert et al 2004 Schottkowski et al 2009b Rengstl et al 2013) For the 722

analysis of native complexes in fractions obtained by sucrose-density centrifugation the 723

volume corresponding to 350 microg of protein in fraction 7 was applied to BNSDS-PAGE 724

For isoelectric focusing (IEF) the volume corresponding to 50 microg of protein from 725

fraction 7 in 200 microl of IEF buffer (8 M urea 4 CHAPS 1 IPG buffer pH 4-7 (GE 726

Healthcare)) was applied to an 11-cm Immobiline DryStrip pH 4-7 (GE Healthcare) in a 727

Protean IEF Cell (Bio-Rad Munich Germany) Strips were rehydrated for 12 h at 20 degC and 728

50V Focusing was carried out in the following steps 500 V rapid 1500 Vh 1000 V linear 729

880 Vh 6000 V linear 9680 Vh 6000 V rapid 5390 Vh 50 microA per gel focus temperature 730

20degC Subsequently the strips were incubated in equilibration buffer I (6 M urea 0375 M 731

Tris pH 88 20 glycerol 2 SDS 2 DTT) and equilibration buffer II (6 M urea 0375 732

M Tris pH 88 20 glycerol 2 SDS 25 iodoacetamide) for 10 min in each buffer 733

Then the IEF strips were applied to second-dimension SDS-PAGE 734

735

Transmission electron microscopy and immunogold labeling 736

Sample preparation for transmission electron microscopy including freeze substitution 737

and immunogold labeling of CurT was performed as described previously (Stengel et al 738

2012) Ultrathin sections were cut to thicknesses of 35 - 45 nm and 45 - 65 nm for 739

ultrastructural analyses and immunogold labeling respectively For immunogold labeling 740

sections collected on collodion-coated Ni grids were incubated for 18 h at 4degC with (rabbit) 741

αCurT (diluted 1100 1500 11000 or 14000 in blocking buffer (5 fetal calf serum) with 742

005 Tween 20) and further processed as described previously (Stengel et al 2012) As a 743

negative control wild-type Synechocystis 6803 cells were incubated without the primary 744

antibody and exposed to the gold-labeled anti-rabbit IgG To image the ultrastructure and the 745

immunogold-treated samples a Fei Morgagni 268 transmission electron microscope was used 746

and micrographs were taken at 80 kV 747

To avoid errors in the interpretation of the immunogold labeling experiment only 748

signals which were unambiguously localized to distinctly visible thylakoid membranes were 749

taken into account For each cell different regions (see Figure 10F) were defined and in each 750

23

region the signals on the convex and concave sides of the thylakoid membrane were analyzed 751

separately (see Supplemental Figure 11 for representative counts) Statistical significance was 752

assessed by χ2 test (Zoumlfel 1988) 753

For the analysis of clusters of CurT signals in biogenesis centers a cluster was defined 754

as a minimum of four signals in close proximity Overall 219 biogenesis centers were 755

examined with regard to CurT cluster formation 756

757

Preparation of proteoliposomes 758

Liposomes with a lipid mixture of 25 monogalactosyl diacylglycerol 42 759

digalactosyl diacylglycerol 16 sulfoquinovosyl diacylglycerol and 17 760

phosphatidylglycerol (Lipid Products South Nutfield UK) were prepared as described 761

previously (Armbruster et al 2013) To generate proteoliposomes CurT and CURT1A 762

proteins were expressed in the presence of liposomes for 3 h at 37degC using a PURExpress In 763

Vitro Protein Synthesis Kit (New England Biolabs Ipswich MA USA) The liposomes were 764

separated from the mix by centrifugation in a discontinuous sucrose gradient (100000 g 18 765

h) Subsequently the fraction containing the liposomes was extracted and dialyzed against 20 766

mM HEPES (pH 76) For transmission electron microscopy the proteoliposomes were 767

negatively stained with 1 uranyl acetate on a carbon-coated copper grid Micrographs were 768

taken on a Fei Morgagni 268 TEM at 80 kV 769

770

curT-CFP strain generation 771

Gibson assembly was used for single-step cloning (Gibson 2011) of the slr0483 gene 772

(together with its ~08 kb upstream region) the mTurquoise2 gene fragment the gentamycin-773

resistance cassette (aacC1) and an ~17-kb downstream region of slr0483 into pBR322 774

cleaved with EcoRV and NheI The slr0483 gene was fused in frame to the codon-optimized 775

mTurquoise2 (DNA20) preceded by a linker sequence encoding GSGSG The resulting 776

plasmid was used to transform Synechocystis 6803 as described previously (Zang et al 2007) 777

After ~ 10 days of incubation on BG11-GelRite (15 ) medium in the presence of 2 microgml 778

gentamycin several antibiotic resistant colonies were obtained and streaked out on fresh 779

medium These transformants were then tested for full segregation of the tagged allele by 780

colony PCR with primers flanking the slr0483 gene 781

782

Fluorescence microscopy 783

24

An aliquot of a cell suspension in mid-log phase was placed under a BG11-agarose 784

pad on a glass coverslip (15) and imaged on an inverted microscope (Zeiss 785

AxioObserverZ1) equipped with an ORCA Flash40 V2 (Hamamatsu) camera a Lumenecor 786

SOLA II Light Engine and a Plan-Apochromat 63x140 Oil DIC M27 (NA 14) objective 787

(Zeiss) Image acquisition was done with Zen 21 software in cyan and far-red fluorescence 788

channels (Zeiss Filter Sets 47 HE and 50) as Z-series with a step size of 250 nm and effective 789

pixel size of 103 nm Acquired image files were subsequently deconvolved (Constrained 790

Iterative Method) using a default theoretical Point Spread Function in Zen 20 (Zeiss) 791

Extraction of intensities for line profiles was performed by image thresholding the thylakoid 792

autofluorescence channel and eroding the resulting binary mask in Fiji (Schindelin et al 793

2012) 794

For immunofluorescence analysis cells were grown to mid-log phase as in the case of 795

the cells prepared for live-cell microscopy A 10-ml culture was fixed for 20 min in 37 796

formaldehyde and following extensive washing with phosphate-buffered saline (PBS) cells 797

were first permeabilized in 005 Triton-X for 20 min and then in lysis buffer (50 mM Tris-798

HCl 100 mM NaCl 5 mgml lysozyme) at 37degC for 2 h with gentle shaking To block 799

unspecific binding sites the cell pellet was incubated in 5 bovine serum albumin in PBS at 800

30degC for 1 h The αCurT serum (1500 dilution) was added to cells in fresh blocking buffer 801

for 1 h at 30degC with gentle shaking Cells were then washed three times with blocking buffer 802

and incubated with goat anti-rabbit IgG secondary antibodies conjugated to Oregon Green 488 803

(Invitrogen) (11000 dilution) under the conditions as for the primary antibodies Cells were 804

washed three times with PBS and prepared for microscopy as above Imaging was done as 805

described for live-cell microscopy except that a Colibri2 LED light source was employed for 806

illumination and a CoolSnap HQ camera (Photometrics) was used for image acquisition Cells 807

were imaged as Z-series (step size 280 nm) in the yellow and far-red fluorescent channels 808

(Zeiss Filter Sets 46 HE and 50) using the 505 nm and 625 nm LED modules Effective pixel 809

size in the final image was 102 nm Deconvolution and image analysis was done as described 810

above As judged by the staining intensity of the Oregon Green-conjugated antibodies 811

approximately half of the cells in any given field of view appeared to have been successfully 812

permeabilised a rate that is common in our experience No significant signal was detected in 813

the control sample that had not been exposed to the primary antibodies 814

815

25

Accession numbers 816

Sequence data from this article can be found in the CyanoBase and EMBLGenBank 817

data libraries under accession number slr0483 818

819

Supplemental Data 820

Supplemental Figure 1 Construction of the curT- mutant 821

Supplemental Figure 2 Growth phenotype of curT- 822

Supplemental Figure 3 Expression analysis of the open reading frame slr0482 (located 823

upstream of curT) in the curT- strain 824

Supplemental Figure 4 Absorbance spectra of curT- and wild-type cells 825

Supplemental Figure 5 High-light growth phenotypes of wild-type Synechocystis 6803 and 826

the curT- strain 827

Supplemental Figure 6 Ultrastructure of the TD41 mutant which lacks the psbA transcript 828

and the D1 protein 829

Supplemental Figure 7 Expression and localization of CurT-CFP 830

Supplemental Figure 8 Localization of CurT and CurT-CFP by fluorescence microscopy 831

Supplemental Figure 9 Chlorophyll autofluorescence of curT- 832

Supplemental Figure 10 The curT- mutant as a negative control for immunogold labeling 833

Supplemental Figure 11 Representative counts of immunogold signals 834

Supplemental Table 1 Overview of immunogold signals in curT- cells 835

Supplemental Table 2 Overview of immunogold signals in specific regions of Synechocystis 836

6803 wild-type cells 837

Supplemental Table 3 Statistical analysis of immunogold signals for wild-type 838

Synechocystis 6803 cells 839

Supplemental Table 4 Co-expression of curT 840

Supplemental Movie 1 Scan through the Z-axis of a curT-CFP cell 841

Supplemental Movie 2 Rendered 3D-model of a CurT-CFP detection 842

Supplemental Movie 3 Scan through the Z-axis of a curT-CFP cell with a traversing 843

thylakoid lamella 844

845

Acknowledgements 846

We thank Y Nishiyama for providing αpD1 and J Soll for αVIPP1 and αYidC antibodies 847

respectively and Nina Dyczmons-Nowaczyk for support with the fluorescence measurements 848

This work was supported by grants awarded to JN (Ni3909) MMN (NO 8363) and DL 849

26

(Le126529) by the Deutsche Forschungsgemeinschaft in the context of Research Unit 850

FOR2092 and the Cluster of Excellence RESOLV (EXC 1069) AG is a Howard Hughes 851

Medical Institute postdoctoral fellow in the laboratory of Erin OrsquoShea at Harvard University 852

LS was supported by a PhD fellowship from the Chinese Scholarship Council 853

854

Author Contributions 855

SH AR LS MMN DL and JN designed the research SH AR LS AG ILG EH ML BR 856

SV performed the research all authors contributed to data analysis SH AR and JN wrote the 857

paper 858

859

Competing Financial Interest statement 860

The authors declare no competing financial interests 861

862

We wish to dedicate this paper to Fabrice Rappaport an outstanding colleague and friend who 863

passed away so early 864

865

27

References 866

Allen JF de Paula WBM Puthiyaveetil S and Nield J (2011) A structural 867

phylogenetic map for chloroplast photosynthesis Trends Plant Sci 16 645-655 868

Anderson JM Horton P Kim E-H and Chow WS (2012) Towards elucidation of 869

dynamic structural changes of plant thylakoid architecture Philos Trans R Soc 870

Lond B Biol Sci 367 3515-3524 871

Armbruster U Zuumlhlke J Rengstl B Kreller R Makarenko E Ruumlhle T Schuumlnemann 872

D Jahns P Weisshaar B Nickelsen J and Leister D (2010) The Arabidopsis 873

thylakoid protein PAM68 is required for efficient D1 biogenesis and photosystem II 874

assembly Plant Cell 22 3439-3460 875

Armbruster U Labs M Pribil M Viola S Xu W Scharfenberg M Hertle AP 876

Rojahn U Jensen PE Rappaport F Joliot P Doumlrmann P Wanner G and 877

Leister D (2013) Arabidopsis CURVATURE THYLAKOID1 proteins modify 878

thylakoid architecture by inducing membrane curvature Plant Cell 25 2661-2678 879

Aseeva E Ossenbuumlhl F Sippel C Cho WK Stein B Eichacker LA Meurer J 880

Wanner G Westhoff P Soll J and Vothknecht UC (2007) Vipp1 is required for 881

basic thylakoid membrane formation but not for the assembly of thylakoid protein 882

complexes Plant Physiol Biochem 45 119-128 883

Bartsevich VV and Pakrasi HB (1995) Molecular identification of an ABC transporter 884

complex for manganese analysis of a cyanobacterial mutant strain impaired in the 885

photosynthetic oxygen evolution process EMBO J 14 1845-1853 886

Bartsevich VV and Pakrasi HB (1996) Manganese transport in the cyanobacterium 887

Synechocystis sp PCC 6803 J Biol Chem 271 26057-26061 888

Bernaacutet G Waschewski N and Roumlgner M (2009) Towards efficient hydrogen production 889

the impact of antenna size and external factors on electron transport dynamics in 890

Synechocystis PCC 6803 Photosynth Res 99 205-216 891

Boehm M Yu J Krynicka V Barker M Tichy M Komenda J Nixon PJ and Nield 892

J (2012) Subunit Organization of a Synechocystis Hetero-Oligomeric Thylakoid FtsH893

Complex Involved in Photosystem II Repair Plant Cell 24 3669-3683894

Bradford MM (1976) A rapid and sensitive method for the quantitation of microgram 895

quantities of protein utilizing the principle of protein-dye binding Anal Biochem 72 896

248-254897

28

Chang L Liu X Li Y Liu C-C Yang F Zhao J and Sui S-F (2015) Structural 898

organization of an intact phycobilisome and its association with photosystem II Cell 899

Res 25 726-737 900

Danielsson R Suorsa M Paakkarinen V Albertsson P-Aring Styring S Aro E-M and 901

Mamedov F (2006) Dimeric and monomeric organization of photosystem II 902

Distribution of five distinct complexes in the different domains of the thylakoid 903

membrane J Biol Chem 281 14241-14249 904

Daum B Nicastro D Austin J McIntosh JR and Kuumlhlbrandt W (2010) Arrangement 905

of photosystem II and ATP synthase in chloroplast membranes of Spinach and Pea 906

Plant Cell 22 1299-1312 907

Engel BD Schaffer M Kuhn Cuellar L Villa E Plitzko JM and Baumeister W 908

(2015) Native architecture of the Chlamydomonas chloroplast revealed by in situ 909

cryo-electron tomography eLife 4 e04889 910

Ford MGJ Mills IG Peter BJ Vallis Y Praefcke GJK Evans PR and McMahon 911

HT (2002) Curvature of clathrin-coated pits driven by epsin Nature 419 361-366 912

Fristedt R Willig A Granath P Cregravevecoeur M Rochaix J-D and Vener AV (2009) 913

Phosphorylation of photosystem II controls functional macroscopic folding of 914

photosynthetic membranes in Arabidopsis Plant Cell 21 3950-3964 915

Gallop JL and McMahon HT (2005) BAR domains and membrane curvature bringing 916

your curves to the BAR Biochem Soc Symp 72 223-231 917

Gibson DG (2011) Chapter fifteen - Enzymatic Assembly of Overlapping DNA Fragments 918

In Methods in Enzymology V Christopher ed (Academic Press) pp 349-361 919

Goedhart J von Stetten D Noirclerc-Savoye M Lelimousin M Joosen L Hink MA 920

van Weeren L Gadella TWJ and Royant A (2012) Structure-guided evolution of 921

cyan fluorescent proteins towards a quantum yield of 93 Nat Commun 3 751 922

Heinz S Liauw P Nickelsen J and Nowaczyk M (2016) Analysis of photosystem II 923

biogenesis in cyanobacteria Biochim Biophys Acta 1857 274-287 924

Hernaacutendez-Prieto M and Futschik M (2012) CyanoEXpress A web database for 925

exploration and visualisation of the integrated transcriptome of cyanobacterium 926

Synechocystis sp PCC6803 Bioinformation 8 634-638 927

Hernaacutendez-Prieto MA Semeniuk TA Giner-Lamia J and Futschik ME (2016) The 928

Transcriptional Landscape of the Photosynthetic Model Cyanobacterium 929

Synechocystis sp PCC6803 Sci Rep 6 22168 930

29

Huang F Fulda S Hagemann M and Norling B (2006) Proteomic screening of salt-931

stress-induced changes in plasma membranes of Synechocystis sp strain PCC 6803 932

Proteomics 6 910-920 933

Kirchhoff H (2013) Architectural switches in plant thylakoid membranes Photosynth Res 934

116 481-487 935

Klinkert B Elles I and Nickelsen J (2006) Translation of chloroplast psbD mRNA in 936

Chlamydomonas is controlled by a secondary RNA structure blocking the AUG start 937

codon Nucleic Acids Res 34 386-394 938

Klinkert B Ossenbuumlhl F Sikorski M Berry S Eichacker L and Nickelsen J (2004) 939

PratA a periplasmic tetratricopeptide repeat protein involved in biogenesis of 940

photosystem II in Synechocystis sp PCC 6803 J Biol Chem 279 44639-44644 941

Komenda J Nickelsen J Tichyacute M Praacutešil O Eichacker LA and Nixon PJ (2008) The 942

cyanobacterial homologue of HCF136YCF48 is a component of an early photosystem 943

II assembly complex and is important for both the efficient assembly and repair of 944

photosystem II in Synechocystis sp PCC 6803 J Biol Chem 283 22390-22399 945

Kopf M Klaumlhn S Scholz I Matthiessen JKF Hess WR and Voszlig B (2014) 946

Comparative analysis of the primary transcriptome of Synechocystis sp PCC 6803 947

DNA Res 21 527-539 948

Kunkel DD (1982) Thylakoid centers Structures associated with the cyanobacterial 949

photosynthetic membrane system Arch Microbiol 133 97-99 950

Liberton M Howard Berg R Heuser J Roth R and Pakrasi BH (2006) Ultrastructure 951

of the membrane systems in the unicellular cyanobacterium Synechocystis sp strain 952

PCC 6803 Protoplasma 227 129-138 953

Liberton M Saha R Jacobs JM Nguyen AY Gritsenko MA Smith RD 954

Koppenaal DW and Pakrasi HB (2016) Global Proteomic Analysis Reveals an 955

Exclusive Role of Thylakoid Membranes in Bioenergetics of a Model 956

Cyanobacterium Mol Cell Proteomics 15 2021-2032 957

Luque I and Ochoa de Alda JAG (2014) CURT1CAAD-containing aaRSs thylakoid 958

curvature and gene translation Trends Plant Sci 19 63-66 959

Marin K Stirnberg M Eisenhut M Kraumlmer R and Hagemann M (2006) Osmotic stress 960

in Synechocystis sp PCC 6803 low tolerance towards nonionic osmotic stress results 961

from lacking activation of glucosylglycerol accumulation Microbiology 152 2023-962

2030 963

Mullineaux CW (2005) Function and evolution of grana Trends Plant Sci 10 521-525 964

30

Mullineaux CW (2008) Biogenesis and dynamics of thylakoid membranes and the 965

photosynthetic apparatus In The Cyanobacteria A Herrero and E Flores eds 966

(Norfolk UK Caister Academic Press) pp 289ndash304 967

Nevo R Charuvi D Tsabari O and Reich Z (2012) Composition architecture and 968

dynamics of the photosynthetic apparatus in higher plants Plant J 70 157-176 969

Nickelsen J and Rengstl B (2013) Photosystem II assembly From cyanobacteria to plants 970

Annu Rev Plant Biol 64 609-635 971

Nickelsen J and Zerges W (2013) Thylakoid biogenesis has joined the new era of bacterial 972

cell biology Front Plant Sci 4 458 973

Nilsson F Simpson DJ Jansson C and Andersson B (1992) Ultrastructural and 974

biochemical characterization of a Synechocystis 6803 mutant with inactivated psbA 975

genes Arch Biochem Biophys 295 340-347 976

Odom WR Hodges R Chitnis PR and Guikema JA (1993) Characterization of 977

Synechocystis sp PCC 6803 in iron-supplied and iron-deficient media Plant Mol 978

Biol 23 1255-1264 979

Ossenbuumlhl F Inaba-Sulpice M Meurer J Soll J and Eichacker LA (2006) The 980

Synechocystis sp PCC 6803 Oxa1 homolog is essential for membrane integration of 981

reaction center precursor protein pD1 Plant Cell 18 2236-2246 982

Pisareva T Kwon J Oh J Kim S Ge C Wieslander Aring Choi J-S and Norling B 983

(2011) Model for Membrane Organization and Protein Sorting in the Cyanobacterium 984

Synechocystis sp PCC 6803 Inferred from Proteomics and Multivariate Sequence 985

Analyses J Proteome Res 10 3617-3631 986

Pribil M Labs M and Leister D (2014) Structure and dynamics of thylakoids in land 987

plants J Exp Bot 65 1955-1972 988

Rast A Heinz S and Nickelsen J (2015) Biogenesis of thylakoid membranes Biochim 989

Biophys Acta 1847 821-830 990

Rast A Rengstl B Heinz S Klingl A and Nickelsen J (2016) The role of Slr0151 a 991

tetratricopeptide repeat protein from Synechocystis sp PCC 6803 during Photosystem 992

II assembly and repair Front Plant Sci 7 605 993

Rengstl B Oster U Stengel A and Nickelsen J (2011) An Intermediate Membrane 994

Subfraction in Cyanobacteria Is Involved in an Assembly Network for Photosystem II 995

Biogenesis J Biol Chem 286 21944-21951 996

31

Rengstl B Knoppovaacute J Komenda J and Nickelsen J (2013) Characterization of a 997

Synechocystis double mutant lacking the photosystem II assembly factors YCF48 and 998

Sll0933 Planta 237 471-480 999

Rexroth S Mullineaux CW Ellinger D Sendtko E Roumlgner M and Koenig F (2011) 1000

The Plasma Membrane of the Cyanobacterium Gloeobacter violaceus Contains 1001

Segregated Bioenergetic Domains Plant Cell 23 2379-2390 1002

Rippka R Deruelles J Waterbury JB Herdman M and Stanier RY (1979) Generic 1003

Assignments Strain Histories and Properties of Pure Cultures of Cyanobacteria 1004

Microbiology 111 1-61 1005

Ruumltgers M and Schroda M (2013) A role of VIPP1 as a dynamic structure within 1006

thylakoid centers as sites of photosystem biogenesis Plant Signal Behav 8 e27037 1007

Sacharz J Bryan SJ Yu J Burroughs NJ Spence EM Nixon PJ and Mullineaux 1008

CW (2015) Sub-cellular location of FtsH proteases in the cyanobacterium1009

Synechocystis sp PCC 6803 suggests localised PSII repair zones in the thylakoid1010

membranes Mol Microbiol 96 448-4621011

Sandstroumlm S Park Y-I Oumlquist G and Gustafsson P (2001) CP43prime the isiA Gene 1012

Product Functions as an Excitation Energy Dissipator in the Cyanobacterium 1013

Synechococcus sp PCC 7942 Photochem Photobiol 74 431-437 1014

Schindelin J Arganda-Carreras I Frise E Kaynig V Longair M Pietzsch T 1015

Preibisch S Rueden C Saalfeld S Schmid B Tinevez J-Y White DJ 1016

Hartenstein V Eliceiri K Tomancak P and Cardona A (2012) Fiji an open-1017

source platform for biological-image analysis Nat Methods 9 676-682 1018

Schottkowski M Ratke J Oster U Nowaczyk M and Nickelsen J (2009a) Pitt a novel 1019

tetratricopeptide repeat protein involved in light-dependent chlorophyll biosynthesis 1020

and thylakoid membrane biogenesis in Synechocystis sp PCC 6803 Mol Plant 2 1021

1289-1297 1022

Schottkowski M Gkalympoudis S Tzekova N Stelljes C Schuumlnemann D Ankele E 1023

and Nickelsen J (2009b) Interaction of the periplasmic PratA factor and the PsbA 1024

(D1) protein during biogenesis of photosystem II in Synechocystis sp PCC 6803 J 1025

Biol Chem 284 1813-1819 1026

Selatildeo TT Zhang L Knoppovaaacute J Komenda J and Norling B (2016) Photosystem II 1027

Assembly Steps Take Place in the Thylakoid Membrane of the Cyanobacterium 1028

Synechocystis sp PCC6803 Plant Cell Physiol 57 878 1029

32

Spaumlt P Maček B and Forchhammer K (2015) Phosphoproteome of the cyanobacterium 1030

Synechocystis sp PCC 6803 and its dynamics during nitrogen starvation Front 1031

Microbiol 6 248 1032

Stengel A Guumlgel IL Hilger D Rengstl B Jung H and Nickelsen J (2012) Initial 1033

steps of photosystem II de novo assembly and preloading with manganese take place 1034

in biogenesis centers in Synechocystis Plant Cell 24 660-675 1035

Uniacke J and Zerges W (2007) Photosystem II assembly and repair are differentially 1036

localized in Chlamydomonas Plant Cell 19 3640-3654 1037

Uniacke J and Zerges W (2009) Chloroplast protein targeting involves localized 1038

translation in Chlamydomonas Proc Natl Acad Sci USA 106 1439-1444 1039

van de Meene AL Hohmann-Marriott M Vermaas WJ and Roberson R (2006) The 1040

three-dimensional structure of the cyanobacterium Synechocystis sp PCC 6803 Arch 1041

Microbiol 184 259-270 1042

van de Meene AML Sharp WP McDaniel JH Friedrich H Vermaas WFJ and 1043

Roberson RW (2012) Gross morphological changes in thylakoid membrane 1044

structure are associated with photosystem I deletion in Synechocystis sp PCC 6803 1045

Biochim Biophys Acta 1818 1427-1434 1046

Watanabe M and Ikeuchi M (2013) Phycobilisome architecture of a light-harvesting 1047

supercomplex Photosynth Res 116 265-276 1048

Wellburn AR and Lichtenthaler H (1984) Formulae and Program to Determine Total 1049

Carotenoids and Chlorophylls A and B of Leaf Extracts in Different Solvents In 1050

Advances in Photosynthesis Research Proceedings of the VIth International Congress 1051

on Photosynthesis Brussels Belgium August 1ndash6 1983 C Sybesma ed (Dordrecht 1052

Springer Netherlands) pp 9-12 1053

Wilde A Lunser K Ossenbuumlhl F Nickelsen J and Borner T (2001) Characterization of 1054

the cyanobacterial ycf37 mutation decreases the photosystem I content Biochem J 1055

357 211-216 1056

Wilson A Boulay C Wilde A Kerfeld CA and Kirilovsky D (2007) Light-Induced 1057

Energy Dissipation in Iron-Starved Cyanobacteria Roles of OCP and IsiA Proteins 1058

Plant Cell 19 656-672 1059

Xu M Bernaacutet G Singh A Mi H Roumlgner M Pakrasi HB and Ogawa T (2008) 1060

Properties of Mutants of Synechocystis sp Strain PCC 6803 Lacking Inorganic Carbon 1061

Sequestration Systems Plant Cell Physiol 49 1672-1677 1062

33

Yamamoto T Burke J Autz G and Jagendorf AT (1981) Bound ribosomes of Pea 1063

chloroplast thylakoid membranes location and release in vitro by high salt 1064

puromycin and RNase Plant Physiol 67 940-949 1065

Yang H Liao L Bo T Zhao L Sun X Lu X Norling B and Huang F (2014) 1066

Slr0151 in Synechocystis sp PCC 6803 is required for efficient repair of photosystem 1067

II under high-light condition J Integr Plant Biol 56 1136-1150 1068

Yeremenko N Kouřil R Ihalainen JA DHaene S van Oosterwijk N 1069

Andrizhiyevskaya EG Keegstra W Dekker HL Hagemann M Boekema EJ 1070

Matthijs HCP and Dekker JP (2004) Supramolecular Organization and Dual 1071

Function of the IsiA Chlorophyll-Binding Protein in Cyanobacteria Biochemistry 43 1072

10308-10313 1073

Zak E Norling B Maitra R Huang F Andersson B and Pakrasi HB (2001) The 1074

initial steps of biogenesis of cyanobacterial photosystems occur in plasma membranes 1075

Proc Natl Acad Sci USA 98 13443-13448 1076

Zang X Liu B Liu S Arunakumara KKIU and Zhang X (2007) Optimum 1077

Conditions for Transformation of Synechocystis sp PCC 6803 J Microbiol 45 241-1078

245 1079

Zhang L and Sakamoto W (2015) Possible function of VIPP1 in maintaining chloroplast 1080

membranes Biochim Biophys Acta 1847 831-837 1081

Zimmerberg J and Kozlov MM (2006) How proteins produce cellular membrane 1082

curvature Nat Rev Mol Cell Biol 7 9-19 1083

Zoumlfel P (1988) Statistik in der Praxis (Stuttgart Germany Gustav Fischer Verlag) 1084

1085

34

Figure Legends 1086

Figure 1 General characteristics of CurT A) Sequence alignment of CurT and CURT1A-D 1087

from A thaliana Predicted chloroplast transit-peptide sequences of CURT1A-D are omitted 1088

(Armbruster et al 2013) Positions of predicted C-terminal transmembrane domains (TDM) 1089

are marked (black bar) as is the position of the predicted amphipathic N-terminal helix in 1090

CurT (red bar) The green bar denotes the peptide sequence used for antibody production 1091

Identical and related amino acids that are conserved in 100 80 and 60 of the sequences 1092

are highlighted in black dark grey and light grey respectively B) Helical-wheel 1093

representation of the N-terminal amphipathic helix of CurT (red bar in A) The color code 1094

reflects the physicochemical properties of amino-acid side-chains green polar and 1095

uncharged blue polar and positively charged red polar and negatively charged yellow 1096

hydrophobic C) Solubility of CurT Membrane-associated proteins (50 microg) from wild-type 1097

cells were extracted with 5 mM HEPES (pH 76) containing either 1 M NaCl 01 M Na2CO3 1098

4 M urea 01 Triton X-100 or no additional solute After separation of membrane-bound 1099

(M) and solubilized (S) proteins by centrifugation proteins were fractionated by SDS-PAGE1100

and CurT was immunodetected on immunoblots As a control the integral membrane protein 1101

CP47 from PSII was analyzed in parallel D) Transmission electron micrographs of negatively 1102

stained liposomes Cell-free expression (CFE) of CurT and A thaliana CURT1A was 1103

performed in the presence of liposomes similar in composition to the lipids of the thylakoid 1104

membrane Liposomes before and after cell-free protein expression in the absence of DNA 1105

served as negative controls Black arrowheads indicate tubular connections between 1106

liposomes Scale bars 250 nm 1107

1108

Figure 2 Ultrastructural analysis of curT- cells Transmission electron micrographs of typical 1109

wild-type (A) and curT- (B-D) Synechocystis 6803 cells taken at 44000times (A B) and 28000times 1110

(C D) magnification respectively Ultrathin sections (35 to 45 nm) of cryofixed samples 1111

were stained with osmium tetroxide and post-stained using lead citrate Arrowheads indicate 1112

biogenesis centers Scale bars 200 nm (A B) and 500 nm (C D) respectively 1113

1114

Figure 3 Accumulation of components of photosynthetic complexes in the curT- mutant A) 1115

Whole cell extracts (30 microg protein) from wild-type and curT- strains were fractionated by 1116

SDS-PAGE and analyzed on immunoblots using the indicated antibodies B) The histogram 1117

shows levels of the indicated proteins in curT- extracts relative to wild-type samples (dashed 1118

red line) Data are means plusmn SD of three independent experiments Significant differences from 1119

35

wild-type protein levels according to Studentrsquos t-test with error probabilities of 5 and 1 1120

are indicated by and respectively 1121

1122

Figure 4 P700+ reduction kinetics and high-light effects in curT- cells A) Averaged traces 1123

(10 single measurements) of P700+ decay after complete oxidation by a 50-ms multiple 1124

turnover pulse (10000 micromol photons m-2 s-1) in the absence and presence of 10 microM DCMU 1125

B) Rate constants for P700+ reduction were obtained by fitting of the data with single1126

exponential functions Error bars indicate the SD of three independent measurements C) 1127

Impact of light intensity on the (relative) electron transport rate (rETR) Cells were exposed to 1128

gradually increasing light intensities which resulted in increasing electron transport until the 1129

capacity limit was reached PAR light intensity (micromol photons m-2 s-1) Error bars indicate the 1130

SD of three independent measurements D) D1 protein level in wild-type and curT- after high-1131

light treatment (800 micromol photons m-2s-1) in the presence and absence of lincomycin Samples 1132

were taken every 30 min and processed as in Figure 3 to determine the level of D1 present 1133

100 refers to wild-type D1 level at the beginning of the experiment 1134

1135

Figure 5 PSII assembly in curT- cells A) BNSDS-PAGE of membrane proteins Membrane 1136

fractions from wild-type and curT- cells were solubilized with 13 n-dodecyl-β-maltoside 1137

and proteins were fractionated by two-dimensional BNSDS-PAGE blotted and probed with 1138

antibodies against the PSII subunits D1 D2 CP47 and CP43 Wild-type blots were also 1139

probed with the αCurT antibody The sizes of marker proteins and the positions of PSII 1140

assembly intermediates (RCCII RCCI RC47) are shown above and below each image B) In 1141

vivo pulse labeling of membrane proteins with 35S Pulse-labeled PSII core proteins were 1142

separated via BNSDS-PAGE and visualized by autoradiography 1143

1144

Figure 6 Loss of CurT induces stress A) Low-temperature (77 K) fluorescence emission of 1145

Synechocystis 6803 wild-type (blue) and curT- (red) cells excited at 440 nm The spectra were 1146

normalized to the added fluorescein standard B) Low-temperature (77 K) fluorescence 1147

emission of Synechocystis 6803 wild-type (blue) and curT- (red) excited at 580 nm The 1148

spectra were normalized to 780 nm C) Level of IsiA in the curT- mutant relative to the wild-1149

type A mean value of 368 plusmn 96 (SD) was determined from three independent experiments 1150

1151

Figure 7 Membrane sublocalization of PSII-related factors Cell extracts from wild-type and 1152

curT- cells were fractionated by two consecutive rounds of sucrose-density gradient 1153

36

centrifugation (Schottkowski et al 2009b) The second linear gradient (20-60 sucrose) was 1154

apportioned into 14 fractions which were analyzed by immunoblotting using the indicated 1155

antibodies Fractions 1ndash6 represent PDMs and fractions 7ndash14 thylakoid membranes (TMs) 1156

To facilitate comparison between gradients sample volumes were normalized to the volume 1157

of fraction 7 that contained 40 microg of protein 1158

1159

Figure 8 Live-cell imaging of the curT-CFP strain by fluorescence microscopy In the curT-1160

CFP strain the native curT gene has been replaced by a CFP-tagged version resulting in the 1161

expression of the CurT-CFP fusion protein under the control of the native promotor A) 1162

Close-up views of the mid-cell plane in the CFP and far-red autofluorescence channels shown 1163

in slice 7 in panel B B) Synechocystis 6803 cells expressing CurT C-terminally fused to the 1164

mTurquoise2 variant of CFP from its native chromosomal promoter The two imaging 1165

channels are displayed as Z-axis montages (auto-scaled contrast step size 250 nm) in 1166

grayscale and color composite configuration The thylakoid autofluorescent channel as 1167

imaged in far-red fluorescence is depicted in magenta and CurT signal as imaged in cyan 1168

fluorescence is depicted in cyan C) Fluorescence intensity profiles of the two channels along 1169

the autofluorescent peripheral cell ldquoringrdquo are shown for slice 7 The maximum projection of 1170

the entire Z montage is also shown Scale bars (light grey) 2 microm 1171

1172

Figure 9 Immunofluorescence detection of CurT A) Close-ups of slice 5 in panel B B) 1173

Wild-type Synechocystis 6803 cells labeled with αCurT antibodies and detected with Oregon 1174

Green-conjugated secondary antibodies The Z-axis montages are shown as in Figure 8B 1175

except that the step size is 280 nm (1 to 10) C) Intensity profiles of the two channels along 1176

the autofluorescent peripheral cell ldquoringrdquo are shown for slice 5 The maximum projection of 1177

the entire Z montage is also shown Scale bars (light grey) 2 microm 1178

1179

Figure 10 Subcellular localization of CurT Ultrathin sections of wild-type Synechocystis 1180

6803 cells were incubated with rabbit αCurT prior to incubation with gold-conjugated goat 1181

anti-rabbit IgG A) Negative control (wild-type processed without addition of primary 1182

antibody) B C) Immunogold-labeled sections showing CurT localization at the cytoplasmic 1183

side of the thylakoid membrane D) Cluster formation of CurT signals at a putative biogenesis 1184

center from C E) Biogenesis center from the same cell (C) without any obvious CurT 1185

clustering of gold particles F) Schematic depiction of a wild-type cell (from Figure 2A) with 1186

color-coded curved membranes green = thylakoids that follow the curvature of the cell red = 1187

37

thylakoids that bend away from the plasma membrane yellow = thylakoids that bend toward 1188

the plasma membrane to converge on sites of biogenesis centers G) Relative distribution of 1189

gold signals between convex (dark color) and concave (light color) sides of membranes (n = 1190

1584 signals from a total of 95 cells) The undifferentiated overall signal distribution is given 1191

in blue Bars = 200 nm (overview) and 100 nm (details) 1192

1193

Figure 11 Differentially modified forms of CurT are found in different complexes in PDMs 1194

and thylakoid membranes Samples were isolated by fractionation of wild-type membranes 1195

via two consecutive sucrose density gradients according to Schottkowski et al (2009b) After 1196

density centrifugation samples were applied to BNSDS-PAGE analysis (A) or isoelectric 1197

focusing (B) Numbers on the right indicate the respective fraction from the second gradient 1198

(see Figure 7) Fraction 5 represents the PDMs and fraction 9 the thylakoid membrane 1199

1200

Figure 12 Loss of CurT increases sensitivity to abiotic stress A B) Doubling times of wild-1201

type and curT- under salt stress (A) or osmotic stress (B) Doubling times are means plusmn SD of 1202

three independent cultures C) Localization of CurT-CFP under salt and osmotic stress 1203

Samples were examined as described in Figure 8 Scale bars 1 microm D) Protein levels of wild-1204

type cells after growth in BG11 medium containing 500 mM NaCl Samples were analyzed on 1205

the same gel but unrelated samples between the presented signals were omitted E) 1206

Membrane preparations obtained from wild-type cells wild-type cells grown in the presence 1207

of 500 mM NaCl and curT- cells were subjected to the first gradient step in the membrane 1208

fractionation scheme The gradient was divided into five fractions and 10 of fractions I-IV 1209

and 02 of fraction V were analyzed by SDS-PAGE Fraction II includes the plasma 1210

membrane and fraction V consists of PratA-defined membrane and thylakoid membrane 1211

1212

Figure 13 Model of CurT distribution at convergence zones in Synechocystis 6803 The 1213

distribution of CurT in thylakoid (green) and plasma membranes (brown) is shown The 1214

pattern of localization of CurT in the thylakoid membrane is derived from membrane 1215

fractionation via sucrose density centrifugation fluorescence-based detection of the CurT-1216

CFP fusion and endogenous CurT and immunogold labeling experiments (Figures 7-10) The 1217

different CurT variants a b c and d identified in the IEF experiments (Figure 11) are depicted 1218

in yellow pink blue and black respectively CurT present in the plasma membrane is 1219

highlighted in gray as its precise nature and role remain to be defined (Figure 12) 1220

Membranes are represented as lipid bilayers Convex and concave faces of bent thylakoid 1221

38

sheets are indicated by black arrows The PDM which is dedicated to PSII assembly and 1222

repair is depicted in blue The dotted blue line emphasizes that the ultrastructure in this region 1223

has not yet been fully resolved PP periplasm PM plasma membrane TM thylakoid 1224

membrane L lumen PDM PratA-defined membrane 1225

1226

Tables 1227

Table 1 Physiological characteristics of the curT- mutant 1228

Strain Doubling time [h]

Oxygen Evolution[nmol h-1 OD750

-1]c

Chlorophyll content

[microg OD750-1]

d

Cell size [microm]e

Cell number [ml-1 OD750

-1]f

Wild type 817plusmn017a 1600plusmn042

b 1933plusmn187 251plusmn014 264plusmn020 390plusmn006 x 107

curT- 1259plusmn020a 3226plusmn056

b 1074plusmn20 195plusmn029 274plusmn044 367plusmn016 x 107

1229 abDoubling times in the presence (a) or absence (b) of 5 mM glucose measured under 1230

continuous illumination at 30 micromol photons m-2 s-1 and CO2-limiting conditions cOxygen 1231

evolution is expressed in nmol O2 produced per hour per OD750 unit dChlorophyll content is 1232

expressed in microg OD750-1 eThe diameter of non-dividing cells is presented in microm fCell number 1233

was determined per ml per OD750 Data are means plusmn SD of at least three independent 1234

experiments 1235

1236

Parsed CitationsAllen JF de Paula WBM Puthiyaveetil S and Nield J (2011) A structural phylogenetic map for chloroplast photosynthesisTrends Plant Sci 16 645-655

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Anderson JM Horton P Kim E-H and Chow WS (2012) Towards elucidation of dynamic structural changes of plant thylakoidarchitecture Philos Trans R Soc Lond B Biol Sci 367 3515-3524

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Armbruster U Zuumlhlke J Rengstl B Kreller R Makarenko E Ruumlhle T Schuumlnemann D Jahns P Weisshaar B NickelsenJ and Leister D (2010) The Arabidopsis thylakoid protein PAM68 is required for efficient D1 biogenesis and photosystem IIassembly Plant Cell 22 3439-3460

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Armbruster U Labs M Pribil M Viola S Xu W Scharfenberg M Hertle AP Rojahn U Jensen PE Rappaport F JoliotP Doumlrmann P Wanner G and Leister D (2013) Arabidopsis CURVATURE THYLAKOID1 proteins modify thylakoid architectureby inducing membrane curvature Plant Cell 25 2661-2678

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Aseeva E Ossenbuumlhl F Sippel C Cho WK Stein B Eichacker LA Meurer J Wanner G Westhoff P Soll J andVothknecht UC (2007) Vipp1 is required for basic thylakoid membrane formation but not for the assembly of thylakoid proteincomplexes Plant Physiol Biochem 45 119-128

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Bartsevich VV and Pakrasi HB (1995) Molecular identification of an ABC transporter complex for manganese analysis of acyanobacterial mutant strain impaired in the photosynthetic oxygen evolution process EMBO J 14 1845-1853

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Bartsevich VV and Pakrasi HB (1996) Manganese transport in the cyanobacterium Synechocystis sp PCC 6803 J Biol Chem271 26057-26061

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Bernaacutet G Waschewski N and Roumlgner M (2009) Towards efficient hydrogen production the impact of antenna size andexternal factors on electron transport dynamics in Synechocystis PCC 6803 Photosynth Res 99 205-216

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Boehm M Yu J Krynicka V Barker M Tichy M Komenda J Nixon PJ and Nield J (2012) Subunit Organization of aSynechocystis Hetero-Oligomeric Thylakoid FtsH Complex Involved in Photosystem II Repair Plant Cell 24 3669-3683

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Bradford MM (1976) A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle ofprotein-dye binding Anal Biochem 72 248-254

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Chang L Liu X Li Y Liu C-C Yang F Zhao J and Sui S-F (2015) Structural organization of an intact phycobilisome and itsassociation with photosystem II Cell Res 25 726-737

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Danielsson R Suorsa M Paakkarinen V Albertsson P-Aring Styring S Aro E-M and Mamedov F (2006) Dimeric andmonomeric organization of photosystem II Distribution of five distinct complexes in the different domains of the thylakoidmembrane J Biol Chem 281 14241-14249

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Daum B Nicastro D Austin J McIntosh JR and Kuumlhlbrandt W (2010) Arrangement of photosystem II and ATP synthase in

11

some clustering of immunogold signals at thylakoid convergence regions found (Figure 10D 346

and 10E) Thus the high local concentration of CurT at biogenic centers seen in the 347

fluorescence-based approaches (Figures 8 and 9) was not quantitatively reflected in the 348

immunogold labeling data This is likely due to the fact that immunogold electron microscopy 349

can only detect antigens on the surface of the section This issue is further complicated by the 350

heterogeneity of the CurT assemblies (see below and Discussion section) 351

Nevertheless closer inspection of the immunogold signals revealed an asymmetric 352

distribution of CurT signals with regard to the two faces of thylakoid sheets As illustrated in 353

Figure 10G curved thylakoid sheets possess a longer convex and a shorter concave face 354

When we analyzed a total of approximately 1500 CurT immunogold signals (from a total of 355

95 cells) which were unambiguously located to one side of the thylakoid membrane (for a 356

representative example see Supplemental Figure 11) 561 were found to be located at the 357

convex face while the other 439 localized to the concave side (Figure 10G Supplemental 358

Table 2) When differently curved regions (Figure 10F) including thylakoid lamellae (i) that 359

follow the overall shape of the cell (green) (ii) bend away from the plasma membrane (red) or 360

(iii) towards it ie where thylakoids converge to form biogenesis centers (yellow) were 361

examined separately red and green regions showed a CurT distribution in the range of 55 362

convex to 45 concave (Figure 10G Supplemental Table 2) However at the biogenesis 363

centers (the regions highlighted in yellow in Figure 10F) the uneven distribution of the 364

immunogold signals was more pronounced 61 of signals were found on the convex side 365

and 39 on the concave face of thylakoid lamellae (Figure 10G Supplemental Table 2) 366

Statistical analyses confirmed the significance of these differences in signal distributions 367

along the thylakoid membrane types (Supplemental Table 3) 368

Taken together with the finding that CurT is required for the formation of the 369

convergence sites forming biogenesis centers these data are consistent with the idea that the 370

thylakoid sheets are shaped by CurT which induces membrane curvature via asymmetric 371

intercalation on the two sides of thylakoid sheet 372

373

Different forms of CurT are found in PDMs and thylakoids 374

CurT was found to localize to both highly curved PDMs and less bent thylakoids Its 375

high local concentration at biogenic centers as seen in the fluorescence-based approaches 376

suggests a dosage-dependent effect of CurT on membrane shaping An alternative possibility 377

is that different CurT variants might exist in the two membrane types which could potentially 378

serve different functions To explore this possibility we asked whether CurT is found in 379

12

different complexes by using 2D BNSDS-PAGE to characterize membrane material isolated 380

via two-step sucrose gradient centrifugation (see Figure 7) In accordance with the data in 381

Figure 5A we find several low-molecular-weight complexes containing CurT (Figure 11A) 382

Smaller complexes of ~80 (complex I) and ~100 kDa (complex II) accumulate in membrane 383

fraction 5 (representing PDMs) but these are far less prevalent in fraction 9 representing 384

thylakoids (Figure 11A) In addition CurT-containing sub-complexes of ~140 (complex III) 385

and ~200 kDa (complex IV) are more prominently represented in thylakoids together with 386

even larger complexes ranging up to 670 kDa (Figure 11A) 387

Even more strikingly PDMs and thylakoids also differ with respect to the forms of 388

CurT they contain Thus isoelectric focusing (IEF) analysis of both membrane fractions 389

revealed at least four different CurT isoforms (a-d Figure 11B) PDMs contain mainly forms 390

b and d as well as trace amounts of a while thylakoids apparently possess very low levels of 391

form d and accumulate forms a b and c (Figure 11B) The nature of the underlying CurT 392

modifications still has to be determined Interestingly however CurT has recently been 393

identified as a phosphoprotein in a proteomic study (Spaumlt et al 2015) and the CurT variants 394

in Figure 11B may differ in their phosphorylation states At all events PDMs and thylakoids 395

can be distinguished by their complement of CurT isoforms which potentially play a role in 396

formation of the CurT sub-complexes that define the two membrane fractions 397

398

CurT is involved in the osmotic stress response 399

To further explore the stress-related role of CurT (Figure 6) and its link to IsiA 400

induction the effect of other potential stressors on curT- cells was tested High light levels had 401

a minor effect on curT- growth and its photosynthetic performance (Figure 4 Supplemental 402

Figure 5 and section above) suggesting that other environmental factors induced isiA 403

expression Our search was also motivated by a previous proteomic survey of plasma 404

membrane proteins of Synechocystis 6803 in high salt conditions in which CurT and VIPP1 405

were found among the most highly induced targets (Huang et al 2006) First we cultured 406

wild-type and curT- cells in different salt concentrations and found that growth of curT- was 407

severely affected in high salt (Figure 12A) Wild-type cells were only slightly affected by the 408

addition of salt to the medium The deleterious effect of the loss of curT on growth was even 409

more pronounced when maltose an osmotically active compound was present in the medium 410

(Figure 12B) Indeed curT- cells failed to survive exposure to 150 mM maltose whereas 411

growth of the wild-type was only slightly compromised These findings assign an additional 412

function to CurT ie a protective role during osmotic stress 413

13

When the curT-CFP strain was analyzed under these stress conditions enhanced 414

accumulation of CurT at the cell periphery was found mostly outside the autofluorescent 415

thylakoids and consistent with accumulation at the plasma membrane (Figure 12C) This was 416

further substantiated by membrane fractionation experiments which also revealed an 417

increased relative abundance of CurT in the plasma membrane fraction in the first sucrose 418

gradient (Figure 12E) Determination of total cellular CurT levels demonstrated that its 419

absolute amount did not increase under stress (Figure 12D) Therefore its higher abundance 420

in the plasma membrane under osmotic stress is likely to be due to CurT trafficking towards 421

the plasma membrane instead of increased synthesis 422

The same appears to hold true for VIPP1 which has been implicated in membrane 423

maintenance in both cyanobacteria and chloroplasts (Zhang and Sakamoto 2015) At stress 424

conditions an increase of the VIPP1 signal in the plasma membrane can be monitored in 425

wild-type (Figure 12E) However enhanced accumulation of VIPP1 in plasma membranes is 426

unaffected in the curT- mutant suggesting that thylakoid convergence zones are not strictly 427

required for the localization of VIPP1 428

429

Discussion 430

CurT determines thylakoid architecture 431

This study demonstrates that the protein CurT a homolog of the grana-forming 432

CURT1 proteins in plants is essential for establishing the proper thylakoid membrane 433

architecture in the cyanobacterium Synechocystis 6803 In particular CurTrsquos membrane-434

bending activity is likely to be required for the formation of thylakoid biogenesis centers at 435

points on the cell periphery where thylakoids converge towards the plasma membrane Here 436

PratA-mediated preloading of early PSII assembly intermediates with Mn2+ ions has been 437

proposed to take place together with PSII repair (Stengel et al 2012 Sacharz et al 2015) 438

This idea is supported by the following lines of evidence (i) The curT- mutant is devoid of 439

any thylakoid sectors that have convergence zones at their distal ends instead thylakoid 440

membranes are displaced and disposed as disordered or continuous rings (ii) CurT similarly 441

to CURT1A possesses a membrane-curving activity in vitro and intercalates asymmetrically 442

into thylakoids (iii) A high local concentration of CurT is observed at regions of high 443

curvature where biogenesis centers are found (iv) Lack of CurT affects the formation and 444

accumulation of PSII complexes as well as the abundance of some of its assembly factors 445

The drastic effects of CurT inactivation indicate an important role for this factor in membrane 446

shaping In contrast to the situation for CURT1A from Arabidopsis attempts to stably 447

14

overexpress CurT in Synechocystis 6803 failed Although short-lived transient increases in 448

CurT levels were observed when curT was expressed via strong heterologous promoters 449

wild-type levels of the protein were restored during subsequent rounds of cultivation of 450

transgenic lines Apparently Synechocystis 6803 cells do not tolerate substantial alterations in 451

CurT dosage and counter-select against these 452

This is in agreement with a dosage-dependent membrane-curving activity of CurT 453

which is suggested by its high local concentration at the edges of thylakoid autofluorescent 454

regions which mark the sites of the highly curved thylakoid convergence zones (Figures 8 9 455

and 13 Supplemental Movie 1 2 and 3) In addition some CurT was detected in structures 456

extending through the cytoplasm which most likely represent thylakoid sheets traversing the 457

cell from one thylakoid convergence zone to another (Figures 2A and 8) CurT might be 458

involved in the formation and stabilization of these structures 459

Members of the CURT1 family contain an N-terminal amphipathic α-helix that may 460

be involved in the membrane-bending activity of CurT (Armbruster et al 2013) Several 461

eukaryotic membrane-shaping proteins possess amphipathic helices as part of either an ENTH 462

(epsin N-terminal homology) or an N-BAR (Bin amphiphysin Rvs with N-terminal 463

amphipathic helix) domain (Ford et al 2002 Gallop and McMahon 2005 Zimmerberg and 464

Kozlov 2006) ENTH and N-BAR domains are rather large (~200 amino acids) and it has 465

been shown that amphipatic helices present in those domains insert into one leaflet of the lipid 466

bilayer and thereby induce curvature of the membrane (reviewed by Gallop and McMahon 467

2005 Zimmerberg and Kozlov 2006) However CurT itself is a small protein (149 amino 468

acids) that contains two transmembrane domains which insert into both leaflets of the lipid 469

bilayer (Figure 1A) as already suggested by Armbruster et al (2013) The amphipathic helix 470

faces the cytoplasm in Synechocystis 6803 or the stroma in A thaliana and most likely it 471

fine-tunes the degree of membrane bending mediated by CurT (Armbruster et al 2013) 472

In addition the increase in curvature correlated with CurT accumulation at convex 473

sides of thylakoid lamella (Figure 10 and 13) Hence curving might be mediated by 474

asymmetric integration of CurT into the lipid bilayers forming opposite faces of thylakoid 475

membrane sheets (Figure 13) However the mechanism causing this asymmetry remains 476

elusive 477

The presence of different CurT isoforms and complexes in PDMs and thylakoids adds 478

a further level of complexity and most likely reflects the dynamic regulation of this system 479

(Figure 11) The formation of different complexes might be primed by the phosphorylation of 480

CurT within its N-terminal cytoplasmic part (Spaumlt et al 2015) It seems likely that these 481

15

complexes play distinct roles in mediating the different CurT functions ie membrane 482

bending and maintenance 483

However it remains to be seen how exactly curvature is established maintained and 484

fine-tuned In addition other determinants of membrane topology and their putative interplay 485

with CurT have to be considered eg lipid and protein (complex) composition of 486

membranes cellular turgor pressure and other factors required for membrane 487

biogenesismaintenance eg the VIPP1 protein before precise molecular models of CurTrsquos 488

mode of action can be constructed (Rast et al 2015 and see below) That these other factors 489

can be crucial for membrane architecture is documented by the fact that some marine 490

cyanobacteria such as Prochlorococcus and Synechococcus contain curved thylakoids (but 491

no thylakoid convergence zones at the plasma membrane) although they lack a curT gene 492

493

The role of biogenesis centers 494

The absence of biogenesis centers in the curT- mutant now enables one to answer some 495

questions relating to the role of these thylakoid sub-structures which form in some but not all 496

cyanobacteria (Kunkel 1982 van de Meene et al 2006) First they are not essential since 497

even the curT- mutant still accumulates PSII to ~50 of wild-type levels On the other hand 498

in the mutant assembly of PSII is impaired as revealed by the increased accumulation of early 499

assembly intermediates In addition PSII dimers are almost completely absent in curT- 500

Whether the reduction in PSII dimers is attributable to an assembly problem linked to the 501

absence of biogenesis centers or to a secondary defect in dimer stabilization caused by 502

changes in overall thylakoid membrane ultrastructure remains to be determined Thus 503

biogenesis centers are more likely to represent evolutionary ldquoadd-onsrdquo that facilitated efficient 504

thylakoid biogenesis This is compatible with the fact that some cyanobacteria are devoid of 505

any biogenesis center-related substructures Second their absence compromises PSII but the 506

accumulation of other photosynthetic complexes ie PSI and the Cyt(b6f) complex is not 507

affected by CurT deficiency (Figure 3) This observation agrees with previous findings that 508

neither the PsaA subunit of PSI nor its assembly factor Ycf37 is detectable in isolated PDM 509

fractions (Rengstl et al 2011) 510

In addition to reduced de novo PSII assembly a higher relative stability of D1 in high-511

light experiments has been detected in curT- which suggests that D1 degradation during PSII 512

repair is less efficient in the mutant Photo-damaged D1 is degraded by the FtsH2FtsH3 513

complex which has previously been shown to partly localize to thylakoid convergence zones 514

at the cell periphery ie biogenesis centers (Boehm et al 2012 Sacharz et al 2015) It 515

16

therefore seems possible that the absence of biogenesis centers in curT- leads to 516

mislocalization of the FtsH2FtsH3 complex and less effective D1 degradation 517

Moreover a PSII related-function for CurT is supported by a meta-analysis of the 518

Synechocystis 6803 transcriptome When the CyanoEXpress 22 database (Hernaacutendez-Prieto 519

and Futschik 2012 Hernaacutendez-Prieto et al 2016) was queried for genes co-expressed with 520

curT (slr0483) genes for five PSII subunits ndash psbE psbO psbF psbL and psb30 ndash were 521

found among the first ten hits (Supplemental Table 4) From this we infer that biogenic 522

centers do not play an essential role in the assembly of all photosynthetic complexes but 523

serve to enhance PSII assemblyrepair possibly through the efficient delivery of Mn2+ 524

Residual PSII in curT- cells is likely to be supplied with cytoplasmic Mn2+ via a second 525

independently operating ABC transporter-based system in the plasma membrane named the 526

Mnt pathway (Bartsevich and Pakrasi 1995 Bartsevich and Pakrasi 1996) 527

Formally we cannot exclude that CurT is directly involved in the PSII assembly 528

process However considering CurTrsquos membrane bending capacity and the mutant phenotype 529

(Figure 1D and Figure 2) it appears more likely that CurT forms cellular substructures for 530

efficient PSII biogenesis ie biogenesis centers 531

As mentioned above some ultrastructural features of biogenesis centers have emerged 532

from studies employing EM-based tomography (van de Meene et al 2006) To date however 533

a high-resolution picture of the precise membrane architecture within these centers remains 534

elusive In particular whether or not a direct connection between plasma membrane and 535

thylakoids exists continues to be debated As recently discussed and in line with this gap in 536

knowledge different membrane fractionation techniques have revealed different distributions 537

of PSII-related subunits and assembly factors between plasma and thylakoid membranes 538

(Heinz et al 2016 Liberton et al 2016 Selatildeo et al 2016) The overall picture that emerges 539

is that the initial hypothesis that PSII biogenesis is initiated at the plasma membrane is no 540

longer tenable whereas a specialized thylakoid sub-fraction like the PDMs that make contact 541

with the plasma membrane could explain many of the available data and thus clarify some 542

aspects of the debate (Zak et al 2001 Pisareva et al 2011 Rast et al 2015) Moreover it 543

has previously been hypothesized that ldquoribosome-decorated membrane-like complexesrdquo 544

forming at the innermost thylakoid sheet might represent biogenic compartments (van de 545

Meene et al 2006 Mullineaux 2008) Whether these structures are affected in curT- cannot 546

be judged based on our TEM analysis but requires ultrastructural data of higher resolution 547

However the accessibility of thylakoids for ribosomes should be increased in the less 548

compressed membrane system of curT- (Figure 2B-D) 549

17

A scenario similar to that of Synechocystis 6803 holds for the situation in chloroplasts 550

of the green alga Chlamydomonas reinhardtii in which de novo PSII biogenesis has been 551

shown to be initiated in punctate regions named T-zones located close to the pyrenoid 552

(Uniacke and Zerges 2007) Unlike the mRNAs for the PSII components neither RNAs for 553

PSI subunits nor PSI assembly factors are localized to T-zones indicating that PSI and PSII 554

assembly processes are spatially separated (Uniacke and Zerges 2009 Nickelsen and Zerges 555

2013 Rast et al 2015) Interestingly a recent cryoelectron tomography study demonstrated 556

that next to T-zones at the chloroplast base-lobe junction the inner chloroplast envelope 557

exhibits invaginationsconnections to thylakoids that structurally resemble the organization of 558

cyanobacterial biogenesis centers (Engel et al 2015) For future investigations it will be 559

interesting to see if a homolog of the CURT1 family is involved in the formation of these 560

structures in C reinhardtii 561

562

Evolution of CURT1 function 563

Homologs of the CURT1 protein family can be found throughout cyanobacteria green 564

algae and plants (Armbruster et al 2013) The Arabidopsis CURT1A-D proteins have 565

recently been shown to induce bending of thylakoid membranes at grana margin regions 566

(Armbruster et al 2013) Interestingly and in contrast to the situation in Synechocystis 6803 567

their inactivation did not result in severe photosynthetic deficiencies although the thylakoids 568

formed lacked defined grana stacks Nevertheless the data available support the idea that the 569

function of thylakoid membrane structures that were regarded as being independent ie 570

cyanobacterial biogenesis centers and grana are closely related Intriguingly both of these 571

thylakoid membrane structures are dedicated to aspects of PSII function but do not involve 572

PSI (Pribil et al 2014) In both the prokaryotic and eukaryotic systems CURT1 homologs 573

appear to bend thylakoid membranes as indicated by (i) the distortion of membrane 574

ultrastructure seen in mutants devoid of curved thylakoids (ii) the localization of CURT1 575

homologs at grana margins and their local concentration at biogenesis centers (iii) the in vitro 576

membrane-curving activity of both CURT forms The phenotypic differences between 577

A thaliana and Synechocystis 6803 mutants may however be attributable to the different 578

functions of the membrane sub-compartments affected in the two model organisms Whereas 579

the role of grana is still under debate one function of the cyanobacterial biogenesis centers is 580

the above-mentioned high-throughput uptake of Mn2+ ions for efficient assembly of PSII 581

(Stengel et al 2012 Nickelsen and Rengstl 2013 Pribil et al 2014) However it appears 582

that in both cases the primary function of CURT1 proteins is to generate curved membrane 583

18

regions These discoveries suggest that until now two independently observed structures ie 584

cyanobacterial thylakoid biogenesis centers and chloroplast grana regions are closely related 585

The degree of curvature is much less pronounced in the cyanobacterial system As previously 586

discussed it was probably the subsequent evolution of a membrane-localized light-harvesting 587

system in chloroplasts that made the formation of tightly curved grana thylakoids possible 588

(Mullineaux 2005 Nevo et al 2012 Pribil et al 2014) 589

590

CurT is involved in osmotic stress response 591

One unexpected phenotype of the curT- mutant is its sensitivity to osmotic stress 592

These data revealed that in addition to shaping membranes CurT also influences their 593

functional integrity This latter function might be intrinsic to CurT or could be mediated by 594

the VIPP1 protein which has been shown to be required for membrane maintenance in 595

bacteria and chloroplasts probably by acting as a supplier of lipids (for an overview see 596

Zhang and Sakamoto 2015) Both factors accumulate in the plasma membrane upon osmotic 597

stress but VIPP1 localization is not severely affected by CurT inactivation which suggests 598

that VIPP1 operates independently of CurT In agreement with this repeated co-599

immunoprecipitations revealed no interaction between both proteins Therefore it remains to 600

be established whether a direct functional relationship between them exists 601

Previous investigations of osmotic stress in Synechocystis 6803 showed a kidney-602

shaped form of wild-type cells under very high concentrations of osmotically active 603

compounds (Marin et al 2006) The cells were severely deformed indicating changes in the 604

structure of the cellular envelope Since CurT shifts towards the plasma membrane already 605

under lower osmolyte concentrations we suggest a stabilizing function of CurT in the plasma 606

membrane CurT might be necessary to tolerate the forces trying to deform the cells under 607

osmotic stress 608

In conclusion this analysis has identified a crucial determinant for shaping and 609

maintaining the cyanobacterial thylakoid membrane system ie CurT a homolog of the 610

grana-forming CURT1 protein family from A thaliana In particular CurT is involved in the 611

formation of specific thylakoid substructures close to the plasma membrane at which PSII is 612

assembledrepaired Future work will dissect the precise ultrastructure of these centers and 613

enable us to elaborate a molecular model for the spatiotemporal organization of PSII assembly 614

in cyanobacteria 615

616

19

Methods 617

Strains and growth conditions 618

Wild-type and mutant Synechocystis 6803 cells were grown on solid or in liquid BG 619

11 medium (Rippka et al 1979) supplemented with 5 mM glucose (unless indicated 620

otherwise) at 30degC under continuous illumination at a photon irradiance of 30 μmol m-2 s-1 of 621

white light For growth during high-light experiments for investigation of D1 repair cells 622

were cultivated in a FMT150 photobioreactor (Photon Systems Instruments Draacutesov Czech 623

Republic) at 800 micromol photons m-2 s-1 in the presence or absence of lincomycin (100 microgml) 624

Cell density was monitored photometrically at 750 nm Doubling times were determined after 625

two days of growth To generate the insertion mutant curT- the curT gene (slr0483) was first 626

amplified from wild-type genomic DNA by PCR using the primer pair 04835 627

(GAAGCCTATTTAGCTAAGGCCGAAAG) and 04833 628

(TAGTACCTGGTCTTCCATGGCGT) and the resulting fragment was cloned into the 629

Bluescript pKS vector (Stratagene Waldbronn Germany) A kanamycin resistance cassette 630

was then inserted into the single AgeI restriction site (159 bp downstream of the start codon) 631

and this disruption construct was used to replace the wild-type gene as described (Wilde et al 632

2001) 633

634

Bioinformatic and computational analysis 635

CURT1 sequences of Synechocystis 6803 were obtained from CyanoBase 636

(httpgenomekazusaorjpcyanobaseSynechocystis) and CURT1 homologs in other 637

organisms were retrieved from NCBIBLAST (httpblastncbinlmnihgovBlastcgi) 638

Numbers and positions of putative transmembrane domains in the predicted proteins were 639

determined with TMHMM20 (httpwwwcbsdtudkservicesTMHMM) The sequence for 640

the N-terminal amphipathic helix was predicted by Jpred 3 641

(httpwwwcompbiodundeeacukwww-jpred) and plotted using a helical wheel projection 642

script (httprzlabucreduscriptswheelwheelcgi) The programs ClustalW2 643

(httpwwwebiacuktoolsclustalw2) and GeneDoc (httpwwwpscedubiomedgenedoc) 644

were used to generate multiple alignments of amino acid sequences Quantitative analysis of 645

immunoblots was performed with the AIDA Image Analyzer V325 (Raytest 646

Isotopenmessgeraumlte GmbH Straubenhardt Germany) 647

Co-expression patterns of curT were analyzed using the CyanoEXpress 22 database 648

(httpcyanoexpresssysbiolabeu Hernaacutendez-Prieto and Futschik 2012 Hernaacutendez-Prieto et 649

al 2016) 650

20

651

Measurement of chlorophyll concentration and oxygen production 652

Determination of chlorophyll content was carried out according to Wellburn and 653

Lichtenthaler (1984) For oxygen evolution measurements cells were grown in BG-11 654

without glucose harvested in mid-log phase and diluted to an OD750 nm = 05 Oxygen 655

evolution rates were measured with a Clark-type oxygen electrode (Hansatech Instruments 656

Ltd Kingrsquos Lynn Norfolk UK) at 1000 micromol photons m-2 s-1 (cool white light) after 5 min of 657

dark acclimation Oxygen evolution under saturating light conditions was measured without 658

any additives 659

660

Cell size and cell number estimation 661

Synechocystis 6803 strains were grown in liquid BG11 media containing 5 mM 662

glucose For cell size estimation the cells were analyzed with a confocal laser scanning 663

microscope TCS SP5 (Leica Wetzlar Germany) The diameter of the cells was measured 664

with the LAS AF Lite software (Leica Wetzlar Germany) Cells that were about to divide 665

were not taken into account For the determination of cell number cultures were set to an 666

OD750 = 1 and analyzed by using a Neubauer counting chamber (Paul Marienfeld GmbH amp 667

Co KG Lauda-Koumlnigshofen Germany) Statistical significance was determined by Studentrsquos 668

t-test 669

670

Measurements of P700+ reduction kinetics and relative electron transport rates 671

P700+ reduction kinetics and changes in chlorophyll fluorescence yield at different 672

light intensities were measured at a chlorophyll concentration of 5 microgml with a Dual-PAM-673

100 instrument (Heinz Walz GmbH Effeltrich Germany) Complete P700 oxidation was 674

achieved by a 50-ms multiple turnover pulse (10000 micromol photons m-2 s-1) after 2 min of dark 675

incubation P700+ reduction kinetics were recorded without any additions as well as in the 676

presence of 10 microM DCMU Ten technical replicates were averaged and fitted with single 677

exponential functions Data interpretation was done according to Bernaacutet et al (2009) 678

Light saturation measurements were performed according to Xu et al (2008) The 679

actinic light intensity was increased stepwise from 0 to 665 micromol photons m-2 s-1 with 30-s 680

adaptation periods Maximal fluorescence yields were obtained by applying saturating light 681

pulses (duration 600 ms intensity 10000 micromol photons m-2 s-1) 682

683

Low-temperature fluorescence measurements 684

21

Fluorescence emission spectra were measured with an AMINCO Bowman Series 2 685

Luminescence Spectrometer Wild-type and curT- cells were grown in the presence of 5 mM 686

glucose to mid log-phase and concentrated to 25 microgml chlorophyll adding 2 microM fluorescein 687

as an internal standard Samples (1 ml) were transferred to thin glass tubes dark-adapted for 688

30 min at 30 degC and shock frozen in liquid N2 To quantify chlorophyllfluorescein and 689

phycobilisome-mediated fluorescence samples were excited and emission recorded at 440 690

nm510 nm (chlorophyll and fluorescein excitationmax fluorescein emission) and 580 691

nm685 nm respectively Emission was scanned at 490-800 nm or at 640-800 nm 692

respectively 693

694

Antibody production and protein analysis 695

For generation of an αCurT antibody the N-terminal coding region of curT (amino 696

acid positions 1-58) was amplified by PCR using primers N04835 697

(AAGGATCCGTGGGCCGTAAACATTCAA) and N04833 698

(AAGTCGACGCACTTCCCACACCGGTTGTA) and cloned into the BamHI and XhoI sites 699

of the pGEX-4T-1 vector (GE Healthcare Freiburg Germany) Expression of the GST fusion 700

protein in Escherichia coli BL21(DE3) and subsequent affinity purification on Glutathione-701

Sepharose 4B (GE Healthcare) were carried out as described (Schottkowski et al 2009b) A 702

polyclonal antiserum was raised against this protein fragment in rabbits (Pineda Berlin 703

Germany) Other primary antibodies used in this study have been described previously ie 704

αpD1 (Schottkowski et al 2009b) αD1 (Schottkowski et al 2009b) αD2 (Klinkert et al 705

2006) αPratA (Klinkert et al 2004) αYcf48 (Rengstl et al 2011) αPitt (Schottkowski et 706

al 2009a) αPOR (Schottkowski et al 2009a) αYidC (Ossenbuumlhl et al 2006) αVIPP1 707

(Aseeva et al 2007) αSll0933 (Armbruster et al 2010) and αSlr0151 (Rast et al 2016) or 708

were purchased from Agrisera (Vaumlnnaumls Sweden) ie αCP43 αCP47 αPsaA αCyt f 709

αRbcL αIsiA The αGFP-HRP antibody was acquired from Miltenyi Biotech (Bergisch 710

Gladbach Germany) 711

Protein concentrations were determined according to Bradford (1976) using RotiQuant 712

(Carl Roth GmbH amp Co KG Karlsruhe Germany) Protein extraction membrane 713

fractionation on sucrose-density gradients and quantification of Western signal intensities was 714

performed as described previously (Rengstl et al 2011) Solubility properties of CurT were 715

determined according to Schottkowski et al (2009a) 716

22

Sucrose-density centrifugation separating PDM and thylakoid membrane fractions by 717

two consecutive gradients was carried out as described previously (Schottkowski et al 718

2009b Rengstl et al 2011) 719

Two-dimensional fractionations of cyanobacterial membrane proteins via BNSDS-720

PAGE and of pulse-labeled proteins by BNSDS-PAGE were performed as previously 721

reported (Klinkert et al 2004 Schottkowski et al 2009b Rengstl et al 2013) For the 722

analysis of native complexes in fractions obtained by sucrose-density centrifugation the 723

volume corresponding to 350 microg of protein in fraction 7 was applied to BNSDS-PAGE 724

For isoelectric focusing (IEF) the volume corresponding to 50 microg of protein from 725

fraction 7 in 200 microl of IEF buffer (8 M urea 4 CHAPS 1 IPG buffer pH 4-7 (GE 726

Healthcare)) was applied to an 11-cm Immobiline DryStrip pH 4-7 (GE Healthcare) in a 727

Protean IEF Cell (Bio-Rad Munich Germany) Strips were rehydrated for 12 h at 20 degC and 728

50V Focusing was carried out in the following steps 500 V rapid 1500 Vh 1000 V linear 729

880 Vh 6000 V linear 9680 Vh 6000 V rapid 5390 Vh 50 microA per gel focus temperature 730

20degC Subsequently the strips were incubated in equilibration buffer I (6 M urea 0375 M 731

Tris pH 88 20 glycerol 2 SDS 2 DTT) and equilibration buffer II (6 M urea 0375 732

M Tris pH 88 20 glycerol 2 SDS 25 iodoacetamide) for 10 min in each buffer 733

Then the IEF strips were applied to second-dimension SDS-PAGE 734

735

Transmission electron microscopy and immunogold labeling 736

Sample preparation for transmission electron microscopy including freeze substitution 737

and immunogold labeling of CurT was performed as described previously (Stengel et al 738

2012) Ultrathin sections were cut to thicknesses of 35 - 45 nm and 45 - 65 nm for 739

ultrastructural analyses and immunogold labeling respectively For immunogold labeling 740

sections collected on collodion-coated Ni grids were incubated for 18 h at 4degC with (rabbit) 741

αCurT (diluted 1100 1500 11000 or 14000 in blocking buffer (5 fetal calf serum) with 742

005 Tween 20) and further processed as described previously (Stengel et al 2012) As a 743

negative control wild-type Synechocystis 6803 cells were incubated without the primary 744

antibody and exposed to the gold-labeled anti-rabbit IgG To image the ultrastructure and the 745

immunogold-treated samples a Fei Morgagni 268 transmission electron microscope was used 746

and micrographs were taken at 80 kV 747

To avoid errors in the interpretation of the immunogold labeling experiment only 748

signals which were unambiguously localized to distinctly visible thylakoid membranes were 749

taken into account For each cell different regions (see Figure 10F) were defined and in each 750

23

region the signals on the convex and concave sides of the thylakoid membrane were analyzed 751

separately (see Supplemental Figure 11 for representative counts) Statistical significance was 752

assessed by χ2 test (Zoumlfel 1988) 753

For the analysis of clusters of CurT signals in biogenesis centers a cluster was defined 754

as a minimum of four signals in close proximity Overall 219 biogenesis centers were 755

examined with regard to CurT cluster formation 756

757

Preparation of proteoliposomes 758

Liposomes with a lipid mixture of 25 monogalactosyl diacylglycerol 42 759

digalactosyl diacylglycerol 16 sulfoquinovosyl diacylglycerol and 17 760

phosphatidylglycerol (Lipid Products South Nutfield UK) were prepared as described 761

previously (Armbruster et al 2013) To generate proteoliposomes CurT and CURT1A 762

proteins were expressed in the presence of liposomes for 3 h at 37degC using a PURExpress In 763

Vitro Protein Synthesis Kit (New England Biolabs Ipswich MA USA) The liposomes were 764

separated from the mix by centrifugation in a discontinuous sucrose gradient (100000 g 18 765

h) Subsequently the fraction containing the liposomes was extracted and dialyzed against 20 766

mM HEPES (pH 76) For transmission electron microscopy the proteoliposomes were 767

negatively stained with 1 uranyl acetate on a carbon-coated copper grid Micrographs were 768

taken on a Fei Morgagni 268 TEM at 80 kV 769

770

curT-CFP strain generation 771

Gibson assembly was used for single-step cloning (Gibson 2011) of the slr0483 gene 772

(together with its ~08 kb upstream region) the mTurquoise2 gene fragment the gentamycin-773

resistance cassette (aacC1) and an ~17-kb downstream region of slr0483 into pBR322 774

cleaved with EcoRV and NheI The slr0483 gene was fused in frame to the codon-optimized 775

mTurquoise2 (DNA20) preceded by a linker sequence encoding GSGSG The resulting 776

plasmid was used to transform Synechocystis 6803 as described previously (Zang et al 2007) 777

After ~ 10 days of incubation on BG11-GelRite (15 ) medium in the presence of 2 microgml 778

gentamycin several antibiotic resistant colonies were obtained and streaked out on fresh 779

medium These transformants were then tested for full segregation of the tagged allele by 780

colony PCR with primers flanking the slr0483 gene 781

782

Fluorescence microscopy 783

24

An aliquot of a cell suspension in mid-log phase was placed under a BG11-agarose 784

pad on a glass coverslip (15) and imaged on an inverted microscope (Zeiss 785

AxioObserverZ1) equipped with an ORCA Flash40 V2 (Hamamatsu) camera a Lumenecor 786

SOLA II Light Engine and a Plan-Apochromat 63x140 Oil DIC M27 (NA 14) objective 787

(Zeiss) Image acquisition was done with Zen 21 software in cyan and far-red fluorescence 788

channels (Zeiss Filter Sets 47 HE and 50) as Z-series with a step size of 250 nm and effective 789

pixel size of 103 nm Acquired image files were subsequently deconvolved (Constrained 790

Iterative Method) using a default theoretical Point Spread Function in Zen 20 (Zeiss) 791

Extraction of intensities for line profiles was performed by image thresholding the thylakoid 792

autofluorescence channel and eroding the resulting binary mask in Fiji (Schindelin et al 793

2012) 794

For immunofluorescence analysis cells were grown to mid-log phase as in the case of 795

the cells prepared for live-cell microscopy A 10-ml culture was fixed for 20 min in 37 796

formaldehyde and following extensive washing with phosphate-buffered saline (PBS) cells 797

were first permeabilized in 005 Triton-X for 20 min and then in lysis buffer (50 mM Tris-798

HCl 100 mM NaCl 5 mgml lysozyme) at 37degC for 2 h with gentle shaking To block 799

unspecific binding sites the cell pellet was incubated in 5 bovine serum albumin in PBS at 800

30degC for 1 h The αCurT serum (1500 dilution) was added to cells in fresh blocking buffer 801

for 1 h at 30degC with gentle shaking Cells were then washed three times with blocking buffer 802

and incubated with goat anti-rabbit IgG secondary antibodies conjugated to Oregon Green 488 803

(Invitrogen) (11000 dilution) under the conditions as for the primary antibodies Cells were 804

washed three times with PBS and prepared for microscopy as above Imaging was done as 805

described for live-cell microscopy except that a Colibri2 LED light source was employed for 806

illumination and a CoolSnap HQ camera (Photometrics) was used for image acquisition Cells 807

were imaged as Z-series (step size 280 nm) in the yellow and far-red fluorescent channels 808

(Zeiss Filter Sets 46 HE and 50) using the 505 nm and 625 nm LED modules Effective pixel 809

size in the final image was 102 nm Deconvolution and image analysis was done as described 810

above As judged by the staining intensity of the Oregon Green-conjugated antibodies 811

approximately half of the cells in any given field of view appeared to have been successfully 812

permeabilised a rate that is common in our experience No significant signal was detected in 813

the control sample that had not been exposed to the primary antibodies 814

815

25

Accession numbers 816

Sequence data from this article can be found in the CyanoBase and EMBLGenBank 817

data libraries under accession number slr0483 818

819

Supplemental Data 820

Supplemental Figure 1 Construction of the curT- mutant 821

Supplemental Figure 2 Growth phenotype of curT- 822

Supplemental Figure 3 Expression analysis of the open reading frame slr0482 (located 823

upstream of curT) in the curT- strain 824

Supplemental Figure 4 Absorbance spectra of curT- and wild-type cells 825

Supplemental Figure 5 High-light growth phenotypes of wild-type Synechocystis 6803 and 826

the curT- strain 827

Supplemental Figure 6 Ultrastructure of the TD41 mutant which lacks the psbA transcript 828

and the D1 protein 829

Supplemental Figure 7 Expression and localization of CurT-CFP 830

Supplemental Figure 8 Localization of CurT and CurT-CFP by fluorescence microscopy 831

Supplemental Figure 9 Chlorophyll autofluorescence of curT- 832

Supplemental Figure 10 The curT- mutant as a negative control for immunogold labeling 833

Supplemental Figure 11 Representative counts of immunogold signals 834

Supplemental Table 1 Overview of immunogold signals in curT- cells 835

Supplemental Table 2 Overview of immunogold signals in specific regions of Synechocystis 836

6803 wild-type cells 837

Supplemental Table 3 Statistical analysis of immunogold signals for wild-type 838

Synechocystis 6803 cells 839

Supplemental Table 4 Co-expression of curT 840

Supplemental Movie 1 Scan through the Z-axis of a curT-CFP cell 841

Supplemental Movie 2 Rendered 3D-model of a CurT-CFP detection 842

Supplemental Movie 3 Scan through the Z-axis of a curT-CFP cell with a traversing 843

thylakoid lamella 844

845

Acknowledgements 846

We thank Y Nishiyama for providing αpD1 and J Soll for αVIPP1 and αYidC antibodies 847

respectively and Nina Dyczmons-Nowaczyk for support with the fluorescence measurements 848

This work was supported by grants awarded to JN (Ni3909) MMN (NO 8363) and DL 849

26

(Le126529) by the Deutsche Forschungsgemeinschaft in the context of Research Unit 850

FOR2092 and the Cluster of Excellence RESOLV (EXC 1069) AG is a Howard Hughes 851

Medical Institute postdoctoral fellow in the laboratory of Erin OrsquoShea at Harvard University 852

LS was supported by a PhD fellowship from the Chinese Scholarship Council 853

854

Author Contributions 855

SH AR LS MMN DL and JN designed the research SH AR LS AG ILG EH ML BR 856

SV performed the research all authors contributed to data analysis SH AR and JN wrote the 857

paper 858

859

Competing Financial Interest statement 860

The authors declare no competing financial interests 861

862

We wish to dedicate this paper to Fabrice Rappaport an outstanding colleague and friend who 863

passed away so early 864

865

27

References 866

Allen JF de Paula WBM Puthiyaveetil S and Nield J (2011) A structural 867

phylogenetic map for chloroplast photosynthesis Trends Plant Sci 16 645-655 868

Anderson JM Horton P Kim E-H and Chow WS (2012) Towards elucidation of 869

dynamic structural changes of plant thylakoid architecture Philos Trans R Soc 870

Lond B Biol Sci 367 3515-3524 871

Armbruster U Zuumlhlke J Rengstl B Kreller R Makarenko E Ruumlhle T Schuumlnemann 872

D Jahns P Weisshaar B Nickelsen J and Leister D (2010) The Arabidopsis 873

thylakoid protein PAM68 is required for efficient D1 biogenesis and photosystem II 874

assembly Plant Cell 22 3439-3460 875

Armbruster U Labs M Pribil M Viola S Xu W Scharfenberg M Hertle AP 876

Rojahn U Jensen PE Rappaport F Joliot P Doumlrmann P Wanner G and 877

Leister D (2013) Arabidopsis CURVATURE THYLAKOID1 proteins modify 878

thylakoid architecture by inducing membrane curvature Plant Cell 25 2661-2678 879

Aseeva E Ossenbuumlhl F Sippel C Cho WK Stein B Eichacker LA Meurer J 880

Wanner G Westhoff P Soll J and Vothknecht UC (2007) Vipp1 is required for 881

basic thylakoid membrane formation but not for the assembly of thylakoid protein 882

complexes Plant Physiol Biochem 45 119-128 883

Bartsevich VV and Pakrasi HB (1995) Molecular identification of an ABC transporter 884

complex for manganese analysis of a cyanobacterial mutant strain impaired in the 885

photosynthetic oxygen evolution process EMBO J 14 1845-1853 886

Bartsevich VV and Pakrasi HB (1996) Manganese transport in the cyanobacterium 887

Synechocystis sp PCC 6803 J Biol Chem 271 26057-26061 888

Bernaacutet G Waschewski N and Roumlgner M (2009) Towards efficient hydrogen production 889

the impact of antenna size and external factors on electron transport dynamics in 890

Synechocystis PCC 6803 Photosynth Res 99 205-216 891

Boehm M Yu J Krynicka V Barker M Tichy M Komenda J Nixon PJ and Nield 892

J (2012) Subunit Organization of a Synechocystis Hetero-Oligomeric Thylakoid FtsH893

Complex Involved in Photosystem II Repair Plant Cell 24 3669-3683894

Bradford MM (1976) A rapid and sensitive method for the quantitation of microgram 895

quantities of protein utilizing the principle of protein-dye binding Anal Biochem 72 896

248-254897

28

Chang L Liu X Li Y Liu C-C Yang F Zhao J and Sui S-F (2015) Structural 898

organization of an intact phycobilisome and its association with photosystem II Cell 899

Res 25 726-737 900

Danielsson R Suorsa M Paakkarinen V Albertsson P-Aring Styring S Aro E-M and 901

Mamedov F (2006) Dimeric and monomeric organization of photosystem II 902

Distribution of five distinct complexes in the different domains of the thylakoid 903

membrane J Biol Chem 281 14241-14249 904

Daum B Nicastro D Austin J McIntosh JR and Kuumlhlbrandt W (2010) Arrangement 905

of photosystem II and ATP synthase in chloroplast membranes of Spinach and Pea 906

Plant Cell 22 1299-1312 907

Engel BD Schaffer M Kuhn Cuellar L Villa E Plitzko JM and Baumeister W 908

(2015) Native architecture of the Chlamydomonas chloroplast revealed by in situ 909

cryo-electron tomography eLife 4 e04889 910

Ford MGJ Mills IG Peter BJ Vallis Y Praefcke GJK Evans PR and McMahon 911

HT (2002) Curvature of clathrin-coated pits driven by epsin Nature 419 361-366 912

Fristedt R Willig A Granath P Cregravevecoeur M Rochaix J-D and Vener AV (2009) 913

Phosphorylation of photosystem II controls functional macroscopic folding of 914

photosynthetic membranes in Arabidopsis Plant Cell 21 3950-3964 915

Gallop JL and McMahon HT (2005) BAR domains and membrane curvature bringing 916

your curves to the BAR Biochem Soc Symp 72 223-231 917

Gibson DG (2011) Chapter fifteen - Enzymatic Assembly of Overlapping DNA Fragments 918

In Methods in Enzymology V Christopher ed (Academic Press) pp 349-361 919

Goedhart J von Stetten D Noirclerc-Savoye M Lelimousin M Joosen L Hink MA 920

van Weeren L Gadella TWJ and Royant A (2012) Structure-guided evolution of 921

cyan fluorescent proteins towards a quantum yield of 93 Nat Commun 3 751 922

Heinz S Liauw P Nickelsen J and Nowaczyk M (2016) Analysis of photosystem II 923

biogenesis in cyanobacteria Biochim Biophys Acta 1857 274-287 924

Hernaacutendez-Prieto M and Futschik M (2012) CyanoEXpress A web database for 925

exploration and visualisation of the integrated transcriptome of cyanobacterium 926

Synechocystis sp PCC6803 Bioinformation 8 634-638 927

Hernaacutendez-Prieto MA Semeniuk TA Giner-Lamia J and Futschik ME (2016) The 928

Transcriptional Landscape of the Photosynthetic Model Cyanobacterium 929

Synechocystis sp PCC6803 Sci Rep 6 22168 930

29

Huang F Fulda S Hagemann M and Norling B (2006) Proteomic screening of salt-931

stress-induced changes in plasma membranes of Synechocystis sp strain PCC 6803 932

Proteomics 6 910-920 933

Kirchhoff H (2013) Architectural switches in plant thylakoid membranes Photosynth Res 934

116 481-487 935

Klinkert B Elles I and Nickelsen J (2006) Translation of chloroplast psbD mRNA in 936

Chlamydomonas is controlled by a secondary RNA structure blocking the AUG start 937

codon Nucleic Acids Res 34 386-394 938

Klinkert B Ossenbuumlhl F Sikorski M Berry S Eichacker L and Nickelsen J (2004) 939

PratA a periplasmic tetratricopeptide repeat protein involved in biogenesis of 940

photosystem II in Synechocystis sp PCC 6803 J Biol Chem 279 44639-44644 941

Komenda J Nickelsen J Tichyacute M Praacutešil O Eichacker LA and Nixon PJ (2008) The 942

cyanobacterial homologue of HCF136YCF48 is a component of an early photosystem 943

II assembly complex and is important for both the efficient assembly and repair of 944

photosystem II in Synechocystis sp PCC 6803 J Biol Chem 283 22390-22399 945

Kopf M Klaumlhn S Scholz I Matthiessen JKF Hess WR and Voszlig B (2014) 946

Comparative analysis of the primary transcriptome of Synechocystis sp PCC 6803 947

DNA Res 21 527-539 948

Kunkel DD (1982) Thylakoid centers Structures associated with the cyanobacterial 949

photosynthetic membrane system Arch Microbiol 133 97-99 950

Liberton M Howard Berg R Heuser J Roth R and Pakrasi BH (2006) Ultrastructure 951

of the membrane systems in the unicellular cyanobacterium Synechocystis sp strain 952

PCC 6803 Protoplasma 227 129-138 953

Liberton M Saha R Jacobs JM Nguyen AY Gritsenko MA Smith RD 954

Koppenaal DW and Pakrasi HB (2016) Global Proteomic Analysis Reveals an 955

Exclusive Role of Thylakoid Membranes in Bioenergetics of a Model 956

Cyanobacterium Mol Cell Proteomics 15 2021-2032 957

Luque I and Ochoa de Alda JAG (2014) CURT1CAAD-containing aaRSs thylakoid 958

curvature and gene translation Trends Plant Sci 19 63-66 959

Marin K Stirnberg M Eisenhut M Kraumlmer R and Hagemann M (2006) Osmotic stress 960

in Synechocystis sp PCC 6803 low tolerance towards nonionic osmotic stress results 961

from lacking activation of glucosylglycerol accumulation Microbiology 152 2023-962

2030 963

Mullineaux CW (2005) Function and evolution of grana Trends Plant Sci 10 521-525 964

30

Mullineaux CW (2008) Biogenesis and dynamics of thylakoid membranes and the 965

photosynthetic apparatus In The Cyanobacteria A Herrero and E Flores eds 966

(Norfolk UK Caister Academic Press) pp 289ndash304 967

Nevo R Charuvi D Tsabari O and Reich Z (2012) Composition architecture and 968

dynamics of the photosynthetic apparatus in higher plants Plant J 70 157-176 969

Nickelsen J and Rengstl B (2013) Photosystem II assembly From cyanobacteria to plants 970

Annu Rev Plant Biol 64 609-635 971

Nickelsen J and Zerges W (2013) Thylakoid biogenesis has joined the new era of bacterial 972

cell biology Front Plant Sci 4 458 973

Nilsson F Simpson DJ Jansson C and Andersson B (1992) Ultrastructural and 974

biochemical characterization of a Synechocystis 6803 mutant with inactivated psbA 975

genes Arch Biochem Biophys 295 340-347 976

Odom WR Hodges R Chitnis PR and Guikema JA (1993) Characterization of 977

Synechocystis sp PCC 6803 in iron-supplied and iron-deficient media Plant Mol 978

Biol 23 1255-1264 979

Ossenbuumlhl F Inaba-Sulpice M Meurer J Soll J and Eichacker LA (2006) The 980

Synechocystis sp PCC 6803 Oxa1 homolog is essential for membrane integration of 981

reaction center precursor protein pD1 Plant Cell 18 2236-2246 982

Pisareva T Kwon J Oh J Kim S Ge C Wieslander Aring Choi J-S and Norling B 983

(2011) Model for Membrane Organization and Protein Sorting in the Cyanobacterium 984

Synechocystis sp PCC 6803 Inferred from Proteomics and Multivariate Sequence 985

Analyses J Proteome Res 10 3617-3631 986

Pribil M Labs M and Leister D (2014) Structure and dynamics of thylakoids in land 987

plants J Exp Bot 65 1955-1972 988

Rast A Heinz S and Nickelsen J (2015) Biogenesis of thylakoid membranes Biochim 989

Biophys Acta 1847 821-830 990

Rast A Rengstl B Heinz S Klingl A and Nickelsen J (2016) The role of Slr0151 a 991

tetratricopeptide repeat protein from Synechocystis sp PCC 6803 during Photosystem 992

II assembly and repair Front Plant Sci 7 605 993

Rengstl B Oster U Stengel A and Nickelsen J (2011) An Intermediate Membrane 994

Subfraction in Cyanobacteria Is Involved in an Assembly Network for Photosystem II 995

Biogenesis J Biol Chem 286 21944-21951 996

31

Rengstl B Knoppovaacute J Komenda J and Nickelsen J (2013) Characterization of a 997

Synechocystis double mutant lacking the photosystem II assembly factors YCF48 and 998

Sll0933 Planta 237 471-480 999

Rexroth S Mullineaux CW Ellinger D Sendtko E Roumlgner M and Koenig F (2011) 1000

The Plasma Membrane of the Cyanobacterium Gloeobacter violaceus Contains 1001

Segregated Bioenergetic Domains Plant Cell 23 2379-2390 1002

Rippka R Deruelles J Waterbury JB Herdman M and Stanier RY (1979) Generic 1003

Assignments Strain Histories and Properties of Pure Cultures of Cyanobacteria 1004

Microbiology 111 1-61 1005

Ruumltgers M and Schroda M (2013) A role of VIPP1 as a dynamic structure within 1006

thylakoid centers as sites of photosystem biogenesis Plant Signal Behav 8 e27037 1007

Sacharz J Bryan SJ Yu J Burroughs NJ Spence EM Nixon PJ and Mullineaux 1008

CW (2015) Sub-cellular location of FtsH proteases in the cyanobacterium1009

Synechocystis sp PCC 6803 suggests localised PSII repair zones in the thylakoid1010

membranes Mol Microbiol 96 448-4621011

Sandstroumlm S Park Y-I Oumlquist G and Gustafsson P (2001) CP43prime the isiA Gene 1012

Product Functions as an Excitation Energy Dissipator in the Cyanobacterium 1013

Synechococcus sp PCC 7942 Photochem Photobiol 74 431-437 1014

Schindelin J Arganda-Carreras I Frise E Kaynig V Longair M Pietzsch T 1015

Preibisch S Rueden C Saalfeld S Schmid B Tinevez J-Y White DJ 1016

Hartenstein V Eliceiri K Tomancak P and Cardona A (2012) Fiji an open-1017

source platform for biological-image analysis Nat Methods 9 676-682 1018

Schottkowski M Ratke J Oster U Nowaczyk M and Nickelsen J (2009a) Pitt a novel 1019

tetratricopeptide repeat protein involved in light-dependent chlorophyll biosynthesis 1020

and thylakoid membrane biogenesis in Synechocystis sp PCC 6803 Mol Plant 2 1021

1289-1297 1022

Schottkowski M Gkalympoudis S Tzekova N Stelljes C Schuumlnemann D Ankele E 1023

and Nickelsen J (2009b) Interaction of the periplasmic PratA factor and the PsbA 1024

(D1) protein during biogenesis of photosystem II in Synechocystis sp PCC 6803 J 1025

Biol Chem 284 1813-1819 1026

Selatildeo TT Zhang L Knoppovaaacute J Komenda J and Norling B (2016) Photosystem II 1027

Assembly Steps Take Place in the Thylakoid Membrane of the Cyanobacterium 1028

Synechocystis sp PCC6803 Plant Cell Physiol 57 878 1029

32

Spaumlt P Maček B and Forchhammer K (2015) Phosphoproteome of the cyanobacterium 1030

Synechocystis sp PCC 6803 and its dynamics during nitrogen starvation Front 1031

Microbiol 6 248 1032

Stengel A Guumlgel IL Hilger D Rengstl B Jung H and Nickelsen J (2012) Initial 1033

steps of photosystem II de novo assembly and preloading with manganese take place 1034

in biogenesis centers in Synechocystis Plant Cell 24 660-675 1035

Uniacke J and Zerges W (2007) Photosystem II assembly and repair are differentially 1036

localized in Chlamydomonas Plant Cell 19 3640-3654 1037

Uniacke J and Zerges W (2009) Chloroplast protein targeting involves localized 1038

translation in Chlamydomonas Proc Natl Acad Sci USA 106 1439-1444 1039

van de Meene AL Hohmann-Marriott M Vermaas WJ and Roberson R (2006) The 1040

three-dimensional structure of the cyanobacterium Synechocystis sp PCC 6803 Arch 1041

Microbiol 184 259-270 1042

van de Meene AML Sharp WP McDaniel JH Friedrich H Vermaas WFJ and 1043

Roberson RW (2012) Gross morphological changes in thylakoid membrane 1044

structure are associated with photosystem I deletion in Synechocystis sp PCC 6803 1045

Biochim Biophys Acta 1818 1427-1434 1046

Watanabe M and Ikeuchi M (2013) Phycobilisome architecture of a light-harvesting 1047

supercomplex Photosynth Res 116 265-276 1048

Wellburn AR and Lichtenthaler H (1984) Formulae and Program to Determine Total 1049

Carotenoids and Chlorophylls A and B of Leaf Extracts in Different Solvents In 1050

Advances in Photosynthesis Research Proceedings of the VIth International Congress 1051

on Photosynthesis Brussels Belgium August 1ndash6 1983 C Sybesma ed (Dordrecht 1052

Springer Netherlands) pp 9-12 1053

Wilde A Lunser K Ossenbuumlhl F Nickelsen J and Borner T (2001) Characterization of 1054

the cyanobacterial ycf37 mutation decreases the photosystem I content Biochem J 1055

357 211-216 1056

Wilson A Boulay C Wilde A Kerfeld CA and Kirilovsky D (2007) Light-Induced 1057

Energy Dissipation in Iron-Starved Cyanobacteria Roles of OCP and IsiA Proteins 1058

Plant Cell 19 656-672 1059

Xu M Bernaacutet G Singh A Mi H Roumlgner M Pakrasi HB and Ogawa T (2008) 1060

Properties of Mutants of Synechocystis sp Strain PCC 6803 Lacking Inorganic Carbon 1061

Sequestration Systems Plant Cell Physiol 49 1672-1677 1062

33

Yamamoto T Burke J Autz G and Jagendorf AT (1981) Bound ribosomes of Pea 1063

chloroplast thylakoid membranes location and release in vitro by high salt 1064

puromycin and RNase Plant Physiol 67 940-949 1065

Yang H Liao L Bo T Zhao L Sun X Lu X Norling B and Huang F (2014) 1066

Slr0151 in Synechocystis sp PCC 6803 is required for efficient repair of photosystem 1067

II under high-light condition J Integr Plant Biol 56 1136-1150 1068

Yeremenko N Kouřil R Ihalainen JA DHaene S van Oosterwijk N 1069

Andrizhiyevskaya EG Keegstra W Dekker HL Hagemann M Boekema EJ 1070

Matthijs HCP and Dekker JP (2004) Supramolecular Organization and Dual 1071

Function of the IsiA Chlorophyll-Binding Protein in Cyanobacteria Biochemistry 43 1072

10308-10313 1073

Zak E Norling B Maitra R Huang F Andersson B and Pakrasi HB (2001) The 1074

initial steps of biogenesis of cyanobacterial photosystems occur in plasma membranes 1075

Proc Natl Acad Sci USA 98 13443-13448 1076

Zang X Liu B Liu S Arunakumara KKIU and Zhang X (2007) Optimum 1077

Conditions for Transformation of Synechocystis sp PCC 6803 J Microbiol 45 241-1078

245 1079

Zhang L and Sakamoto W (2015) Possible function of VIPP1 in maintaining chloroplast 1080

membranes Biochim Biophys Acta 1847 831-837 1081

Zimmerberg J and Kozlov MM (2006) How proteins produce cellular membrane 1082

curvature Nat Rev Mol Cell Biol 7 9-19 1083

Zoumlfel P (1988) Statistik in der Praxis (Stuttgart Germany Gustav Fischer Verlag) 1084

1085

34

Figure Legends 1086

Figure 1 General characteristics of CurT A) Sequence alignment of CurT and CURT1A-D 1087

from A thaliana Predicted chloroplast transit-peptide sequences of CURT1A-D are omitted 1088

(Armbruster et al 2013) Positions of predicted C-terminal transmembrane domains (TDM) 1089

are marked (black bar) as is the position of the predicted amphipathic N-terminal helix in 1090

CurT (red bar) The green bar denotes the peptide sequence used for antibody production 1091

Identical and related amino acids that are conserved in 100 80 and 60 of the sequences 1092

are highlighted in black dark grey and light grey respectively B) Helical-wheel 1093

representation of the N-terminal amphipathic helix of CurT (red bar in A) The color code 1094

reflects the physicochemical properties of amino-acid side-chains green polar and 1095

uncharged blue polar and positively charged red polar and negatively charged yellow 1096

hydrophobic C) Solubility of CurT Membrane-associated proteins (50 microg) from wild-type 1097

cells were extracted with 5 mM HEPES (pH 76) containing either 1 M NaCl 01 M Na2CO3 1098

4 M urea 01 Triton X-100 or no additional solute After separation of membrane-bound 1099

(M) and solubilized (S) proteins by centrifugation proteins were fractionated by SDS-PAGE1100

and CurT was immunodetected on immunoblots As a control the integral membrane protein 1101

CP47 from PSII was analyzed in parallel D) Transmission electron micrographs of negatively 1102

stained liposomes Cell-free expression (CFE) of CurT and A thaliana CURT1A was 1103

performed in the presence of liposomes similar in composition to the lipids of the thylakoid 1104

membrane Liposomes before and after cell-free protein expression in the absence of DNA 1105

served as negative controls Black arrowheads indicate tubular connections between 1106

liposomes Scale bars 250 nm 1107

1108

Figure 2 Ultrastructural analysis of curT- cells Transmission electron micrographs of typical 1109

wild-type (A) and curT- (B-D) Synechocystis 6803 cells taken at 44000times (A B) and 28000times 1110

(C D) magnification respectively Ultrathin sections (35 to 45 nm) of cryofixed samples 1111

were stained with osmium tetroxide and post-stained using lead citrate Arrowheads indicate 1112

biogenesis centers Scale bars 200 nm (A B) and 500 nm (C D) respectively 1113

1114

Figure 3 Accumulation of components of photosynthetic complexes in the curT- mutant A) 1115

Whole cell extracts (30 microg protein) from wild-type and curT- strains were fractionated by 1116

SDS-PAGE and analyzed on immunoblots using the indicated antibodies B) The histogram 1117

shows levels of the indicated proteins in curT- extracts relative to wild-type samples (dashed 1118

red line) Data are means plusmn SD of three independent experiments Significant differences from 1119

35

wild-type protein levels according to Studentrsquos t-test with error probabilities of 5 and 1 1120

are indicated by and respectively 1121

1122

Figure 4 P700+ reduction kinetics and high-light effects in curT- cells A) Averaged traces 1123

(10 single measurements) of P700+ decay after complete oxidation by a 50-ms multiple 1124

turnover pulse (10000 micromol photons m-2 s-1) in the absence and presence of 10 microM DCMU 1125

B) Rate constants for P700+ reduction were obtained by fitting of the data with single1126

exponential functions Error bars indicate the SD of three independent measurements C) 1127

Impact of light intensity on the (relative) electron transport rate (rETR) Cells were exposed to 1128

gradually increasing light intensities which resulted in increasing electron transport until the 1129

capacity limit was reached PAR light intensity (micromol photons m-2 s-1) Error bars indicate the 1130

SD of three independent measurements D) D1 protein level in wild-type and curT- after high-1131

light treatment (800 micromol photons m-2s-1) in the presence and absence of lincomycin Samples 1132

were taken every 30 min and processed as in Figure 3 to determine the level of D1 present 1133

100 refers to wild-type D1 level at the beginning of the experiment 1134

1135

Figure 5 PSII assembly in curT- cells A) BNSDS-PAGE of membrane proteins Membrane 1136

fractions from wild-type and curT- cells were solubilized with 13 n-dodecyl-β-maltoside 1137

and proteins were fractionated by two-dimensional BNSDS-PAGE blotted and probed with 1138

antibodies against the PSII subunits D1 D2 CP47 and CP43 Wild-type blots were also 1139

probed with the αCurT antibody The sizes of marker proteins and the positions of PSII 1140

assembly intermediates (RCCII RCCI RC47) are shown above and below each image B) In 1141

vivo pulse labeling of membrane proteins with 35S Pulse-labeled PSII core proteins were 1142

separated via BNSDS-PAGE and visualized by autoradiography 1143

1144

Figure 6 Loss of CurT induces stress A) Low-temperature (77 K) fluorescence emission of 1145

Synechocystis 6803 wild-type (blue) and curT- (red) cells excited at 440 nm The spectra were 1146

normalized to the added fluorescein standard B) Low-temperature (77 K) fluorescence 1147

emission of Synechocystis 6803 wild-type (blue) and curT- (red) excited at 580 nm The 1148

spectra were normalized to 780 nm C) Level of IsiA in the curT- mutant relative to the wild-1149

type A mean value of 368 plusmn 96 (SD) was determined from three independent experiments 1150

1151

Figure 7 Membrane sublocalization of PSII-related factors Cell extracts from wild-type and 1152

curT- cells were fractionated by two consecutive rounds of sucrose-density gradient 1153

36

centrifugation (Schottkowski et al 2009b) The second linear gradient (20-60 sucrose) was 1154

apportioned into 14 fractions which were analyzed by immunoblotting using the indicated 1155

antibodies Fractions 1ndash6 represent PDMs and fractions 7ndash14 thylakoid membranes (TMs) 1156

To facilitate comparison between gradients sample volumes were normalized to the volume 1157

of fraction 7 that contained 40 microg of protein 1158

1159

Figure 8 Live-cell imaging of the curT-CFP strain by fluorescence microscopy In the curT-1160

CFP strain the native curT gene has been replaced by a CFP-tagged version resulting in the 1161

expression of the CurT-CFP fusion protein under the control of the native promotor A) 1162

Close-up views of the mid-cell plane in the CFP and far-red autofluorescence channels shown 1163

in slice 7 in panel B B) Synechocystis 6803 cells expressing CurT C-terminally fused to the 1164

mTurquoise2 variant of CFP from its native chromosomal promoter The two imaging 1165

channels are displayed as Z-axis montages (auto-scaled contrast step size 250 nm) in 1166

grayscale and color composite configuration The thylakoid autofluorescent channel as 1167

imaged in far-red fluorescence is depicted in magenta and CurT signal as imaged in cyan 1168

fluorescence is depicted in cyan C) Fluorescence intensity profiles of the two channels along 1169

the autofluorescent peripheral cell ldquoringrdquo are shown for slice 7 The maximum projection of 1170

the entire Z montage is also shown Scale bars (light grey) 2 microm 1171

1172

Figure 9 Immunofluorescence detection of CurT A) Close-ups of slice 5 in panel B B) 1173

Wild-type Synechocystis 6803 cells labeled with αCurT antibodies and detected with Oregon 1174

Green-conjugated secondary antibodies The Z-axis montages are shown as in Figure 8B 1175

except that the step size is 280 nm (1 to 10) C) Intensity profiles of the two channels along 1176

the autofluorescent peripheral cell ldquoringrdquo are shown for slice 5 The maximum projection of 1177

the entire Z montage is also shown Scale bars (light grey) 2 microm 1178

1179

Figure 10 Subcellular localization of CurT Ultrathin sections of wild-type Synechocystis 1180

6803 cells were incubated with rabbit αCurT prior to incubation with gold-conjugated goat 1181

anti-rabbit IgG A) Negative control (wild-type processed without addition of primary 1182

antibody) B C) Immunogold-labeled sections showing CurT localization at the cytoplasmic 1183

side of the thylakoid membrane D) Cluster formation of CurT signals at a putative biogenesis 1184

center from C E) Biogenesis center from the same cell (C) without any obvious CurT 1185

clustering of gold particles F) Schematic depiction of a wild-type cell (from Figure 2A) with 1186

color-coded curved membranes green = thylakoids that follow the curvature of the cell red = 1187

37

thylakoids that bend away from the plasma membrane yellow = thylakoids that bend toward 1188

the plasma membrane to converge on sites of biogenesis centers G) Relative distribution of 1189

gold signals between convex (dark color) and concave (light color) sides of membranes (n = 1190

1584 signals from a total of 95 cells) The undifferentiated overall signal distribution is given 1191

in blue Bars = 200 nm (overview) and 100 nm (details) 1192

1193

Figure 11 Differentially modified forms of CurT are found in different complexes in PDMs 1194

and thylakoid membranes Samples were isolated by fractionation of wild-type membranes 1195

via two consecutive sucrose density gradients according to Schottkowski et al (2009b) After 1196

density centrifugation samples were applied to BNSDS-PAGE analysis (A) or isoelectric 1197

focusing (B) Numbers on the right indicate the respective fraction from the second gradient 1198

(see Figure 7) Fraction 5 represents the PDMs and fraction 9 the thylakoid membrane 1199

1200

Figure 12 Loss of CurT increases sensitivity to abiotic stress A B) Doubling times of wild-1201

type and curT- under salt stress (A) or osmotic stress (B) Doubling times are means plusmn SD of 1202

three independent cultures C) Localization of CurT-CFP under salt and osmotic stress 1203

Samples were examined as described in Figure 8 Scale bars 1 microm D) Protein levels of wild-1204

type cells after growth in BG11 medium containing 500 mM NaCl Samples were analyzed on 1205

the same gel but unrelated samples between the presented signals were omitted E) 1206

Membrane preparations obtained from wild-type cells wild-type cells grown in the presence 1207

of 500 mM NaCl and curT- cells were subjected to the first gradient step in the membrane 1208

fractionation scheme The gradient was divided into five fractions and 10 of fractions I-IV 1209

and 02 of fraction V were analyzed by SDS-PAGE Fraction II includes the plasma 1210

membrane and fraction V consists of PratA-defined membrane and thylakoid membrane 1211

1212

Figure 13 Model of CurT distribution at convergence zones in Synechocystis 6803 The 1213

distribution of CurT in thylakoid (green) and plasma membranes (brown) is shown The 1214

pattern of localization of CurT in the thylakoid membrane is derived from membrane 1215

fractionation via sucrose density centrifugation fluorescence-based detection of the CurT-1216

CFP fusion and endogenous CurT and immunogold labeling experiments (Figures 7-10) The 1217

different CurT variants a b c and d identified in the IEF experiments (Figure 11) are depicted 1218

in yellow pink blue and black respectively CurT present in the plasma membrane is 1219

highlighted in gray as its precise nature and role remain to be defined (Figure 12) 1220

Membranes are represented as lipid bilayers Convex and concave faces of bent thylakoid 1221

38

sheets are indicated by black arrows The PDM which is dedicated to PSII assembly and 1222

repair is depicted in blue The dotted blue line emphasizes that the ultrastructure in this region 1223

has not yet been fully resolved PP periplasm PM plasma membrane TM thylakoid 1224

membrane L lumen PDM PratA-defined membrane 1225

1226

Tables 1227

Table 1 Physiological characteristics of the curT- mutant 1228

Strain Doubling time [h]

Oxygen Evolution[nmol h-1 OD750

-1]c

Chlorophyll content

[microg OD750-1]

d

Cell size [microm]e

Cell number [ml-1 OD750

-1]f

Wild type 817plusmn017a 1600plusmn042

b 1933plusmn187 251plusmn014 264plusmn020 390plusmn006 x 107

curT- 1259plusmn020a 3226plusmn056

b 1074plusmn20 195plusmn029 274plusmn044 367plusmn016 x 107

1229 abDoubling times in the presence (a) or absence (b) of 5 mM glucose measured under 1230

continuous illumination at 30 micromol photons m-2 s-1 and CO2-limiting conditions cOxygen 1231

evolution is expressed in nmol O2 produced per hour per OD750 unit dChlorophyll content is 1232

expressed in microg OD750-1 eThe diameter of non-dividing cells is presented in microm fCell number 1233

was determined per ml per OD750 Data are means plusmn SD of at least three independent 1234

experiments 1235

1236

Parsed CitationsAllen JF de Paula WBM Puthiyaveetil S and Nield J (2011) A structural phylogenetic map for chloroplast photosynthesisTrends Plant Sci 16 645-655

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Anderson JM Horton P Kim E-H and Chow WS (2012) Towards elucidation of dynamic structural changes of plant thylakoidarchitecture Philos Trans R Soc Lond B Biol Sci 367 3515-3524

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Armbruster U Zuumlhlke J Rengstl B Kreller R Makarenko E Ruumlhle T Schuumlnemann D Jahns P Weisshaar B NickelsenJ and Leister D (2010) The Arabidopsis thylakoid protein PAM68 is required for efficient D1 biogenesis and photosystem IIassembly Plant Cell 22 3439-3460

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Armbruster U Labs M Pribil M Viola S Xu W Scharfenberg M Hertle AP Rojahn U Jensen PE Rappaport F JoliotP Doumlrmann P Wanner G and Leister D (2013) Arabidopsis CURVATURE THYLAKOID1 proteins modify thylakoid architectureby inducing membrane curvature Plant Cell 25 2661-2678

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Aseeva E Ossenbuumlhl F Sippel C Cho WK Stein B Eichacker LA Meurer J Wanner G Westhoff P Soll J andVothknecht UC (2007) Vipp1 is required for basic thylakoid membrane formation but not for the assembly of thylakoid proteincomplexes Plant Physiol Biochem 45 119-128

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Bartsevich VV and Pakrasi HB (1995) Molecular identification of an ABC transporter complex for manganese analysis of acyanobacterial mutant strain impaired in the photosynthetic oxygen evolution process EMBO J 14 1845-1853

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Bartsevich VV and Pakrasi HB (1996) Manganese transport in the cyanobacterium Synechocystis sp PCC 6803 J Biol Chem271 26057-26061

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Bernaacutet G Waschewski N and Roumlgner M (2009) Towards efficient hydrogen production the impact of antenna size andexternal factors on electron transport dynamics in Synechocystis PCC 6803 Photosynth Res 99 205-216

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Boehm M Yu J Krynicka V Barker M Tichy M Komenda J Nixon PJ and Nield J (2012) Subunit Organization of aSynechocystis Hetero-Oligomeric Thylakoid FtsH Complex Involved in Photosystem II Repair Plant Cell 24 3669-3683

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Bradford MM (1976) A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle ofprotein-dye binding Anal Biochem 72 248-254

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Chang L Liu X Li Y Liu C-C Yang F Zhao J and Sui S-F (2015) Structural organization of an intact phycobilisome and itsassociation with photosystem II Cell Res 25 726-737

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Danielsson R Suorsa M Paakkarinen V Albertsson P-Aring Styring S Aro E-M and Mamedov F (2006) Dimeric andmonomeric organization of photosystem II Distribution of five distinct complexes in the different domains of the thylakoidmembrane J Biol Chem 281 14241-14249

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Daum B Nicastro D Austin J McIntosh JR and Kuumlhlbrandt W (2010) Arrangement of photosystem II and ATP synthase in

12

different complexes by using 2D BNSDS-PAGE to characterize membrane material isolated 380

via two-step sucrose gradient centrifugation (see Figure 7) In accordance with the data in 381

Figure 5A we find several low-molecular-weight complexes containing CurT (Figure 11A) 382

Smaller complexes of ~80 (complex I) and ~100 kDa (complex II) accumulate in membrane 383

fraction 5 (representing PDMs) but these are far less prevalent in fraction 9 representing 384

thylakoids (Figure 11A) In addition CurT-containing sub-complexes of ~140 (complex III) 385

and ~200 kDa (complex IV) are more prominently represented in thylakoids together with 386

even larger complexes ranging up to 670 kDa (Figure 11A) 387

Even more strikingly PDMs and thylakoids also differ with respect to the forms of 388

CurT they contain Thus isoelectric focusing (IEF) analysis of both membrane fractions 389

revealed at least four different CurT isoforms (a-d Figure 11B) PDMs contain mainly forms 390

b and d as well as trace amounts of a while thylakoids apparently possess very low levels of 391

form d and accumulate forms a b and c (Figure 11B) The nature of the underlying CurT 392

modifications still has to be determined Interestingly however CurT has recently been 393

identified as a phosphoprotein in a proteomic study (Spaumlt et al 2015) and the CurT variants 394

in Figure 11B may differ in their phosphorylation states At all events PDMs and thylakoids 395

can be distinguished by their complement of CurT isoforms which potentially play a role in 396

formation of the CurT sub-complexes that define the two membrane fractions 397

398

CurT is involved in the osmotic stress response 399

To further explore the stress-related role of CurT (Figure 6) and its link to IsiA 400

induction the effect of other potential stressors on curT- cells was tested High light levels had 401

a minor effect on curT- growth and its photosynthetic performance (Figure 4 Supplemental 402

Figure 5 and section above) suggesting that other environmental factors induced isiA 403

expression Our search was also motivated by a previous proteomic survey of plasma 404

membrane proteins of Synechocystis 6803 in high salt conditions in which CurT and VIPP1 405

were found among the most highly induced targets (Huang et al 2006) First we cultured 406

wild-type and curT- cells in different salt concentrations and found that growth of curT- was 407

severely affected in high salt (Figure 12A) Wild-type cells were only slightly affected by the 408

addition of salt to the medium The deleterious effect of the loss of curT on growth was even 409

more pronounced when maltose an osmotically active compound was present in the medium 410

(Figure 12B) Indeed curT- cells failed to survive exposure to 150 mM maltose whereas 411

growth of the wild-type was only slightly compromised These findings assign an additional 412

function to CurT ie a protective role during osmotic stress 413

13

When the curT-CFP strain was analyzed under these stress conditions enhanced 414

accumulation of CurT at the cell periphery was found mostly outside the autofluorescent 415

thylakoids and consistent with accumulation at the plasma membrane (Figure 12C) This was 416

further substantiated by membrane fractionation experiments which also revealed an 417

increased relative abundance of CurT in the plasma membrane fraction in the first sucrose 418

gradient (Figure 12E) Determination of total cellular CurT levels demonstrated that its 419

absolute amount did not increase under stress (Figure 12D) Therefore its higher abundance 420

in the plasma membrane under osmotic stress is likely to be due to CurT trafficking towards 421

the plasma membrane instead of increased synthesis 422

The same appears to hold true for VIPP1 which has been implicated in membrane 423

maintenance in both cyanobacteria and chloroplasts (Zhang and Sakamoto 2015) At stress 424

conditions an increase of the VIPP1 signal in the plasma membrane can be monitored in 425

wild-type (Figure 12E) However enhanced accumulation of VIPP1 in plasma membranes is 426

unaffected in the curT- mutant suggesting that thylakoid convergence zones are not strictly 427

required for the localization of VIPP1 428

429

Discussion 430

CurT determines thylakoid architecture 431

This study demonstrates that the protein CurT a homolog of the grana-forming 432

CURT1 proteins in plants is essential for establishing the proper thylakoid membrane 433

architecture in the cyanobacterium Synechocystis 6803 In particular CurTrsquos membrane-434

bending activity is likely to be required for the formation of thylakoid biogenesis centers at 435

points on the cell periphery where thylakoids converge towards the plasma membrane Here 436

PratA-mediated preloading of early PSII assembly intermediates with Mn2+ ions has been 437

proposed to take place together with PSII repair (Stengel et al 2012 Sacharz et al 2015) 438

This idea is supported by the following lines of evidence (i) The curT- mutant is devoid of 439

any thylakoid sectors that have convergence zones at their distal ends instead thylakoid 440

membranes are displaced and disposed as disordered or continuous rings (ii) CurT similarly 441

to CURT1A possesses a membrane-curving activity in vitro and intercalates asymmetrically 442

into thylakoids (iii) A high local concentration of CurT is observed at regions of high 443

curvature where biogenesis centers are found (iv) Lack of CurT affects the formation and 444

accumulation of PSII complexes as well as the abundance of some of its assembly factors 445

The drastic effects of CurT inactivation indicate an important role for this factor in membrane 446

shaping In contrast to the situation for CURT1A from Arabidopsis attempts to stably 447

14

overexpress CurT in Synechocystis 6803 failed Although short-lived transient increases in 448

CurT levels were observed when curT was expressed via strong heterologous promoters 449

wild-type levels of the protein were restored during subsequent rounds of cultivation of 450

transgenic lines Apparently Synechocystis 6803 cells do not tolerate substantial alterations in 451

CurT dosage and counter-select against these 452

This is in agreement with a dosage-dependent membrane-curving activity of CurT 453

which is suggested by its high local concentration at the edges of thylakoid autofluorescent 454

regions which mark the sites of the highly curved thylakoid convergence zones (Figures 8 9 455

and 13 Supplemental Movie 1 2 and 3) In addition some CurT was detected in structures 456

extending through the cytoplasm which most likely represent thylakoid sheets traversing the 457

cell from one thylakoid convergence zone to another (Figures 2A and 8) CurT might be 458

involved in the formation and stabilization of these structures 459

Members of the CURT1 family contain an N-terminal amphipathic α-helix that may 460

be involved in the membrane-bending activity of CurT (Armbruster et al 2013) Several 461

eukaryotic membrane-shaping proteins possess amphipathic helices as part of either an ENTH 462

(epsin N-terminal homology) or an N-BAR (Bin amphiphysin Rvs with N-terminal 463

amphipathic helix) domain (Ford et al 2002 Gallop and McMahon 2005 Zimmerberg and 464

Kozlov 2006) ENTH and N-BAR domains are rather large (~200 amino acids) and it has 465

been shown that amphipatic helices present in those domains insert into one leaflet of the lipid 466

bilayer and thereby induce curvature of the membrane (reviewed by Gallop and McMahon 467

2005 Zimmerberg and Kozlov 2006) However CurT itself is a small protein (149 amino 468

acids) that contains two transmembrane domains which insert into both leaflets of the lipid 469

bilayer (Figure 1A) as already suggested by Armbruster et al (2013) The amphipathic helix 470

faces the cytoplasm in Synechocystis 6803 or the stroma in A thaliana and most likely it 471

fine-tunes the degree of membrane bending mediated by CurT (Armbruster et al 2013) 472

In addition the increase in curvature correlated with CurT accumulation at convex 473

sides of thylakoid lamella (Figure 10 and 13) Hence curving might be mediated by 474

asymmetric integration of CurT into the lipid bilayers forming opposite faces of thylakoid 475

membrane sheets (Figure 13) However the mechanism causing this asymmetry remains 476

elusive 477

The presence of different CurT isoforms and complexes in PDMs and thylakoids adds 478

a further level of complexity and most likely reflects the dynamic regulation of this system 479

(Figure 11) The formation of different complexes might be primed by the phosphorylation of 480

CurT within its N-terminal cytoplasmic part (Spaumlt et al 2015) It seems likely that these 481

15

complexes play distinct roles in mediating the different CurT functions ie membrane 482

bending and maintenance 483

However it remains to be seen how exactly curvature is established maintained and 484

fine-tuned In addition other determinants of membrane topology and their putative interplay 485

with CurT have to be considered eg lipid and protein (complex) composition of 486

membranes cellular turgor pressure and other factors required for membrane 487

biogenesismaintenance eg the VIPP1 protein before precise molecular models of CurTrsquos 488

mode of action can be constructed (Rast et al 2015 and see below) That these other factors 489

can be crucial for membrane architecture is documented by the fact that some marine 490

cyanobacteria such as Prochlorococcus and Synechococcus contain curved thylakoids (but 491

no thylakoid convergence zones at the plasma membrane) although they lack a curT gene 492

493

The role of biogenesis centers 494

The absence of biogenesis centers in the curT- mutant now enables one to answer some 495

questions relating to the role of these thylakoid sub-structures which form in some but not all 496

cyanobacteria (Kunkel 1982 van de Meene et al 2006) First they are not essential since 497

even the curT- mutant still accumulates PSII to ~50 of wild-type levels On the other hand 498

in the mutant assembly of PSII is impaired as revealed by the increased accumulation of early 499

assembly intermediates In addition PSII dimers are almost completely absent in curT- 500

Whether the reduction in PSII dimers is attributable to an assembly problem linked to the 501

absence of biogenesis centers or to a secondary defect in dimer stabilization caused by 502

changes in overall thylakoid membrane ultrastructure remains to be determined Thus 503

biogenesis centers are more likely to represent evolutionary ldquoadd-onsrdquo that facilitated efficient 504

thylakoid biogenesis This is compatible with the fact that some cyanobacteria are devoid of 505

any biogenesis center-related substructures Second their absence compromises PSII but the 506

accumulation of other photosynthetic complexes ie PSI and the Cyt(b6f) complex is not 507

affected by CurT deficiency (Figure 3) This observation agrees with previous findings that 508

neither the PsaA subunit of PSI nor its assembly factor Ycf37 is detectable in isolated PDM 509

fractions (Rengstl et al 2011) 510

In addition to reduced de novo PSII assembly a higher relative stability of D1 in high-511

light experiments has been detected in curT- which suggests that D1 degradation during PSII 512

repair is less efficient in the mutant Photo-damaged D1 is degraded by the FtsH2FtsH3 513

complex which has previously been shown to partly localize to thylakoid convergence zones 514

at the cell periphery ie biogenesis centers (Boehm et al 2012 Sacharz et al 2015) It 515

16

therefore seems possible that the absence of biogenesis centers in curT- leads to 516

mislocalization of the FtsH2FtsH3 complex and less effective D1 degradation 517

Moreover a PSII related-function for CurT is supported by a meta-analysis of the 518

Synechocystis 6803 transcriptome When the CyanoEXpress 22 database (Hernaacutendez-Prieto 519

and Futschik 2012 Hernaacutendez-Prieto et al 2016) was queried for genes co-expressed with 520

curT (slr0483) genes for five PSII subunits ndash psbE psbO psbF psbL and psb30 ndash were 521

found among the first ten hits (Supplemental Table 4) From this we infer that biogenic 522

centers do not play an essential role in the assembly of all photosynthetic complexes but 523

serve to enhance PSII assemblyrepair possibly through the efficient delivery of Mn2+ 524

Residual PSII in curT- cells is likely to be supplied with cytoplasmic Mn2+ via a second 525

independently operating ABC transporter-based system in the plasma membrane named the 526

Mnt pathway (Bartsevich and Pakrasi 1995 Bartsevich and Pakrasi 1996) 527

Formally we cannot exclude that CurT is directly involved in the PSII assembly 528

process However considering CurTrsquos membrane bending capacity and the mutant phenotype 529

(Figure 1D and Figure 2) it appears more likely that CurT forms cellular substructures for 530

efficient PSII biogenesis ie biogenesis centers 531

As mentioned above some ultrastructural features of biogenesis centers have emerged 532

from studies employing EM-based tomography (van de Meene et al 2006) To date however 533

a high-resolution picture of the precise membrane architecture within these centers remains 534

elusive In particular whether or not a direct connection between plasma membrane and 535

thylakoids exists continues to be debated As recently discussed and in line with this gap in 536

knowledge different membrane fractionation techniques have revealed different distributions 537

of PSII-related subunits and assembly factors between plasma and thylakoid membranes 538

(Heinz et al 2016 Liberton et al 2016 Selatildeo et al 2016) The overall picture that emerges 539

is that the initial hypothesis that PSII biogenesis is initiated at the plasma membrane is no 540

longer tenable whereas a specialized thylakoid sub-fraction like the PDMs that make contact 541

with the plasma membrane could explain many of the available data and thus clarify some 542

aspects of the debate (Zak et al 2001 Pisareva et al 2011 Rast et al 2015) Moreover it 543

has previously been hypothesized that ldquoribosome-decorated membrane-like complexesrdquo 544

forming at the innermost thylakoid sheet might represent biogenic compartments (van de 545

Meene et al 2006 Mullineaux 2008) Whether these structures are affected in curT- cannot 546

be judged based on our TEM analysis but requires ultrastructural data of higher resolution 547

However the accessibility of thylakoids for ribosomes should be increased in the less 548

compressed membrane system of curT- (Figure 2B-D) 549

17

A scenario similar to that of Synechocystis 6803 holds for the situation in chloroplasts 550

of the green alga Chlamydomonas reinhardtii in which de novo PSII biogenesis has been 551

shown to be initiated in punctate regions named T-zones located close to the pyrenoid 552

(Uniacke and Zerges 2007) Unlike the mRNAs for the PSII components neither RNAs for 553

PSI subunits nor PSI assembly factors are localized to T-zones indicating that PSI and PSII 554

assembly processes are spatially separated (Uniacke and Zerges 2009 Nickelsen and Zerges 555

2013 Rast et al 2015) Interestingly a recent cryoelectron tomography study demonstrated 556

that next to T-zones at the chloroplast base-lobe junction the inner chloroplast envelope 557

exhibits invaginationsconnections to thylakoids that structurally resemble the organization of 558

cyanobacterial biogenesis centers (Engel et al 2015) For future investigations it will be 559

interesting to see if a homolog of the CURT1 family is involved in the formation of these 560

structures in C reinhardtii 561

562

Evolution of CURT1 function 563

Homologs of the CURT1 protein family can be found throughout cyanobacteria green 564

algae and plants (Armbruster et al 2013) The Arabidopsis CURT1A-D proteins have 565

recently been shown to induce bending of thylakoid membranes at grana margin regions 566

(Armbruster et al 2013) Interestingly and in contrast to the situation in Synechocystis 6803 567

their inactivation did not result in severe photosynthetic deficiencies although the thylakoids 568

formed lacked defined grana stacks Nevertheless the data available support the idea that the 569

function of thylakoid membrane structures that were regarded as being independent ie 570

cyanobacterial biogenesis centers and grana are closely related Intriguingly both of these 571

thylakoid membrane structures are dedicated to aspects of PSII function but do not involve 572

PSI (Pribil et al 2014) In both the prokaryotic and eukaryotic systems CURT1 homologs 573

appear to bend thylakoid membranes as indicated by (i) the distortion of membrane 574

ultrastructure seen in mutants devoid of curved thylakoids (ii) the localization of CURT1 575

homologs at grana margins and their local concentration at biogenesis centers (iii) the in vitro 576

membrane-curving activity of both CURT forms The phenotypic differences between 577

A thaliana and Synechocystis 6803 mutants may however be attributable to the different 578

functions of the membrane sub-compartments affected in the two model organisms Whereas 579

the role of grana is still under debate one function of the cyanobacterial biogenesis centers is 580

the above-mentioned high-throughput uptake of Mn2+ ions for efficient assembly of PSII 581

(Stengel et al 2012 Nickelsen and Rengstl 2013 Pribil et al 2014) However it appears 582

that in both cases the primary function of CURT1 proteins is to generate curved membrane 583

18

regions These discoveries suggest that until now two independently observed structures ie 584

cyanobacterial thylakoid biogenesis centers and chloroplast grana regions are closely related 585

The degree of curvature is much less pronounced in the cyanobacterial system As previously 586

discussed it was probably the subsequent evolution of a membrane-localized light-harvesting 587

system in chloroplasts that made the formation of tightly curved grana thylakoids possible 588

(Mullineaux 2005 Nevo et al 2012 Pribil et al 2014) 589

590

CurT is involved in osmotic stress response 591

One unexpected phenotype of the curT- mutant is its sensitivity to osmotic stress 592

These data revealed that in addition to shaping membranes CurT also influences their 593

functional integrity This latter function might be intrinsic to CurT or could be mediated by 594

the VIPP1 protein which has been shown to be required for membrane maintenance in 595

bacteria and chloroplasts probably by acting as a supplier of lipids (for an overview see 596

Zhang and Sakamoto 2015) Both factors accumulate in the plasma membrane upon osmotic 597

stress but VIPP1 localization is not severely affected by CurT inactivation which suggests 598

that VIPP1 operates independently of CurT In agreement with this repeated co-599

immunoprecipitations revealed no interaction between both proteins Therefore it remains to 600

be established whether a direct functional relationship between them exists 601

Previous investigations of osmotic stress in Synechocystis 6803 showed a kidney-602

shaped form of wild-type cells under very high concentrations of osmotically active 603

compounds (Marin et al 2006) The cells were severely deformed indicating changes in the 604

structure of the cellular envelope Since CurT shifts towards the plasma membrane already 605

under lower osmolyte concentrations we suggest a stabilizing function of CurT in the plasma 606

membrane CurT might be necessary to tolerate the forces trying to deform the cells under 607

osmotic stress 608

In conclusion this analysis has identified a crucial determinant for shaping and 609

maintaining the cyanobacterial thylakoid membrane system ie CurT a homolog of the 610

grana-forming CURT1 protein family from A thaliana In particular CurT is involved in the 611

formation of specific thylakoid substructures close to the plasma membrane at which PSII is 612

assembledrepaired Future work will dissect the precise ultrastructure of these centers and 613

enable us to elaborate a molecular model for the spatiotemporal organization of PSII assembly 614

in cyanobacteria 615

616

19

Methods 617

Strains and growth conditions 618

Wild-type and mutant Synechocystis 6803 cells were grown on solid or in liquid BG 619

11 medium (Rippka et al 1979) supplemented with 5 mM glucose (unless indicated 620

otherwise) at 30degC under continuous illumination at a photon irradiance of 30 μmol m-2 s-1 of 621

white light For growth during high-light experiments for investigation of D1 repair cells 622

were cultivated in a FMT150 photobioreactor (Photon Systems Instruments Draacutesov Czech 623

Republic) at 800 micromol photons m-2 s-1 in the presence or absence of lincomycin (100 microgml) 624

Cell density was monitored photometrically at 750 nm Doubling times were determined after 625

two days of growth To generate the insertion mutant curT- the curT gene (slr0483) was first 626

amplified from wild-type genomic DNA by PCR using the primer pair 04835 627

(GAAGCCTATTTAGCTAAGGCCGAAAG) and 04833 628

(TAGTACCTGGTCTTCCATGGCGT) and the resulting fragment was cloned into the 629

Bluescript pKS vector (Stratagene Waldbronn Germany) A kanamycin resistance cassette 630

was then inserted into the single AgeI restriction site (159 bp downstream of the start codon) 631

and this disruption construct was used to replace the wild-type gene as described (Wilde et al 632

2001) 633

634

Bioinformatic and computational analysis 635

CURT1 sequences of Synechocystis 6803 were obtained from CyanoBase 636

(httpgenomekazusaorjpcyanobaseSynechocystis) and CURT1 homologs in other 637

organisms were retrieved from NCBIBLAST (httpblastncbinlmnihgovBlastcgi) 638

Numbers and positions of putative transmembrane domains in the predicted proteins were 639

determined with TMHMM20 (httpwwwcbsdtudkservicesTMHMM) The sequence for 640

the N-terminal amphipathic helix was predicted by Jpred 3 641

(httpwwwcompbiodundeeacukwww-jpred) and plotted using a helical wheel projection 642

script (httprzlabucreduscriptswheelwheelcgi) The programs ClustalW2 643

(httpwwwebiacuktoolsclustalw2) and GeneDoc (httpwwwpscedubiomedgenedoc) 644

were used to generate multiple alignments of amino acid sequences Quantitative analysis of 645

immunoblots was performed with the AIDA Image Analyzer V325 (Raytest 646

Isotopenmessgeraumlte GmbH Straubenhardt Germany) 647

Co-expression patterns of curT were analyzed using the CyanoEXpress 22 database 648

(httpcyanoexpresssysbiolabeu Hernaacutendez-Prieto and Futschik 2012 Hernaacutendez-Prieto et 649

al 2016) 650

20

651

Measurement of chlorophyll concentration and oxygen production 652

Determination of chlorophyll content was carried out according to Wellburn and 653

Lichtenthaler (1984) For oxygen evolution measurements cells were grown in BG-11 654

without glucose harvested in mid-log phase and diluted to an OD750 nm = 05 Oxygen 655

evolution rates were measured with a Clark-type oxygen electrode (Hansatech Instruments 656

Ltd Kingrsquos Lynn Norfolk UK) at 1000 micromol photons m-2 s-1 (cool white light) after 5 min of 657

dark acclimation Oxygen evolution under saturating light conditions was measured without 658

any additives 659

660

Cell size and cell number estimation 661

Synechocystis 6803 strains were grown in liquid BG11 media containing 5 mM 662

glucose For cell size estimation the cells were analyzed with a confocal laser scanning 663

microscope TCS SP5 (Leica Wetzlar Germany) The diameter of the cells was measured 664

with the LAS AF Lite software (Leica Wetzlar Germany) Cells that were about to divide 665

were not taken into account For the determination of cell number cultures were set to an 666

OD750 = 1 and analyzed by using a Neubauer counting chamber (Paul Marienfeld GmbH amp 667

Co KG Lauda-Koumlnigshofen Germany) Statistical significance was determined by Studentrsquos 668

t-test 669

670

Measurements of P700+ reduction kinetics and relative electron transport rates 671

P700+ reduction kinetics and changes in chlorophyll fluorescence yield at different 672

light intensities were measured at a chlorophyll concentration of 5 microgml with a Dual-PAM-673

100 instrument (Heinz Walz GmbH Effeltrich Germany) Complete P700 oxidation was 674

achieved by a 50-ms multiple turnover pulse (10000 micromol photons m-2 s-1) after 2 min of dark 675

incubation P700+ reduction kinetics were recorded without any additions as well as in the 676

presence of 10 microM DCMU Ten technical replicates were averaged and fitted with single 677

exponential functions Data interpretation was done according to Bernaacutet et al (2009) 678

Light saturation measurements were performed according to Xu et al (2008) The 679

actinic light intensity was increased stepwise from 0 to 665 micromol photons m-2 s-1 with 30-s 680

adaptation periods Maximal fluorescence yields were obtained by applying saturating light 681

pulses (duration 600 ms intensity 10000 micromol photons m-2 s-1) 682

683

Low-temperature fluorescence measurements 684

21

Fluorescence emission spectra were measured with an AMINCO Bowman Series 2 685

Luminescence Spectrometer Wild-type and curT- cells were grown in the presence of 5 mM 686

glucose to mid log-phase and concentrated to 25 microgml chlorophyll adding 2 microM fluorescein 687

as an internal standard Samples (1 ml) were transferred to thin glass tubes dark-adapted for 688

30 min at 30 degC and shock frozen in liquid N2 To quantify chlorophyllfluorescein and 689

phycobilisome-mediated fluorescence samples were excited and emission recorded at 440 690

nm510 nm (chlorophyll and fluorescein excitationmax fluorescein emission) and 580 691

nm685 nm respectively Emission was scanned at 490-800 nm or at 640-800 nm 692

respectively 693

694

Antibody production and protein analysis 695

For generation of an αCurT antibody the N-terminal coding region of curT (amino 696

acid positions 1-58) was amplified by PCR using primers N04835 697

(AAGGATCCGTGGGCCGTAAACATTCAA) and N04833 698

(AAGTCGACGCACTTCCCACACCGGTTGTA) and cloned into the BamHI and XhoI sites 699

of the pGEX-4T-1 vector (GE Healthcare Freiburg Germany) Expression of the GST fusion 700

protein in Escherichia coli BL21(DE3) and subsequent affinity purification on Glutathione-701

Sepharose 4B (GE Healthcare) were carried out as described (Schottkowski et al 2009b) A 702

polyclonal antiserum was raised against this protein fragment in rabbits (Pineda Berlin 703

Germany) Other primary antibodies used in this study have been described previously ie 704

αpD1 (Schottkowski et al 2009b) αD1 (Schottkowski et al 2009b) αD2 (Klinkert et al 705

2006) αPratA (Klinkert et al 2004) αYcf48 (Rengstl et al 2011) αPitt (Schottkowski et 706

al 2009a) αPOR (Schottkowski et al 2009a) αYidC (Ossenbuumlhl et al 2006) αVIPP1 707

(Aseeva et al 2007) αSll0933 (Armbruster et al 2010) and αSlr0151 (Rast et al 2016) or 708

were purchased from Agrisera (Vaumlnnaumls Sweden) ie αCP43 αCP47 αPsaA αCyt f 709

αRbcL αIsiA The αGFP-HRP antibody was acquired from Miltenyi Biotech (Bergisch 710

Gladbach Germany) 711

Protein concentrations were determined according to Bradford (1976) using RotiQuant 712

(Carl Roth GmbH amp Co KG Karlsruhe Germany) Protein extraction membrane 713

fractionation on sucrose-density gradients and quantification of Western signal intensities was 714

performed as described previously (Rengstl et al 2011) Solubility properties of CurT were 715

determined according to Schottkowski et al (2009a) 716

22

Sucrose-density centrifugation separating PDM and thylakoid membrane fractions by 717

two consecutive gradients was carried out as described previously (Schottkowski et al 718

2009b Rengstl et al 2011) 719

Two-dimensional fractionations of cyanobacterial membrane proteins via BNSDS-720

PAGE and of pulse-labeled proteins by BNSDS-PAGE were performed as previously 721

reported (Klinkert et al 2004 Schottkowski et al 2009b Rengstl et al 2013) For the 722

analysis of native complexes in fractions obtained by sucrose-density centrifugation the 723

volume corresponding to 350 microg of protein in fraction 7 was applied to BNSDS-PAGE 724

For isoelectric focusing (IEF) the volume corresponding to 50 microg of protein from 725

fraction 7 in 200 microl of IEF buffer (8 M urea 4 CHAPS 1 IPG buffer pH 4-7 (GE 726

Healthcare)) was applied to an 11-cm Immobiline DryStrip pH 4-7 (GE Healthcare) in a 727

Protean IEF Cell (Bio-Rad Munich Germany) Strips were rehydrated for 12 h at 20 degC and 728

50V Focusing was carried out in the following steps 500 V rapid 1500 Vh 1000 V linear 729

880 Vh 6000 V linear 9680 Vh 6000 V rapid 5390 Vh 50 microA per gel focus temperature 730

20degC Subsequently the strips were incubated in equilibration buffer I (6 M urea 0375 M 731

Tris pH 88 20 glycerol 2 SDS 2 DTT) and equilibration buffer II (6 M urea 0375 732

M Tris pH 88 20 glycerol 2 SDS 25 iodoacetamide) for 10 min in each buffer 733

Then the IEF strips were applied to second-dimension SDS-PAGE 734

735

Transmission electron microscopy and immunogold labeling 736

Sample preparation for transmission electron microscopy including freeze substitution 737

and immunogold labeling of CurT was performed as described previously (Stengel et al 738

2012) Ultrathin sections were cut to thicknesses of 35 - 45 nm and 45 - 65 nm for 739

ultrastructural analyses and immunogold labeling respectively For immunogold labeling 740

sections collected on collodion-coated Ni grids were incubated for 18 h at 4degC with (rabbit) 741

αCurT (diluted 1100 1500 11000 or 14000 in blocking buffer (5 fetal calf serum) with 742

005 Tween 20) and further processed as described previously (Stengel et al 2012) As a 743

negative control wild-type Synechocystis 6803 cells were incubated without the primary 744

antibody and exposed to the gold-labeled anti-rabbit IgG To image the ultrastructure and the 745

immunogold-treated samples a Fei Morgagni 268 transmission electron microscope was used 746

and micrographs were taken at 80 kV 747

To avoid errors in the interpretation of the immunogold labeling experiment only 748

signals which were unambiguously localized to distinctly visible thylakoid membranes were 749

taken into account For each cell different regions (see Figure 10F) were defined and in each 750

23

region the signals on the convex and concave sides of the thylakoid membrane were analyzed 751

separately (see Supplemental Figure 11 for representative counts) Statistical significance was 752

assessed by χ2 test (Zoumlfel 1988) 753

For the analysis of clusters of CurT signals in biogenesis centers a cluster was defined 754

as a minimum of four signals in close proximity Overall 219 biogenesis centers were 755

examined with regard to CurT cluster formation 756

757

Preparation of proteoliposomes 758

Liposomes with a lipid mixture of 25 monogalactosyl diacylglycerol 42 759

digalactosyl diacylglycerol 16 sulfoquinovosyl diacylglycerol and 17 760

phosphatidylglycerol (Lipid Products South Nutfield UK) were prepared as described 761

previously (Armbruster et al 2013) To generate proteoliposomes CurT and CURT1A 762

proteins were expressed in the presence of liposomes for 3 h at 37degC using a PURExpress In 763

Vitro Protein Synthesis Kit (New England Biolabs Ipswich MA USA) The liposomes were 764

separated from the mix by centrifugation in a discontinuous sucrose gradient (100000 g 18 765

h) Subsequently the fraction containing the liposomes was extracted and dialyzed against 20 766

mM HEPES (pH 76) For transmission electron microscopy the proteoliposomes were 767

negatively stained with 1 uranyl acetate on a carbon-coated copper grid Micrographs were 768

taken on a Fei Morgagni 268 TEM at 80 kV 769

770

curT-CFP strain generation 771

Gibson assembly was used for single-step cloning (Gibson 2011) of the slr0483 gene 772

(together with its ~08 kb upstream region) the mTurquoise2 gene fragment the gentamycin-773

resistance cassette (aacC1) and an ~17-kb downstream region of slr0483 into pBR322 774

cleaved with EcoRV and NheI The slr0483 gene was fused in frame to the codon-optimized 775

mTurquoise2 (DNA20) preceded by a linker sequence encoding GSGSG The resulting 776

plasmid was used to transform Synechocystis 6803 as described previously (Zang et al 2007) 777

After ~ 10 days of incubation on BG11-GelRite (15 ) medium in the presence of 2 microgml 778

gentamycin several antibiotic resistant colonies were obtained and streaked out on fresh 779

medium These transformants were then tested for full segregation of the tagged allele by 780

colony PCR with primers flanking the slr0483 gene 781

782

Fluorescence microscopy 783

24

An aliquot of a cell suspension in mid-log phase was placed under a BG11-agarose 784

pad on a glass coverslip (15) and imaged on an inverted microscope (Zeiss 785

AxioObserverZ1) equipped with an ORCA Flash40 V2 (Hamamatsu) camera a Lumenecor 786

SOLA II Light Engine and a Plan-Apochromat 63x140 Oil DIC M27 (NA 14) objective 787

(Zeiss) Image acquisition was done with Zen 21 software in cyan and far-red fluorescence 788

channels (Zeiss Filter Sets 47 HE and 50) as Z-series with a step size of 250 nm and effective 789

pixel size of 103 nm Acquired image files were subsequently deconvolved (Constrained 790

Iterative Method) using a default theoretical Point Spread Function in Zen 20 (Zeiss) 791

Extraction of intensities for line profiles was performed by image thresholding the thylakoid 792

autofluorescence channel and eroding the resulting binary mask in Fiji (Schindelin et al 793

2012) 794

For immunofluorescence analysis cells were grown to mid-log phase as in the case of 795

the cells prepared for live-cell microscopy A 10-ml culture was fixed for 20 min in 37 796

formaldehyde and following extensive washing with phosphate-buffered saline (PBS) cells 797

were first permeabilized in 005 Triton-X for 20 min and then in lysis buffer (50 mM Tris-798

HCl 100 mM NaCl 5 mgml lysozyme) at 37degC for 2 h with gentle shaking To block 799

unspecific binding sites the cell pellet was incubated in 5 bovine serum albumin in PBS at 800

30degC for 1 h The αCurT serum (1500 dilution) was added to cells in fresh blocking buffer 801

for 1 h at 30degC with gentle shaking Cells were then washed three times with blocking buffer 802

and incubated with goat anti-rabbit IgG secondary antibodies conjugated to Oregon Green 488 803

(Invitrogen) (11000 dilution) under the conditions as for the primary antibodies Cells were 804

washed three times with PBS and prepared for microscopy as above Imaging was done as 805

described for live-cell microscopy except that a Colibri2 LED light source was employed for 806

illumination and a CoolSnap HQ camera (Photometrics) was used for image acquisition Cells 807

were imaged as Z-series (step size 280 nm) in the yellow and far-red fluorescent channels 808

(Zeiss Filter Sets 46 HE and 50) using the 505 nm and 625 nm LED modules Effective pixel 809

size in the final image was 102 nm Deconvolution and image analysis was done as described 810

above As judged by the staining intensity of the Oregon Green-conjugated antibodies 811

approximately half of the cells in any given field of view appeared to have been successfully 812

permeabilised a rate that is common in our experience No significant signal was detected in 813

the control sample that had not been exposed to the primary antibodies 814

815

25

Accession numbers 816

Sequence data from this article can be found in the CyanoBase and EMBLGenBank 817

data libraries under accession number slr0483 818

819

Supplemental Data 820

Supplemental Figure 1 Construction of the curT- mutant 821

Supplemental Figure 2 Growth phenotype of curT- 822

Supplemental Figure 3 Expression analysis of the open reading frame slr0482 (located 823

upstream of curT) in the curT- strain 824

Supplemental Figure 4 Absorbance spectra of curT- and wild-type cells 825

Supplemental Figure 5 High-light growth phenotypes of wild-type Synechocystis 6803 and 826

the curT- strain 827

Supplemental Figure 6 Ultrastructure of the TD41 mutant which lacks the psbA transcript 828

and the D1 protein 829

Supplemental Figure 7 Expression and localization of CurT-CFP 830

Supplemental Figure 8 Localization of CurT and CurT-CFP by fluorescence microscopy 831

Supplemental Figure 9 Chlorophyll autofluorescence of curT- 832

Supplemental Figure 10 The curT- mutant as a negative control for immunogold labeling 833

Supplemental Figure 11 Representative counts of immunogold signals 834

Supplemental Table 1 Overview of immunogold signals in curT- cells 835

Supplemental Table 2 Overview of immunogold signals in specific regions of Synechocystis 836

6803 wild-type cells 837

Supplemental Table 3 Statistical analysis of immunogold signals for wild-type 838

Synechocystis 6803 cells 839

Supplemental Table 4 Co-expression of curT 840

Supplemental Movie 1 Scan through the Z-axis of a curT-CFP cell 841

Supplemental Movie 2 Rendered 3D-model of a CurT-CFP detection 842

Supplemental Movie 3 Scan through the Z-axis of a curT-CFP cell with a traversing 843

thylakoid lamella 844

845

Acknowledgements 846

We thank Y Nishiyama for providing αpD1 and J Soll for αVIPP1 and αYidC antibodies 847

respectively and Nina Dyczmons-Nowaczyk for support with the fluorescence measurements 848

This work was supported by grants awarded to JN (Ni3909) MMN (NO 8363) and DL 849

26

(Le126529) by the Deutsche Forschungsgemeinschaft in the context of Research Unit 850

FOR2092 and the Cluster of Excellence RESOLV (EXC 1069) AG is a Howard Hughes 851

Medical Institute postdoctoral fellow in the laboratory of Erin OrsquoShea at Harvard University 852

LS was supported by a PhD fellowship from the Chinese Scholarship Council 853

854

Author Contributions 855

SH AR LS MMN DL and JN designed the research SH AR LS AG ILG EH ML BR 856

SV performed the research all authors contributed to data analysis SH AR and JN wrote the 857

paper 858

859

Competing Financial Interest statement 860

The authors declare no competing financial interests 861

862

We wish to dedicate this paper to Fabrice Rappaport an outstanding colleague and friend who 863

passed away so early 864

865

27

References 866

Allen JF de Paula WBM Puthiyaveetil S and Nield J (2011) A structural 867

phylogenetic map for chloroplast photosynthesis Trends Plant Sci 16 645-655 868

Anderson JM Horton P Kim E-H and Chow WS (2012) Towards elucidation of 869

dynamic structural changes of plant thylakoid architecture Philos Trans R Soc 870

Lond B Biol Sci 367 3515-3524 871

Armbruster U Zuumlhlke J Rengstl B Kreller R Makarenko E Ruumlhle T Schuumlnemann 872

D Jahns P Weisshaar B Nickelsen J and Leister D (2010) The Arabidopsis 873

thylakoid protein PAM68 is required for efficient D1 biogenesis and photosystem II 874

assembly Plant Cell 22 3439-3460 875

Armbruster U Labs M Pribil M Viola S Xu W Scharfenberg M Hertle AP 876

Rojahn U Jensen PE Rappaport F Joliot P Doumlrmann P Wanner G and 877

Leister D (2013) Arabidopsis CURVATURE THYLAKOID1 proteins modify 878

thylakoid architecture by inducing membrane curvature Plant Cell 25 2661-2678 879

Aseeva E Ossenbuumlhl F Sippel C Cho WK Stein B Eichacker LA Meurer J 880

Wanner G Westhoff P Soll J and Vothknecht UC (2007) Vipp1 is required for 881

basic thylakoid membrane formation but not for the assembly of thylakoid protein 882

complexes Plant Physiol Biochem 45 119-128 883

Bartsevich VV and Pakrasi HB (1995) Molecular identification of an ABC transporter 884

complex for manganese analysis of a cyanobacterial mutant strain impaired in the 885

photosynthetic oxygen evolution process EMBO J 14 1845-1853 886

Bartsevich VV and Pakrasi HB (1996) Manganese transport in the cyanobacterium 887

Synechocystis sp PCC 6803 J Biol Chem 271 26057-26061 888

Bernaacutet G Waschewski N and Roumlgner M (2009) Towards efficient hydrogen production 889

the impact of antenna size and external factors on electron transport dynamics in 890

Synechocystis PCC 6803 Photosynth Res 99 205-216 891

Boehm M Yu J Krynicka V Barker M Tichy M Komenda J Nixon PJ and Nield 892

J (2012) Subunit Organization of a Synechocystis Hetero-Oligomeric Thylakoid FtsH893

Complex Involved in Photosystem II Repair Plant Cell 24 3669-3683894

Bradford MM (1976) A rapid and sensitive method for the quantitation of microgram 895

quantities of protein utilizing the principle of protein-dye binding Anal Biochem 72 896

248-254897

28

Chang L Liu X Li Y Liu C-C Yang F Zhao J and Sui S-F (2015) Structural 898

organization of an intact phycobilisome and its association with photosystem II Cell 899

Res 25 726-737 900

Danielsson R Suorsa M Paakkarinen V Albertsson P-Aring Styring S Aro E-M and 901

Mamedov F (2006) Dimeric and monomeric organization of photosystem II 902

Distribution of five distinct complexes in the different domains of the thylakoid 903

membrane J Biol Chem 281 14241-14249 904

Daum B Nicastro D Austin J McIntosh JR and Kuumlhlbrandt W (2010) Arrangement 905

of photosystem II and ATP synthase in chloroplast membranes of Spinach and Pea 906

Plant Cell 22 1299-1312 907

Engel BD Schaffer M Kuhn Cuellar L Villa E Plitzko JM and Baumeister W 908

(2015) Native architecture of the Chlamydomonas chloroplast revealed by in situ 909

cryo-electron tomography eLife 4 e04889 910

Ford MGJ Mills IG Peter BJ Vallis Y Praefcke GJK Evans PR and McMahon 911

HT (2002) Curvature of clathrin-coated pits driven by epsin Nature 419 361-366 912

Fristedt R Willig A Granath P Cregravevecoeur M Rochaix J-D and Vener AV (2009) 913

Phosphorylation of photosystem II controls functional macroscopic folding of 914

photosynthetic membranes in Arabidopsis Plant Cell 21 3950-3964 915

Gallop JL and McMahon HT (2005) BAR domains and membrane curvature bringing 916

your curves to the BAR Biochem Soc Symp 72 223-231 917

Gibson DG (2011) Chapter fifteen - Enzymatic Assembly of Overlapping DNA Fragments 918

In Methods in Enzymology V Christopher ed (Academic Press) pp 349-361 919

Goedhart J von Stetten D Noirclerc-Savoye M Lelimousin M Joosen L Hink MA 920

van Weeren L Gadella TWJ and Royant A (2012) Structure-guided evolution of 921

cyan fluorescent proteins towards a quantum yield of 93 Nat Commun 3 751 922

Heinz S Liauw P Nickelsen J and Nowaczyk M (2016) Analysis of photosystem II 923

biogenesis in cyanobacteria Biochim Biophys Acta 1857 274-287 924

Hernaacutendez-Prieto M and Futschik M (2012) CyanoEXpress A web database for 925

exploration and visualisation of the integrated transcriptome of cyanobacterium 926

Synechocystis sp PCC6803 Bioinformation 8 634-638 927

Hernaacutendez-Prieto MA Semeniuk TA Giner-Lamia J and Futschik ME (2016) The 928

Transcriptional Landscape of the Photosynthetic Model Cyanobacterium 929

Synechocystis sp PCC6803 Sci Rep 6 22168 930

29

Huang F Fulda S Hagemann M and Norling B (2006) Proteomic screening of salt-931

stress-induced changes in plasma membranes of Synechocystis sp strain PCC 6803 932

Proteomics 6 910-920 933

Kirchhoff H (2013) Architectural switches in plant thylakoid membranes Photosynth Res 934

116 481-487 935

Klinkert B Elles I and Nickelsen J (2006) Translation of chloroplast psbD mRNA in 936

Chlamydomonas is controlled by a secondary RNA structure blocking the AUG start 937

codon Nucleic Acids Res 34 386-394 938

Klinkert B Ossenbuumlhl F Sikorski M Berry S Eichacker L and Nickelsen J (2004) 939

PratA a periplasmic tetratricopeptide repeat protein involved in biogenesis of 940

photosystem II in Synechocystis sp PCC 6803 J Biol Chem 279 44639-44644 941

Komenda J Nickelsen J Tichyacute M Praacutešil O Eichacker LA and Nixon PJ (2008) The 942

cyanobacterial homologue of HCF136YCF48 is a component of an early photosystem 943

II assembly complex and is important for both the efficient assembly and repair of 944

photosystem II in Synechocystis sp PCC 6803 J Biol Chem 283 22390-22399 945

Kopf M Klaumlhn S Scholz I Matthiessen JKF Hess WR and Voszlig B (2014) 946

Comparative analysis of the primary transcriptome of Synechocystis sp PCC 6803 947

DNA Res 21 527-539 948

Kunkel DD (1982) Thylakoid centers Structures associated with the cyanobacterial 949

photosynthetic membrane system Arch Microbiol 133 97-99 950

Liberton M Howard Berg R Heuser J Roth R and Pakrasi BH (2006) Ultrastructure 951

of the membrane systems in the unicellular cyanobacterium Synechocystis sp strain 952

PCC 6803 Protoplasma 227 129-138 953

Liberton M Saha R Jacobs JM Nguyen AY Gritsenko MA Smith RD 954

Koppenaal DW and Pakrasi HB (2016) Global Proteomic Analysis Reveals an 955

Exclusive Role of Thylakoid Membranes in Bioenergetics of a Model 956

Cyanobacterium Mol Cell Proteomics 15 2021-2032 957

Luque I and Ochoa de Alda JAG (2014) CURT1CAAD-containing aaRSs thylakoid 958

curvature and gene translation Trends Plant Sci 19 63-66 959

Marin K Stirnberg M Eisenhut M Kraumlmer R and Hagemann M (2006) Osmotic stress 960

in Synechocystis sp PCC 6803 low tolerance towards nonionic osmotic stress results 961

from lacking activation of glucosylglycerol accumulation Microbiology 152 2023-962

2030 963

Mullineaux CW (2005) Function and evolution of grana Trends Plant Sci 10 521-525 964

30

Mullineaux CW (2008) Biogenesis and dynamics of thylakoid membranes and the 965

photosynthetic apparatus In The Cyanobacteria A Herrero and E Flores eds 966

(Norfolk UK Caister Academic Press) pp 289ndash304 967

Nevo R Charuvi D Tsabari O and Reich Z (2012) Composition architecture and 968

dynamics of the photosynthetic apparatus in higher plants Plant J 70 157-176 969

Nickelsen J and Rengstl B (2013) Photosystem II assembly From cyanobacteria to plants 970

Annu Rev Plant Biol 64 609-635 971

Nickelsen J and Zerges W (2013) Thylakoid biogenesis has joined the new era of bacterial 972

cell biology Front Plant Sci 4 458 973

Nilsson F Simpson DJ Jansson C and Andersson B (1992) Ultrastructural and 974

biochemical characterization of a Synechocystis 6803 mutant with inactivated psbA 975

genes Arch Biochem Biophys 295 340-347 976

Odom WR Hodges R Chitnis PR and Guikema JA (1993) Characterization of 977

Synechocystis sp PCC 6803 in iron-supplied and iron-deficient media Plant Mol 978

Biol 23 1255-1264 979

Ossenbuumlhl F Inaba-Sulpice M Meurer J Soll J and Eichacker LA (2006) The 980

Synechocystis sp PCC 6803 Oxa1 homolog is essential for membrane integration of 981

reaction center precursor protein pD1 Plant Cell 18 2236-2246 982

Pisareva T Kwon J Oh J Kim S Ge C Wieslander Aring Choi J-S and Norling B 983

(2011) Model for Membrane Organization and Protein Sorting in the Cyanobacterium 984

Synechocystis sp PCC 6803 Inferred from Proteomics and Multivariate Sequence 985

Analyses J Proteome Res 10 3617-3631 986

Pribil M Labs M and Leister D (2014) Structure and dynamics of thylakoids in land 987

plants J Exp Bot 65 1955-1972 988

Rast A Heinz S and Nickelsen J (2015) Biogenesis of thylakoid membranes Biochim 989

Biophys Acta 1847 821-830 990

Rast A Rengstl B Heinz S Klingl A and Nickelsen J (2016) The role of Slr0151 a 991

tetratricopeptide repeat protein from Synechocystis sp PCC 6803 during Photosystem 992

II assembly and repair Front Plant Sci 7 605 993

Rengstl B Oster U Stengel A and Nickelsen J (2011) An Intermediate Membrane 994

Subfraction in Cyanobacteria Is Involved in an Assembly Network for Photosystem II 995

Biogenesis J Biol Chem 286 21944-21951 996

31

Rengstl B Knoppovaacute J Komenda J and Nickelsen J (2013) Characterization of a 997

Synechocystis double mutant lacking the photosystem II assembly factors YCF48 and 998

Sll0933 Planta 237 471-480 999

Rexroth S Mullineaux CW Ellinger D Sendtko E Roumlgner M and Koenig F (2011) 1000

The Plasma Membrane of the Cyanobacterium Gloeobacter violaceus Contains 1001

Segregated Bioenergetic Domains Plant Cell 23 2379-2390 1002

Rippka R Deruelles J Waterbury JB Herdman M and Stanier RY (1979) Generic 1003

Assignments Strain Histories and Properties of Pure Cultures of Cyanobacteria 1004

Microbiology 111 1-61 1005

Ruumltgers M and Schroda M (2013) A role of VIPP1 as a dynamic structure within 1006

thylakoid centers as sites of photosystem biogenesis Plant Signal Behav 8 e27037 1007

Sacharz J Bryan SJ Yu J Burroughs NJ Spence EM Nixon PJ and Mullineaux 1008

CW (2015) Sub-cellular location of FtsH proteases in the cyanobacterium1009

Synechocystis sp PCC 6803 suggests localised PSII repair zones in the thylakoid1010

membranes Mol Microbiol 96 448-4621011

Sandstroumlm S Park Y-I Oumlquist G and Gustafsson P (2001) CP43prime the isiA Gene 1012

Product Functions as an Excitation Energy Dissipator in the Cyanobacterium 1013

Synechococcus sp PCC 7942 Photochem Photobiol 74 431-437 1014

Schindelin J Arganda-Carreras I Frise E Kaynig V Longair M Pietzsch T 1015

Preibisch S Rueden C Saalfeld S Schmid B Tinevez J-Y White DJ 1016

Hartenstein V Eliceiri K Tomancak P and Cardona A (2012) Fiji an open-1017

source platform for biological-image analysis Nat Methods 9 676-682 1018

Schottkowski M Ratke J Oster U Nowaczyk M and Nickelsen J (2009a) Pitt a novel 1019

tetratricopeptide repeat protein involved in light-dependent chlorophyll biosynthesis 1020

and thylakoid membrane biogenesis in Synechocystis sp PCC 6803 Mol Plant 2 1021

1289-1297 1022

Schottkowski M Gkalympoudis S Tzekova N Stelljes C Schuumlnemann D Ankele E 1023

and Nickelsen J (2009b) Interaction of the periplasmic PratA factor and the PsbA 1024

(D1) protein during biogenesis of photosystem II in Synechocystis sp PCC 6803 J 1025

Biol Chem 284 1813-1819 1026

Selatildeo TT Zhang L Knoppovaaacute J Komenda J and Norling B (2016) Photosystem II 1027

Assembly Steps Take Place in the Thylakoid Membrane of the Cyanobacterium 1028

Synechocystis sp PCC6803 Plant Cell Physiol 57 878 1029

32

Spaumlt P Maček B and Forchhammer K (2015) Phosphoproteome of the cyanobacterium 1030

Synechocystis sp PCC 6803 and its dynamics during nitrogen starvation Front 1031

Microbiol 6 248 1032

Stengel A Guumlgel IL Hilger D Rengstl B Jung H and Nickelsen J (2012) Initial 1033

steps of photosystem II de novo assembly and preloading with manganese take place 1034

in biogenesis centers in Synechocystis Plant Cell 24 660-675 1035

Uniacke J and Zerges W (2007) Photosystem II assembly and repair are differentially 1036

localized in Chlamydomonas Plant Cell 19 3640-3654 1037

Uniacke J and Zerges W (2009) Chloroplast protein targeting involves localized 1038

translation in Chlamydomonas Proc Natl Acad Sci USA 106 1439-1444 1039

van de Meene AL Hohmann-Marriott M Vermaas WJ and Roberson R (2006) The 1040

three-dimensional structure of the cyanobacterium Synechocystis sp PCC 6803 Arch 1041

Microbiol 184 259-270 1042

van de Meene AML Sharp WP McDaniel JH Friedrich H Vermaas WFJ and 1043

Roberson RW (2012) Gross morphological changes in thylakoid membrane 1044

structure are associated with photosystem I deletion in Synechocystis sp PCC 6803 1045

Biochim Biophys Acta 1818 1427-1434 1046

Watanabe M and Ikeuchi M (2013) Phycobilisome architecture of a light-harvesting 1047

supercomplex Photosynth Res 116 265-276 1048

Wellburn AR and Lichtenthaler H (1984) Formulae and Program to Determine Total 1049

Carotenoids and Chlorophylls A and B of Leaf Extracts in Different Solvents In 1050

Advances in Photosynthesis Research Proceedings of the VIth International Congress 1051

on Photosynthesis Brussels Belgium August 1ndash6 1983 C Sybesma ed (Dordrecht 1052

Springer Netherlands) pp 9-12 1053

Wilde A Lunser K Ossenbuumlhl F Nickelsen J and Borner T (2001) Characterization of 1054

the cyanobacterial ycf37 mutation decreases the photosystem I content Biochem J 1055

357 211-216 1056

Wilson A Boulay C Wilde A Kerfeld CA and Kirilovsky D (2007) Light-Induced 1057

Energy Dissipation in Iron-Starved Cyanobacteria Roles of OCP and IsiA Proteins 1058

Plant Cell 19 656-672 1059

Xu M Bernaacutet G Singh A Mi H Roumlgner M Pakrasi HB and Ogawa T (2008) 1060

Properties of Mutants of Synechocystis sp Strain PCC 6803 Lacking Inorganic Carbon 1061

Sequestration Systems Plant Cell Physiol 49 1672-1677 1062

33

Yamamoto T Burke J Autz G and Jagendorf AT (1981) Bound ribosomes of Pea 1063

chloroplast thylakoid membranes location and release in vitro by high salt 1064

puromycin and RNase Plant Physiol 67 940-949 1065

Yang H Liao L Bo T Zhao L Sun X Lu X Norling B and Huang F (2014) 1066

Slr0151 in Synechocystis sp PCC 6803 is required for efficient repair of photosystem 1067

II under high-light condition J Integr Plant Biol 56 1136-1150 1068

Yeremenko N Kouřil R Ihalainen JA DHaene S van Oosterwijk N 1069

Andrizhiyevskaya EG Keegstra W Dekker HL Hagemann M Boekema EJ 1070

Matthijs HCP and Dekker JP (2004) Supramolecular Organization and Dual 1071

Function of the IsiA Chlorophyll-Binding Protein in Cyanobacteria Biochemistry 43 1072

10308-10313 1073

Zak E Norling B Maitra R Huang F Andersson B and Pakrasi HB (2001) The 1074

initial steps of biogenesis of cyanobacterial photosystems occur in plasma membranes 1075

Proc Natl Acad Sci USA 98 13443-13448 1076

Zang X Liu B Liu S Arunakumara KKIU and Zhang X (2007) Optimum 1077

Conditions for Transformation of Synechocystis sp PCC 6803 J Microbiol 45 241-1078

245 1079

Zhang L and Sakamoto W (2015) Possible function of VIPP1 in maintaining chloroplast 1080

membranes Biochim Biophys Acta 1847 831-837 1081

Zimmerberg J and Kozlov MM (2006) How proteins produce cellular membrane 1082

curvature Nat Rev Mol Cell Biol 7 9-19 1083

Zoumlfel P (1988) Statistik in der Praxis (Stuttgart Germany Gustav Fischer Verlag) 1084

1085

34

Figure Legends 1086

Figure 1 General characteristics of CurT A) Sequence alignment of CurT and CURT1A-D 1087

from A thaliana Predicted chloroplast transit-peptide sequences of CURT1A-D are omitted 1088

(Armbruster et al 2013) Positions of predicted C-terminal transmembrane domains (TDM) 1089

are marked (black bar) as is the position of the predicted amphipathic N-terminal helix in 1090

CurT (red bar) The green bar denotes the peptide sequence used for antibody production 1091

Identical and related amino acids that are conserved in 100 80 and 60 of the sequences 1092

are highlighted in black dark grey and light grey respectively B) Helical-wheel 1093

representation of the N-terminal amphipathic helix of CurT (red bar in A) The color code 1094

reflects the physicochemical properties of amino-acid side-chains green polar and 1095

uncharged blue polar and positively charged red polar and negatively charged yellow 1096

hydrophobic C) Solubility of CurT Membrane-associated proteins (50 microg) from wild-type 1097

cells were extracted with 5 mM HEPES (pH 76) containing either 1 M NaCl 01 M Na2CO3 1098

4 M urea 01 Triton X-100 or no additional solute After separation of membrane-bound 1099

(M) and solubilized (S) proteins by centrifugation proteins were fractionated by SDS-PAGE1100

and CurT was immunodetected on immunoblots As a control the integral membrane protein 1101

CP47 from PSII was analyzed in parallel D) Transmission electron micrographs of negatively 1102

stained liposomes Cell-free expression (CFE) of CurT and A thaliana CURT1A was 1103

performed in the presence of liposomes similar in composition to the lipids of the thylakoid 1104

membrane Liposomes before and after cell-free protein expression in the absence of DNA 1105

served as negative controls Black arrowheads indicate tubular connections between 1106

liposomes Scale bars 250 nm 1107

1108

Figure 2 Ultrastructural analysis of curT- cells Transmission electron micrographs of typical 1109

wild-type (A) and curT- (B-D) Synechocystis 6803 cells taken at 44000times (A B) and 28000times 1110

(C D) magnification respectively Ultrathin sections (35 to 45 nm) of cryofixed samples 1111

were stained with osmium tetroxide and post-stained using lead citrate Arrowheads indicate 1112

biogenesis centers Scale bars 200 nm (A B) and 500 nm (C D) respectively 1113

1114

Figure 3 Accumulation of components of photosynthetic complexes in the curT- mutant A) 1115

Whole cell extracts (30 microg protein) from wild-type and curT- strains were fractionated by 1116

SDS-PAGE and analyzed on immunoblots using the indicated antibodies B) The histogram 1117

shows levels of the indicated proteins in curT- extracts relative to wild-type samples (dashed 1118

red line) Data are means plusmn SD of three independent experiments Significant differences from 1119

35

wild-type protein levels according to Studentrsquos t-test with error probabilities of 5 and 1 1120

are indicated by and respectively 1121

1122

Figure 4 P700+ reduction kinetics and high-light effects in curT- cells A) Averaged traces 1123

(10 single measurements) of P700+ decay after complete oxidation by a 50-ms multiple 1124

turnover pulse (10000 micromol photons m-2 s-1) in the absence and presence of 10 microM DCMU 1125

B) Rate constants for P700+ reduction were obtained by fitting of the data with single1126

exponential functions Error bars indicate the SD of three independent measurements C) 1127

Impact of light intensity on the (relative) electron transport rate (rETR) Cells were exposed to 1128

gradually increasing light intensities which resulted in increasing electron transport until the 1129

capacity limit was reached PAR light intensity (micromol photons m-2 s-1) Error bars indicate the 1130

SD of three independent measurements D) D1 protein level in wild-type and curT- after high-1131

light treatment (800 micromol photons m-2s-1) in the presence and absence of lincomycin Samples 1132

were taken every 30 min and processed as in Figure 3 to determine the level of D1 present 1133

100 refers to wild-type D1 level at the beginning of the experiment 1134

1135

Figure 5 PSII assembly in curT- cells A) BNSDS-PAGE of membrane proteins Membrane 1136

fractions from wild-type and curT- cells were solubilized with 13 n-dodecyl-β-maltoside 1137

and proteins were fractionated by two-dimensional BNSDS-PAGE blotted and probed with 1138

antibodies against the PSII subunits D1 D2 CP47 and CP43 Wild-type blots were also 1139

probed with the αCurT antibody The sizes of marker proteins and the positions of PSII 1140

assembly intermediates (RCCII RCCI RC47) are shown above and below each image B) In 1141

vivo pulse labeling of membrane proteins with 35S Pulse-labeled PSII core proteins were 1142

separated via BNSDS-PAGE and visualized by autoradiography 1143

1144

Figure 6 Loss of CurT induces stress A) Low-temperature (77 K) fluorescence emission of 1145

Synechocystis 6803 wild-type (blue) and curT- (red) cells excited at 440 nm The spectra were 1146

normalized to the added fluorescein standard B) Low-temperature (77 K) fluorescence 1147

emission of Synechocystis 6803 wild-type (blue) and curT- (red) excited at 580 nm The 1148

spectra were normalized to 780 nm C) Level of IsiA in the curT- mutant relative to the wild-1149

type A mean value of 368 plusmn 96 (SD) was determined from three independent experiments 1150

1151

Figure 7 Membrane sublocalization of PSII-related factors Cell extracts from wild-type and 1152

curT- cells were fractionated by two consecutive rounds of sucrose-density gradient 1153

36

centrifugation (Schottkowski et al 2009b) The second linear gradient (20-60 sucrose) was 1154

apportioned into 14 fractions which were analyzed by immunoblotting using the indicated 1155

antibodies Fractions 1ndash6 represent PDMs and fractions 7ndash14 thylakoid membranes (TMs) 1156

To facilitate comparison between gradients sample volumes were normalized to the volume 1157

of fraction 7 that contained 40 microg of protein 1158

1159

Figure 8 Live-cell imaging of the curT-CFP strain by fluorescence microscopy In the curT-1160

CFP strain the native curT gene has been replaced by a CFP-tagged version resulting in the 1161

expression of the CurT-CFP fusion protein under the control of the native promotor A) 1162

Close-up views of the mid-cell plane in the CFP and far-red autofluorescence channels shown 1163

in slice 7 in panel B B) Synechocystis 6803 cells expressing CurT C-terminally fused to the 1164

mTurquoise2 variant of CFP from its native chromosomal promoter The two imaging 1165

channels are displayed as Z-axis montages (auto-scaled contrast step size 250 nm) in 1166

grayscale and color composite configuration The thylakoid autofluorescent channel as 1167

imaged in far-red fluorescence is depicted in magenta and CurT signal as imaged in cyan 1168

fluorescence is depicted in cyan C) Fluorescence intensity profiles of the two channels along 1169

the autofluorescent peripheral cell ldquoringrdquo are shown for slice 7 The maximum projection of 1170

the entire Z montage is also shown Scale bars (light grey) 2 microm 1171

1172

Figure 9 Immunofluorescence detection of CurT A) Close-ups of slice 5 in panel B B) 1173

Wild-type Synechocystis 6803 cells labeled with αCurT antibodies and detected with Oregon 1174

Green-conjugated secondary antibodies The Z-axis montages are shown as in Figure 8B 1175

except that the step size is 280 nm (1 to 10) C) Intensity profiles of the two channels along 1176

the autofluorescent peripheral cell ldquoringrdquo are shown for slice 5 The maximum projection of 1177

the entire Z montage is also shown Scale bars (light grey) 2 microm 1178

1179

Figure 10 Subcellular localization of CurT Ultrathin sections of wild-type Synechocystis 1180

6803 cells were incubated with rabbit αCurT prior to incubation with gold-conjugated goat 1181

anti-rabbit IgG A) Negative control (wild-type processed without addition of primary 1182

antibody) B C) Immunogold-labeled sections showing CurT localization at the cytoplasmic 1183

side of the thylakoid membrane D) Cluster formation of CurT signals at a putative biogenesis 1184

center from C E) Biogenesis center from the same cell (C) without any obvious CurT 1185

clustering of gold particles F) Schematic depiction of a wild-type cell (from Figure 2A) with 1186

color-coded curved membranes green = thylakoids that follow the curvature of the cell red = 1187

37

thylakoids that bend away from the plasma membrane yellow = thylakoids that bend toward 1188

the plasma membrane to converge on sites of biogenesis centers G) Relative distribution of 1189

gold signals between convex (dark color) and concave (light color) sides of membranes (n = 1190

1584 signals from a total of 95 cells) The undifferentiated overall signal distribution is given 1191

in blue Bars = 200 nm (overview) and 100 nm (details) 1192

1193

Figure 11 Differentially modified forms of CurT are found in different complexes in PDMs 1194

and thylakoid membranes Samples were isolated by fractionation of wild-type membranes 1195

via two consecutive sucrose density gradients according to Schottkowski et al (2009b) After 1196

density centrifugation samples were applied to BNSDS-PAGE analysis (A) or isoelectric 1197

focusing (B) Numbers on the right indicate the respective fraction from the second gradient 1198

(see Figure 7) Fraction 5 represents the PDMs and fraction 9 the thylakoid membrane 1199

1200

Figure 12 Loss of CurT increases sensitivity to abiotic stress A B) Doubling times of wild-1201

type and curT- under salt stress (A) or osmotic stress (B) Doubling times are means plusmn SD of 1202

three independent cultures C) Localization of CurT-CFP under salt and osmotic stress 1203

Samples were examined as described in Figure 8 Scale bars 1 microm D) Protein levels of wild-1204

type cells after growth in BG11 medium containing 500 mM NaCl Samples were analyzed on 1205

the same gel but unrelated samples between the presented signals were omitted E) 1206

Membrane preparations obtained from wild-type cells wild-type cells grown in the presence 1207

of 500 mM NaCl and curT- cells were subjected to the first gradient step in the membrane 1208

fractionation scheme The gradient was divided into five fractions and 10 of fractions I-IV 1209

and 02 of fraction V were analyzed by SDS-PAGE Fraction II includes the plasma 1210

membrane and fraction V consists of PratA-defined membrane and thylakoid membrane 1211

1212

Figure 13 Model of CurT distribution at convergence zones in Synechocystis 6803 The 1213

distribution of CurT in thylakoid (green) and plasma membranes (brown) is shown The 1214

pattern of localization of CurT in the thylakoid membrane is derived from membrane 1215

fractionation via sucrose density centrifugation fluorescence-based detection of the CurT-1216

CFP fusion and endogenous CurT and immunogold labeling experiments (Figures 7-10) The 1217

different CurT variants a b c and d identified in the IEF experiments (Figure 11) are depicted 1218

in yellow pink blue and black respectively CurT present in the plasma membrane is 1219

highlighted in gray as its precise nature and role remain to be defined (Figure 12) 1220

Membranes are represented as lipid bilayers Convex and concave faces of bent thylakoid 1221

38

sheets are indicated by black arrows The PDM which is dedicated to PSII assembly and 1222

repair is depicted in blue The dotted blue line emphasizes that the ultrastructure in this region 1223

has not yet been fully resolved PP periplasm PM plasma membrane TM thylakoid 1224

membrane L lumen PDM PratA-defined membrane 1225

1226

Tables 1227

Table 1 Physiological characteristics of the curT- mutant 1228

Strain Doubling time [h]

Oxygen Evolution[nmol h-1 OD750

-1]c

Chlorophyll content

[microg OD750-1]

d

Cell size [microm]e

Cell number [ml-1 OD750

-1]f

Wild type 817plusmn017a 1600plusmn042

b 1933plusmn187 251plusmn014 264plusmn020 390plusmn006 x 107

curT- 1259plusmn020a 3226plusmn056

b 1074plusmn20 195plusmn029 274plusmn044 367plusmn016 x 107

1229 abDoubling times in the presence (a) or absence (b) of 5 mM glucose measured under 1230

continuous illumination at 30 micromol photons m-2 s-1 and CO2-limiting conditions cOxygen 1231

evolution is expressed in nmol O2 produced per hour per OD750 unit dChlorophyll content is 1232

expressed in microg OD750-1 eThe diameter of non-dividing cells is presented in microm fCell number 1233

was determined per ml per OD750 Data are means plusmn SD of at least three independent 1234

experiments 1235

1236

Parsed CitationsAllen JF de Paula WBM Puthiyaveetil S and Nield J (2011) A structural phylogenetic map for chloroplast photosynthesisTrends Plant Sci 16 645-655

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Anderson JM Horton P Kim E-H and Chow WS (2012) Towards elucidation of dynamic structural changes of plant thylakoidarchitecture Philos Trans R Soc Lond B Biol Sci 367 3515-3524

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Armbruster U Zuumlhlke J Rengstl B Kreller R Makarenko E Ruumlhle T Schuumlnemann D Jahns P Weisshaar B NickelsenJ and Leister D (2010) The Arabidopsis thylakoid protein PAM68 is required for efficient D1 biogenesis and photosystem IIassembly Plant Cell 22 3439-3460

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Armbruster U Labs M Pribil M Viola S Xu W Scharfenberg M Hertle AP Rojahn U Jensen PE Rappaport F JoliotP Doumlrmann P Wanner G and Leister D (2013) Arabidopsis CURVATURE THYLAKOID1 proteins modify thylakoid architectureby inducing membrane curvature Plant Cell 25 2661-2678

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Aseeva E Ossenbuumlhl F Sippel C Cho WK Stein B Eichacker LA Meurer J Wanner G Westhoff P Soll J andVothknecht UC (2007) Vipp1 is required for basic thylakoid membrane formation but not for the assembly of thylakoid proteincomplexes Plant Physiol Biochem 45 119-128

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Bartsevich VV and Pakrasi HB (1995) Molecular identification of an ABC transporter complex for manganese analysis of acyanobacterial mutant strain impaired in the photosynthetic oxygen evolution process EMBO J 14 1845-1853

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Bartsevich VV and Pakrasi HB (1996) Manganese transport in the cyanobacterium Synechocystis sp PCC 6803 J Biol Chem271 26057-26061

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Bernaacutet G Waschewski N and Roumlgner M (2009) Towards efficient hydrogen production the impact of antenna size andexternal factors on electron transport dynamics in Synechocystis PCC 6803 Photosynth Res 99 205-216

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Boehm M Yu J Krynicka V Barker M Tichy M Komenda J Nixon PJ and Nield J (2012) Subunit Organization of aSynechocystis Hetero-Oligomeric Thylakoid FtsH Complex Involved in Photosystem II Repair Plant Cell 24 3669-3683

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Bradford MM (1976) A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle ofprotein-dye binding Anal Biochem 72 248-254

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Chang L Liu X Li Y Liu C-C Yang F Zhao J and Sui S-F (2015) Structural organization of an intact phycobilisome and itsassociation with photosystem II Cell Res 25 726-737

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Danielsson R Suorsa M Paakkarinen V Albertsson P-Aring Styring S Aro E-M and Mamedov F (2006) Dimeric andmonomeric organization of photosystem II Distribution of five distinct complexes in the different domains of the thylakoidmembrane J Biol Chem 281 14241-14249

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Daum B Nicastro D Austin J McIntosh JR and Kuumlhlbrandt W (2010) Arrangement of photosystem II and ATP synthase in

13

When the curT-CFP strain was analyzed under these stress conditions enhanced 414

accumulation of CurT at the cell periphery was found mostly outside the autofluorescent 415

thylakoids and consistent with accumulation at the plasma membrane (Figure 12C) This was 416

further substantiated by membrane fractionation experiments which also revealed an 417

increased relative abundance of CurT in the plasma membrane fraction in the first sucrose 418

gradient (Figure 12E) Determination of total cellular CurT levels demonstrated that its 419

absolute amount did not increase under stress (Figure 12D) Therefore its higher abundance 420

in the plasma membrane under osmotic stress is likely to be due to CurT trafficking towards 421

the plasma membrane instead of increased synthesis 422

The same appears to hold true for VIPP1 which has been implicated in membrane 423

maintenance in both cyanobacteria and chloroplasts (Zhang and Sakamoto 2015) At stress 424

conditions an increase of the VIPP1 signal in the plasma membrane can be monitored in 425

wild-type (Figure 12E) However enhanced accumulation of VIPP1 in plasma membranes is 426

unaffected in the curT- mutant suggesting that thylakoid convergence zones are not strictly 427

required for the localization of VIPP1 428

429

Discussion 430

CurT determines thylakoid architecture 431

This study demonstrates that the protein CurT a homolog of the grana-forming 432

CURT1 proteins in plants is essential for establishing the proper thylakoid membrane 433

architecture in the cyanobacterium Synechocystis 6803 In particular CurTrsquos membrane-434

bending activity is likely to be required for the formation of thylakoid biogenesis centers at 435

points on the cell periphery where thylakoids converge towards the plasma membrane Here 436

PratA-mediated preloading of early PSII assembly intermediates with Mn2+ ions has been 437

proposed to take place together with PSII repair (Stengel et al 2012 Sacharz et al 2015) 438

This idea is supported by the following lines of evidence (i) The curT- mutant is devoid of 439

any thylakoid sectors that have convergence zones at their distal ends instead thylakoid 440

membranes are displaced and disposed as disordered or continuous rings (ii) CurT similarly 441

to CURT1A possesses a membrane-curving activity in vitro and intercalates asymmetrically 442

into thylakoids (iii) A high local concentration of CurT is observed at regions of high 443

curvature where biogenesis centers are found (iv) Lack of CurT affects the formation and 444

accumulation of PSII complexes as well as the abundance of some of its assembly factors 445

The drastic effects of CurT inactivation indicate an important role for this factor in membrane 446

shaping In contrast to the situation for CURT1A from Arabidopsis attempts to stably 447

14

overexpress CurT in Synechocystis 6803 failed Although short-lived transient increases in 448

CurT levels were observed when curT was expressed via strong heterologous promoters 449

wild-type levels of the protein were restored during subsequent rounds of cultivation of 450

transgenic lines Apparently Synechocystis 6803 cells do not tolerate substantial alterations in 451

CurT dosage and counter-select against these 452

This is in agreement with a dosage-dependent membrane-curving activity of CurT 453

which is suggested by its high local concentration at the edges of thylakoid autofluorescent 454

regions which mark the sites of the highly curved thylakoid convergence zones (Figures 8 9 455

and 13 Supplemental Movie 1 2 and 3) In addition some CurT was detected in structures 456

extending through the cytoplasm which most likely represent thylakoid sheets traversing the 457

cell from one thylakoid convergence zone to another (Figures 2A and 8) CurT might be 458

involved in the formation and stabilization of these structures 459

Members of the CURT1 family contain an N-terminal amphipathic α-helix that may 460

be involved in the membrane-bending activity of CurT (Armbruster et al 2013) Several 461

eukaryotic membrane-shaping proteins possess amphipathic helices as part of either an ENTH 462

(epsin N-terminal homology) or an N-BAR (Bin amphiphysin Rvs with N-terminal 463

amphipathic helix) domain (Ford et al 2002 Gallop and McMahon 2005 Zimmerberg and 464

Kozlov 2006) ENTH and N-BAR domains are rather large (~200 amino acids) and it has 465

been shown that amphipatic helices present in those domains insert into one leaflet of the lipid 466

bilayer and thereby induce curvature of the membrane (reviewed by Gallop and McMahon 467

2005 Zimmerberg and Kozlov 2006) However CurT itself is a small protein (149 amino 468

acids) that contains two transmembrane domains which insert into both leaflets of the lipid 469

bilayer (Figure 1A) as already suggested by Armbruster et al (2013) The amphipathic helix 470

faces the cytoplasm in Synechocystis 6803 or the stroma in A thaliana and most likely it 471

fine-tunes the degree of membrane bending mediated by CurT (Armbruster et al 2013) 472

In addition the increase in curvature correlated with CurT accumulation at convex 473

sides of thylakoid lamella (Figure 10 and 13) Hence curving might be mediated by 474

asymmetric integration of CurT into the lipid bilayers forming opposite faces of thylakoid 475

membrane sheets (Figure 13) However the mechanism causing this asymmetry remains 476

elusive 477

The presence of different CurT isoforms and complexes in PDMs and thylakoids adds 478

a further level of complexity and most likely reflects the dynamic regulation of this system 479

(Figure 11) The formation of different complexes might be primed by the phosphorylation of 480

CurT within its N-terminal cytoplasmic part (Spaumlt et al 2015) It seems likely that these 481

15

complexes play distinct roles in mediating the different CurT functions ie membrane 482

bending and maintenance 483

However it remains to be seen how exactly curvature is established maintained and 484

fine-tuned In addition other determinants of membrane topology and their putative interplay 485

with CurT have to be considered eg lipid and protein (complex) composition of 486

membranes cellular turgor pressure and other factors required for membrane 487

biogenesismaintenance eg the VIPP1 protein before precise molecular models of CurTrsquos 488

mode of action can be constructed (Rast et al 2015 and see below) That these other factors 489

can be crucial for membrane architecture is documented by the fact that some marine 490

cyanobacteria such as Prochlorococcus and Synechococcus contain curved thylakoids (but 491

no thylakoid convergence zones at the plasma membrane) although they lack a curT gene 492

493

The role of biogenesis centers 494

The absence of biogenesis centers in the curT- mutant now enables one to answer some 495

questions relating to the role of these thylakoid sub-structures which form in some but not all 496

cyanobacteria (Kunkel 1982 van de Meene et al 2006) First they are not essential since 497

even the curT- mutant still accumulates PSII to ~50 of wild-type levels On the other hand 498

in the mutant assembly of PSII is impaired as revealed by the increased accumulation of early 499

assembly intermediates In addition PSII dimers are almost completely absent in curT- 500

Whether the reduction in PSII dimers is attributable to an assembly problem linked to the 501

absence of biogenesis centers or to a secondary defect in dimer stabilization caused by 502

changes in overall thylakoid membrane ultrastructure remains to be determined Thus 503

biogenesis centers are more likely to represent evolutionary ldquoadd-onsrdquo that facilitated efficient 504

thylakoid biogenesis This is compatible with the fact that some cyanobacteria are devoid of 505

any biogenesis center-related substructures Second their absence compromises PSII but the 506

accumulation of other photosynthetic complexes ie PSI and the Cyt(b6f) complex is not 507

affected by CurT deficiency (Figure 3) This observation agrees with previous findings that 508

neither the PsaA subunit of PSI nor its assembly factor Ycf37 is detectable in isolated PDM 509

fractions (Rengstl et al 2011) 510

In addition to reduced de novo PSII assembly a higher relative stability of D1 in high-511

light experiments has been detected in curT- which suggests that D1 degradation during PSII 512

repair is less efficient in the mutant Photo-damaged D1 is degraded by the FtsH2FtsH3 513

complex which has previously been shown to partly localize to thylakoid convergence zones 514

at the cell periphery ie biogenesis centers (Boehm et al 2012 Sacharz et al 2015) It 515

16

therefore seems possible that the absence of biogenesis centers in curT- leads to 516

mislocalization of the FtsH2FtsH3 complex and less effective D1 degradation 517

Moreover a PSII related-function for CurT is supported by a meta-analysis of the 518

Synechocystis 6803 transcriptome When the CyanoEXpress 22 database (Hernaacutendez-Prieto 519

and Futschik 2012 Hernaacutendez-Prieto et al 2016) was queried for genes co-expressed with 520

curT (slr0483) genes for five PSII subunits ndash psbE psbO psbF psbL and psb30 ndash were 521

found among the first ten hits (Supplemental Table 4) From this we infer that biogenic 522

centers do not play an essential role in the assembly of all photosynthetic complexes but 523

serve to enhance PSII assemblyrepair possibly through the efficient delivery of Mn2+ 524

Residual PSII in curT- cells is likely to be supplied with cytoplasmic Mn2+ via a second 525

independently operating ABC transporter-based system in the plasma membrane named the 526

Mnt pathway (Bartsevich and Pakrasi 1995 Bartsevich and Pakrasi 1996) 527

Formally we cannot exclude that CurT is directly involved in the PSII assembly 528

process However considering CurTrsquos membrane bending capacity and the mutant phenotype 529

(Figure 1D and Figure 2) it appears more likely that CurT forms cellular substructures for 530

efficient PSII biogenesis ie biogenesis centers 531

As mentioned above some ultrastructural features of biogenesis centers have emerged 532

from studies employing EM-based tomography (van de Meene et al 2006) To date however 533

a high-resolution picture of the precise membrane architecture within these centers remains 534

elusive In particular whether or not a direct connection between plasma membrane and 535

thylakoids exists continues to be debated As recently discussed and in line with this gap in 536

knowledge different membrane fractionation techniques have revealed different distributions 537

of PSII-related subunits and assembly factors between plasma and thylakoid membranes 538

(Heinz et al 2016 Liberton et al 2016 Selatildeo et al 2016) The overall picture that emerges 539

is that the initial hypothesis that PSII biogenesis is initiated at the plasma membrane is no 540

longer tenable whereas a specialized thylakoid sub-fraction like the PDMs that make contact 541

with the plasma membrane could explain many of the available data and thus clarify some 542

aspects of the debate (Zak et al 2001 Pisareva et al 2011 Rast et al 2015) Moreover it 543

has previously been hypothesized that ldquoribosome-decorated membrane-like complexesrdquo 544

forming at the innermost thylakoid sheet might represent biogenic compartments (van de 545

Meene et al 2006 Mullineaux 2008) Whether these structures are affected in curT- cannot 546

be judged based on our TEM analysis but requires ultrastructural data of higher resolution 547

However the accessibility of thylakoids for ribosomes should be increased in the less 548

compressed membrane system of curT- (Figure 2B-D) 549

17

A scenario similar to that of Synechocystis 6803 holds for the situation in chloroplasts 550

of the green alga Chlamydomonas reinhardtii in which de novo PSII biogenesis has been 551

shown to be initiated in punctate regions named T-zones located close to the pyrenoid 552

(Uniacke and Zerges 2007) Unlike the mRNAs for the PSII components neither RNAs for 553

PSI subunits nor PSI assembly factors are localized to T-zones indicating that PSI and PSII 554

assembly processes are spatially separated (Uniacke and Zerges 2009 Nickelsen and Zerges 555

2013 Rast et al 2015) Interestingly a recent cryoelectron tomography study demonstrated 556

that next to T-zones at the chloroplast base-lobe junction the inner chloroplast envelope 557

exhibits invaginationsconnections to thylakoids that structurally resemble the organization of 558

cyanobacterial biogenesis centers (Engel et al 2015) For future investigations it will be 559

interesting to see if a homolog of the CURT1 family is involved in the formation of these 560

structures in C reinhardtii 561

562

Evolution of CURT1 function 563

Homologs of the CURT1 protein family can be found throughout cyanobacteria green 564

algae and plants (Armbruster et al 2013) The Arabidopsis CURT1A-D proteins have 565

recently been shown to induce bending of thylakoid membranes at grana margin regions 566

(Armbruster et al 2013) Interestingly and in contrast to the situation in Synechocystis 6803 567

their inactivation did not result in severe photosynthetic deficiencies although the thylakoids 568

formed lacked defined grana stacks Nevertheless the data available support the idea that the 569

function of thylakoid membrane structures that were regarded as being independent ie 570

cyanobacterial biogenesis centers and grana are closely related Intriguingly both of these 571

thylakoid membrane structures are dedicated to aspects of PSII function but do not involve 572

PSI (Pribil et al 2014) In both the prokaryotic and eukaryotic systems CURT1 homologs 573

appear to bend thylakoid membranes as indicated by (i) the distortion of membrane 574

ultrastructure seen in mutants devoid of curved thylakoids (ii) the localization of CURT1 575

homologs at grana margins and their local concentration at biogenesis centers (iii) the in vitro 576

membrane-curving activity of both CURT forms The phenotypic differences between 577

A thaliana and Synechocystis 6803 mutants may however be attributable to the different 578

functions of the membrane sub-compartments affected in the two model organisms Whereas 579

the role of grana is still under debate one function of the cyanobacterial biogenesis centers is 580

the above-mentioned high-throughput uptake of Mn2+ ions for efficient assembly of PSII 581

(Stengel et al 2012 Nickelsen and Rengstl 2013 Pribil et al 2014) However it appears 582

that in both cases the primary function of CURT1 proteins is to generate curved membrane 583

18

regions These discoveries suggest that until now two independently observed structures ie 584

cyanobacterial thylakoid biogenesis centers and chloroplast grana regions are closely related 585

The degree of curvature is much less pronounced in the cyanobacterial system As previously 586

discussed it was probably the subsequent evolution of a membrane-localized light-harvesting 587

system in chloroplasts that made the formation of tightly curved grana thylakoids possible 588

(Mullineaux 2005 Nevo et al 2012 Pribil et al 2014) 589

590

CurT is involved in osmotic stress response 591

One unexpected phenotype of the curT- mutant is its sensitivity to osmotic stress 592

These data revealed that in addition to shaping membranes CurT also influences their 593

functional integrity This latter function might be intrinsic to CurT or could be mediated by 594

the VIPP1 protein which has been shown to be required for membrane maintenance in 595

bacteria and chloroplasts probably by acting as a supplier of lipids (for an overview see 596

Zhang and Sakamoto 2015) Both factors accumulate in the plasma membrane upon osmotic 597

stress but VIPP1 localization is not severely affected by CurT inactivation which suggests 598

that VIPP1 operates independently of CurT In agreement with this repeated co-599

immunoprecipitations revealed no interaction between both proteins Therefore it remains to 600

be established whether a direct functional relationship between them exists 601

Previous investigations of osmotic stress in Synechocystis 6803 showed a kidney-602

shaped form of wild-type cells under very high concentrations of osmotically active 603

compounds (Marin et al 2006) The cells were severely deformed indicating changes in the 604

structure of the cellular envelope Since CurT shifts towards the plasma membrane already 605

under lower osmolyte concentrations we suggest a stabilizing function of CurT in the plasma 606

membrane CurT might be necessary to tolerate the forces trying to deform the cells under 607

osmotic stress 608

In conclusion this analysis has identified a crucial determinant for shaping and 609

maintaining the cyanobacterial thylakoid membrane system ie CurT a homolog of the 610

grana-forming CURT1 protein family from A thaliana In particular CurT is involved in the 611

formation of specific thylakoid substructures close to the plasma membrane at which PSII is 612

assembledrepaired Future work will dissect the precise ultrastructure of these centers and 613

enable us to elaborate a molecular model for the spatiotemporal organization of PSII assembly 614

in cyanobacteria 615

616

19

Methods 617

Strains and growth conditions 618

Wild-type and mutant Synechocystis 6803 cells were grown on solid or in liquid BG 619

11 medium (Rippka et al 1979) supplemented with 5 mM glucose (unless indicated 620

otherwise) at 30degC under continuous illumination at a photon irradiance of 30 μmol m-2 s-1 of 621

white light For growth during high-light experiments for investigation of D1 repair cells 622

were cultivated in a FMT150 photobioreactor (Photon Systems Instruments Draacutesov Czech 623

Republic) at 800 micromol photons m-2 s-1 in the presence or absence of lincomycin (100 microgml) 624

Cell density was monitored photometrically at 750 nm Doubling times were determined after 625

two days of growth To generate the insertion mutant curT- the curT gene (slr0483) was first 626

amplified from wild-type genomic DNA by PCR using the primer pair 04835 627

(GAAGCCTATTTAGCTAAGGCCGAAAG) and 04833 628

(TAGTACCTGGTCTTCCATGGCGT) and the resulting fragment was cloned into the 629

Bluescript pKS vector (Stratagene Waldbronn Germany) A kanamycin resistance cassette 630

was then inserted into the single AgeI restriction site (159 bp downstream of the start codon) 631

and this disruption construct was used to replace the wild-type gene as described (Wilde et al 632

2001) 633

634

Bioinformatic and computational analysis 635

CURT1 sequences of Synechocystis 6803 were obtained from CyanoBase 636

(httpgenomekazusaorjpcyanobaseSynechocystis) and CURT1 homologs in other 637

organisms were retrieved from NCBIBLAST (httpblastncbinlmnihgovBlastcgi) 638

Numbers and positions of putative transmembrane domains in the predicted proteins were 639

determined with TMHMM20 (httpwwwcbsdtudkservicesTMHMM) The sequence for 640

the N-terminal amphipathic helix was predicted by Jpred 3 641

(httpwwwcompbiodundeeacukwww-jpred) and plotted using a helical wheel projection 642

script (httprzlabucreduscriptswheelwheelcgi) The programs ClustalW2 643

(httpwwwebiacuktoolsclustalw2) and GeneDoc (httpwwwpscedubiomedgenedoc) 644

were used to generate multiple alignments of amino acid sequences Quantitative analysis of 645

immunoblots was performed with the AIDA Image Analyzer V325 (Raytest 646

Isotopenmessgeraumlte GmbH Straubenhardt Germany) 647

Co-expression patterns of curT were analyzed using the CyanoEXpress 22 database 648

(httpcyanoexpresssysbiolabeu Hernaacutendez-Prieto and Futschik 2012 Hernaacutendez-Prieto et 649

al 2016) 650

20

651

Measurement of chlorophyll concentration and oxygen production 652

Determination of chlorophyll content was carried out according to Wellburn and 653

Lichtenthaler (1984) For oxygen evolution measurements cells were grown in BG-11 654

without glucose harvested in mid-log phase and diluted to an OD750 nm = 05 Oxygen 655

evolution rates were measured with a Clark-type oxygen electrode (Hansatech Instruments 656

Ltd Kingrsquos Lynn Norfolk UK) at 1000 micromol photons m-2 s-1 (cool white light) after 5 min of 657

dark acclimation Oxygen evolution under saturating light conditions was measured without 658

any additives 659

660

Cell size and cell number estimation 661

Synechocystis 6803 strains were grown in liquid BG11 media containing 5 mM 662

glucose For cell size estimation the cells were analyzed with a confocal laser scanning 663

microscope TCS SP5 (Leica Wetzlar Germany) The diameter of the cells was measured 664

with the LAS AF Lite software (Leica Wetzlar Germany) Cells that were about to divide 665

were not taken into account For the determination of cell number cultures were set to an 666

OD750 = 1 and analyzed by using a Neubauer counting chamber (Paul Marienfeld GmbH amp 667

Co KG Lauda-Koumlnigshofen Germany) Statistical significance was determined by Studentrsquos 668

t-test 669

670

Measurements of P700+ reduction kinetics and relative electron transport rates 671

P700+ reduction kinetics and changes in chlorophyll fluorescence yield at different 672

light intensities were measured at a chlorophyll concentration of 5 microgml with a Dual-PAM-673

100 instrument (Heinz Walz GmbH Effeltrich Germany) Complete P700 oxidation was 674

achieved by a 50-ms multiple turnover pulse (10000 micromol photons m-2 s-1) after 2 min of dark 675

incubation P700+ reduction kinetics were recorded without any additions as well as in the 676

presence of 10 microM DCMU Ten technical replicates were averaged and fitted with single 677

exponential functions Data interpretation was done according to Bernaacutet et al (2009) 678

Light saturation measurements were performed according to Xu et al (2008) The 679

actinic light intensity was increased stepwise from 0 to 665 micromol photons m-2 s-1 with 30-s 680

adaptation periods Maximal fluorescence yields were obtained by applying saturating light 681

pulses (duration 600 ms intensity 10000 micromol photons m-2 s-1) 682

683

Low-temperature fluorescence measurements 684

21

Fluorescence emission spectra were measured with an AMINCO Bowman Series 2 685

Luminescence Spectrometer Wild-type and curT- cells were grown in the presence of 5 mM 686

glucose to mid log-phase and concentrated to 25 microgml chlorophyll adding 2 microM fluorescein 687

as an internal standard Samples (1 ml) were transferred to thin glass tubes dark-adapted for 688

30 min at 30 degC and shock frozen in liquid N2 To quantify chlorophyllfluorescein and 689

phycobilisome-mediated fluorescence samples were excited and emission recorded at 440 690

nm510 nm (chlorophyll and fluorescein excitationmax fluorescein emission) and 580 691

nm685 nm respectively Emission was scanned at 490-800 nm or at 640-800 nm 692

respectively 693

694

Antibody production and protein analysis 695

For generation of an αCurT antibody the N-terminal coding region of curT (amino 696

acid positions 1-58) was amplified by PCR using primers N04835 697

(AAGGATCCGTGGGCCGTAAACATTCAA) and N04833 698

(AAGTCGACGCACTTCCCACACCGGTTGTA) and cloned into the BamHI and XhoI sites 699

of the pGEX-4T-1 vector (GE Healthcare Freiburg Germany) Expression of the GST fusion 700

protein in Escherichia coli BL21(DE3) and subsequent affinity purification on Glutathione-701

Sepharose 4B (GE Healthcare) were carried out as described (Schottkowski et al 2009b) A 702

polyclonal antiserum was raised against this protein fragment in rabbits (Pineda Berlin 703

Germany) Other primary antibodies used in this study have been described previously ie 704

αpD1 (Schottkowski et al 2009b) αD1 (Schottkowski et al 2009b) αD2 (Klinkert et al 705

2006) αPratA (Klinkert et al 2004) αYcf48 (Rengstl et al 2011) αPitt (Schottkowski et 706

al 2009a) αPOR (Schottkowski et al 2009a) αYidC (Ossenbuumlhl et al 2006) αVIPP1 707

(Aseeva et al 2007) αSll0933 (Armbruster et al 2010) and αSlr0151 (Rast et al 2016) or 708

were purchased from Agrisera (Vaumlnnaumls Sweden) ie αCP43 αCP47 αPsaA αCyt f 709

αRbcL αIsiA The αGFP-HRP antibody was acquired from Miltenyi Biotech (Bergisch 710

Gladbach Germany) 711

Protein concentrations were determined according to Bradford (1976) using RotiQuant 712

(Carl Roth GmbH amp Co KG Karlsruhe Germany) Protein extraction membrane 713

fractionation on sucrose-density gradients and quantification of Western signal intensities was 714

performed as described previously (Rengstl et al 2011) Solubility properties of CurT were 715

determined according to Schottkowski et al (2009a) 716

22

Sucrose-density centrifugation separating PDM and thylakoid membrane fractions by 717

two consecutive gradients was carried out as described previously (Schottkowski et al 718

2009b Rengstl et al 2011) 719

Two-dimensional fractionations of cyanobacterial membrane proteins via BNSDS-720

PAGE and of pulse-labeled proteins by BNSDS-PAGE were performed as previously 721

reported (Klinkert et al 2004 Schottkowski et al 2009b Rengstl et al 2013) For the 722

analysis of native complexes in fractions obtained by sucrose-density centrifugation the 723

volume corresponding to 350 microg of protein in fraction 7 was applied to BNSDS-PAGE 724

For isoelectric focusing (IEF) the volume corresponding to 50 microg of protein from 725

fraction 7 in 200 microl of IEF buffer (8 M urea 4 CHAPS 1 IPG buffer pH 4-7 (GE 726

Healthcare)) was applied to an 11-cm Immobiline DryStrip pH 4-7 (GE Healthcare) in a 727

Protean IEF Cell (Bio-Rad Munich Germany) Strips were rehydrated for 12 h at 20 degC and 728

50V Focusing was carried out in the following steps 500 V rapid 1500 Vh 1000 V linear 729

880 Vh 6000 V linear 9680 Vh 6000 V rapid 5390 Vh 50 microA per gel focus temperature 730

20degC Subsequently the strips were incubated in equilibration buffer I (6 M urea 0375 M 731

Tris pH 88 20 glycerol 2 SDS 2 DTT) and equilibration buffer II (6 M urea 0375 732

M Tris pH 88 20 glycerol 2 SDS 25 iodoacetamide) for 10 min in each buffer 733

Then the IEF strips were applied to second-dimension SDS-PAGE 734

735

Transmission electron microscopy and immunogold labeling 736

Sample preparation for transmission electron microscopy including freeze substitution 737

and immunogold labeling of CurT was performed as described previously (Stengel et al 738

2012) Ultrathin sections were cut to thicknesses of 35 - 45 nm and 45 - 65 nm for 739

ultrastructural analyses and immunogold labeling respectively For immunogold labeling 740

sections collected on collodion-coated Ni grids were incubated for 18 h at 4degC with (rabbit) 741

αCurT (diluted 1100 1500 11000 or 14000 in blocking buffer (5 fetal calf serum) with 742

005 Tween 20) and further processed as described previously (Stengel et al 2012) As a 743

negative control wild-type Synechocystis 6803 cells were incubated without the primary 744

antibody and exposed to the gold-labeled anti-rabbit IgG To image the ultrastructure and the 745

immunogold-treated samples a Fei Morgagni 268 transmission electron microscope was used 746

and micrographs were taken at 80 kV 747

To avoid errors in the interpretation of the immunogold labeling experiment only 748

signals which were unambiguously localized to distinctly visible thylakoid membranes were 749

taken into account For each cell different regions (see Figure 10F) were defined and in each 750

23

region the signals on the convex and concave sides of the thylakoid membrane were analyzed 751

separately (see Supplemental Figure 11 for representative counts) Statistical significance was 752

assessed by χ2 test (Zoumlfel 1988) 753

For the analysis of clusters of CurT signals in biogenesis centers a cluster was defined 754

as a minimum of four signals in close proximity Overall 219 biogenesis centers were 755

examined with regard to CurT cluster formation 756

757

Preparation of proteoliposomes 758

Liposomes with a lipid mixture of 25 monogalactosyl diacylglycerol 42 759

digalactosyl diacylglycerol 16 sulfoquinovosyl diacylglycerol and 17 760

phosphatidylglycerol (Lipid Products South Nutfield UK) were prepared as described 761

previously (Armbruster et al 2013) To generate proteoliposomes CurT and CURT1A 762

proteins were expressed in the presence of liposomes for 3 h at 37degC using a PURExpress In 763

Vitro Protein Synthesis Kit (New England Biolabs Ipswich MA USA) The liposomes were 764

separated from the mix by centrifugation in a discontinuous sucrose gradient (100000 g 18 765

h) Subsequently the fraction containing the liposomes was extracted and dialyzed against 20 766

mM HEPES (pH 76) For transmission electron microscopy the proteoliposomes were 767

negatively stained with 1 uranyl acetate on a carbon-coated copper grid Micrographs were 768

taken on a Fei Morgagni 268 TEM at 80 kV 769

770

curT-CFP strain generation 771

Gibson assembly was used for single-step cloning (Gibson 2011) of the slr0483 gene 772

(together with its ~08 kb upstream region) the mTurquoise2 gene fragment the gentamycin-773

resistance cassette (aacC1) and an ~17-kb downstream region of slr0483 into pBR322 774

cleaved with EcoRV and NheI The slr0483 gene was fused in frame to the codon-optimized 775

mTurquoise2 (DNA20) preceded by a linker sequence encoding GSGSG The resulting 776

plasmid was used to transform Synechocystis 6803 as described previously (Zang et al 2007) 777

After ~ 10 days of incubation on BG11-GelRite (15 ) medium in the presence of 2 microgml 778

gentamycin several antibiotic resistant colonies were obtained and streaked out on fresh 779

medium These transformants were then tested for full segregation of the tagged allele by 780

colony PCR with primers flanking the slr0483 gene 781

782

Fluorescence microscopy 783

24

An aliquot of a cell suspension in mid-log phase was placed under a BG11-agarose 784

pad on a glass coverslip (15) and imaged on an inverted microscope (Zeiss 785

AxioObserverZ1) equipped with an ORCA Flash40 V2 (Hamamatsu) camera a Lumenecor 786

SOLA II Light Engine and a Plan-Apochromat 63x140 Oil DIC M27 (NA 14) objective 787

(Zeiss) Image acquisition was done with Zen 21 software in cyan and far-red fluorescence 788

channels (Zeiss Filter Sets 47 HE and 50) as Z-series with a step size of 250 nm and effective 789

pixel size of 103 nm Acquired image files were subsequently deconvolved (Constrained 790

Iterative Method) using a default theoretical Point Spread Function in Zen 20 (Zeiss) 791

Extraction of intensities for line profiles was performed by image thresholding the thylakoid 792

autofluorescence channel and eroding the resulting binary mask in Fiji (Schindelin et al 793

2012) 794

For immunofluorescence analysis cells were grown to mid-log phase as in the case of 795

the cells prepared for live-cell microscopy A 10-ml culture was fixed for 20 min in 37 796

formaldehyde and following extensive washing with phosphate-buffered saline (PBS) cells 797

were first permeabilized in 005 Triton-X for 20 min and then in lysis buffer (50 mM Tris-798

HCl 100 mM NaCl 5 mgml lysozyme) at 37degC for 2 h with gentle shaking To block 799

unspecific binding sites the cell pellet was incubated in 5 bovine serum albumin in PBS at 800

30degC for 1 h The αCurT serum (1500 dilution) was added to cells in fresh blocking buffer 801

for 1 h at 30degC with gentle shaking Cells were then washed three times with blocking buffer 802

and incubated with goat anti-rabbit IgG secondary antibodies conjugated to Oregon Green 488 803

(Invitrogen) (11000 dilution) under the conditions as for the primary antibodies Cells were 804

washed three times with PBS and prepared for microscopy as above Imaging was done as 805

described for live-cell microscopy except that a Colibri2 LED light source was employed for 806

illumination and a CoolSnap HQ camera (Photometrics) was used for image acquisition Cells 807

were imaged as Z-series (step size 280 nm) in the yellow and far-red fluorescent channels 808

(Zeiss Filter Sets 46 HE and 50) using the 505 nm and 625 nm LED modules Effective pixel 809

size in the final image was 102 nm Deconvolution and image analysis was done as described 810

above As judged by the staining intensity of the Oregon Green-conjugated antibodies 811

approximately half of the cells in any given field of view appeared to have been successfully 812

permeabilised a rate that is common in our experience No significant signal was detected in 813

the control sample that had not been exposed to the primary antibodies 814

815

25

Accession numbers 816

Sequence data from this article can be found in the CyanoBase and EMBLGenBank 817

data libraries under accession number slr0483 818

819

Supplemental Data 820

Supplemental Figure 1 Construction of the curT- mutant 821

Supplemental Figure 2 Growth phenotype of curT- 822

Supplemental Figure 3 Expression analysis of the open reading frame slr0482 (located 823

upstream of curT) in the curT- strain 824

Supplemental Figure 4 Absorbance spectra of curT- and wild-type cells 825

Supplemental Figure 5 High-light growth phenotypes of wild-type Synechocystis 6803 and 826

the curT- strain 827

Supplemental Figure 6 Ultrastructure of the TD41 mutant which lacks the psbA transcript 828

and the D1 protein 829

Supplemental Figure 7 Expression and localization of CurT-CFP 830

Supplemental Figure 8 Localization of CurT and CurT-CFP by fluorescence microscopy 831

Supplemental Figure 9 Chlorophyll autofluorescence of curT- 832

Supplemental Figure 10 The curT- mutant as a negative control for immunogold labeling 833

Supplemental Figure 11 Representative counts of immunogold signals 834

Supplemental Table 1 Overview of immunogold signals in curT- cells 835

Supplemental Table 2 Overview of immunogold signals in specific regions of Synechocystis 836

6803 wild-type cells 837

Supplemental Table 3 Statistical analysis of immunogold signals for wild-type 838

Synechocystis 6803 cells 839

Supplemental Table 4 Co-expression of curT 840

Supplemental Movie 1 Scan through the Z-axis of a curT-CFP cell 841

Supplemental Movie 2 Rendered 3D-model of a CurT-CFP detection 842

Supplemental Movie 3 Scan through the Z-axis of a curT-CFP cell with a traversing 843

thylakoid lamella 844

845

Acknowledgements 846

We thank Y Nishiyama for providing αpD1 and J Soll for αVIPP1 and αYidC antibodies 847

respectively and Nina Dyczmons-Nowaczyk for support with the fluorescence measurements 848

This work was supported by grants awarded to JN (Ni3909) MMN (NO 8363) and DL 849

26

(Le126529) by the Deutsche Forschungsgemeinschaft in the context of Research Unit 850

FOR2092 and the Cluster of Excellence RESOLV (EXC 1069) AG is a Howard Hughes 851

Medical Institute postdoctoral fellow in the laboratory of Erin OrsquoShea at Harvard University 852

LS was supported by a PhD fellowship from the Chinese Scholarship Council 853

854

Author Contributions 855

SH AR LS MMN DL and JN designed the research SH AR LS AG ILG EH ML BR 856

SV performed the research all authors contributed to data analysis SH AR and JN wrote the 857

paper 858

859

Competing Financial Interest statement 860

The authors declare no competing financial interests 861

862

We wish to dedicate this paper to Fabrice Rappaport an outstanding colleague and friend who 863

passed away so early 864

865

27

References 866

Allen JF de Paula WBM Puthiyaveetil S and Nield J (2011) A structural 867

phylogenetic map for chloroplast photosynthesis Trends Plant Sci 16 645-655 868

Anderson JM Horton P Kim E-H and Chow WS (2012) Towards elucidation of 869

dynamic structural changes of plant thylakoid architecture Philos Trans R Soc 870

Lond B Biol Sci 367 3515-3524 871

Armbruster U Zuumlhlke J Rengstl B Kreller R Makarenko E Ruumlhle T Schuumlnemann 872

D Jahns P Weisshaar B Nickelsen J and Leister D (2010) The Arabidopsis 873

thylakoid protein PAM68 is required for efficient D1 biogenesis and photosystem II 874

assembly Plant Cell 22 3439-3460 875

Armbruster U Labs M Pribil M Viola S Xu W Scharfenberg M Hertle AP 876

Rojahn U Jensen PE Rappaport F Joliot P Doumlrmann P Wanner G and 877

Leister D (2013) Arabidopsis CURVATURE THYLAKOID1 proteins modify 878

thylakoid architecture by inducing membrane curvature Plant Cell 25 2661-2678 879

Aseeva E Ossenbuumlhl F Sippel C Cho WK Stein B Eichacker LA Meurer J 880

Wanner G Westhoff P Soll J and Vothknecht UC (2007) Vipp1 is required for 881

basic thylakoid membrane formation but not for the assembly of thylakoid protein 882

complexes Plant Physiol Biochem 45 119-128 883

Bartsevich VV and Pakrasi HB (1995) Molecular identification of an ABC transporter 884

complex for manganese analysis of a cyanobacterial mutant strain impaired in the 885

photosynthetic oxygen evolution process EMBO J 14 1845-1853 886

Bartsevich VV and Pakrasi HB (1996) Manganese transport in the cyanobacterium 887

Synechocystis sp PCC 6803 J Biol Chem 271 26057-26061 888

Bernaacutet G Waschewski N and Roumlgner M (2009) Towards efficient hydrogen production 889

the impact of antenna size and external factors on electron transport dynamics in 890

Synechocystis PCC 6803 Photosynth Res 99 205-216 891

Boehm M Yu J Krynicka V Barker M Tichy M Komenda J Nixon PJ and Nield 892

J (2012) Subunit Organization of a Synechocystis Hetero-Oligomeric Thylakoid FtsH893

Complex Involved in Photosystem II Repair Plant Cell 24 3669-3683894

Bradford MM (1976) A rapid and sensitive method for the quantitation of microgram 895

quantities of protein utilizing the principle of protein-dye binding Anal Biochem 72 896

248-254897

28

Chang L Liu X Li Y Liu C-C Yang F Zhao J and Sui S-F (2015) Structural 898

organization of an intact phycobilisome and its association with photosystem II Cell 899

Res 25 726-737 900

Danielsson R Suorsa M Paakkarinen V Albertsson P-Aring Styring S Aro E-M and 901

Mamedov F (2006) Dimeric and monomeric organization of photosystem II 902

Distribution of five distinct complexes in the different domains of the thylakoid 903

membrane J Biol Chem 281 14241-14249 904

Daum B Nicastro D Austin J McIntosh JR and Kuumlhlbrandt W (2010) Arrangement 905

of photosystem II and ATP synthase in chloroplast membranes of Spinach and Pea 906

Plant Cell 22 1299-1312 907

Engel BD Schaffer M Kuhn Cuellar L Villa E Plitzko JM and Baumeister W 908

(2015) Native architecture of the Chlamydomonas chloroplast revealed by in situ 909

cryo-electron tomography eLife 4 e04889 910

Ford MGJ Mills IG Peter BJ Vallis Y Praefcke GJK Evans PR and McMahon 911

HT (2002) Curvature of clathrin-coated pits driven by epsin Nature 419 361-366 912

Fristedt R Willig A Granath P Cregravevecoeur M Rochaix J-D and Vener AV (2009) 913

Phosphorylation of photosystem II controls functional macroscopic folding of 914

photosynthetic membranes in Arabidopsis Plant Cell 21 3950-3964 915

Gallop JL and McMahon HT (2005) BAR domains and membrane curvature bringing 916

your curves to the BAR Biochem Soc Symp 72 223-231 917

Gibson DG (2011) Chapter fifteen - Enzymatic Assembly of Overlapping DNA Fragments 918

In Methods in Enzymology V Christopher ed (Academic Press) pp 349-361 919

Goedhart J von Stetten D Noirclerc-Savoye M Lelimousin M Joosen L Hink MA 920

van Weeren L Gadella TWJ and Royant A (2012) Structure-guided evolution of 921

cyan fluorescent proteins towards a quantum yield of 93 Nat Commun 3 751 922

Heinz S Liauw P Nickelsen J and Nowaczyk M (2016) Analysis of photosystem II 923

biogenesis in cyanobacteria Biochim Biophys Acta 1857 274-287 924

Hernaacutendez-Prieto M and Futschik M (2012) CyanoEXpress A web database for 925

exploration and visualisation of the integrated transcriptome of cyanobacterium 926

Synechocystis sp PCC6803 Bioinformation 8 634-638 927

Hernaacutendez-Prieto MA Semeniuk TA Giner-Lamia J and Futschik ME (2016) The 928

Transcriptional Landscape of the Photosynthetic Model Cyanobacterium 929

Synechocystis sp PCC6803 Sci Rep 6 22168 930

29

Huang F Fulda S Hagemann M and Norling B (2006) Proteomic screening of salt-931

stress-induced changes in plasma membranes of Synechocystis sp strain PCC 6803 932

Proteomics 6 910-920 933

Kirchhoff H (2013) Architectural switches in plant thylakoid membranes Photosynth Res 934

116 481-487 935

Klinkert B Elles I and Nickelsen J (2006) Translation of chloroplast psbD mRNA in 936

Chlamydomonas is controlled by a secondary RNA structure blocking the AUG start 937

codon Nucleic Acids Res 34 386-394 938

Klinkert B Ossenbuumlhl F Sikorski M Berry S Eichacker L and Nickelsen J (2004) 939

PratA a periplasmic tetratricopeptide repeat protein involved in biogenesis of 940

photosystem II in Synechocystis sp PCC 6803 J Biol Chem 279 44639-44644 941

Komenda J Nickelsen J Tichyacute M Praacutešil O Eichacker LA and Nixon PJ (2008) The 942

cyanobacterial homologue of HCF136YCF48 is a component of an early photosystem 943

II assembly complex and is important for both the efficient assembly and repair of 944

photosystem II in Synechocystis sp PCC 6803 J Biol Chem 283 22390-22399 945

Kopf M Klaumlhn S Scholz I Matthiessen JKF Hess WR and Voszlig B (2014) 946

Comparative analysis of the primary transcriptome of Synechocystis sp PCC 6803 947

DNA Res 21 527-539 948

Kunkel DD (1982) Thylakoid centers Structures associated with the cyanobacterial 949

photosynthetic membrane system Arch Microbiol 133 97-99 950

Liberton M Howard Berg R Heuser J Roth R and Pakrasi BH (2006) Ultrastructure 951

of the membrane systems in the unicellular cyanobacterium Synechocystis sp strain 952

PCC 6803 Protoplasma 227 129-138 953

Liberton M Saha R Jacobs JM Nguyen AY Gritsenko MA Smith RD 954

Koppenaal DW and Pakrasi HB (2016) Global Proteomic Analysis Reveals an 955

Exclusive Role of Thylakoid Membranes in Bioenergetics of a Model 956

Cyanobacterium Mol Cell Proteomics 15 2021-2032 957

Luque I and Ochoa de Alda JAG (2014) CURT1CAAD-containing aaRSs thylakoid 958

curvature and gene translation Trends Plant Sci 19 63-66 959

Marin K Stirnberg M Eisenhut M Kraumlmer R and Hagemann M (2006) Osmotic stress 960

in Synechocystis sp PCC 6803 low tolerance towards nonionic osmotic stress results 961

from lacking activation of glucosylglycerol accumulation Microbiology 152 2023-962

2030 963

Mullineaux CW (2005) Function and evolution of grana Trends Plant Sci 10 521-525 964

30

Mullineaux CW (2008) Biogenesis and dynamics of thylakoid membranes and the 965

photosynthetic apparatus In The Cyanobacteria A Herrero and E Flores eds 966

(Norfolk UK Caister Academic Press) pp 289ndash304 967

Nevo R Charuvi D Tsabari O and Reich Z (2012) Composition architecture and 968

dynamics of the photosynthetic apparatus in higher plants Plant J 70 157-176 969

Nickelsen J and Rengstl B (2013) Photosystem II assembly From cyanobacteria to plants 970

Annu Rev Plant Biol 64 609-635 971

Nickelsen J and Zerges W (2013) Thylakoid biogenesis has joined the new era of bacterial 972

cell biology Front Plant Sci 4 458 973

Nilsson F Simpson DJ Jansson C and Andersson B (1992) Ultrastructural and 974

biochemical characterization of a Synechocystis 6803 mutant with inactivated psbA 975

genes Arch Biochem Biophys 295 340-347 976

Odom WR Hodges R Chitnis PR and Guikema JA (1993) Characterization of 977

Synechocystis sp PCC 6803 in iron-supplied and iron-deficient media Plant Mol 978

Biol 23 1255-1264 979

Ossenbuumlhl F Inaba-Sulpice M Meurer J Soll J and Eichacker LA (2006) The 980

Synechocystis sp PCC 6803 Oxa1 homolog is essential for membrane integration of 981

reaction center precursor protein pD1 Plant Cell 18 2236-2246 982

Pisareva T Kwon J Oh J Kim S Ge C Wieslander Aring Choi J-S and Norling B 983

(2011) Model for Membrane Organization and Protein Sorting in the Cyanobacterium 984

Synechocystis sp PCC 6803 Inferred from Proteomics and Multivariate Sequence 985

Analyses J Proteome Res 10 3617-3631 986

Pribil M Labs M and Leister D (2014) Structure and dynamics of thylakoids in land 987

plants J Exp Bot 65 1955-1972 988

Rast A Heinz S and Nickelsen J (2015) Biogenesis of thylakoid membranes Biochim 989

Biophys Acta 1847 821-830 990

Rast A Rengstl B Heinz S Klingl A and Nickelsen J (2016) The role of Slr0151 a 991

tetratricopeptide repeat protein from Synechocystis sp PCC 6803 during Photosystem 992

II assembly and repair Front Plant Sci 7 605 993

Rengstl B Oster U Stengel A and Nickelsen J (2011) An Intermediate Membrane 994

Subfraction in Cyanobacteria Is Involved in an Assembly Network for Photosystem II 995

Biogenesis J Biol Chem 286 21944-21951 996

31

Rengstl B Knoppovaacute J Komenda J and Nickelsen J (2013) Characterization of a 997

Synechocystis double mutant lacking the photosystem II assembly factors YCF48 and 998

Sll0933 Planta 237 471-480 999

Rexroth S Mullineaux CW Ellinger D Sendtko E Roumlgner M and Koenig F (2011) 1000

The Plasma Membrane of the Cyanobacterium Gloeobacter violaceus Contains 1001

Segregated Bioenergetic Domains Plant Cell 23 2379-2390 1002

Rippka R Deruelles J Waterbury JB Herdman M and Stanier RY (1979) Generic 1003

Assignments Strain Histories and Properties of Pure Cultures of Cyanobacteria 1004

Microbiology 111 1-61 1005

Ruumltgers M and Schroda M (2013) A role of VIPP1 as a dynamic structure within 1006

thylakoid centers as sites of photosystem biogenesis Plant Signal Behav 8 e27037 1007

Sacharz J Bryan SJ Yu J Burroughs NJ Spence EM Nixon PJ and Mullineaux 1008

CW (2015) Sub-cellular location of FtsH proteases in the cyanobacterium1009

Synechocystis sp PCC 6803 suggests localised PSII repair zones in the thylakoid1010

membranes Mol Microbiol 96 448-4621011

Sandstroumlm S Park Y-I Oumlquist G and Gustafsson P (2001) CP43prime the isiA Gene 1012

Product Functions as an Excitation Energy Dissipator in the Cyanobacterium 1013

Synechococcus sp PCC 7942 Photochem Photobiol 74 431-437 1014

Schindelin J Arganda-Carreras I Frise E Kaynig V Longair M Pietzsch T 1015

Preibisch S Rueden C Saalfeld S Schmid B Tinevez J-Y White DJ 1016

Hartenstein V Eliceiri K Tomancak P and Cardona A (2012) Fiji an open-1017

source platform for biological-image analysis Nat Methods 9 676-682 1018

Schottkowski M Ratke J Oster U Nowaczyk M and Nickelsen J (2009a) Pitt a novel 1019

tetratricopeptide repeat protein involved in light-dependent chlorophyll biosynthesis 1020

and thylakoid membrane biogenesis in Synechocystis sp PCC 6803 Mol Plant 2 1021

1289-1297 1022

Schottkowski M Gkalympoudis S Tzekova N Stelljes C Schuumlnemann D Ankele E 1023

and Nickelsen J (2009b) Interaction of the periplasmic PratA factor and the PsbA 1024

(D1) protein during biogenesis of photosystem II in Synechocystis sp PCC 6803 J 1025

Biol Chem 284 1813-1819 1026

Selatildeo TT Zhang L Knoppovaaacute J Komenda J and Norling B (2016) Photosystem II 1027

Assembly Steps Take Place in the Thylakoid Membrane of the Cyanobacterium 1028

Synechocystis sp PCC6803 Plant Cell Physiol 57 878 1029

32

Spaumlt P Maček B and Forchhammer K (2015) Phosphoproteome of the cyanobacterium 1030

Synechocystis sp PCC 6803 and its dynamics during nitrogen starvation Front 1031

Microbiol 6 248 1032

Stengel A Guumlgel IL Hilger D Rengstl B Jung H and Nickelsen J (2012) Initial 1033

steps of photosystem II de novo assembly and preloading with manganese take place 1034

in biogenesis centers in Synechocystis Plant Cell 24 660-675 1035

Uniacke J and Zerges W (2007) Photosystem II assembly and repair are differentially 1036

localized in Chlamydomonas Plant Cell 19 3640-3654 1037

Uniacke J and Zerges W (2009) Chloroplast protein targeting involves localized 1038

translation in Chlamydomonas Proc Natl Acad Sci USA 106 1439-1444 1039

van de Meene AL Hohmann-Marriott M Vermaas WJ and Roberson R (2006) The 1040

three-dimensional structure of the cyanobacterium Synechocystis sp PCC 6803 Arch 1041

Microbiol 184 259-270 1042

van de Meene AML Sharp WP McDaniel JH Friedrich H Vermaas WFJ and 1043

Roberson RW (2012) Gross morphological changes in thylakoid membrane 1044

structure are associated with photosystem I deletion in Synechocystis sp PCC 6803 1045

Biochim Biophys Acta 1818 1427-1434 1046

Watanabe M and Ikeuchi M (2013) Phycobilisome architecture of a light-harvesting 1047

supercomplex Photosynth Res 116 265-276 1048

Wellburn AR and Lichtenthaler H (1984) Formulae and Program to Determine Total 1049

Carotenoids and Chlorophylls A and B of Leaf Extracts in Different Solvents In 1050

Advances in Photosynthesis Research Proceedings of the VIth International Congress 1051

on Photosynthesis Brussels Belgium August 1ndash6 1983 C Sybesma ed (Dordrecht 1052

Springer Netherlands) pp 9-12 1053

Wilde A Lunser K Ossenbuumlhl F Nickelsen J and Borner T (2001) Characterization of 1054

the cyanobacterial ycf37 mutation decreases the photosystem I content Biochem J 1055

357 211-216 1056

Wilson A Boulay C Wilde A Kerfeld CA and Kirilovsky D (2007) Light-Induced 1057

Energy Dissipation in Iron-Starved Cyanobacteria Roles of OCP and IsiA Proteins 1058

Plant Cell 19 656-672 1059

Xu M Bernaacutet G Singh A Mi H Roumlgner M Pakrasi HB and Ogawa T (2008) 1060

Properties of Mutants of Synechocystis sp Strain PCC 6803 Lacking Inorganic Carbon 1061

Sequestration Systems Plant Cell Physiol 49 1672-1677 1062

33

Yamamoto T Burke J Autz G and Jagendorf AT (1981) Bound ribosomes of Pea 1063

chloroplast thylakoid membranes location and release in vitro by high salt 1064

puromycin and RNase Plant Physiol 67 940-949 1065

Yang H Liao L Bo T Zhao L Sun X Lu X Norling B and Huang F (2014) 1066

Slr0151 in Synechocystis sp PCC 6803 is required for efficient repair of photosystem 1067

II under high-light condition J Integr Plant Biol 56 1136-1150 1068

Yeremenko N Kouřil R Ihalainen JA DHaene S van Oosterwijk N 1069

Andrizhiyevskaya EG Keegstra W Dekker HL Hagemann M Boekema EJ 1070

Matthijs HCP and Dekker JP (2004) Supramolecular Organization and Dual 1071

Function of the IsiA Chlorophyll-Binding Protein in Cyanobacteria Biochemistry 43 1072

10308-10313 1073

Zak E Norling B Maitra R Huang F Andersson B and Pakrasi HB (2001) The 1074

initial steps of biogenesis of cyanobacterial photosystems occur in plasma membranes 1075

Proc Natl Acad Sci USA 98 13443-13448 1076

Zang X Liu B Liu S Arunakumara KKIU and Zhang X (2007) Optimum 1077

Conditions for Transformation of Synechocystis sp PCC 6803 J Microbiol 45 241-1078

245 1079

Zhang L and Sakamoto W (2015) Possible function of VIPP1 in maintaining chloroplast 1080

membranes Biochim Biophys Acta 1847 831-837 1081

Zimmerberg J and Kozlov MM (2006) How proteins produce cellular membrane 1082

curvature Nat Rev Mol Cell Biol 7 9-19 1083

Zoumlfel P (1988) Statistik in der Praxis (Stuttgart Germany Gustav Fischer Verlag) 1084

1085

34

Figure Legends 1086

Figure 1 General characteristics of CurT A) Sequence alignment of CurT and CURT1A-D 1087

from A thaliana Predicted chloroplast transit-peptide sequences of CURT1A-D are omitted 1088

(Armbruster et al 2013) Positions of predicted C-terminal transmembrane domains (TDM) 1089

are marked (black bar) as is the position of the predicted amphipathic N-terminal helix in 1090

CurT (red bar) The green bar denotes the peptide sequence used for antibody production 1091

Identical and related amino acids that are conserved in 100 80 and 60 of the sequences 1092

are highlighted in black dark grey and light grey respectively B) Helical-wheel 1093

representation of the N-terminal amphipathic helix of CurT (red bar in A) The color code 1094

reflects the physicochemical properties of amino-acid side-chains green polar and 1095

uncharged blue polar and positively charged red polar and negatively charged yellow 1096

hydrophobic C) Solubility of CurT Membrane-associated proteins (50 microg) from wild-type 1097

cells were extracted with 5 mM HEPES (pH 76) containing either 1 M NaCl 01 M Na2CO3 1098

4 M urea 01 Triton X-100 or no additional solute After separation of membrane-bound 1099

(M) and solubilized (S) proteins by centrifugation proteins were fractionated by SDS-PAGE1100

and CurT was immunodetected on immunoblots As a control the integral membrane protein 1101

CP47 from PSII was analyzed in parallel D) Transmission electron micrographs of negatively 1102

stained liposomes Cell-free expression (CFE) of CurT and A thaliana CURT1A was 1103

performed in the presence of liposomes similar in composition to the lipids of the thylakoid 1104

membrane Liposomes before and after cell-free protein expression in the absence of DNA 1105

served as negative controls Black arrowheads indicate tubular connections between 1106

liposomes Scale bars 250 nm 1107

1108

Figure 2 Ultrastructural analysis of curT- cells Transmission electron micrographs of typical 1109

wild-type (A) and curT- (B-D) Synechocystis 6803 cells taken at 44000times (A B) and 28000times 1110

(C D) magnification respectively Ultrathin sections (35 to 45 nm) of cryofixed samples 1111

were stained with osmium tetroxide and post-stained using lead citrate Arrowheads indicate 1112

biogenesis centers Scale bars 200 nm (A B) and 500 nm (C D) respectively 1113

1114

Figure 3 Accumulation of components of photosynthetic complexes in the curT- mutant A) 1115

Whole cell extracts (30 microg protein) from wild-type and curT- strains were fractionated by 1116

SDS-PAGE and analyzed on immunoblots using the indicated antibodies B) The histogram 1117

shows levels of the indicated proteins in curT- extracts relative to wild-type samples (dashed 1118

red line) Data are means plusmn SD of three independent experiments Significant differences from 1119

35

wild-type protein levels according to Studentrsquos t-test with error probabilities of 5 and 1 1120

are indicated by and respectively 1121

1122

Figure 4 P700+ reduction kinetics and high-light effects in curT- cells A) Averaged traces 1123

(10 single measurements) of P700+ decay after complete oxidation by a 50-ms multiple 1124

turnover pulse (10000 micromol photons m-2 s-1) in the absence and presence of 10 microM DCMU 1125

B) Rate constants for P700+ reduction were obtained by fitting of the data with single1126

exponential functions Error bars indicate the SD of three independent measurements C) 1127

Impact of light intensity on the (relative) electron transport rate (rETR) Cells were exposed to 1128

gradually increasing light intensities which resulted in increasing electron transport until the 1129

capacity limit was reached PAR light intensity (micromol photons m-2 s-1) Error bars indicate the 1130

SD of three independent measurements D) D1 protein level in wild-type and curT- after high-1131

light treatment (800 micromol photons m-2s-1) in the presence and absence of lincomycin Samples 1132

were taken every 30 min and processed as in Figure 3 to determine the level of D1 present 1133

100 refers to wild-type D1 level at the beginning of the experiment 1134

1135

Figure 5 PSII assembly in curT- cells A) BNSDS-PAGE of membrane proteins Membrane 1136

fractions from wild-type and curT- cells were solubilized with 13 n-dodecyl-β-maltoside 1137

and proteins were fractionated by two-dimensional BNSDS-PAGE blotted and probed with 1138

antibodies against the PSII subunits D1 D2 CP47 and CP43 Wild-type blots were also 1139

probed with the αCurT antibody The sizes of marker proteins and the positions of PSII 1140

assembly intermediates (RCCII RCCI RC47) are shown above and below each image B) In 1141

vivo pulse labeling of membrane proteins with 35S Pulse-labeled PSII core proteins were 1142

separated via BNSDS-PAGE and visualized by autoradiography 1143

1144

Figure 6 Loss of CurT induces stress A) Low-temperature (77 K) fluorescence emission of 1145

Synechocystis 6803 wild-type (blue) and curT- (red) cells excited at 440 nm The spectra were 1146

normalized to the added fluorescein standard B) Low-temperature (77 K) fluorescence 1147

emission of Synechocystis 6803 wild-type (blue) and curT- (red) excited at 580 nm The 1148

spectra were normalized to 780 nm C) Level of IsiA in the curT- mutant relative to the wild-1149

type A mean value of 368 plusmn 96 (SD) was determined from three independent experiments 1150

1151

Figure 7 Membrane sublocalization of PSII-related factors Cell extracts from wild-type and 1152

curT- cells were fractionated by two consecutive rounds of sucrose-density gradient 1153

36

centrifugation (Schottkowski et al 2009b) The second linear gradient (20-60 sucrose) was 1154

apportioned into 14 fractions which were analyzed by immunoblotting using the indicated 1155

antibodies Fractions 1ndash6 represent PDMs and fractions 7ndash14 thylakoid membranes (TMs) 1156

To facilitate comparison between gradients sample volumes were normalized to the volume 1157

of fraction 7 that contained 40 microg of protein 1158

1159

Figure 8 Live-cell imaging of the curT-CFP strain by fluorescence microscopy In the curT-1160

CFP strain the native curT gene has been replaced by a CFP-tagged version resulting in the 1161

expression of the CurT-CFP fusion protein under the control of the native promotor A) 1162

Close-up views of the mid-cell plane in the CFP and far-red autofluorescence channels shown 1163

in slice 7 in panel B B) Synechocystis 6803 cells expressing CurT C-terminally fused to the 1164

mTurquoise2 variant of CFP from its native chromosomal promoter The two imaging 1165

channels are displayed as Z-axis montages (auto-scaled contrast step size 250 nm) in 1166

grayscale and color composite configuration The thylakoid autofluorescent channel as 1167

imaged in far-red fluorescence is depicted in magenta and CurT signal as imaged in cyan 1168

fluorescence is depicted in cyan C) Fluorescence intensity profiles of the two channels along 1169

the autofluorescent peripheral cell ldquoringrdquo are shown for slice 7 The maximum projection of 1170

the entire Z montage is also shown Scale bars (light grey) 2 microm 1171

1172

Figure 9 Immunofluorescence detection of CurT A) Close-ups of slice 5 in panel B B) 1173

Wild-type Synechocystis 6803 cells labeled with αCurT antibodies and detected with Oregon 1174

Green-conjugated secondary antibodies The Z-axis montages are shown as in Figure 8B 1175

except that the step size is 280 nm (1 to 10) C) Intensity profiles of the two channels along 1176

the autofluorescent peripheral cell ldquoringrdquo are shown for slice 5 The maximum projection of 1177

the entire Z montage is also shown Scale bars (light grey) 2 microm 1178

1179

Figure 10 Subcellular localization of CurT Ultrathin sections of wild-type Synechocystis 1180

6803 cells were incubated with rabbit αCurT prior to incubation with gold-conjugated goat 1181

anti-rabbit IgG A) Negative control (wild-type processed without addition of primary 1182

antibody) B C) Immunogold-labeled sections showing CurT localization at the cytoplasmic 1183

side of the thylakoid membrane D) Cluster formation of CurT signals at a putative biogenesis 1184

center from C E) Biogenesis center from the same cell (C) without any obvious CurT 1185

clustering of gold particles F) Schematic depiction of a wild-type cell (from Figure 2A) with 1186

color-coded curved membranes green = thylakoids that follow the curvature of the cell red = 1187

37

thylakoids that bend away from the plasma membrane yellow = thylakoids that bend toward 1188

the plasma membrane to converge on sites of biogenesis centers G) Relative distribution of 1189

gold signals between convex (dark color) and concave (light color) sides of membranes (n = 1190

1584 signals from a total of 95 cells) The undifferentiated overall signal distribution is given 1191

in blue Bars = 200 nm (overview) and 100 nm (details) 1192

1193

Figure 11 Differentially modified forms of CurT are found in different complexes in PDMs 1194

and thylakoid membranes Samples were isolated by fractionation of wild-type membranes 1195

via two consecutive sucrose density gradients according to Schottkowski et al (2009b) After 1196

density centrifugation samples were applied to BNSDS-PAGE analysis (A) or isoelectric 1197

focusing (B) Numbers on the right indicate the respective fraction from the second gradient 1198

(see Figure 7) Fraction 5 represents the PDMs and fraction 9 the thylakoid membrane 1199

1200

Figure 12 Loss of CurT increases sensitivity to abiotic stress A B) Doubling times of wild-1201

type and curT- under salt stress (A) or osmotic stress (B) Doubling times are means plusmn SD of 1202

three independent cultures C) Localization of CurT-CFP under salt and osmotic stress 1203

Samples were examined as described in Figure 8 Scale bars 1 microm D) Protein levels of wild-1204

type cells after growth in BG11 medium containing 500 mM NaCl Samples were analyzed on 1205

the same gel but unrelated samples between the presented signals were omitted E) 1206

Membrane preparations obtained from wild-type cells wild-type cells grown in the presence 1207

of 500 mM NaCl and curT- cells were subjected to the first gradient step in the membrane 1208

fractionation scheme The gradient was divided into five fractions and 10 of fractions I-IV 1209

and 02 of fraction V were analyzed by SDS-PAGE Fraction II includes the plasma 1210

membrane and fraction V consists of PratA-defined membrane and thylakoid membrane 1211

1212

Figure 13 Model of CurT distribution at convergence zones in Synechocystis 6803 The 1213

distribution of CurT in thylakoid (green) and plasma membranes (brown) is shown The 1214

pattern of localization of CurT in the thylakoid membrane is derived from membrane 1215

fractionation via sucrose density centrifugation fluorescence-based detection of the CurT-1216

CFP fusion and endogenous CurT and immunogold labeling experiments (Figures 7-10) The 1217

different CurT variants a b c and d identified in the IEF experiments (Figure 11) are depicted 1218

in yellow pink blue and black respectively CurT present in the plasma membrane is 1219

highlighted in gray as its precise nature and role remain to be defined (Figure 12) 1220

Membranes are represented as lipid bilayers Convex and concave faces of bent thylakoid 1221

38

sheets are indicated by black arrows The PDM which is dedicated to PSII assembly and 1222

repair is depicted in blue The dotted blue line emphasizes that the ultrastructure in this region 1223

has not yet been fully resolved PP periplasm PM plasma membrane TM thylakoid 1224

membrane L lumen PDM PratA-defined membrane 1225

1226

Tables 1227

Table 1 Physiological characteristics of the curT- mutant 1228

Strain Doubling time [h]

Oxygen Evolution[nmol h-1 OD750

-1]c

Chlorophyll content

[microg OD750-1]

d

Cell size [microm]e

Cell number [ml-1 OD750

-1]f

Wild type 817plusmn017a 1600plusmn042

b 1933plusmn187 251plusmn014 264plusmn020 390plusmn006 x 107

curT- 1259plusmn020a 3226plusmn056

b 1074plusmn20 195plusmn029 274plusmn044 367plusmn016 x 107

1229 abDoubling times in the presence (a) or absence (b) of 5 mM glucose measured under 1230

continuous illumination at 30 micromol photons m-2 s-1 and CO2-limiting conditions cOxygen 1231

evolution is expressed in nmol O2 produced per hour per OD750 unit dChlorophyll content is 1232

expressed in microg OD750-1 eThe diameter of non-dividing cells is presented in microm fCell number 1233

was determined per ml per OD750 Data are means plusmn SD of at least three independent 1234

experiments 1235

1236

Parsed CitationsAllen JF de Paula WBM Puthiyaveetil S and Nield J (2011) A structural phylogenetic map for chloroplast photosynthesisTrends Plant Sci 16 645-655

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Anderson JM Horton P Kim E-H and Chow WS (2012) Towards elucidation of dynamic structural changes of plant thylakoidarchitecture Philos Trans R Soc Lond B Biol Sci 367 3515-3524

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Armbruster U Zuumlhlke J Rengstl B Kreller R Makarenko E Ruumlhle T Schuumlnemann D Jahns P Weisshaar B NickelsenJ and Leister D (2010) The Arabidopsis thylakoid protein PAM68 is required for efficient D1 biogenesis and photosystem IIassembly Plant Cell 22 3439-3460

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Armbruster U Labs M Pribil M Viola S Xu W Scharfenberg M Hertle AP Rojahn U Jensen PE Rappaport F JoliotP Doumlrmann P Wanner G and Leister D (2013) Arabidopsis CURVATURE THYLAKOID1 proteins modify thylakoid architectureby inducing membrane curvature Plant Cell 25 2661-2678

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Aseeva E Ossenbuumlhl F Sippel C Cho WK Stein B Eichacker LA Meurer J Wanner G Westhoff P Soll J andVothknecht UC (2007) Vipp1 is required for basic thylakoid membrane formation but not for the assembly of thylakoid proteincomplexes Plant Physiol Biochem 45 119-128

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Bartsevich VV and Pakrasi HB (1995) Molecular identification of an ABC transporter complex for manganese analysis of acyanobacterial mutant strain impaired in the photosynthetic oxygen evolution process EMBO J 14 1845-1853

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Bartsevich VV and Pakrasi HB (1996) Manganese transport in the cyanobacterium Synechocystis sp PCC 6803 J Biol Chem271 26057-26061

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Bernaacutet G Waschewski N and Roumlgner M (2009) Towards efficient hydrogen production the impact of antenna size andexternal factors on electron transport dynamics in Synechocystis PCC 6803 Photosynth Res 99 205-216

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Boehm M Yu J Krynicka V Barker M Tichy M Komenda J Nixon PJ and Nield J (2012) Subunit Organization of aSynechocystis Hetero-Oligomeric Thylakoid FtsH Complex Involved in Photosystem II Repair Plant Cell 24 3669-3683

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Bradford MM (1976) A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle ofprotein-dye binding Anal Biochem 72 248-254

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Chang L Liu X Li Y Liu C-C Yang F Zhao J and Sui S-F (2015) Structural organization of an intact phycobilisome and itsassociation with photosystem II Cell Res 25 726-737

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Danielsson R Suorsa M Paakkarinen V Albertsson P-Aring Styring S Aro E-M and Mamedov F (2006) Dimeric andmonomeric organization of photosystem II Distribution of five distinct complexes in the different domains of the thylakoidmembrane J Biol Chem 281 14241-14249

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Daum B Nicastro D Austin J McIntosh JR and Kuumlhlbrandt W (2010) Arrangement of photosystem II and ATP synthase in

14

overexpress CurT in Synechocystis 6803 failed Although short-lived transient increases in 448

CurT levels were observed when curT was expressed via strong heterologous promoters 449

wild-type levels of the protein were restored during subsequent rounds of cultivation of 450

transgenic lines Apparently Synechocystis 6803 cells do not tolerate substantial alterations in 451

CurT dosage and counter-select against these 452

This is in agreement with a dosage-dependent membrane-curving activity of CurT 453

which is suggested by its high local concentration at the edges of thylakoid autofluorescent 454

regions which mark the sites of the highly curved thylakoid convergence zones (Figures 8 9 455

and 13 Supplemental Movie 1 2 and 3) In addition some CurT was detected in structures 456

extending through the cytoplasm which most likely represent thylakoid sheets traversing the 457

cell from one thylakoid convergence zone to another (Figures 2A and 8) CurT might be 458

involved in the formation and stabilization of these structures 459

Members of the CURT1 family contain an N-terminal amphipathic α-helix that may 460

be involved in the membrane-bending activity of CurT (Armbruster et al 2013) Several 461

eukaryotic membrane-shaping proteins possess amphipathic helices as part of either an ENTH 462

(epsin N-terminal homology) or an N-BAR (Bin amphiphysin Rvs with N-terminal 463

amphipathic helix) domain (Ford et al 2002 Gallop and McMahon 2005 Zimmerberg and 464

Kozlov 2006) ENTH and N-BAR domains are rather large (~200 amino acids) and it has 465

been shown that amphipatic helices present in those domains insert into one leaflet of the lipid 466

bilayer and thereby induce curvature of the membrane (reviewed by Gallop and McMahon 467

2005 Zimmerberg and Kozlov 2006) However CurT itself is a small protein (149 amino 468

acids) that contains two transmembrane domains which insert into both leaflets of the lipid 469

bilayer (Figure 1A) as already suggested by Armbruster et al (2013) The amphipathic helix 470

faces the cytoplasm in Synechocystis 6803 or the stroma in A thaliana and most likely it 471

fine-tunes the degree of membrane bending mediated by CurT (Armbruster et al 2013) 472

In addition the increase in curvature correlated with CurT accumulation at convex 473

sides of thylakoid lamella (Figure 10 and 13) Hence curving might be mediated by 474

asymmetric integration of CurT into the lipid bilayers forming opposite faces of thylakoid 475

membrane sheets (Figure 13) However the mechanism causing this asymmetry remains 476

elusive 477

The presence of different CurT isoforms and complexes in PDMs and thylakoids adds 478

a further level of complexity and most likely reflects the dynamic regulation of this system 479

(Figure 11) The formation of different complexes might be primed by the phosphorylation of 480

CurT within its N-terminal cytoplasmic part (Spaumlt et al 2015) It seems likely that these 481

15

complexes play distinct roles in mediating the different CurT functions ie membrane 482

bending and maintenance 483

However it remains to be seen how exactly curvature is established maintained and 484

fine-tuned In addition other determinants of membrane topology and their putative interplay 485

with CurT have to be considered eg lipid and protein (complex) composition of 486

membranes cellular turgor pressure and other factors required for membrane 487

biogenesismaintenance eg the VIPP1 protein before precise molecular models of CurTrsquos 488

mode of action can be constructed (Rast et al 2015 and see below) That these other factors 489

can be crucial for membrane architecture is documented by the fact that some marine 490

cyanobacteria such as Prochlorococcus and Synechococcus contain curved thylakoids (but 491

no thylakoid convergence zones at the plasma membrane) although they lack a curT gene 492

493

The role of biogenesis centers 494

The absence of biogenesis centers in the curT- mutant now enables one to answer some 495

questions relating to the role of these thylakoid sub-structures which form in some but not all 496

cyanobacteria (Kunkel 1982 van de Meene et al 2006) First they are not essential since 497

even the curT- mutant still accumulates PSII to ~50 of wild-type levels On the other hand 498

in the mutant assembly of PSII is impaired as revealed by the increased accumulation of early 499

assembly intermediates In addition PSII dimers are almost completely absent in curT- 500

Whether the reduction in PSII dimers is attributable to an assembly problem linked to the 501

absence of biogenesis centers or to a secondary defect in dimer stabilization caused by 502

changes in overall thylakoid membrane ultrastructure remains to be determined Thus 503

biogenesis centers are more likely to represent evolutionary ldquoadd-onsrdquo that facilitated efficient 504

thylakoid biogenesis This is compatible with the fact that some cyanobacteria are devoid of 505

any biogenesis center-related substructures Second their absence compromises PSII but the 506

accumulation of other photosynthetic complexes ie PSI and the Cyt(b6f) complex is not 507

affected by CurT deficiency (Figure 3) This observation agrees with previous findings that 508

neither the PsaA subunit of PSI nor its assembly factor Ycf37 is detectable in isolated PDM 509

fractions (Rengstl et al 2011) 510

In addition to reduced de novo PSII assembly a higher relative stability of D1 in high-511

light experiments has been detected in curT- which suggests that D1 degradation during PSII 512

repair is less efficient in the mutant Photo-damaged D1 is degraded by the FtsH2FtsH3 513

complex which has previously been shown to partly localize to thylakoid convergence zones 514

at the cell periphery ie biogenesis centers (Boehm et al 2012 Sacharz et al 2015) It 515

16

therefore seems possible that the absence of biogenesis centers in curT- leads to 516

mislocalization of the FtsH2FtsH3 complex and less effective D1 degradation 517

Moreover a PSII related-function for CurT is supported by a meta-analysis of the 518

Synechocystis 6803 transcriptome When the CyanoEXpress 22 database (Hernaacutendez-Prieto 519

and Futschik 2012 Hernaacutendez-Prieto et al 2016) was queried for genes co-expressed with 520

curT (slr0483) genes for five PSII subunits ndash psbE psbO psbF psbL and psb30 ndash were 521

found among the first ten hits (Supplemental Table 4) From this we infer that biogenic 522

centers do not play an essential role in the assembly of all photosynthetic complexes but 523

serve to enhance PSII assemblyrepair possibly through the efficient delivery of Mn2+ 524

Residual PSII in curT- cells is likely to be supplied with cytoplasmic Mn2+ via a second 525

independently operating ABC transporter-based system in the plasma membrane named the 526

Mnt pathway (Bartsevich and Pakrasi 1995 Bartsevich and Pakrasi 1996) 527

Formally we cannot exclude that CurT is directly involved in the PSII assembly 528

process However considering CurTrsquos membrane bending capacity and the mutant phenotype 529

(Figure 1D and Figure 2) it appears more likely that CurT forms cellular substructures for 530

efficient PSII biogenesis ie biogenesis centers 531

As mentioned above some ultrastructural features of biogenesis centers have emerged 532

from studies employing EM-based tomography (van de Meene et al 2006) To date however 533

a high-resolution picture of the precise membrane architecture within these centers remains 534

elusive In particular whether or not a direct connection between plasma membrane and 535

thylakoids exists continues to be debated As recently discussed and in line with this gap in 536

knowledge different membrane fractionation techniques have revealed different distributions 537

of PSII-related subunits and assembly factors between plasma and thylakoid membranes 538

(Heinz et al 2016 Liberton et al 2016 Selatildeo et al 2016) The overall picture that emerges 539

is that the initial hypothesis that PSII biogenesis is initiated at the plasma membrane is no 540

longer tenable whereas a specialized thylakoid sub-fraction like the PDMs that make contact 541

with the plasma membrane could explain many of the available data and thus clarify some 542

aspects of the debate (Zak et al 2001 Pisareva et al 2011 Rast et al 2015) Moreover it 543

has previously been hypothesized that ldquoribosome-decorated membrane-like complexesrdquo 544

forming at the innermost thylakoid sheet might represent biogenic compartments (van de 545

Meene et al 2006 Mullineaux 2008) Whether these structures are affected in curT- cannot 546

be judged based on our TEM analysis but requires ultrastructural data of higher resolution 547

However the accessibility of thylakoids for ribosomes should be increased in the less 548

compressed membrane system of curT- (Figure 2B-D) 549

17

A scenario similar to that of Synechocystis 6803 holds for the situation in chloroplasts 550

of the green alga Chlamydomonas reinhardtii in which de novo PSII biogenesis has been 551

shown to be initiated in punctate regions named T-zones located close to the pyrenoid 552

(Uniacke and Zerges 2007) Unlike the mRNAs for the PSII components neither RNAs for 553

PSI subunits nor PSI assembly factors are localized to T-zones indicating that PSI and PSII 554

assembly processes are spatially separated (Uniacke and Zerges 2009 Nickelsen and Zerges 555

2013 Rast et al 2015) Interestingly a recent cryoelectron tomography study demonstrated 556

that next to T-zones at the chloroplast base-lobe junction the inner chloroplast envelope 557

exhibits invaginationsconnections to thylakoids that structurally resemble the organization of 558

cyanobacterial biogenesis centers (Engel et al 2015) For future investigations it will be 559

interesting to see if a homolog of the CURT1 family is involved in the formation of these 560

structures in C reinhardtii 561

562

Evolution of CURT1 function 563

Homologs of the CURT1 protein family can be found throughout cyanobacteria green 564

algae and plants (Armbruster et al 2013) The Arabidopsis CURT1A-D proteins have 565

recently been shown to induce bending of thylakoid membranes at grana margin regions 566

(Armbruster et al 2013) Interestingly and in contrast to the situation in Synechocystis 6803 567

their inactivation did not result in severe photosynthetic deficiencies although the thylakoids 568

formed lacked defined grana stacks Nevertheless the data available support the idea that the 569

function of thylakoid membrane structures that were regarded as being independent ie 570

cyanobacterial biogenesis centers and grana are closely related Intriguingly both of these 571

thylakoid membrane structures are dedicated to aspects of PSII function but do not involve 572

PSI (Pribil et al 2014) In both the prokaryotic and eukaryotic systems CURT1 homologs 573

appear to bend thylakoid membranes as indicated by (i) the distortion of membrane 574

ultrastructure seen in mutants devoid of curved thylakoids (ii) the localization of CURT1 575

homologs at grana margins and their local concentration at biogenesis centers (iii) the in vitro 576

membrane-curving activity of both CURT forms The phenotypic differences between 577

A thaliana and Synechocystis 6803 mutants may however be attributable to the different 578

functions of the membrane sub-compartments affected in the two model organisms Whereas 579

the role of grana is still under debate one function of the cyanobacterial biogenesis centers is 580

the above-mentioned high-throughput uptake of Mn2+ ions for efficient assembly of PSII 581

(Stengel et al 2012 Nickelsen and Rengstl 2013 Pribil et al 2014) However it appears 582

that in both cases the primary function of CURT1 proteins is to generate curved membrane 583

18

regions These discoveries suggest that until now two independently observed structures ie 584

cyanobacterial thylakoid biogenesis centers and chloroplast grana regions are closely related 585

The degree of curvature is much less pronounced in the cyanobacterial system As previously 586

discussed it was probably the subsequent evolution of a membrane-localized light-harvesting 587

system in chloroplasts that made the formation of tightly curved grana thylakoids possible 588

(Mullineaux 2005 Nevo et al 2012 Pribil et al 2014) 589

590

CurT is involved in osmotic stress response 591

One unexpected phenotype of the curT- mutant is its sensitivity to osmotic stress 592

These data revealed that in addition to shaping membranes CurT also influences their 593

functional integrity This latter function might be intrinsic to CurT or could be mediated by 594

the VIPP1 protein which has been shown to be required for membrane maintenance in 595

bacteria and chloroplasts probably by acting as a supplier of lipids (for an overview see 596

Zhang and Sakamoto 2015) Both factors accumulate in the plasma membrane upon osmotic 597

stress but VIPP1 localization is not severely affected by CurT inactivation which suggests 598

that VIPP1 operates independently of CurT In agreement with this repeated co-599

immunoprecipitations revealed no interaction between both proteins Therefore it remains to 600

be established whether a direct functional relationship between them exists 601

Previous investigations of osmotic stress in Synechocystis 6803 showed a kidney-602

shaped form of wild-type cells under very high concentrations of osmotically active 603

compounds (Marin et al 2006) The cells were severely deformed indicating changes in the 604

structure of the cellular envelope Since CurT shifts towards the plasma membrane already 605

under lower osmolyte concentrations we suggest a stabilizing function of CurT in the plasma 606

membrane CurT might be necessary to tolerate the forces trying to deform the cells under 607

osmotic stress 608

In conclusion this analysis has identified a crucial determinant for shaping and 609

maintaining the cyanobacterial thylakoid membrane system ie CurT a homolog of the 610

grana-forming CURT1 protein family from A thaliana In particular CurT is involved in the 611

formation of specific thylakoid substructures close to the plasma membrane at which PSII is 612

assembledrepaired Future work will dissect the precise ultrastructure of these centers and 613

enable us to elaborate a molecular model for the spatiotemporal organization of PSII assembly 614

in cyanobacteria 615

616

19

Methods 617

Strains and growth conditions 618

Wild-type and mutant Synechocystis 6803 cells were grown on solid or in liquid BG 619

11 medium (Rippka et al 1979) supplemented with 5 mM glucose (unless indicated 620

otherwise) at 30degC under continuous illumination at a photon irradiance of 30 μmol m-2 s-1 of 621

white light For growth during high-light experiments for investigation of D1 repair cells 622

were cultivated in a FMT150 photobioreactor (Photon Systems Instruments Draacutesov Czech 623

Republic) at 800 micromol photons m-2 s-1 in the presence or absence of lincomycin (100 microgml) 624

Cell density was monitored photometrically at 750 nm Doubling times were determined after 625

two days of growth To generate the insertion mutant curT- the curT gene (slr0483) was first 626

amplified from wild-type genomic DNA by PCR using the primer pair 04835 627

(GAAGCCTATTTAGCTAAGGCCGAAAG) and 04833 628

(TAGTACCTGGTCTTCCATGGCGT) and the resulting fragment was cloned into the 629

Bluescript pKS vector (Stratagene Waldbronn Germany) A kanamycin resistance cassette 630

was then inserted into the single AgeI restriction site (159 bp downstream of the start codon) 631

and this disruption construct was used to replace the wild-type gene as described (Wilde et al 632

2001) 633

634

Bioinformatic and computational analysis 635

CURT1 sequences of Synechocystis 6803 were obtained from CyanoBase 636

(httpgenomekazusaorjpcyanobaseSynechocystis) and CURT1 homologs in other 637

organisms were retrieved from NCBIBLAST (httpblastncbinlmnihgovBlastcgi) 638

Numbers and positions of putative transmembrane domains in the predicted proteins were 639

determined with TMHMM20 (httpwwwcbsdtudkservicesTMHMM) The sequence for 640

the N-terminal amphipathic helix was predicted by Jpred 3 641

(httpwwwcompbiodundeeacukwww-jpred) and plotted using a helical wheel projection 642

script (httprzlabucreduscriptswheelwheelcgi) The programs ClustalW2 643

(httpwwwebiacuktoolsclustalw2) and GeneDoc (httpwwwpscedubiomedgenedoc) 644

were used to generate multiple alignments of amino acid sequences Quantitative analysis of 645

immunoblots was performed with the AIDA Image Analyzer V325 (Raytest 646

Isotopenmessgeraumlte GmbH Straubenhardt Germany) 647

Co-expression patterns of curT were analyzed using the CyanoEXpress 22 database 648

(httpcyanoexpresssysbiolabeu Hernaacutendez-Prieto and Futschik 2012 Hernaacutendez-Prieto et 649

al 2016) 650

20

651

Measurement of chlorophyll concentration and oxygen production 652

Determination of chlorophyll content was carried out according to Wellburn and 653

Lichtenthaler (1984) For oxygen evolution measurements cells were grown in BG-11 654

without glucose harvested in mid-log phase and diluted to an OD750 nm = 05 Oxygen 655

evolution rates were measured with a Clark-type oxygen electrode (Hansatech Instruments 656

Ltd Kingrsquos Lynn Norfolk UK) at 1000 micromol photons m-2 s-1 (cool white light) after 5 min of 657

dark acclimation Oxygen evolution under saturating light conditions was measured without 658

any additives 659

660

Cell size and cell number estimation 661

Synechocystis 6803 strains were grown in liquid BG11 media containing 5 mM 662

glucose For cell size estimation the cells were analyzed with a confocal laser scanning 663

microscope TCS SP5 (Leica Wetzlar Germany) The diameter of the cells was measured 664

with the LAS AF Lite software (Leica Wetzlar Germany) Cells that were about to divide 665

were not taken into account For the determination of cell number cultures were set to an 666

OD750 = 1 and analyzed by using a Neubauer counting chamber (Paul Marienfeld GmbH amp 667

Co KG Lauda-Koumlnigshofen Germany) Statistical significance was determined by Studentrsquos 668

t-test 669

670

Measurements of P700+ reduction kinetics and relative electron transport rates 671

P700+ reduction kinetics and changes in chlorophyll fluorescence yield at different 672

light intensities were measured at a chlorophyll concentration of 5 microgml with a Dual-PAM-673

100 instrument (Heinz Walz GmbH Effeltrich Germany) Complete P700 oxidation was 674

achieved by a 50-ms multiple turnover pulse (10000 micromol photons m-2 s-1) after 2 min of dark 675

incubation P700+ reduction kinetics were recorded without any additions as well as in the 676

presence of 10 microM DCMU Ten technical replicates were averaged and fitted with single 677

exponential functions Data interpretation was done according to Bernaacutet et al (2009) 678

Light saturation measurements were performed according to Xu et al (2008) The 679

actinic light intensity was increased stepwise from 0 to 665 micromol photons m-2 s-1 with 30-s 680

adaptation periods Maximal fluorescence yields were obtained by applying saturating light 681

pulses (duration 600 ms intensity 10000 micromol photons m-2 s-1) 682

683

Low-temperature fluorescence measurements 684

21

Fluorescence emission spectra were measured with an AMINCO Bowman Series 2 685

Luminescence Spectrometer Wild-type and curT- cells were grown in the presence of 5 mM 686

glucose to mid log-phase and concentrated to 25 microgml chlorophyll adding 2 microM fluorescein 687

as an internal standard Samples (1 ml) were transferred to thin glass tubes dark-adapted for 688

30 min at 30 degC and shock frozen in liquid N2 To quantify chlorophyllfluorescein and 689

phycobilisome-mediated fluorescence samples were excited and emission recorded at 440 690

nm510 nm (chlorophyll and fluorescein excitationmax fluorescein emission) and 580 691

nm685 nm respectively Emission was scanned at 490-800 nm or at 640-800 nm 692

respectively 693

694

Antibody production and protein analysis 695

For generation of an αCurT antibody the N-terminal coding region of curT (amino 696

acid positions 1-58) was amplified by PCR using primers N04835 697

(AAGGATCCGTGGGCCGTAAACATTCAA) and N04833 698

(AAGTCGACGCACTTCCCACACCGGTTGTA) and cloned into the BamHI and XhoI sites 699

of the pGEX-4T-1 vector (GE Healthcare Freiburg Germany) Expression of the GST fusion 700

protein in Escherichia coli BL21(DE3) and subsequent affinity purification on Glutathione-701

Sepharose 4B (GE Healthcare) were carried out as described (Schottkowski et al 2009b) A 702

polyclonal antiserum was raised against this protein fragment in rabbits (Pineda Berlin 703

Germany) Other primary antibodies used in this study have been described previously ie 704

αpD1 (Schottkowski et al 2009b) αD1 (Schottkowski et al 2009b) αD2 (Klinkert et al 705

2006) αPratA (Klinkert et al 2004) αYcf48 (Rengstl et al 2011) αPitt (Schottkowski et 706

al 2009a) αPOR (Schottkowski et al 2009a) αYidC (Ossenbuumlhl et al 2006) αVIPP1 707

(Aseeva et al 2007) αSll0933 (Armbruster et al 2010) and αSlr0151 (Rast et al 2016) or 708

were purchased from Agrisera (Vaumlnnaumls Sweden) ie αCP43 αCP47 αPsaA αCyt f 709

αRbcL αIsiA The αGFP-HRP antibody was acquired from Miltenyi Biotech (Bergisch 710

Gladbach Germany) 711

Protein concentrations were determined according to Bradford (1976) using RotiQuant 712

(Carl Roth GmbH amp Co KG Karlsruhe Germany) Protein extraction membrane 713

fractionation on sucrose-density gradients and quantification of Western signal intensities was 714

performed as described previously (Rengstl et al 2011) Solubility properties of CurT were 715

determined according to Schottkowski et al (2009a) 716

22

Sucrose-density centrifugation separating PDM and thylakoid membrane fractions by 717

two consecutive gradients was carried out as described previously (Schottkowski et al 718

2009b Rengstl et al 2011) 719

Two-dimensional fractionations of cyanobacterial membrane proteins via BNSDS-720

PAGE and of pulse-labeled proteins by BNSDS-PAGE were performed as previously 721

reported (Klinkert et al 2004 Schottkowski et al 2009b Rengstl et al 2013) For the 722

analysis of native complexes in fractions obtained by sucrose-density centrifugation the 723

volume corresponding to 350 microg of protein in fraction 7 was applied to BNSDS-PAGE 724

For isoelectric focusing (IEF) the volume corresponding to 50 microg of protein from 725

fraction 7 in 200 microl of IEF buffer (8 M urea 4 CHAPS 1 IPG buffer pH 4-7 (GE 726

Healthcare)) was applied to an 11-cm Immobiline DryStrip pH 4-7 (GE Healthcare) in a 727

Protean IEF Cell (Bio-Rad Munich Germany) Strips were rehydrated for 12 h at 20 degC and 728

50V Focusing was carried out in the following steps 500 V rapid 1500 Vh 1000 V linear 729

880 Vh 6000 V linear 9680 Vh 6000 V rapid 5390 Vh 50 microA per gel focus temperature 730

20degC Subsequently the strips were incubated in equilibration buffer I (6 M urea 0375 M 731

Tris pH 88 20 glycerol 2 SDS 2 DTT) and equilibration buffer II (6 M urea 0375 732

M Tris pH 88 20 glycerol 2 SDS 25 iodoacetamide) for 10 min in each buffer 733

Then the IEF strips were applied to second-dimension SDS-PAGE 734

735

Transmission electron microscopy and immunogold labeling 736

Sample preparation for transmission electron microscopy including freeze substitution 737

and immunogold labeling of CurT was performed as described previously (Stengel et al 738

2012) Ultrathin sections were cut to thicknesses of 35 - 45 nm and 45 - 65 nm for 739

ultrastructural analyses and immunogold labeling respectively For immunogold labeling 740

sections collected on collodion-coated Ni grids were incubated for 18 h at 4degC with (rabbit) 741

αCurT (diluted 1100 1500 11000 or 14000 in blocking buffer (5 fetal calf serum) with 742

005 Tween 20) and further processed as described previously (Stengel et al 2012) As a 743

negative control wild-type Synechocystis 6803 cells were incubated without the primary 744

antibody and exposed to the gold-labeled anti-rabbit IgG To image the ultrastructure and the 745

immunogold-treated samples a Fei Morgagni 268 transmission electron microscope was used 746

and micrographs were taken at 80 kV 747

To avoid errors in the interpretation of the immunogold labeling experiment only 748

signals which were unambiguously localized to distinctly visible thylakoid membranes were 749

taken into account For each cell different regions (see Figure 10F) were defined and in each 750

23

region the signals on the convex and concave sides of the thylakoid membrane were analyzed 751

separately (see Supplemental Figure 11 for representative counts) Statistical significance was 752

assessed by χ2 test (Zoumlfel 1988) 753

For the analysis of clusters of CurT signals in biogenesis centers a cluster was defined 754

as a minimum of four signals in close proximity Overall 219 biogenesis centers were 755

examined with regard to CurT cluster formation 756

757

Preparation of proteoliposomes 758

Liposomes with a lipid mixture of 25 monogalactosyl diacylglycerol 42 759

digalactosyl diacylglycerol 16 sulfoquinovosyl diacylglycerol and 17 760

phosphatidylglycerol (Lipid Products South Nutfield UK) were prepared as described 761

previously (Armbruster et al 2013) To generate proteoliposomes CurT and CURT1A 762

proteins were expressed in the presence of liposomes for 3 h at 37degC using a PURExpress In 763

Vitro Protein Synthesis Kit (New England Biolabs Ipswich MA USA) The liposomes were 764

separated from the mix by centrifugation in a discontinuous sucrose gradient (100000 g 18 765

h) Subsequently the fraction containing the liposomes was extracted and dialyzed against 20 766

mM HEPES (pH 76) For transmission electron microscopy the proteoliposomes were 767

negatively stained with 1 uranyl acetate on a carbon-coated copper grid Micrographs were 768

taken on a Fei Morgagni 268 TEM at 80 kV 769

770

curT-CFP strain generation 771

Gibson assembly was used for single-step cloning (Gibson 2011) of the slr0483 gene 772

(together with its ~08 kb upstream region) the mTurquoise2 gene fragment the gentamycin-773

resistance cassette (aacC1) and an ~17-kb downstream region of slr0483 into pBR322 774

cleaved with EcoRV and NheI The slr0483 gene was fused in frame to the codon-optimized 775

mTurquoise2 (DNA20) preceded by a linker sequence encoding GSGSG The resulting 776

plasmid was used to transform Synechocystis 6803 as described previously (Zang et al 2007) 777

After ~ 10 days of incubation on BG11-GelRite (15 ) medium in the presence of 2 microgml 778

gentamycin several antibiotic resistant colonies were obtained and streaked out on fresh 779

medium These transformants were then tested for full segregation of the tagged allele by 780

colony PCR with primers flanking the slr0483 gene 781

782

Fluorescence microscopy 783

24

An aliquot of a cell suspension in mid-log phase was placed under a BG11-agarose 784

pad on a glass coverslip (15) and imaged on an inverted microscope (Zeiss 785

AxioObserverZ1) equipped with an ORCA Flash40 V2 (Hamamatsu) camera a Lumenecor 786

SOLA II Light Engine and a Plan-Apochromat 63x140 Oil DIC M27 (NA 14) objective 787

(Zeiss) Image acquisition was done with Zen 21 software in cyan and far-red fluorescence 788

channels (Zeiss Filter Sets 47 HE and 50) as Z-series with a step size of 250 nm and effective 789

pixel size of 103 nm Acquired image files were subsequently deconvolved (Constrained 790

Iterative Method) using a default theoretical Point Spread Function in Zen 20 (Zeiss) 791

Extraction of intensities for line profiles was performed by image thresholding the thylakoid 792

autofluorescence channel and eroding the resulting binary mask in Fiji (Schindelin et al 793

2012) 794

For immunofluorescence analysis cells were grown to mid-log phase as in the case of 795

the cells prepared for live-cell microscopy A 10-ml culture was fixed for 20 min in 37 796

formaldehyde and following extensive washing with phosphate-buffered saline (PBS) cells 797

were first permeabilized in 005 Triton-X for 20 min and then in lysis buffer (50 mM Tris-798

HCl 100 mM NaCl 5 mgml lysozyme) at 37degC for 2 h with gentle shaking To block 799

unspecific binding sites the cell pellet was incubated in 5 bovine serum albumin in PBS at 800

30degC for 1 h The αCurT serum (1500 dilution) was added to cells in fresh blocking buffer 801

for 1 h at 30degC with gentle shaking Cells were then washed three times with blocking buffer 802

and incubated with goat anti-rabbit IgG secondary antibodies conjugated to Oregon Green 488 803

(Invitrogen) (11000 dilution) under the conditions as for the primary antibodies Cells were 804

washed three times with PBS and prepared for microscopy as above Imaging was done as 805

described for live-cell microscopy except that a Colibri2 LED light source was employed for 806

illumination and a CoolSnap HQ camera (Photometrics) was used for image acquisition Cells 807

were imaged as Z-series (step size 280 nm) in the yellow and far-red fluorescent channels 808

(Zeiss Filter Sets 46 HE and 50) using the 505 nm and 625 nm LED modules Effective pixel 809

size in the final image was 102 nm Deconvolution and image analysis was done as described 810

above As judged by the staining intensity of the Oregon Green-conjugated antibodies 811

approximately half of the cells in any given field of view appeared to have been successfully 812

permeabilised a rate that is common in our experience No significant signal was detected in 813

the control sample that had not been exposed to the primary antibodies 814

815

25

Accession numbers 816

Sequence data from this article can be found in the CyanoBase and EMBLGenBank 817

data libraries under accession number slr0483 818

819

Supplemental Data 820

Supplemental Figure 1 Construction of the curT- mutant 821

Supplemental Figure 2 Growth phenotype of curT- 822

Supplemental Figure 3 Expression analysis of the open reading frame slr0482 (located 823

upstream of curT) in the curT- strain 824

Supplemental Figure 4 Absorbance spectra of curT- and wild-type cells 825

Supplemental Figure 5 High-light growth phenotypes of wild-type Synechocystis 6803 and 826

the curT- strain 827

Supplemental Figure 6 Ultrastructure of the TD41 mutant which lacks the psbA transcript 828

and the D1 protein 829

Supplemental Figure 7 Expression and localization of CurT-CFP 830

Supplemental Figure 8 Localization of CurT and CurT-CFP by fluorescence microscopy 831

Supplemental Figure 9 Chlorophyll autofluorescence of curT- 832

Supplemental Figure 10 The curT- mutant as a negative control for immunogold labeling 833

Supplemental Figure 11 Representative counts of immunogold signals 834

Supplemental Table 1 Overview of immunogold signals in curT- cells 835

Supplemental Table 2 Overview of immunogold signals in specific regions of Synechocystis 836

6803 wild-type cells 837

Supplemental Table 3 Statistical analysis of immunogold signals for wild-type 838

Synechocystis 6803 cells 839

Supplemental Table 4 Co-expression of curT 840

Supplemental Movie 1 Scan through the Z-axis of a curT-CFP cell 841

Supplemental Movie 2 Rendered 3D-model of a CurT-CFP detection 842

Supplemental Movie 3 Scan through the Z-axis of a curT-CFP cell with a traversing 843

thylakoid lamella 844

845

Acknowledgements 846

We thank Y Nishiyama for providing αpD1 and J Soll for αVIPP1 and αYidC antibodies 847

respectively and Nina Dyczmons-Nowaczyk for support with the fluorescence measurements 848

This work was supported by grants awarded to JN (Ni3909) MMN (NO 8363) and DL 849

26

(Le126529) by the Deutsche Forschungsgemeinschaft in the context of Research Unit 850

FOR2092 and the Cluster of Excellence RESOLV (EXC 1069) AG is a Howard Hughes 851

Medical Institute postdoctoral fellow in the laboratory of Erin OrsquoShea at Harvard University 852

LS was supported by a PhD fellowship from the Chinese Scholarship Council 853

854

Author Contributions 855

SH AR LS MMN DL and JN designed the research SH AR LS AG ILG EH ML BR 856

SV performed the research all authors contributed to data analysis SH AR and JN wrote the 857

paper 858

859

Competing Financial Interest statement 860

The authors declare no competing financial interests 861

862

We wish to dedicate this paper to Fabrice Rappaport an outstanding colleague and friend who 863

passed away so early 864

865

27

References 866

Allen JF de Paula WBM Puthiyaveetil S and Nield J (2011) A structural 867

phylogenetic map for chloroplast photosynthesis Trends Plant Sci 16 645-655 868

Anderson JM Horton P Kim E-H and Chow WS (2012) Towards elucidation of 869

dynamic structural changes of plant thylakoid architecture Philos Trans R Soc 870

Lond B Biol Sci 367 3515-3524 871

Armbruster U Zuumlhlke J Rengstl B Kreller R Makarenko E Ruumlhle T Schuumlnemann 872

D Jahns P Weisshaar B Nickelsen J and Leister D (2010) The Arabidopsis 873

thylakoid protein PAM68 is required for efficient D1 biogenesis and photosystem II 874

assembly Plant Cell 22 3439-3460 875

Armbruster U Labs M Pribil M Viola S Xu W Scharfenberg M Hertle AP 876

Rojahn U Jensen PE Rappaport F Joliot P Doumlrmann P Wanner G and 877

Leister D (2013) Arabidopsis CURVATURE THYLAKOID1 proteins modify 878

thylakoid architecture by inducing membrane curvature Plant Cell 25 2661-2678 879

Aseeva E Ossenbuumlhl F Sippel C Cho WK Stein B Eichacker LA Meurer J 880

Wanner G Westhoff P Soll J and Vothknecht UC (2007) Vipp1 is required for 881

basic thylakoid membrane formation but not for the assembly of thylakoid protein 882

complexes Plant Physiol Biochem 45 119-128 883

Bartsevich VV and Pakrasi HB (1995) Molecular identification of an ABC transporter 884

complex for manganese analysis of a cyanobacterial mutant strain impaired in the 885

photosynthetic oxygen evolution process EMBO J 14 1845-1853 886

Bartsevich VV and Pakrasi HB (1996) Manganese transport in the cyanobacterium 887

Synechocystis sp PCC 6803 J Biol Chem 271 26057-26061 888

Bernaacutet G Waschewski N and Roumlgner M (2009) Towards efficient hydrogen production 889

the impact of antenna size and external factors on electron transport dynamics in 890

Synechocystis PCC 6803 Photosynth Res 99 205-216 891

Boehm M Yu J Krynicka V Barker M Tichy M Komenda J Nixon PJ and Nield 892

J (2012) Subunit Organization of a Synechocystis Hetero-Oligomeric Thylakoid FtsH893

Complex Involved in Photosystem II Repair Plant Cell 24 3669-3683894

Bradford MM (1976) A rapid and sensitive method for the quantitation of microgram 895

quantities of protein utilizing the principle of protein-dye binding Anal Biochem 72 896

248-254897

28

Chang L Liu X Li Y Liu C-C Yang F Zhao J and Sui S-F (2015) Structural 898

organization of an intact phycobilisome and its association with photosystem II Cell 899

Res 25 726-737 900

Danielsson R Suorsa M Paakkarinen V Albertsson P-Aring Styring S Aro E-M and 901

Mamedov F (2006) Dimeric and monomeric organization of photosystem II 902

Distribution of five distinct complexes in the different domains of the thylakoid 903

membrane J Biol Chem 281 14241-14249 904

Daum B Nicastro D Austin J McIntosh JR and Kuumlhlbrandt W (2010) Arrangement 905

of photosystem II and ATP synthase in chloroplast membranes of Spinach and Pea 906

Plant Cell 22 1299-1312 907

Engel BD Schaffer M Kuhn Cuellar L Villa E Plitzko JM and Baumeister W 908

(2015) Native architecture of the Chlamydomonas chloroplast revealed by in situ 909

cryo-electron tomography eLife 4 e04889 910

Ford MGJ Mills IG Peter BJ Vallis Y Praefcke GJK Evans PR and McMahon 911

HT (2002) Curvature of clathrin-coated pits driven by epsin Nature 419 361-366 912

Fristedt R Willig A Granath P Cregravevecoeur M Rochaix J-D and Vener AV (2009) 913

Phosphorylation of photosystem II controls functional macroscopic folding of 914

photosynthetic membranes in Arabidopsis Plant Cell 21 3950-3964 915

Gallop JL and McMahon HT (2005) BAR domains and membrane curvature bringing 916

your curves to the BAR Biochem Soc Symp 72 223-231 917

Gibson DG (2011) Chapter fifteen - Enzymatic Assembly of Overlapping DNA Fragments 918

In Methods in Enzymology V Christopher ed (Academic Press) pp 349-361 919

Goedhart J von Stetten D Noirclerc-Savoye M Lelimousin M Joosen L Hink MA 920

van Weeren L Gadella TWJ and Royant A (2012) Structure-guided evolution of 921

cyan fluorescent proteins towards a quantum yield of 93 Nat Commun 3 751 922

Heinz S Liauw P Nickelsen J and Nowaczyk M (2016) Analysis of photosystem II 923

biogenesis in cyanobacteria Biochim Biophys Acta 1857 274-287 924

Hernaacutendez-Prieto M and Futschik M (2012) CyanoEXpress A web database for 925

exploration and visualisation of the integrated transcriptome of cyanobacterium 926

Synechocystis sp PCC6803 Bioinformation 8 634-638 927

Hernaacutendez-Prieto MA Semeniuk TA Giner-Lamia J and Futschik ME (2016) The 928

Transcriptional Landscape of the Photosynthetic Model Cyanobacterium 929

Synechocystis sp PCC6803 Sci Rep 6 22168 930

29

Huang F Fulda S Hagemann M and Norling B (2006) Proteomic screening of salt-931

stress-induced changes in plasma membranes of Synechocystis sp strain PCC 6803 932

Proteomics 6 910-920 933

Kirchhoff H (2013) Architectural switches in plant thylakoid membranes Photosynth Res 934

116 481-487 935

Klinkert B Elles I and Nickelsen J (2006) Translation of chloroplast psbD mRNA in 936

Chlamydomonas is controlled by a secondary RNA structure blocking the AUG start 937

codon Nucleic Acids Res 34 386-394 938

Klinkert B Ossenbuumlhl F Sikorski M Berry S Eichacker L and Nickelsen J (2004) 939

PratA a periplasmic tetratricopeptide repeat protein involved in biogenesis of 940

photosystem II in Synechocystis sp PCC 6803 J Biol Chem 279 44639-44644 941

Komenda J Nickelsen J Tichyacute M Praacutešil O Eichacker LA and Nixon PJ (2008) The 942

cyanobacterial homologue of HCF136YCF48 is a component of an early photosystem 943

II assembly complex and is important for both the efficient assembly and repair of 944

photosystem II in Synechocystis sp PCC 6803 J Biol Chem 283 22390-22399 945

Kopf M Klaumlhn S Scholz I Matthiessen JKF Hess WR and Voszlig B (2014) 946

Comparative analysis of the primary transcriptome of Synechocystis sp PCC 6803 947

DNA Res 21 527-539 948

Kunkel DD (1982) Thylakoid centers Structures associated with the cyanobacterial 949

photosynthetic membrane system Arch Microbiol 133 97-99 950

Liberton M Howard Berg R Heuser J Roth R and Pakrasi BH (2006) Ultrastructure 951

of the membrane systems in the unicellular cyanobacterium Synechocystis sp strain 952

PCC 6803 Protoplasma 227 129-138 953

Liberton M Saha R Jacobs JM Nguyen AY Gritsenko MA Smith RD 954

Koppenaal DW and Pakrasi HB (2016) Global Proteomic Analysis Reveals an 955

Exclusive Role of Thylakoid Membranes in Bioenergetics of a Model 956

Cyanobacterium Mol Cell Proteomics 15 2021-2032 957

Luque I and Ochoa de Alda JAG (2014) CURT1CAAD-containing aaRSs thylakoid 958

curvature and gene translation Trends Plant Sci 19 63-66 959

Marin K Stirnberg M Eisenhut M Kraumlmer R and Hagemann M (2006) Osmotic stress 960

in Synechocystis sp PCC 6803 low tolerance towards nonionic osmotic stress results 961

from lacking activation of glucosylglycerol accumulation Microbiology 152 2023-962

2030 963

Mullineaux CW (2005) Function and evolution of grana Trends Plant Sci 10 521-525 964

30

Mullineaux CW (2008) Biogenesis and dynamics of thylakoid membranes and the 965

photosynthetic apparatus In The Cyanobacteria A Herrero and E Flores eds 966

(Norfolk UK Caister Academic Press) pp 289ndash304 967

Nevo R Charuvi D Tsabari O and Reich Z (2012) Composition architecture and 968

dynamics of the photosynthetic apparatus in higher plants Plant J 70 157-176 969

Nickelsen J and Rengstl B (2013) Photosystem II assembly From cyanobacteria to plants 970

Annu Rev Plant Biol 64 609-635 971

Nickelsen J and Zerges W (2013) Thylakoid biogenesis has joined the new era of bacterial 972

cell biology Front Plant Sci 4 458 973

Nilsson F Simpson DJ Jansson C and Andersson B (1992) Ultrastructural and 974

biochemical characterization of a Synechocystis 6803 mutant with inactivated psbA 975

genes Arch Biochem Biophys 295 340-347 976

Odom WR Hodges R Chitnis PR and Guikema JA (1993) Characterization of 977

Synechocystis sp PCC 6803 in iron-supplied and iron-deficient media Plant Mol 978

Biol 23 1255-1264 979

Ossenbuumlhl F Inaba-Sulpice M Meurer J Soll J and Eichacker LA (2006) The 980

Synechocystis sp PCC 6803 Oxa1 homolog is essential for membrane integration of 981

reaction center precursor protein pD1 Plant Cell 18 2236-2246 982

Pisareva T Kwon J Oh J Kim S Ge C Wieslander Aring Choi J-S and Norling B 983

(2011) Model for Membrane Organization and Protein Sorting in the Cyanobacterium 984

Synechocystis sp PCC 6803 Inferred from Proteomics and Multivariate Sequence 985

Analyses J Proteome Res 10 3617-3631 986

Pribil M Labs M and Leister D (2014) Structure and dynamics of thylakoids in land 987

plants J Exp Bot 65 1955-1972 988

Rast A Heinz S and Nickelsen J (2015) Biogenesis of thylakoid membranes Biochim 989

Biophys Acta 1847 821-830 990

Rast A Rengstl B Heinz S Klingl A and Nickelsen J (2016) The role of Slr0151 a 991

tetratricopeptide repeat protein from Synechocystis sp PCC 6803 during Photosystem 992

II assembly and repair Front Plant Sci 7 605 993

Rengstl B Oster U Stengel A and Nickelsen J (2011) An Intermediate Membrane 994

Subfraction in Cyanobacteria Is Involved in an Assembly Network for Photosystem II 995

Biogenesis J Biol Chem 286 21944-21951 996

31

Rengstl B Knoppovaacute J Komenda J and Nickelsen J (2013) Characterization of a 997

Synechocystis double mutant lacking the photosystem II assembly factors YCF48 and 998

Sll0933 Planta 237 471-480 999

Rexroth S Mullineaux CW Ellinger D Sendtko E Roumlgner M and Koenig F (2011) 1000

The Plasma Membrane of the Cyanobacterium Gloeobacter violaceus Contains 1001

Segregated Bioenergetic Domains Plant Cell 23 2379-2390 1002

Rippka R Deruelles J Waterbury JB Herdman M and Stanier RY (1979) Generic 1003

Assignments Strain Histories and Properties of Pure Cultures of Cyanobacteria 1004

Microbiology 111 1-61 1005

Ruumltgers M and Schroda M (2013) A role of VIPP1 as a dynamic structure within 1006

thylakoid centers as sites of photosystem biogenesis Plant Signal Behav 8 e27037 1007

Sacharz J Bryan SJ Yu J Burroughs NJ Spence EM Nixon PJ and Mullineaux 1008

CW (2015) Sub-cellular location of FtsH proteases in the cyanobacterium1009

Synechocystis sp PCC 6803 suggests localised PSII repair zones in the thylakoid1010

membranes Mol Microbiol 96 448-4621011

Sandstroumlm S Park Y-I Oumlquist G and Gustafsson P (2001) CP43prime the isiA Gene 1012

Product Functions as an Excitation Energy Dissipator in the Cyanobacterium 1013

Synechococcus sp PCC 7942 Photochem Photobiol 74 431-437 1014

Schindelin J Arganda-Carreras I Frise E Kaynig V Longair M Pietzsch T 1015

Preibisch S Rueden C Saalfeld S Schmid B Tinevez J-Y White DJ 1016

Hartenstein V Eliceiri K Tomancak P and Cardona A (2012) Fiji an open-1017

source platform for biological-image analysis Nat Methods 9 676-682 1018

Schottkowski M Ratke J Oster U Nowaczyk M and Nickelsen J (2009a) Pitt a novel 1019

tetratricopeptide repeat protein involved in light-dependent chlorophyll biosynthesis 1020

and thylakoid membrane biogenesis in Synechocystis sp PCC 6803 Mol Plant 2 1021

1289-1297 1022

Schottkowski M Gkalympoudis S Tzekova N Stelljes C Schuumlnemann D Ankele E 1023

and Nickelsen J (2009b) Interaction of the periplasmic PratA factor and the PsbA 1024

(D1) protein during biogenesis of photosystem II in Synechocystis sp PCC 6803 J 1025

Biol Chem 284 1813-1819 1026

Selatildeo TT Zhang L Knoppovaaacute J Komenda J and Norling B (2016) Photosystem II 1027

Assembly Steps Take Place in the Thylakoid Membrane of the Cyanobacterium 1028

Synechocystis sp PCC6803 Plant Cell Physiol 57 878 1029

32

Spaumlt P Maček B and Forchhammer K (2015) Phosphoproteome of the cyanobacterium 1030

Synechocystis sp PCC 6803 and its dynamics during nitrogen starvation Front 1031

Microbiol 6 248 1032

Stengel A Guumlgel IL Hilger D Rengstl B Jung H and Nickelsen J (2012) Initial 1033

steps of photosystem II de novo assembly and preloading with manganese take place 1034

in biogenesis centers in Synechocystis Plant Cell 24 660-675 1035

Uniacke J and Zerges W (2007) Photosystem II assembly and repair are differentially 1036

localized in Chlamydomonas Plant Cell 19 3640-3654 1037

Uniacke J and Zerges W (2009) Chloroplast protein targeting involves localized 1038

translation in Chlamydomonas Proc Natl Acad Sci USA 106 1439-1444 1039

van de Meene AL Hohmann-Marriott M Vermaas WJ and Roberson R (2006) The 1040

three-dimensional structure of the cyanobacterium Synechocystis sp PCC 6803 Arch 1041

Microbiol 184 259-270 1042

van de Meene AML Sharp WP McDaniel JH Friedrich H Vermaas WFJ and 1043

Roberson RW (2012) Gross morphological changes in thylakoid membrane 1044

structure are associated with photosystem I deletion in Synechocystis sp PCC 6803 1045

Biochim Biophys Acta 1818 1427-1434 1046

Watanabe M and Ikeuchi M (2013) Phycobilisome architecture of a light-harvesting 1047

supercomplex Photosynth Res 116 265-276 1048

Wellburn AR and Lichtenthaler H (1984) Formulae and Program to Determine Total 1049

Carotenoids and Chlorophylls A and B of Leaf Extracts in Different Solvents In 1050

Advances in Photosynthesis Research Proceedings of the VIth International Congress 1051

on Photosynthesis Brussels Belgium August 1ndash6 1983 C Sybesma ed (Dordrecht 1052

Springer Netherlands) pp 9-12 1053

Wilde A Lunser K Ossenbuumlhl F Nickelsen J and Borner T (2001) Characterization of 1054

the cyanobacterial ycf37 mutation decreases the photosystem I content Biochem J 1055

357 211-216 1056

Wilson A Boulay C Wilde A Kerfeld CA and Kirilovsky D (2007) Light-Induced 1057

Energy Dissipation in Iron-Starved Cyanobacteria Roles of OCP and IsiA Proteins 1058

Plant Cell 19 656-672 1059

Xu M Bernaacutet G Singh A Mi H Roumlgner M Pakrasi HB and Ogawa T (2008) 1060

Properties of Mutants of Synechocystis sp Strain PCC 6803 Lacking Inorganic Carbon 1061

Sequestration Systems Plant Cell Physiol 49 1672-1677 1062

33

Yamamoto T Burke J Autz G and Jagendorf AT (1981) Bound ribosomes of Pea 1063

chloroplast thylakoid membranes location and release in vitro by high salt 1064

puromycin and RNase Plant Physiol 67 940-949 1065

Yang H Liao L Bo T Zhao L Sun X Lu X Norling B and Huang F (2014) 1066

Slr0151 in Synechocystis sp PCC 6803 is required for efficient repair of photosystem 1067

II under high-light condition J Integr Plant Biol 56 1136-1150 1068

Yeremenko N Kouřil R Ihalainen JA DHaene S van Oosterwijk N 1069

Andrizhiyevskaya EG Keegstra W Dekker HL Hagemann M Boekema EJ 1070

Matthijs HCP and Dekker JP (2004) Supramolecular Organization and Dual 1071

Function of the IsiA Chlorophyll-Binding Protein in Cyanobacteria Biochemistry 43 1072

10308-10313 1073

Zak E Norling B Maitra R Huang F Andersson B and Pakrasi HB (2001) The 1074

initial steps of biogenesis of cyanobacterial photosystems occur in plasma membranes 1075

Proc Natl Acad Sci USA 98 13443-13448 1076

Zang X Liu B Liu S Arunakumara KKIU and Zhang X (2007) Optimum 1077

Conditions for Transformation of Synechocystis sp PCC 6803 J Microbiol 45 241-1078

245 1079

Zhang L and Sakamoto W (2015) Possible function of VIPP1 in maintaining chloroplast 1080

membranes Biochim Biophys Acta 1847 831-837 1081

Zimmerberg J and Kozlov MM (2006) How proteins produce cellular membrane 1082

curvature Nat Rev Mol Cell Biol 7 9-19 1083

Zoumlfel P (1988) Statistik in der Praxis (Stuttgart Germany Gustav Fischer Verlag) 1084

1085

34

Figure Legends 1086

Figure 1 General characteristics of CurT A) Sequence alignment of CurT and CURT1A-D 1087

from A thaliana Predicted chloroplast transit-peptide sequences of CURT1A-D are omitted 1088

(Armbruster et al 2013) Positions of predicted C-terminal transmembrane domains (TDM) 1089

are marked (black bar) as is the position of the predicted amphipathic N-terminal helix in 1090

CurT (red bar) The green bar denotes the peptide sequence used for antibody production 1091

Identical and related amino acids that are conserved in 100 80 and 60 of the sequences 1092

are highlighted in black dark grey and light grey respectively B) Helical-wheel 1093

representation of the N-terminal amphipathic helix of CurT (red bar in A) The color code 1094

reflects the physicochemical properties of amino-acid side-chains green polar and 1095

uncharged blue polar and positively charged red polar and negatively charged yellow 1096

hydrophobic C) Solubility of CurT Membrane-associated proteins (50 microg) from wild-type 1097

cells were extracted with 5 mM HEPES (pH 76) containing either 1 M NaCl 01 M Na2CO3 1098

4 M urea 01 Triton X-100 or no additional solute After separation of membrane-bound 1099

(M) and solubilized (S) proteins by centrifugation proteins were fractionated by SDS-PAGE1100

and CurT was immunodetected on immunoblots As a control the integral membrane protein 1101

CP47 from PSII was analyzed in parallel D) Transmission electron micrographs of negatively 1102

stained liposomes Cell-free expression (CFE) of CurT and A thaliana CURT1A was 1103

performed in the presence of liposomes similar in composition to the lipids of the thylakoid 1104

membrane Liposomes before and after cell-free protein expression in the absence of DNA 1105

served as negative controls Black arrowheads indicate tubular connections between 1106

liposomes Scale bars 250 nm 1107

1108

Figure 2 Ultrastructural analysis of curT- cells Transmission electron micrographs of typical 1109

wild-type (A) and curT- (B-D) Synechocystis 6803 cells taken at 44000times (A B) and 28000times 1110

(C D) magnification respectively Ultrathin sections (35 to 45 nm) of cryofixed samples 1111

were stained with osmium tetroxide and post-stained using lead citrate Arrowheads indicate 1112

biogenesis centers Scale bars 200 nm (A B) and 500 nm (C D) respectively 1113

1114

Figure 3 Accumulation of components of photosynthetic complexes in the curT- mutant A) 1115

Whole cell extracts (30 microg protein) from wild-type and curT- strains were fractionated by 1116

SDS-PAGE and analyzed on immunoblots using the indicated antibodies B) The histogram 1117

shows levels of the indicated proteins in curT- extracts relative to wild-type samples (dashed 1118

red line) Data are means plusmn SD of three independent experiments Significant differences from 1119

35

wild-type protein levels according to Studentrsquos t-test with error probabilities of 5 and 1 1120

are indicated by and respectively 1121

1122

Figure 4 P700+ reduction kinetics and high-light effects in curT- cells A) Averaged traces 1123

(10 single measurements) of P700+ decay after complete oxidation by a 50-ms multiple 1124

turnover pulse (10000 micromol photons m-2 s-1) in the absence and presence of 10 microM DCMU 1125

B) Rate constants for P700+ reduction were obtained by fitting of the data with single1126

exponential functions Error bars indicate the SD of three independent measurements C) 1127

Impact of light intensity on the (relative) electron transport rate (rETR) Cells were exposed to 1128

gradually increasing light intensities which resulted in increasing electron transport until the 1129

capacity limit was reached PAR light intensity (micromol photons m-2 s-1) Error bars indicate the 1130

SD of three independent measurements D) D1 protein level in wild-type and curT- after high-1131

light treatment (800 micromol photons m-2s-1) in the presence and absence of lincomycin Samples 1132

were taken every 30 min and processed as in Figure 3 to determine the level of D1 present 1133

100 refers to wild-type D1 level at the beginning of the experiment 1134

1135

Figure 5 PSII assembly in curT- cells A) BNSDS-PAGE of membrane proteins Membrane 1136

fractions from wild-type and curT- cells were solubilized with 13 n-dodecyl-β-maltoside 1137

and proteins were fractionated by two-dimensional BNSDS-PAGE blotted and probed with 1138

antibodies against the PSII subunits D1 D2 CP47 and CP43 Wild-type blots were also 1139

probed with the αCurT antibody The sizes of marker proteins and the positions of PSII 1140

assembly intermediates (RCCII RCCI RC47) are shown above and below each image B) In 1141

vivo pulse labeling of membrane proteins with 35S Pulse-labeled PSII core proteins were 1142

separated via BNSDS-PAGE and visualized by autoradiography 1143

1144

Figure 6 Loss of CurT induces stress A) Low-temperature (77 K) fluorescence emission of 1145

Synechocystis 6803 wild-type (blue) and curT- (red) cells excited at 440 nm The spectra were 1146

normalized to the added fluorescein standard B) Low-temperature (77 K) fluorescence 1147

emission of Synechocystis 6803 wild-type (blue) and curT- (red) excited at 580 nm The 1148

spectra were normalized to 780 nm C) Level of IsiA in the curT- mutant relative to the wild-1149

type A mean value of 368 plusmn 96 (SD) was determined from three independent experiments 1150

1151

Figure 7 Membrane sublocalization of PSII-related factors Cell extracts from wild-type and 1152

curT- cells were fractionated by two consecutive rounds of sucrose-density gradient 1153

36

centrifugation (Schottkowski et al 2009b) The second linear gradient (20-60 sucrose) was 1154

apportioned into 14 fractions which were analyzed by immunoblotting using the indicated 1155

antibodies Fractions 1ndash6 represent PDMs and fractions 7ndash14 thylakoid membranes (TMs) 1156

To facilitate comparison between gradients sample volumes were normalized to the volume 1157

of fraction 7 that contained 40 microg of protein 1158

1159

Figure 8 Live-cell imaging of the curT-CFP strain by fluorescence microscopy In the curT-1160

CFP strain the native curT gene has been replaced by a CFP-tagged version resulting in the 1161

expression of the CurT-CFP fusion protein under the control of the native promotor A) 1162

Close-up views of the mid-cell plane in the CFP and far-red autofluorescence channels shown 1163

in slice 7 in panel B B) Synechocystis 6803 cells expressing CurT C-terminally fused to the 1164

mTurquoise2 variant of CFP from its native chromosomal promoter The two imaging 1165

channels are displayed as Z-axis montages (auto-scaled contrast step size 250 nm) in 1166

grayscale and color composite configuration The thylakoid autofluorescent channel as 1167

imaged in far-red fluorescence is depicted in magenta and CurT signal as imaged in cyan 1168

fluorescence is depicted in cyan C) Fluorescence intensity profiles of the two channels along 1169

the autofluorescent peripheral cell ldquoringrdquo are shown for slice 7 The maximum projection of 1170

the entire Z montage is also shown Scale bars (light grey) 2 microm 1171

1172

Figure 9 Immunofluorescence detection of CurT A) Close-ups of slice 5 in panel B B) 1173

Wild-type Synechocystis 6803 cells labeled with αCurT antibodies and detected with Oregon 1174

Green-conjugated secondary antibodies The Z-axis montages are shown as in Figure 8B 1175

except that the step size is 280 nm (1 to 10) C) Intensity profiles of the two channels along 1176

the autofluorescent peripheral cell ldquoringrdquo are shown for slice 5 The maximum projection of 1177

the entire Z montage is also shown Scale bars (light grey) 2 microm 1178

1179

Figure 10 Subcellular localization of CurT Ultrathin sections of wild-type Synechocystis 1180

6803 cells were incubated with rabbit αCurT prior to incubation with gold-conjugated goat 1181

anti-rabbit IgG A) Negative control (wild-type processed without addition of primary 1182

antibody) B C) Immunogold-labeled sections showing CurT localization at the cytoplasmic 1183

side of the thylakoid membrane D) Cluster formation of CurT signals at a putative biogenesis 1184

center from C E) Biogenesis center from the same cell (C) without any obvious CurT 1185

clustering of gold particles F) Schematic depiction of a wild-type cell (from Figure 2A) with 1186

color-coded curved membranes green = thylakoids that follow the curvature of the cell red = 1187

37

thylakoids that bend away from the plasma membrane yellow = thylakoids that bend toward 1188

the plasma membrane to converge on sites of biogenesis centers G) Relative distribution of 1189

gold signals between convex (dark color) and concave (light color) sides of membranes (n = 1190

1584 signals from a total of 95 cells) The undifferentiated overall signal distribution is given 1191

in blue Bars = 200 nm (overview) and 100 nm (details) 1192

1193

Figure 11 Differentially modified forms of CurT are found in different complexes in PDMs 1194

and thylakoid membranes Samples were isolated by fractionation of wild-type membranes 1195

via two consecutive sucrose density gradients according to Schottkowski et al (2009b) After 1196

density centrifugation samples were applied to BNSDS-PAGE analysis (A) or isoelectric 1197

focusing (B) Numbers on the right indicate the respective fraction from the second gradient 1198

(see Figure 7) Fraction 5 represents the PDMs and fraction 9 the thylakoid membrane 1199

1200

Figure 12 Loss of CurT increases sensitivity to abiotic stress A B) Doubling times of wild-1201

type and curT- under salt stress (A) or osmotic stress (B) Doubling times are means plusmn SD of 1202

three independent cultures C) Localization of CurT-CFP under salt and osmotic stress 1203

Samples were examined as described in Figure 8 Scale bars 1 microm D) Protein levels of wild-1204

type cells after growth in BG11 medium containing 500 mM NaCl Samples were analyzed on 1205

the same gel but unrelated samples between the presented signals were omitted E) 1206

Membrane preparations obtained from wild-type cells wild-type cells grown in the presence 1207

of 500 mM NaCl and curT- cells were subjected to the first gradient step in the membrane 1208

fractionation scheme The gradient was divided into five fractions and 10 of fractions I-IV 1209

and 02 of fraction V were analyzed by SDS-PAGE Fraction II includes the plasma 1210

membrane and fraction V consists of PratA-defined membrane and thylakoid membrane 1211

1212

Figure 13 Model of CurT distribution at convergence zones in Synechocystis 6803 The 1213

distribution of CurT in thylakoid (green) and plasma membranes (brown) is shown The 1214

pattern of localization of CurT in the thylakoid membrane is derived from membrane 1215

fractionation via sucrose density centrifugation fluorescence-based detection of the CurT-1216

CFP fusion and endogenous CurT and immunogold labeling experiments (Figures 7-10) The 1217

different CurT variants a b c and d identified in the IEF experiments (Figure 11) are depicted 1218

in yellow pink blue and black respectively CurT present in the plasma membrane is 1219

highlighted in gray as its precise nature and role remain to be defined (Figure 12) 1220

Membranes are represented as lipid bilayers Convex and concave faces of bent thylakoid 1221

38

sheets are indicated by black arrows The PDM which is dedicated to PSII assembly and 1222

repair is depicted in blue The dotted blue line emphasizes that the ultrastructure in this region 1223

has not yet been fully resolved PP periplasm PM plasma membrane TM thylakoid 1224

membrane L lumen PDM PratA-defined membrane 1225

1226

Tables 1227

Table 1 Physiological characteristics of the curT- mutant 1228

Strain Doubling time [h]

Oxygen Evolution[nmol h-1 OD750

-1]c

Chlorophyll content

[microg OD750-1]

d

Cell size [microm]e

Cell number [ml-1 OD750

-1]f

Wild type 817plusmn017a 1600plusmn042

b 1933plusmn187 251plusmn014 264plusmn020 390plusmn006 x 107

curT- 1259plusmn020a 3226plusmn056

b 1074plusmn20 195plusmn029 274plusmn044 367plusmn016 x 107

1229 abDoubling times in the presence (a) or absence (b) of 5 mM glucose measured under 1230

continuous illumination at 30 micromol photons m-2 s-1 and CO2-limiting conditions cOxygen 1231

evolution is expressed in nmol O2 produced per hour per OD750 unit dChlorophyll content is 1232

expressed in microg OD750-1 eThe diameter of non-dividing cells is presented in microm fCell number 1233

was determined per ml per OD750 Data are means plusmn SD of at least three independent 1234

experiments 1235

1236

Parsed CitationsAllen JF de Paula WBM Puthiyaveetil S and Nield J (2011) A structural phylogenetic map for chloroplast photosynthesisTrends Plant Sci 16 645-655

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Anderson JM Horton P Kim E-H and Chow WS (2012) Towards elucidation of dynamic structural changes of plant thylakoidarchitecture Philos Trans R Soc Lond B Biol Sci 367 3515-3524

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Armbruster U Zuumlhlke J Rengstl B Kreller R Makarenko E Ruumlhle T Schuumlnemann D Jahns P Weisshaar B NickelsenJ and Leister D (2010) The Arabidopsis thylakoid protein PAM68 is required for efficient D1 biogenesis and photosystem IIassembly Plant Cell 22 3439-3460

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Armbruster U Labs M Pribil M Viola S Xu W Scharfenberg M Hertle AP Rojahn U Jensen PE Rappaport F JoliotP Doumlrmann P Wanner G and Leister D (2013) Arabidopsis CURVATURE THYLAKOID1 proteins modify thylakoid architectureby inducing membrane curvature Plant Cell 25 2661-2678

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Aseeva E Ossenbuumlhl F Sippel C Cho WK Stein B Eichacker LA Meurer J Wanner G Westhoff P Soll J andVothknecht UC (2007) Vipp1 is required for basic thylakoid membrane formation but not for the assembly of thylakoid proteincomplexes Plant Physiol Biochem 45 119-128

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Bartsevich VV and Pakrasi HB (1995) Molecular identification of an ABC transporter complex for manganese analysis of acyanobacterial mutant strain impaired in the photosynthetic oxygen evolution process EMBO J 14 1845-1853

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Bartsevich VV and Pakrasi HB (1996) Manganese transport in the cyanobacterium Synechocystis sp PCC 6803 J Biol Chem271 26057-26061

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Bernaacutet G Waschewski N and Roumlgner M (2009) Towards efficient hydrogen production the impact of antenna size andexternal factors on electron transport dynamics in Synechocystis PCC 6803 Photosynth Res 99 205-216

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Boehm M Yu J Krynicka V Barker M Tichy M Komenda J Nixon PJ and Nield J (2012) Subunit Organization of aSynechocystis Hetero-Oligomeric Thylakoid FtsH Complex Involved in Photosystem II Repair Plant Cell 24 3669-3683

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Bradford MM (1976) A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle ofprotein-dye binding Anal Biochem 72 248-254

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Chang L Liu X Li Y Liu C-C Yang F Zhao J and Sui S-F (2015) Structural organization of an intact phycobilisome and itsassociation with photosystem II Cell Res 25 726-737

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Danielsson R Suorsa M Paakkarinen V Albertsson P-Aring Styring S Aro E-M and Mamedov F (2006) Dimeric andmonomeric organization of photosystem II Distribution of five distinct complexes in the different domains of the thylakoidmembrane J Biol Chem 281 14241-14249

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Daum B Nicastro D Austin J McIntosh JR and Kuumlhlbrandt W (2010) Arrangement of photosystem II and ATP synthase in

15

complexes play distinct roles in mediating the different CurT functions ie membrane 482

bending and maintenance 483

However it remains to be seen how exactly curvature is established maintained and 484

fine-tuned In addition other determinants of membrane topology and their putative interplay 485

with CurT have to be considered eg lipid and protein (complex) composition of 486

membranes cellular turgor pressure and other factors required for membrane 487

biogenesismaintenance eg the VIPP1 protein before precise molecular models of CurTrsquos 488

mode of action can be constructed (Rast et al 2015 and see below) That these other factors 489

can be crucial for membrane architecture is documented by the fact that some marine 490

cyanobacteria such as Prochlorococcus and Synechococcus contain curved thylakoids (but 491

no thylakoid convergence zones at the plasma membrane) although they lack a curT gene 492

493

The role of biogenesis centers 494

The absence of biogenesis centers in the curT- mutant now enables one to answer some 495

questions relating to the role of these thylakoid sub-structures which form in some but not all 496

cyanobacteria (Kunkel 1982 van de Meene et al 2006) First they are not essential since 497

even the curT- mutant still accumulates PSII to ~50 of wild-type levels On the other hand 498

in the mutant assembly of PSII is impaired as revealed by the increased accumulation of early 499

assembly intermediates In addition PSII dimers are almost completely absent in curT- 500

Whether the reduction in PSII dimers is attributable to an assembly problem linked to the 501

absence of biogenesis centers or to a secondary defect in dimer stabilization caused by 502

changes in overall thylakoid membrane ultrastructure remains to be determined Thus 503

biogenesis centers are more likely to represent evolutionary ldquoadd-onsrdquo that facilitated efficient 504

thylakoid biogenesis This is compatible with the fact that some cyanobacteria are devoid of 505

any biogenesis center-related substructures Second their absence compromises PSII but the 506

accumulation of other photosynthetic complexes ie PSI and the Cyt(b6f) complex is not 507

affected by CurT deficiency (Figure 3) This observation agrees with previous findings that 508

neither the PsaA subunit of PSI nor its assembly factor Ycf37 is detectable in isolated PDM 509

fractions (Rengstl et al 2011) 510

In addition to reduced de novo PSII assembly a higher relative stability of D1 in high-511

light experiments has been detected in curT- which suggests that D1 degradation during PSII 512

repair is less efficient in the mutant Photo-damaged D1 is degraded by the FtsH2FtsH3 513

complex which has previously been shown to partly localize to thylakoid convergence zones 514

at the cell periphery ie biogenesis centers (Boehm et al 2012 Sacharz et al 2015) It 515

16

therefore seems possible that the absence of biogenesis centers in curT- leads to 516

mislocalization of the FtsH2FtsH3 complex and less effective D1 degradation 517

Moreover a PSII related-function for CurT is supported by a meta-analysis of the 518

Synechocystis 6803 transcriptome When the CyanoEXpress 22 database (Hernaacutendez-Prieto 519

and Futschik 2012 Hernaacutendez-Prieto et al 2016) was queried for genes co-expressed with 520

curT (slr0483) genes for five PSII subunits ndash psbE psbO psbF psbL and psb30 ndash were 521

found among the first ten hits (Supplemental Table 4) From this we infer that biogenic 522

centers do not play an essential role in the assembly of all photosynthetic complexes but 523

serve to enhance PSII assemblyrepair possibly through the efficient delivery of Mn2+ 524

Residual PSII in curT- cells is likely to be supplied with cytoplasmic Mn2+ via a second 525

independently operating ABC transporter-based system in the plasma membrane named the 526

Mnt pathway (Bartsevich and Pakrasi 1995 Bartsevich and Pakrasi 1996) 527

Formally we cannot exclude that CurT is directly involved in the PSII assembly 528

process However considering CurTrsquos membrane bending capacity and the mutant phenotype 529

(Figure 1D and Figure 2) it appears more likely that CurT forms cellular substructures for 530

efficient PSII biogenesis ie biogenesis centers 531

As mentioned above some ultrastructural features of biogenesis centers have emerged 532

from studies employing EM-based tomography (van de Meene et al 2006) To date however 533

a high-resolution picture of the precise membrane architecture within these centers remains 534

elusive In particular whether or not a direct connection between plasma membrane and 535

thylakoids exists continues to be debated As recently discussed and in line with this gap in 536

knowledge different membrane fractionation techniques have revealed different distributions 537

of PSII-related subunits and assembly factors between plasma and thylakoid membranes 538

(Heinz et al 2016 Liberton et al 2016 Selatildeo et al 2016) The overall picture that emerges 539

is that the initial hypothesis that PSII biogenesis is initiated at the plasma membrane is no 540

longer tenable whereas a specialized thylakoid sub-fraction like the PDMs that make contact 541

with the plasma membrane could explain many of the available data and thus clarify some 542

aspects of the debate (Zak et al 2001 Pisareva et al 2011 Rast et al 2015) Moreover it 543

has previously been hypothesized that ldquoribosome-decorated membrane-like complexesrdquo 544

forming at the innermost thylakoid sheet might represent biogenic compartments (van de 545

Meene et al 2006 Mullineaux 2008) Whether these structures are affected in curT- cannot 546

be judged based on our TEM analysis but requires ultrastructural data of higher resolution 547

However the accessibility of thylakoids for ribosomes should be increased in the less 548

compressed membrane system of curT- (Figure 2B-D) 549

17

A scenario similar to that of Synechocystis 6803 holds for the situation in chloroplasts 550

of the green alga Chlamydomonas reinhardtii in which de novo PSII biogenesis has been 551

shown to be initiated in punctate regions named T-zones located close to the pyrenoid 552

(Uniacke and Zerges 2007) Unlike the mRNAs for the PSII components neither RNAs for 553

PSI subunits nor PSI assembly factors are localized to T-zones indicating that PSI and PSII 554

assembly processes are spatially separated (Uniacke and Zerges 2009 Nickelsen and Zerges 555

2013 Rast et al 2015) Interestingly a recent cryoelectron tomography study demonstrated 556

that next to T-zones at the chloroplast base-lobe junction the inner chloroplast envelope 557

exhibits invaginationsconnections to thylakoids that structurally resemble the organization of 558

cyanobacterial biogenesis centers (Engel et al 2015) For future investigations it will be 559

interesting to see if a homolog of the CURT1 family is involved in the formation of these 560

structures in C reinhardtii 561

562

Evolution of CURT1 function 563

Homologs of the CURT1 protein family can be found throughout cyanobacteria green 564

algae and plants (Armbruster et al 2013) The Arabidopsis CURT1A-D proteins have 565

recently been shown to induce bending of thylakoid membranes at grana margin regions 566

(Armbruster et al 2013) Interestingly and in contrast to the situation in Synechocystis 6803 567

their inactivation did not result in severe photosynthetic deficiencies although the thylakoids 568

formed lacked defined grana stacks Nevertheless the data available support the idea that the 569

function of thylakoid membrane structures that were regarded as being independent ie 570

cyanobacterial biogenesis centers and grana are closely related Intriguingly both of these 571

thylakoid membrane structures are dedicated to aspects of PSII function but do not involve 572

PSI (Pribil et al 2014) In both the prokaryotic and eukaryotic systems CURT1 homologs 573

appear to bend thylakoid membranes as indicated by (i) the distortion of membrane 574

ultrastructure seen in mutants devoid of curved thylakoids (ii) the localization of CURT1 575

homologs at grana margins and their local concentration at biogenesis centers (iii) the in vitro 576

membrane-curving activity of both CURT forms The phenotypic differences between 577

A thaliana and Synechocystis 6803 mutants may however be attributable to the different 578

functions of the membrane sub-compartments affected in the two model organisms Whereas 579

the role of grana is still under debate one function of the cyanobacterial biogenesis centers is 580

the above-mentioned high-throughput uptake of Mn2+ ions for efficient assembly of PSII 581

(Stengel et al 2012 Nickelsen and Rengstl 2013 Pribil et al 2014) However it appears 582

that in both cases the primary function of CURT1 proteins is to generate curved membrane 583

18

regions These discoveries suggest that until now two independently observed structures ie 584

cyanobacterial thylakoid biogenesis centers and chloroplast grana regions are closely related 585

The degree of curvature is much less pronounced in the cyanobacterial system As previously 586

discussed it was probably the subsequent evolution of a membrane-localized light-harvesting 587

system in chloroplasts that made the formation of tightly curved grana thylakoids possible 588

(Mullineaux 2005 Nevo et al 2012 Pribil et al 2014) 589

590

CurT is involved in osmotic stress response 591

One unexpected phenotype of the curT- mutant is its sensitivity to osmotic stress 592

These data revealed that in addition to shaping membranes CurT also influences their 593

functional integrity This latter function might be intrinsic to CurT or could be mediated by 594

the VIPP1 protein which has been shown to be required for membrane maintenance in 595

bacteria and chloroplasts probably by acting as a supplier of lipids (for an overview see 596

Zhang and Sakamoto 2015) Both factors accumulate in the plasma membrane upon osmotic 597

stress but VIPP1 localization is not severely affected by CurT inactivation which suggests 598

that VIPP1 operates independently of CurT In agreement with this repeated co-599

immunoprecipitations revealed no interaction between both proteins Therefore it remains to 600

be established whether a direct functional relationship between them exists 601

Previous investigations of osmotic stress in Synechocystis 6803 showed a kidney-602

shaped form of wild-type cells under very high concentrations of osmotically active 603

compounds (Marin et al 2006) The cells were severely deformed indicating changes in the 604

structure of the cellular envelope Since CurT shifts towards the plasma membrane already 605

under lower osmolyte concentrations we suggest a stabilizing function of CurT in the plasma 606

membrane CurT might be necessary to tolerate the forces trying to deform the cells under 607

osmotic stress 608

In conclusion this analysis has identified a crucial determinant for shaping and 609

maintaining the cyanobacterial thylakoid membrane system ie CurT a homolog of the 610

grana-forming CURT1 protein family from A thaliana In particular CurT is involved in the 611

formation of specific thylakoid substructures close to the plasma membrane at which PSII is 612

assembledrepaired Future work will dissect the precise ultrastructure of these centers and 613

enable us to elaborate a molecular model for the spatiotemporal organization of PSII assembly 614

in cyanobacteria 615

616

19

Methods 617

Strains and growth conditions 618

Wild-type and mutant Synechocystis 6803 cells were grown on solid or in liquid BG 619

11 medium (Rippka et al 1979) supplemented with 5 mM glucose (unless indicated 620

otherwise) at 30degC under continuous illumination at a photon irradiance of 30 μmol m-2 s-1 of 621

white light For growth during high-light experiments for investigation of D1 repair cells 622

were cultivated in a FMT150 photobioreactor (Photon Systems Instruments Draacutesov Czech 623

Republic) at 800 micromol photons m-2 s-1 in the presence or absence of lincomycin (100 microgml) 624

Cell density was monitored photometrically at 750 nm Doubling times were determined after 625

two days of growth To generate the insertion mutant curT- the curT gene (slr0483) was first 626

amplified from wild-type genomic DNA by PCR using the primer pair 04835 627

(GAAGCCTATTTAGCTAAGGCCGAAAG) and 04833 628

(TAGTACCTGGTCTTCCATGGCGT) and the resulting fragment was cloned into the 629

Bluescript pKS vector (Stratagene Waldbronn Germany) A kanamycin resistance cassette 630

was then inserted into the single AgeI restriction site (159 bp downstream of the start codon) 631

and this disruption construct was used to replace the wild-type gene as described (Wilde et al 632

2001) 633

634

Bioinformatic and computational analysis 635

CURT1 sequences of Synechocystis 6803 were obtained from CyanoBase 636

(httpgenomekazusaorjpcyanobaseSynechocystis) and CURT1 homologs in other 637

organisms were retrieved from NCBIBLAST (httpblastncbinlmnihgovBlastcgi) 638

Numbers and positions of putative transmembrane domains in the predicted proteins were 639

determined with TMHMM20 (httpwwwcbsdtudkservicesTMHMM) The sequence for 640

the N-terminal amphipathic helix was predicted by Jpred 3 641

(httpwwwcompbiodundeeacukwww-jpred) and plotted using a helical wheel projection 642

script (httprzlabucreduscriptswheelwheelcgi) The programs ClustalW2 643

(httpwwwebiacuktoolsclustalw2) and GeneDoc (httpwwwpscedubiomedgenedoc) 644

were used to generate multiple alignments of amino acid sequences Quantitative analysis of 645

immunoblots was performed with the AIDA Image Analyzer V325 (Raytest 646

Isotopenmessgeraumlte GmbH Straubenhardt Germany) 647

Co-expression patterns of curT were analyzed using the CyanoEXpress 22 database 648

(httpcyanoexpresssysbiolabeu Hernaacutendez-Prieto and Futschik 2012 Hernaacutendez-Prieto et 649

al 2016) 650

20

651

Measurement of chlorophyll concentration and oxygen production 652

Determination of chlorophyll content was carried out according to Wellburn and 653

Lichtenthaler (1984) For oxygen evolution measurements cells were grown in BG-11 654

without glucose harvested in mid-log phase and diluted to an OD750 nm = 05 Oxygen 655

evolution rates were measured with a Clark-type oxygen electrode (Hansatech Instruments 656

Ltd Kingrsquos Lynn Norfolk UK) at 1000 micromol photons m-2 s-1 (cool white light) after 5 min of 657

dark acclimation Oxygen evolution under saturating light conditions was measured without 658

any additives 659

660

Cell size and cell number estimation 661

Synechocystis 6803 strains were grown in liquid BG11 media containing 5 mM 662

glucose For cell size estimation the cells were analyzed with a confocal laser scanning 663

microscope TCS SP5 (Leica Wetzlar Germany) The diameter of the cells was measured 664

with the LAS AF Lite software (Leica Wetzlar Germany) Cells that were about to divide 665

were not taken into account For the determination of cell number cultures were set to an 666

OD750 = 1 and analyzed by using a Neubauer counting chamber (Paul Marienfeld GmbH amp 667

Co KG Lauda-Koumlnigshofen Germany) Statistical significance was determined by Studentrsquos 668

t-test 669

670

Measurements of P700+ reduction kinetics and relative electron transport rates 671

P700+ reduction kinetics and changes in chlorophyll fluorescence yield at different 672

light intensities were measured at a chlorophyll concentration of 5 microgml with a Dual-PAM-673

100 instrument (Heinz Walz GmbH Effeltrich Germany) Complete P700 oxidation was 674

achieved by a 50-ms multiple turnover pulse (10000 micromol photons m-2 s-1) after 2 min of dark 675

incubation P700+ reduction kinetics were recorded without any additions as well as in the 676

presence of 10 microM DCMU Ten technical replicates were averaged and fitted with single 677

exponential functions Data interpretation was done according to Bernaacutet et al (2009) 678

Light saturation measurements were performed according to Xu et al (2008) The 679

actinic light intensity was increased stepwise from 0 to 665 micromol photons m-2 s-1 with 30-s 680

adaptation periods Maximal fluorescence yields were obtained by applying saturating light 681

pulses (duration 600 ms intensity 10000 micromol photons m-2 s-1) 682

683

Low-temperature fluorescence measurements 684

21

Fluorescence emission spectra were measured with an AMINCO Bowman Series 2 685

Luminescence Spectrometer Wild-type and curT- cells were grown in the presence of 5 mM 686

glucose to mid log-phase and concentrated to 25 microgml chlorophyll adding 2 microM fluorescein 687

as an internal standard Samples (1 ml) were transferred to thin glass tubes dark-adapted for 688

30 min at 30 degC and shock frozen in liquid N2 To quantify chlorophyllfluorescein and 689

phycobilisome-mediated fluorescence samples were excited and emission recorded at 440 690

nm510 nm (chlorophyll and fluorescein excitationmax fluorescein emission) and 580 691

nm685 nm respectively Emission was scanned at 490-800 nm or at 640-800 nm 692

respectively 693

694

Antibody production and protein analysis 695

For generation of an αCurT antibody the N-terminal coding region of curT (amino 696

acid positions 1-58) was amplified by PCR using primers N04835 697

(AAGGATCCGTGGGCCGTAAACATTCAA) and N04833 698

(AAGTCGACGCACTTCCCACACCGGTTGTA) and cloned into the BamHI and XhoI sites 699

of the pGEX-4T-1 vector (GE Healthcare Freiburg Germany) Expression of the GST fusion 700

protein in Escherichia coli BL21(DE3) and subsequent affinity purification on Glutathione-701

Sepharose 4B (GE Healthcare) were carried out as described (Schottkowski et al 2009b) A 702

polyclonal antiserum was raised against this protein fragment in rabbits (Pineda Berlin 703

Germany) Other primary antibodies used in this study have been described previously ie 704

αpD1 (Schottkowski et al 2009b) αD1 (Schottkowski et al 2009b) αD2 (Klinkert et al 705

2006) αPratA (Klinkert et al 2004) αYcf48 (Rengstl et al 2011) αPitt (Schottkowski et 706

al 2009a) αPOR (Schottkowski et al 2009a) αYidC (Ossenbuumlhl et al 2006) αVIPP1 707

(Aseeva et al 2007) αSll0933 (Armbruster et al 2010) and αSlr0151 (Rast et al 2016) or 708

were purchased from Agrisera (Vaumlnnaumls Sweden) ie αCP43 αCP47 αPsaA αCyt f 709

αRbcL αIsiA The αGFP-HRP antibody was acquired from Miltenyi Biotech (Bergisch 710

Gladbach Germany) 711

Protein concentrations were determined according to Bradford (1976) using RotiQuant 712

(Carl Roth GmbH amp Co KG Karlsruhe Germany) Protein extraction membrane 713

fractionation on sucrose-density gradients and quantification of Western signal intensities was 714

performed as described previously (Rengstl et al 2011) Solubility properties of CurT were 715

determined according to Schottkowski et al (2009a) 716

22

Sucrose-density centrifugation separating PDM and thylakoid membrane fractions by 717

two consecutive gradients was carried out as described previously (Schottkowski et al 718

2009b Rengstl et al 2011) 719

Two-dimensional fractionations of cyanobacterial membrane proteins via BNSDS-720

PAGE and of pulse-labeled proteins by BNSDS-PAGE were performed as previously 721

reported (Klinkert et al 2004 Schottkowski et al 2009b Rengstl et al 2013) For the 722

analysis of native complexes in fractions obtained by sucrose-density centrifugation the 723

volume corresponding to 350 microg of protein in fraction 7 was applied to BNSDS-PAGE 724

For isoelectric focusing (IEF) the volume corresponding to 50 microg of protein from 725

fraction 7 in 200 microl of IEF buffer (8 M urea 4 CHAPS 1 IPG buffer pH 4-7 (GE 726

Healthcare)) was applied to an 11-cm Immobiline DryStrip pH 4-7 (GE Healthcare) in a 727

Protean IEF Cell (Bio-Rad Munich Germany) Strips were rehydrated for 12 h at 20 degC and 728

50V Focusing was carried out in the following steps 500 V rapid 1500 Vh 1000 V linear 729

880 Vh 6000 V linear 9680 Vh 6000 V rapid 5390 Vh 50 microA per gel focus temperature 730

20degC Subsequently the strips were incubated in equilibration buffer I (6 M urea 0375 M 731

Tris pH 88 20 glycerol 2 SDS 2 DTT) and equilibration buffer II (6 M urea 0375 732

M Tris pH 88 20 glycerol 2 SDS 25 iodoacetamide) for 10 min in each buffer 733

Then the IEF strips were applied to second-dimension SDS-PAGE 734

735

Transmission electron microscopy and immunogold labeling 736

Sample preparation for transmission electron microscopy including freeze substitution 737

and immunogold labeling of CurT was performed as described previously (Stengel et al 738

2012) Ultrathin sections were cut to thicknesses of 35 - 45 nm and 45 - 65 nm for 739

ultrastructural analyses and immunogold labeling respectively For immunogold labeling 740

sections collected on collodion-coated Ni grids were incubated for 18 h at 4degC with (rabbit) 741

αCurT (diluted 1100 1500 11000 or 14000 in blocking buffer (5 fetal calf serum) with 742

005 Tween 20) and further processed as described previously (Stengel et al 2012) As a 743

negative control wild-type Synechocystis 6803 cells were incubated without the primary 744

antibody and exposed to the gold-labeled anti-rabbit IgG To image the ultrastructure and the 745

immunogold-treated samples a Fei Morgagni 268 transmission electron microscope was used 746

and micrographs were taken at 80 kV 747

To avoid errors in the interpretation of the immunogold labeling experiment only 748

signals which were unambiguously localized to distinctly visible thylakoid membranes were 749

taken into account For each cell different regions (see Figure 10F) were defined and in each 750

23

region the signals on the convex and concave sides of the thylakoid membrane were analyzed 751

separately (see Supplemental Figure 11 for representative counts) Statistical significance was 752

assessed by χ2 test (Zoumlfel 1988) 753

For the analysis of clusters of CurT signals in biogenesis centers a cluster was defined 754

as a minimum of four signals in close proximity Overall 219 biogenesis centers were 755

examined with regard to CurT cluster formation 756

757

Preparation of proteoliposomes 758

Liposomes with a lipid mixture of 25 monogalactosyl diacylglycerol 42 759

digalactosyl diacylglycerol 16 sulfoquinovosyl diacylglycerol and 17 760

phosphatidylglycerol (Lipid Products South Nutfield UK) were prepared as described 761

previously (Armbruster et al 2013) To generate proteoliposomes CurT and CURT1A 762

proteins were expressed in the presence of liposomes for 3 h at 37degC using a PURExpress In 763

Vitro Protein Synthesis Kit (New England Biolabs Ipswich MA USA) The liposomes were 764

separated from the mix by centrifugation in a discontinuous sucrose gradient (100000 g 18 765

h) Subsequently the fraction containing the liposomes was extracted and dialyzed against 20 766

mM HEPES (pH 76) For transmission electron microscopy the proteoliposomes were 767

negatively stained with 1 uranyl acetate on a carbon-coated copper grid Micrographs were 768

taken on a Fei Morgagni 268 TEM at 80 kV 769

770

curT-CFP strain generation 771

Gibson assembly was used for single-step cloning (Gibson 2011) of the slr0483 gene 772

(together with its ~08 kb upstream region) the mTurquoise2 gene fragment the gentamycin-773

resistance cassette (aacC1) and an ~17-kb downstream region of slr0483 into pBR322 774

cleaved with EcoRV and NheI The slr0483 gene was fused in frame to the codon-optimized 775

mTurquoise2 (DNA20) preceded by a linker sequence encoding GSGSG The resulting 776

plasmid was used to transform Synechocystis 6803 as described previously (Zang et al 2007) 777

After ~ 10 days of incubation on BG11-GelRite (15 ) medium in the presence of 2 microgml 778

gentamycin several antibiotic resistant colonies were obtained and streaked out on fresh 779

medium These transformants were then tested for full segregation of the tagged allele by 780

colony PCR with primers flanking the slr0483 gene 781

782

Fluorescence microscopy 783

24

An aliquot of a cell suspension in mid-log phase was placed under a BG11-agarose 784

pad on a glass coverslip (15) and imaged on an inverted microscope (Zeiss 785

AxioObserverZ1) equipped with an ORCA Flash40 V2 (Hamamatsu) camera a Lumenecor 786

SOLA II Light Engine and a Plan-Apochromat 63x140 Oil DIC M27 (NA 14) objective 787

(Zeiss) Image acquisition was done with Zen 21 software in cyan and far-red fluorescence 788

channels (Zeiss Filter Sets 47 HE and 50) as Z-series with a step size of 250 nm and effective 789

pixel size of 103 nm Acquired image files were subsequently deconvolved (Constrained 790

Iterative Method) using a default theoretical Point Spread Function in Zen 20 (Zeiss) 791

Extraction of intensities for line profiles was performed by image thresholding the thylakoid 792

autofluorescence channel and eroding the resulting binary mask in Fiji (Schindelin et al 793

2012) 794

For immunofluorescence analysis cells were grown to mid-log phase as in the case of 795

the cells prepared for live-cell microscopy A 10-ml culture was fixed for 20 min in 37 796

formaldehyde and following extensive washing with phosphate-buffered saline (PBS) cells 797

were first permeabilized in 005 Triton-X for 20 min and then in lysis buffer (50 mM Tris-798

HCl 100 mM NaCl 5 mgml lysozyme) at 37degC for 2 h with gentle shaking To block 799

unspecific binding sites the cell pellet was incubated in 5 bovine serum albumin in PBS at 800

30degC for 1 h The αCurT serum (1500 dilution) was added to cells in fresh blocking buffer 801

for 1 h at 30degC with gentle shaking Cells were then washed three times with blocking buffer 802

and incubated with goat anti-rabbit IgG secondary antibodies conjugated to Oregon Green 488 803

(Invitrogen) (11000 dilution) under the conditions as for the primary antibodies Cells were 804

washed three times with PBS and prepared for microscopy as above Imaging was done as 805

described for live-cell microscopy except that a Colibri2 LED light source was employed for 806

illumination and a CoolSnap HQ camera (Photometrics) was used for image acquisition Cells 807

were imaged as Z-series (step size 280 nm) in the yellow and far-red fluorescent channels 808

(Zeiss Filter Sets 46 HE and 50) using the 505 nm and 625 nm LED modules Effective pixel 809

size in the final image was 102 nm Deconvolution and image analysis was done as described 810

above As judged by the staining intensity of the Oregon Green-conjugated antibodies 811

approximately half of the cells in any given field of view appeared to have been successfully 812

permeabilised a rate that is common in our experience No significant signal was detected in 813

the control sample that had not been exposed to the primary antibodies 814

815

25

Accession numbers 816

Sequence data from this article can be found in the CyanoBase and EMBLGenBank 817

data libraries under accession number slr0483 818

819

Supplemental Data 820

Supplemental Figure 1 Construction of the curT- mutant 821

Supplemental Figure 2 Growth phenotype of curT- 822

Supplemental Figure 3 Expression analysis of the open reading frame slr0482 (located 823

upstream of curT) in the curT- strain 824

Supplemental Figure 4 Absorbance spectra of curT- and wild-type cells 825

Supplemental Figure 5 High-light growth phenotypes of wild-type Synechocystis 6803 and 826

the curT- strain 827

Supplemental Figure 6 Ultrastructure of the TD41 mutant which lacks the psbA transcript 828

and the D1 protein 829

Supplemental Figure 7 Expression and localization of CurT-CFP 830

Supplemental Figure 8 Localization of CurT and CurT-CFP by fluorescence microscopy 831

Supplemental Figure 9 Chlorophyll autofluorescence of curT- 832

Supplemental Figure 10 The curT- mutant as a negative control for immunogold labeling 833

Supplemental Figure 11 Representative counts of immunogold signals 834

Supplemental Table 1 Overview of immunogold signals in curT- cells 835

Supplemental Table 2 Overview of immunogold signals in specific regions of Synechocystis 836

6803 wild-type cells 837

Supplemental Table 3 Statistical analysis of immunogold signals for wild-type 838

Synechocystis 6803 cells 839

Supplemental Table 4 Co-expression of curT 840

Supplemental Movie 1 Scan through the Z-axis of a curT-CFP cell 841

Supplemental Movie 2 Rendered 3D-model of a CurT-CFP detection 842

Supplemental Movie 3 Scan through the Z-axis of a curT-CFP cell with a traversing 843

thylakoid lamella 844

845

Acknowledgements 846

We thank Y Nishiyama for providing αpD1 and J Soll for αVIPP1 and αYidC antibodies 847

respectively and Nina Dyczmons-Nowaczyk for support with the fluorescence measurements 848

This work was supported by grants awarded to JN (Ni3909) MMN (NO 8363) and DL 849

26

(Le126529) by the Deutsche Forschungsgemeinschaft in the context of Research Unit 850

FOR2092 and the Cluster of Excellence RESOLV (EXC 1069) AG is a Howard Hughes 851

Medical Institute postdoctoral fellow in the laboratory of Erin OrsquoShea at Harvard University 852

LS was supported by a PhD fellowship from the Chinese Scholarship Council 853

854

Author Contributions 855

SH AR LS MMN DL and JN designed the research SH AR LS AG ILG EH ML BR 856

SV performed the research all authors contributed to data analysis SH AR and JN wrote the 857

paper 858

859

Competing Financial Interest statement 860

The authors declare no competing financial interests 861

862

We wish to dedicate this paper to Fabrice Rappaport an outstanding colleague and friend who 863

passed away so early 864

865

27

References 866

Allen JF de Paula WBM Puthiyaveetil S and Nield J (2011) A structural 867

phylogenetic map for chloroplast photosynthesis Trends Plant Sci 16 645-655 868

Anderson JM Horton P Kim E-H and Chow WS (2012) Towards elucidation of 869

dynamic structural changes of plant thylakoid architecture Philos Trans R Soc 870

Lond B Biol Sci 367 3515-3524 871

Armbruster U Zuumlhlke J Rengstl B Kreller R Makarenko E Ruumlhle T Schuumlnemann 872

D Jahns P Weisshaar B Nickelsen J and Leister D (2010) The Arabidopsis 873

thylakoid protein PAM68 is required for efficient D1 biogenesis and photosystem II 874

assembly Plant Cell 22 3439-3460 875

Armbruster U Labs M Pribil M Viola S Xu W Scharfenberg M Hertle AP 876

Rojahn U Jensen PE Rappaport F Joliot P Doumlrmann P Wanner G and 877

Leister D (2013) Arabidopsis CURVATURE THYLAKOID1 proteins modify 878

thylakoid architecture by inducing membrane curvature Plant Cell 25 2661-2678 879

Aseeva E Ossenbuumlhl F Sippel C Cho WK Stein B Eichacker LA Meurer J 880

Wanner G Westhoff P Soll J and Vothknecht UC (2007) Vipp1 is required for 881

basic thylakoid membrane formation but not for the assembly of thylakoid protein 882

complexes Plant Physiol Biochem 45 119-128 883

Bartsevich VV and Pakrasi HB (1995) Molecular identification of an ABC transporter 884

complex for manganese analysis of a cyanobacterial mutant strain impaired in the 885

photosynthetic oxygen evolution process EMBO J 14 1845-1853 886

Bartsevich VV and Pakrasi HB (1996) Manganese transport in the cyanobacterium 887

Synechocystis sp PCC 6803 J Biol Chem 271 26057-26061 888

Bernaacutet G Waschewski N and Roumlgner M (2009) Towards efficient hydrogen production 889

the impact of antenna size and external factors on electron transport dynamics in 890

Synechocystis PCC 6803 Photosynth Res 99 205-216 891

Boehm M Yu J Krynicka V Barker M Tichy M Komenda J Nixon PJ and Nield 892

J (2012) Subunit Organization of a Synechocystis Hetero-Oligomeric Thylakoid FtsH893

Complex Involved in Photosystem II Repair Plant Cell 24 3669-3683894

Bradford MM (1976) A rapid and sensitive method for the quantitation of microgram 895

quantities of protein utilizing the principle of protein-dye binding Anal Biochem 72 896

248-254897

28

Chang L Liu X Li Y Liu C-C Yang F Zhao J and Sui S-F (2015) Structural 898

organization of an intact phycobilisome and its association with photosystem II Cell 899

Res 25 726-737 900

Danielsson R Suorsa M Paakkarinen V Albertsson P-Aring Styring S Aro E-M and 901

Mamedov F (2006) Dimeric and monomeric organization of photosystem II 902

Distribution of five distinct complexes in the different domains of the thylakoid 903

membrane J Biol Chem 281 14241-14249 904

Daum B Nicastro D Austin J McIntosh JR and Kuumlhlbrandt W (2010) Arrangement 905

of photosystem II and ATP synthase in chloroplast membranes of Spinach and Pea 906

Plant Cell 22 1299-1312 907

Engel BD Schaffer M Kuhn Cuellar L Villa E Plitzko JM and Baumeister W 908

(2015) Native architecture of the Chlamydomonas chloroplast revealed by in situ 909

cryo-electron tomography eLife 4 e04889 910

Ford MGJ Mills IG Peter BJ Vallis Y Praefcke GJK Evans PR and McMahon 911

HT (2002) Curvature of clathrin-coated pits driven by epsin Nature 419 361-366 912

Fristedt R Willig A Granath P Cregravevecoeur M Rochaix J-D and Vener AV (2009) 913

Phosphorylation of photosystem II controls functional macroscopic folding of 914

photosynthetic membranes in Arabidopsis Plant Cell 21 3950-3964 915

Gallop JL and McMahon HT (2005) BAR domains and membrane curvature bringing 916

your curves to the BAR Biochem Soc Symp 72 223-231 917

Gibson DG (2011) Chapter fifteen - Enzymatic Assembly of Overlapping DNA Fragments 918

In Methods in Enzymology V Christopher ed (Academic Press) pp 349-361 919

Goedhart J von Stetten D Noirclerc-Savoye M Lelimousin M Joosen L Hink MA 920

van Weeren L Gadella TWJ and Royant A (2012) Structure-guided evolution of 921

cyan fluorescent proteins towards a quantum yield of 93 Nat Commun 3 751 922

Heinz S Liauw P Nickelsen J and Nowaczyk M (2016) Analysis of photosystem II 923

biogenesis in cyanobacteria Biochim Biophys Acta 1857 274-287 924

Hernaacutendez-Prieto M and Futschik M (2012) CyanoEXpress A web database for 925

exploration and visualisation of the integrated transcriptome of cyanobacterium 926

Synechocystis sp PCC6803 Bioinformation 8 634-638 927

Hernaacutendez-Prieto MA Semeniuk TA Giner-Lamia J and Futschik ME (2016) The 928

Transcriptional Landscape of the Photosynthetic Model Cyanobacterium 929

Synechocystis sp PCC6803 Sci Rep 6 22168 930

29

Huang F Fulda S Hagemann M and Norling B (2006) Proteomic screening of salt-931

stress-induced changes in plasma membranes of Synechocystis sp strain PCC 6803 932

Proteomics 6 910-920 933

Kirchhoff H (2013) Architectural switches in plant thylakoid membranes Photosynth Res 934

116 481-487 935

Klinkert B Elles I and Nickelsen J (2006) Translation of chloroplast psbD mRNA in 936

Chlamydomonas is controlled by a secondary RNA structure blocking the AUG start 937

codon Nucleic Acids Res 34 386-394 938

Klinkert B Ossenbuumlhl F Sikorski M Berry S Eichacker L and Nickelsen J (2004) 939

PratA a periplasmic tetratricopeptide repeat protein involved in biogenesis of 940

photosystem II in Synechocystis sp PCC 6803 J Biol Chem 279 44639-44644 941

Komenda J Nickelsen J Tichyacute M Praacutešil O Eichacker LA and Nixon PJ (2008) The 942

cyanobacterial homologue of HCF136YCF48 is a component of an early photosystem 943

II assembly complex and is important for both the efficient assembly and repair of 944

photosystem II in Synechocystis sp PCC 6803 J Biol Chem 283 22390-22399 945

Kopf M Klaumlhn S Scholz I Matthiessen JKF Hess WR and Voszlig B (2014) 946

Comparative analysis of the primary transcriptome of Synechocystis sp PCC 6803 947

DNA Res 21 527-539 948

Kunkel DD (1982) Thylakoid centers Structures associated with the cyanobacterial 949

photosynthetic membrane system Arch Microbiol 133 97-99 950

Liberton M Howard Berg R Heuser J Roth R and Pakrasi BH (2006) Ultrastructure 951

of the membrane systems in the unicellular cyanobacterium Synechocystis sp strain 952

PCC 6803 Protoplasma 227 129-138 953

Liberton M Saha R Jacobs JM Nguyen AY Gritsenko MA Smith RD 954

Koppenaal DW and Pakrasi HB (2016) Global Proteomic Analysis Reveals an 955

Exclusive Role of Thylakoid Membranes in Bioenergetics of a Model 956

Cyanobacterium Mol Cell Proteomics 15 2021-2032 957

Luque I and Ochoa de Alda JAG (2014) CURT1CAAD-containing aaRSs thylakoid 958

curvature and gene translation Trends Plant Sci 19 63-66 959

Marin K Stirnberg M Eisenhut M Kraumlmer R and Hagemann M (2006) Osmotic stress 960

in Synechocystis sp PCC 6803 low tolerance towards nonionic osmotic stress results 961

from lacking activation of glucosylglycerol accumulation Microbiology 152 2023-962

2030 963

Mullineaux CW (2005) Function and evolution of grana Trends Plant Sci 10 521-525 964

30

Mullineaux CW (2008) Biogenesis and dynamics of thylakoid membranes and the 965

photosynthetic apparatus In The Cyanobacteria A Herrero and E Flores eds 966

(Norfolk UK Caister Academic Press) pp 289ndash304 967

Nevo R Charuvi D Tsabari O and Reich Z (2012) Composition architecture and 968

dynamics of the photosynthetic apparatus in higher plants Plant J 70 157-176 969

Nickelsen J and Rengstl B (2013) Photosystem II assembly From cyanobacteria to plants 970

Annu Rev Plant Biol 64 609-635 971

Nickelsen J and Zerges W (2013) Thylakoid biogenesis has joined the new era of bacterial 972

cell biology Front Plant Sci 4 458 973

Nilsson F Simpson DJ Jansson C and Andersson B (1992) Ultrastructural and 974

biochemical characterization of a Synechocystis 6803 mutant with inactivated psbA 975

genes Arch Biochem Biophys 295 340-347 976

Odom WR Hodges R Chitnis PR and Guikema JA (1993) Characterization of 977

Synechocystis sp PCC 6803 in iron-supplied and iron-deficient media Plant Mol 978

Biol 23 1255-1264 979

Ossenbuumlhl F Inaba-Sulpice M Meurer J Soll J and Eichacker LA (2006) The 980

Synechocystis sp PCC 6803 Oxa1 homolog is essential for membrane integration of 981

reaction center precursor protein pD1 Plant Cell 18 2236-2246 982

Pisareva T Kwon J Oh J Kim S Ge C Wieslander Aring Choi J-S and Norling B 983

(2011) Model for Membrane Organization and Protein Sorting in the Cyanobacterium 984

Synechocystis sp PCC 6803 Inferred from Proteomics and Multivariate Sequence 985

Analyses J Proteome Res 10 3617-3631 986

Pribil M Labs M and Leister D (2014) Structure and dynamics of thylakoids in land 987

plants J Exp Bot 65 1955-1972 988

Rast A Heinz S and Nickelsen J (2015) Biogenesis of thylakoid membranes Biochim 989

Biophys Acta 1847 821-830 990

Rast A Rengstl B Heinz S Klingl A and Nickelsen J (2016) The role of Slr0151 a 991

tetratricopeptide repeat protein from Synechocystis sp PCC 6803 during Photosystem 992

II assembly and repair Front Plant Sci 7 605 993

Rengstl B Oster U Stengel A and Nickelsen J (2011) An Intermediate Membrane 994

Subfraction in Cyanobacteria Is Involved in an Assembly Network for Photosystem II 995

Biogenesis J Biol Chem 286 21944-21951 996

31

Rengstl B Knoppovaacute J Komenda J and Nickelsen J (2013) Characterization of a 997

Synechocystis double mutant lacking the photosystem II assembly factors YCF48 and 998

Sll0933 Planta 237 471-480 999

Rexroth S Mullineaux CW Ellinger D Sendtko E Roumlgner M and Koenig F (2011) 1000

The Plasma Membrane of the Cyanobacterium Gloeobacter violaceus Contains 1001

Segregated Bioenergetic Domains Plant Cell 23 2379-2390 1002

Rippka R Deruelles J Waterbury JB Herdman M and Stanier RY (1979) Generic 1003

Assignments Strain Histories and Properties of Pure Cultures of Cyanobacteria 1004

Microbiology 111 1-61 1005

Ruumltgers M and Schroda M (2013) A role of VIPP1 as a dynamic structure within 1006

thylakoid centers as sites of photosystem biogenesis Plant Signal Behav 8 e27037 1007

Sacharz J Bryan SJ Yu J Burroughs NJ Spence EM Nixon PJ and Mullineaux 1008

CW (2015) Sub-cellular location of FtsH proteases in the cyanobacterium1009

Synechocystis sp PCC 6803 suggests localised PSII repair zones in the thylakoid1010

membranes Mol Microbiol 96 448-4621011

Sandstroumlm S Park Y-I Oumlquist G and Gustafsson P (2001) CP43prime the isiA Gene 1012

Product Functions as an Excitation Energy Dissipator in the Cyanobacterium 1013

Synechococcus sp PCC 7942 Photochem Photobiol 74 431-437 1014

Schindelin J Arganda-Carreras I Frise E Kaynig V Longair M Pietzsch T 1015

Preibisch S Rueden C Saalfeld S Schmid B Tinevez J-Y White DJ 1016

Hartenstein V Eliceiri K Tomancak P and Cardona A (2012) Fiji an open-1017

source platform for biological-image analysis Nat Methods 9 676-682 1018

Schottkowski M Ratke J Oster U Nowaczyk M and Nickelsen J (2009a) Pitt a novel 1019

tetratricopeptide repeat protein involved in light-dependent chlorophyll biosynthesis 1020

and thylakoid membrane biogenesis in Synechocystis sp PCC 6803 Mol Plant 2 1021

1289-1297 1022

Schottkowski M Gkalympoudis S Tzekova N Stelljes C Schuumlnemann D Ankele E 1023

and Nickelsen J (2009b) Interaction of the periplasmic PratA factor and the PsbA 1024

(D1) protein during biogenesis of photosystem II in Synechocystis sp PCC 6803 J 1025

Biol Chem 284 1813-1819 1026

Selatildeo TT Zhang L Knoppovaaacute J Komenda J and Norling B (2016) Photosystem II 1027

Assembly Steps Take Place in the Thylakoid Membrane of the Cyanobacterium 1028

Synechocystis sp PCC6803 Plant Cell Physiol 57 878 1029

32

Spaumlt P Maček B and Forchhammer K (2015) Phosphoproteome of the cyanobacterium 1030

Synechocystis sp PCC 6803 and its dynamics during nitrogen starvation Front 1031

Microbiol 6 248 1032

Stengel A Guumlgel IL Hilger D Rengstl B Jung H and Nickelsen J (2012) Initial 1033

steps of photosystem II de novo assembly and preloading with manganese take place 1034

in biogenesis centers in Synechocystis Plant Cell 24 660-675 1035

Uniacke J and Zerges W (2007) Photosystem II assembly and repair are differentially 1036

localized in Chlamydomonas Plant Cell 19 3640-3654 1037

Uniacke J and Zerges W (2009) Chloroplast protein targeting involves localized 1038

translation in Chlamydomonas Proc Natl Acad Sci USA 106 1439-1444 1039

van de Meene AL Hohmann-Marriott M Vermaas WJ and Roberson R (2006) The 1040

three-dimensional structure of the cyanobacterium Synechocystis sp PCC 6803 Arch 1041

Microbiol 184 259-270 1042

van de Meene AML Sharp WP McDaniel JH Friedrich H Vermaas WFJ and 1043

Roberson RW (2012) Gross morphological changes in thylakoid membrane 1044

structure are associated with photosystem I deletion in Synechocystis sp PCC 6803 1045

Biochim Biophys Acta 1818 1427-1434 1046

Watanabe M and Ikeuchi M (2013) Phycobilisome architecture of a light-harvesting 1047

supercomplex Photosynth Res 116 265-276 1048

Wellburn AR and Lichtenthaler H (1984) Formulae and Program to Determine Total 1049

Carotenoids and Chlorophylls A and B of Leaf Extracts in Different Solvents In 1050

Advances in Photosynthesis Research Proceedings of the VIth International Congress 1051

on Photosynthesis Brussels Belgium August 1ndash6 1983 C Sybesma ed (Dordrecht 1052

Springer Netherlands) pp 9-12 1053

Wilde A Lunser K Ossenbuumlhl F Nickelsen J and Borner T (2001) Characterization of 1054

the cyanobacterial ycf37 mutation decreases the photosystem I content Biochem J 1055

357 211-216 1056

Wilson A Boulay C Wilde A Kerfeld CA and Kirilovsky D (2007) Light-Induced 1057

Energy Dissipation in Iron-Starved Cyanobacteria Roles of OCP and IsiA Proteins 1058

Plant Cell 19 656-672 1059

Xu M Bernaacutet G Singh A Mi H Roumlgner M Pakrasi HB and Ogawa T (2008) 1060

Properties of Mutants of Synechocystis sp Strain PCC 6803 Lacking Inorganic Carbon 1061

Sequestration Systems Plant Cell Physiol 49 1672-1677 1062

33

Yamamoto T Burke J Autz G and Jagendorf AT (1981) Bound ribosomes of Pea 1063

chloroplast thylakoid membranes location and release in vitro by high salt 1064

puromycin and RNase Plant Physiol 67 940-949 1065

Yang H Liao L Bo T Zhao L Sun X Lu X Norling B and Huang F (2014) 1066

Slr0151 in Synechocystis sp PCC 6803 is required for efficient repair of photosystem 1067

II under high-light condition J Integr Plant Biol 56 1136-1150 1068

Yeremenko N Kouřil R Ihalainen JA DHaene S van Oosterwijk N 1069

Andrizhiyevskaya EG Keegstra W Dekker HL Hagemann M Boekema EJ 1070

Matthijs HCP and Dekker JP (2004) Supramolecular Organization and Dual 1071

Function of the IsiA Chlorophyll-Binding Protein in Cyanobacteria Biochemistry 43 1072

10308-10313 1073

Zak E Norling B Maitra R Huang F Andersson B and Pakrasi HB (2001) The 1074

initial steps of biogenesis of cyanobacterial photosystems occur in plasma membranes 1075

Proc Natl Acad Sci USA 98 13443-13448 1076

Zang X Liu B Liu S Arunakumara KKIU and Zhang X (2007) Optimum 1077

Conditions for Transformation of Synechocystis sp PCC 6803 J Microbiol 45 241-1078

245 1079

Zhang L and Sakamoto W (2015) Possible function of VIPP1 in maintaining chloroplast 1080

membranes Biochim Biophys Acta 1847 831-837 1081

Zimmerberg J and Kozlov MM (2006) How proteins produce cellular membrane 1082

curvature Nat Rev Mol Cell Biol 7 9-19 1083

Zoumlfel P (1988) Statistik in der Praxis (Stuttgart Germany Gustav Fischer Verlag) 1084

1085

34

Figure Legends 1086

Figure 1 General characteristics of CurT A) Sequence alignment of CurT and CURT1A-D 1087

from A thaliana Predicted chloroplast transit-peptide sequences of CURT1A-D are omitted 1088

(Armbruster et al 2013) Positions of predicted C-terminal transmembrane domains (TDM) 1089

are marked (black bar) as is the position of the predicted amphipathic N-terminal helix in 1090

CurT (red bar) The green bar denotes the peptide sequence used for antibody production 1091

Identical and related amino acids that are conserved in 100 80 and 60 of the sequences 1092

are highlighted in black dark grey and light grey respectively B) Helical-wheel 1093

representation of the N-terminal amphipathic helix of CurT (red bar in A) The color code 1094

reflects the physicochemical properties of amino-acid side-chains green polar and 1095

uncharged blue polar and positively charged red polar and negatively charged yellow 1096

hydrophobic C) Solubility of CurT Membrane-associated proteins (50 microg) from wild-type 1097

cells were extracted with 5 mM HEPES (pH 76) containing either 1 M NaCl 01 M Na2CO3 1098

4 M urea 01 Triton X-100 or no additional solute After separation of membrane-bound 1099

(M) and solubilized (S) proteins by centrifugation proteins were fractionated by SDS-PAGE1100

and CurT was immunodetected on immunoblots As a control the integral membrane protein 1101

CP47 from PSII was analyzed in parallel D) Transmission electron micrographs of negatively 1102

stained liposomes Cell-free expression (CFE) of CurT and A thaliana CURT1A was 1103

performed in the presence of liposomes similar in composition to the lipids of the thylakoid 1104

membrane Liposomes before and after cell-free protein expression in the absence of DNA 1105

served as negative controls Black arrowheads indicate tubular connections between 1106

liposomes Scale bars 250 nm 1107

1108

Figure 2 Ultrastructural analysis of curT- cells Transmission electron micrographs of typical 1109

wild-type (A) and curT- (B-D) Synechocystis 6803 cells taken at 44000times (A B) and 28000times 1110

(C D) magnification respectively Ultrathin sections (35 to 45 nm) of cryofixed samples 1111

were stained with osmium tetroxide and post-stained using lead citrate Arrowheads indicate 1112

biogenesis centers Scale bars 200 nm (A B) and 500 nm (C D) respectively 1113

1114

Figure 3 Accumulation of components of photosynthetic complexes in the curT- mutant A) 1115

Whole cell extracts (30 microg protein) from wild-type and curT- strains were fractionated by 1116

SDS-PAGE and analyzed on immunoblots using the indicated antibodies B) The histogram 1117

shows levels of the indicated proteins in curT- extracts relative to wild-type samples (dashed 1118

red line) Data are means plusmn SD of three independent experiments Significant differences from 1119

35

wild-type protein levels according to Studentrsquos t-test with error probabilities of 5 and 1 1120

are indicated by and respectively 1121

1122

Figure 4 P700+ reduction kinetics and high-light effects in curT- cells A) Averaged traces 1123

(10 single measurements) of P700+ decay after complete oxidation by a 50-ms multiple 1124

turnover pulse (10000 micromol photons m-2 s-1) in the absence and presence of 10 microM DCMU 1125

B) Rate constants for P700+ reduction were obtained by fitting of the data with single1126

exponential functions Error bars indicate the SD of three independent measurements C) 1127

Impact of light intensity on the (relative) electron transport rate (rETR) Cells were exposed to 1128

gradually increasing light intensities which resulted in increasing electron transport until the 1129

capacity limit was reached PAR light intensity (micromol photons m-2 s-1) Error bars indicate the 1130

SD of three independent measurements D) D1 protein level in wild-type and curT- after high-1131

light treatment (800 micromol photons m-2s-1) in the presence and absence of lincomycin Samples 1132

were taken every 30 min and processed as in Figure 3 to determine the level of D1 present 1133

100 refers to wild-type D1 level at the beginning of the experiment 1134

1135

Figure 5 PSII assembly in curT- cells A) BNSDS-PAGE of membrane proteins Membrane 1136

fractions from wild-type and curT- cells were solubilized with 13 n-dodecyl-β-maltoside 1137

and proteins were fractionated by two-dimensional BNSDS-PAGE blotted and probed with 1138

antibodies against the PSII subunits D1 D2 CP47 and CP43 Wild-type blots were also 1139

probed with the αCurT antibody The sizes of marker proteins and the positions of PSII 1140

assembly intermediates (RCCII RCCI RC47) are shown above and below each image B) In 1141

vivo pulse labeling of membrane proteins with 35S Pulse-labeled PSII core proteins were 1142

separated via BNSDS-PAGE and visualized by autoradiography 1143

1144

Figure 6 Loss of CurT induces stress A) Low-temperature (77 K) fluorescence emission of 1145

Synechocystis 6803 wild-type (blue) and curT- (red) cells excited at 440 nm The spectra were 1146

normalized to the added fluorescein standard B) Low-temperature (77 K) fluorescence 1147

emission of Synechocystis 6803 wild-type (blue) and curT- (red) excited at 580 nm The 1148

spectra were normalized to 780 nm C) Level of IsiA in the curT- mutant relative to the wild-1149

type A mean value of 368 plusmn 96 (SD) was determined from three independent experiments 1150

1151

Figure 7 Membrane sublocalization of PSII-related factors Cell extracts from wild-type and 1152

curT- cells were fractionated by two consecutive rounds of sucrose-density gradient 1153

36

centrifugation (Schottkowski et al 2009b) The second linear gradient (20-60 sucrose) was 1154

apportioned into 14 fractions which were analyzed by immunoblotting using the indicated 1155

antibodies Fractions 1ndash6 represent PDMs and fractions 7ndash14 thylakoid membranes (TMs) 1156

To facilitate comparison between gradients sample volumes were normalized to the volume 1157

of fraction 7 that contained 40 microg of protein 1158

1159

Figure 8 Live-cell imaging of the curT-CFP strain by fluorescence microscopy In the curT-1160

CFP strain the native curT gene has been replaced by a CFP-tagged version resulting in the 1161

expression of the CurT-CFP fusion protein under the control of the native promotor A) 1162

Close-up views of the mid-cell plane in the CFP and far-red autofluorescence channels shown 1163

in slice 7 in panel B B) Synechocystis 6803 cells expressing CurT C-terminally fused to the 1164

mTurquoise2 variant of CFP from its native chromosomal promoter The two imaging 1165

channels are displayed as Z-axis montages (auto-scaled contrast step size 250 nm) in 1166

grayscale and color composite configuration The thylakoid autofluorescent channel as 1167

imaged in far-red fluorescence is depicted in magenta and CurT signal as imaged in cyan 1168

fluorescence is depicted in cyan C) Fluorescence intensity profiles of the two channels along 1169

the autofluorescent peripheral cell ldquoringrdquo are shown for slice 7 The maximum projection of 1170

the entire Z montage is also shown Scale bars (light grey) 2 microm 1171

1172

Figure 9 Immunofluorescence detection of CurT A) Close-ups of slice 5 in panel B B) 1173

Wild-type Synechocystis 6803 cells labeled with αCurT antibodies and detected with Oregon 1174

Green-conjugated secondary antibodies The Z-axis montages are shown as in Figure 8B 1175

except that the step size is 280 nm (1 to 10) C) Intensity profiles of the two channels along 1176

the autofluorescent peripheral cell ldquoringrdquo are shown for slice 5 The maximum projection of 1177

the entire Z montage is also shown Scale bars (light grey) 2 microm 1178

1179

Figure 10 Subcellular localization of CurT Ultrathin sections of wild-type Synechocystis 1180

6803 cells were incubated with rabbit αCurT prior to incubation with gold-conjugated goat 1181

anti-rabbit IgG A) Negative control (wild-type processed without addition of primary 1182

antibody) B C) Immunogold-labeled sections showing CurT localization at the cytoplasmic 1183

side of the thylakoid membrane D) Cluster formation of CurT signals at a putative biogenesis 1184

center from C E) Biogenesis center from the same cell (C) without any obvious CurT 1185

clustering of gold particles F) Schematic depiction of a wild-type cell (from Figure 2A) with 1186

color-coded curved membranes green = thylakoids that follow the curvature of the cell red = 1187

37

thylakoids that bend away from the plasma membrane yellow = thylakoids that bend toward 1188

the plasma membrane to converge on sites of biogenesis centers G) Relative distribution of 1189

gold signals between convex (dark color) and concave (light color) sides of membranes (n = 1190

1584 signals from a total of 95 cells) The undifferentiated overall signal distribution is given 1191

in blue Bars = 200 nm (overview) and 100 nm (details) 1192

1193

Figure 11 Differentially modified forms of CurT are found in different complexes in PDMs 1194

and thylakoid membranes Samples were isolated by fractionation of wild-type membranes 1195

via two consecutive sucrose density gradients according to Schottkowski et al (2009b) After 1196

density centrifugation samples were applied to BNSDS-PAGE analysis (A) or isoelectric 1197

focusing (B) Numbers on the right indicate the respective fraction from the second gradient 1198

(see Figure 7) Fraction 5 represents the PDMs and fraction 9 the thylakoid membrane 1199

1200

Figure 12 Loss of CurT increases sensitivity to abiotic stress A B) Doubling times of wild-1201

type and curT- under salt stress (A) or osmotic stress (B) Doubling times are means plusmn SD of 1202

three independent cultures C) Localization of CurT-CFP under salt and osmotic stress 1203

Samples were examined as described in Figure 8 Scale bars 1 microm D) Protein levels of wild-1204

type cells after growth in BG11 medium containing 500 mM NaCl Samples were analyzed on 1205

the same gel but unrelated samples between the presented signals were omitted E) 1206

Membrane preparations obtained from wild-type cells wild-type cells grown in the presence 1207

of 500 mM NaCl and curT- cells were subjected to the first gradient step in the membrane 1208

fractionation scheme The gradient was divided into five fractions and 10 of fractions I-IV 1209

and 02 of fraction V were analyzed by SDS-PAGE Fraction II includes the plasma 1210

membrane and fraction V consists of PratA-defined membrane and thylakoid membrane 1211

1212

Figure 13 Model of CurT distribution at convergence zones in Synechocystis 6803 The 1213

distribution of CurT in thylakoid (green) and plasma membranes (brown) is shown The 1214

pattern of localization of CurT in the thylakoid membrane is derived from membrane 1215

fractionation via sucrose density centrifugation fluorescence-based detection of the CurT-1216

CFP fusion and endogenous CurT and immunogold labeling experiments (Figures 7-10) The 1217

different CurT variants a b c and d identified in the IEF experiments (Figure 11) are depicted 1218

in yellow pink blue and black respectively CurT present in the plasma membrane is 1219

highlighted in gray as its precise nature and role remain to be defined (Figure 12) 1220

Membranes are represented as lipid bilayers Convex and concave faces of bent thylakoid 1221

38

sheets are indicated by black arrows The PDM which is dedicated to PSII assembly and 1222

repair is depicted in blue The dotted blue line emphasizes that the ultrastructure in this region 1223

has not yet been fully resolved PP periplasm PM plasma membrane TM thylakoid 1224

membrane L lumen PDM PratA-defined membrane 1225

1226

Tables 1227

Table 1 Physiological characteristics of the curT- mutant 1228

Strain Doubling time [h]

Oxygen Evolution[nmol h-1 OD750

-1]c

Chlorophyll content

[microg OD750-1]

d

Cell size [microm]e

Cell number [ml-1 OD750

-1]f

Wild type 817plusmn017a 1600plusmn042

b 1933plusmn187 251plusmn014 264plusmn020 390plusmn006 x 107

curT- 1259plusmn020a 3226plusmn056

b 1074plusmn20 195plusmn029 274plusmn044 367plusmn016 x 107

1229 abDoubling times in the presence (a) or absence (b) of 5 mM glucose measured under 1230

continuous illumination at 30 micromol photons m-2 s-1 and CO2-limiting conditions cOxygen 1231

evolution is expressed in nmol O2 produced per hour per OD750 unit dChlorophyll content is 1232

expressed in microg OD750-1 eThe diameter of non-dividing cells is presented in microm fCell number 1233

was determined per ml per OD750 Data are means plusmn SD of at least three independent 1234

experiments 1235

1236

Parsed CitationsAllen JF de Paula WBM Puthiyaveetil S and Nield J (2011) A structural phylogenetic map for chloroplast photosynthesisTrends Plant Sci 16 645-655

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Anderson JM Horton P Kim E-H and Chow WS (2012) Towards elucidation of dynamic structural changes of plant thylakoidarchitecture Philos Trans R Soc Lond B Biol Sci 367 3515-3524

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Armbruster U Zuumlhlke J Rengstl B Kreller R Makarenko E Ruumlhle T Schuumlnemann D Jahns P Weisshaar B NickelsenJ and Leister D (2010) The Arabidopsis thylakoid protein PAM68 is required for efficient D1 biogenesis and photosystem IIassembly Plant Cell 22 3439-3460

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Armbruster U Labs M Pribil M Viola S Xu W Scharfenberg M Hertle AP Rojahn U Jensen PE Rappaport F JoliotP Doumlrmann P Wanner G and Leister D (2013) Arabidopsis CURVATURE THYLAKOID1 proteins modify thylakoid architectureby inducing membrane curvature Plant Cell 25 2661-2678

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Aseeva E Ossenbuumlhl F Sippel C Cho WK Stein B Eichacker LA Meurer J Wanner G Westhoff P Soll J andVothknecht UC (2007) Vipp1 is required for basic thylakoid membrane formation but not for the assembly of thylakoid proteincomplexes Plant Physiol Biochem 45 119-128

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Bartsevich VV and Pakrasi HB (1995) Molecular identification of an ABC transporter complex for manganese analysis of acyanobacterial mutant strain impaired in the photosynthetic oxygen evolution process EMBO J 14 1845-1853

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Bartsevich VV and Pakrasi HB (1996) Manganese transport in the cyanobacterium Synechocystis sp PCC 6803 J Biol Chem271 26057-26061

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Bernaacutet G Waschewski N and Roumlgner M (2009) Towards efficient hydrogen production the impact of antenna size andexternal factors on electron transport dynamics in Synechocystis PCC 6803 Photosynth Res 99 205-216

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Boehm M Yu J Krynicka V Barker M Tichy M Komenda J Nixon PJ and Nield J (2012) Subunit Organization of aSynechocystis Hetero-Oligomeric Thylakoid FtsH Complex Involved in Photosystem II Repair Plant Cell 24 3669-3683

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Bradford MM (1976) A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle ofprotein-dye binding Anal Biochem 72 248-254

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Chang L Liu X Li Y Liu C-C Yang F Zhao J and Sui S-F (2015) Structural organization of an intact phycobilisome and itsassociation with photosystem II Cell Res 25 726-737

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Danielsson R Suorsa M Paakkarinen V Albertsson P-Aring Styring S Aro E-M and Mamedov F (2006) Dimeric andmonomeric organization of photosystem II Distribution of five distinct complexes in the different domains of the thylakoidmembrane J Biol Chem 281 14241-14249

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Daum B Nicastro D Austin J McIntosh JR and Kuumlhlbrandt W (2010) Arrangement of photosystem II and ATP synthase in

16

therefore seems possible that the absence of biogenesis centers in curT- leads to 516

mislocalization of the FtsH2FtsH3 complex and less effective D1 degradation 517

Moreover a PSII related-function for CurT is supported by a meta-analysis of the 518

Synechocystis 6803 transcriptome When the CyanoEXpress 22 database (Hernaacutendez-Prieto 519

and Futschik 2012 Hernaacutendez-Prieto et al 2016) was queried for genes co-expressed with 520

curT (slr0483) genes for five PSII subunits ndash psbE psbO psbF psbL and psb30 ndash were 521

found among the first ten hits (Supplemental Table 4) From this we infer that biogenic 522

centers do not play an essential role in the assembly of all photosynthetic complexes but 523

serve to enhance PSII assemblyrepair possibly through the efficient delivery of Mn2+ 524

Residual PSII in curT- cells is likely to be supplied with cytoplasmic Mn2+ via a second 525

independently operating ABC transporter-based system in the plasma membrane named the 526

Mnt pathway (Bartsevich and Pakrasi 1995 Bartsevich and Pakrasi 1996) 527

Formally we cannot exclude that CurT is directly involved in the PSII assembly 528

process However considering CurTrsquos membrane bending capacity and the mutant phenotype 529

(Figure 1D and Figure 2) it appears more likely that CurT forms cellular substructures for 530

efficient PSII biogenesis ie biogenesis centers 531

As mentioned above some ultrastructural features of biogenesis centers have emerged 532

from studies employing EM-based tomography (van de Meene et al 2006) To date however 533

a high-resolution picture of the precise membrane architecture within these centers remains 534

elusive In particular whether or not a direct connection between plasma membrane and 535

thylakoids exists continues to be debated As recently discussed and in line with this gap in 536

knowledge different membrane fractionation techniques have revealed different distributions 537

of PSII-related subunits and assembly factors between plasma and thylakoid membranes 538

(Heinz et al 2016 Liberton et al 2016 Selatildeo et al 2016) The overall picture that emerges 539

is that the initial hypothesis that PSII biogenesis is initiated at the plasma membrane is no 540

longer tenable whereas a specialized thylakoid sub-fraction like the PDMs that make contact 541

with the plasma membrane could explain many of the available data and thus clarify some 542

aspects of the debate (Zak et al 2001 Pisareva et al 2011 Rast et al 2015) Moreover it 543

has previously been hypothesized that ldquoribosome-decorated membrane-like complexesrdquo 544

forming at the innermost thylakoid sheet might represent biogenic compartments (van de 545

Meene et al 2006 Mullineaux 2008) Whether these structures are affected in curT- cannot 546

be judged based on our TEM analysis but requires ultrastructural data of higher resolution 547

However the accessibility of thylakoids for ribosomes should be increased in the less 548

compressed membrane system of curT- (Figure 2B-D) 549

17

A scenario similar to that of Synechocystis 6803 holds for the situation in chloroplasts 550

of the green alga Chlamydomonas reinhardtii in which de novo PSII biogenesis has been 551

shown to be initiated in punctate regions named T-zones located close to the pyrenoid 552

(Uniacke and Zerges 2007) Unlike the mRNAs for the PSII components neither RNAs for 553

PSI subunits nor PSI assembly factors are localized to T-zones indicating that PSI and PSII 554

assembly processes are spatially separated (Uniacke and Zerges 2009 Nickelsen and Zerges 555

2013 Rast et al 2015) Interestingly a recent cryoelectron tomography study demonstrated 556

that next to T-zones at the chloroplast base-lobe junction the inner chloroplast envelope 557

exhibits invaginationsconnections to thylakoids that structurally resemble the organization of 558

cyanobacterial biogenesis centers (Engel et al 2015) For future investigations it will be 559

interesting to see if a homolog of the CURT1 family is involved in the formation of these 560

structures in C reinhardtii 561

562

Evolution of CURT1 function 563

Homologs of the CURT1 protein family can be found throughout cyanobacteria green 564

algae and plants (Armbruster et al 2013) The Arabidopsis CURT1A-D proteins have 565

recently been shown to induce bending of thylakoid membranes at grana margin regions 566

(Armbruster et al 2013) Interestingly and in contrast to the situation in Synechocystis 6803 567

their inactivation did not result in severe photosynthetic deficiencies although the thylakoids 568

formed lacked defined grana stacks Nevertheless the data available support the idea that the 569

function of thylakoid membrane structures that were regarded as being independent ie 570

cyanobacterial biogenesis centers and grana are closely related Intriguingly both of these 571

thylakoid membrane structures are dedicated to aspects of PSII function but do not involve 572

PSI (Pribil et al 2014) In both the prokaryotic and eukaryotic systems CURT1 homologs 573

appear to bend thylakoid membranes as indicated by (i) the distortion of membrane 574

ultrastructure seen in mutants devoid of curved thylakoids (ii) the localization of CURT1 575

homologs at grana margins and their local concentration at biogenesis centers (iii) the in vitro 576

membrane-curving activity of both CURT forms The phenotypic differences between 577

A thaliana and Synechocystis 6803 mutants may however be attributable to the different 578

functions of the membrane sub-compartments affected in the two model organisms Whereas 579

the role of grana is still under debate one function of the cyanobacterial biogenesis centers is 580

the above-mentioned high-throughput uptake of Mn2+ ions for efficient assembly of PSII 581

(Stengel et al 2012 Nickelsen and Rengstl 2013 Pribil et al 2014) However it appears 582

that in both cases the primary function of CURT1 proteins is to generate curved membrane 583

18

regions These discoveries suggest that until now two independently observed structures ie 584

cyanobacterial thylakoid biogenesis centers and chloroplast grana regions are closely related 585

The degree of curvature is much less pronounced in the cyanobacterial system As previously 586

discussed it was probably the subsequent evolution of a membrane-localized light-harvesting 587

system in chloroplasts that made the formation of tightly curved grana thylakoids possible 588

(Mullineaux 2005 Nevo et al 2012 Pribil et al 2014) 589

590

CurT is involved in osmotic stress response 591

One unexpected phenotype of the curT- mutant is its sensitivity to osmotic stress 592

These data revealed that in addition to shaping membranes CurT also influences their 593

functional integrity This latter function might be intrinsic to CurT or could be mediated by 594

the VIPP1 protein which has been shown to be required for membrane maintenance in 595

bacteria and chloroplasts probably by acting as a supplier of lipids (for an overview see 596

Zhang and Sakamoto 2015) Both factors accumulate in the plasma membrane upon osmotic 597

stress but VIPP1 localization is not severely affected by CurT inactivation which suggests 598

that VIPP1 operates independently of CurT In agreement with this repeated co-599

immunoprecipitations revealed no interaction between both proteins Therefore it remains to 600

be established whether a direct functional relationship between them exists 601

Previous investigations of osmotic stress in Synechocystis 6803 showed a kidney-602

shaped form of wild-type cells under very high concentrations of osmotically active 603

compounds (Marin et al 2006) The cells were severely deformed indicating changes in the 604

structure of the cellular envelope Since CurT shifts towards the plasma membrane already 605

under lower osmolyte concentrations we suggest a stabilizing function of CurT in the plasma 606

membrane CurT might be necessary to tolerate the forces trying to deform the cells under 607

osmotic stress 608

In conclusion this analysis has identified a crucial determinant for shaping and 609

maintaining the cyanobacterial thylakoid membrane system ie CurT a homolog of the 610

grana-forming CURT1 protein family from A thaliana In particular CurT is involved in the 611

formation of specific thylakoid substructures close to the plasma membrane at which PSII is 612

assembledrepaired Future work will dissect the precise ultrastructure of these centers and 613

enable us to elaborate a molecular model for the spatiotemporal organization of PSII assembly 614

in cyanobacteria 615

616

19

Methods 617

Strains and growth conditions 618

Wild-type and mutant Synechocystis 6803 cells were grown on solid or in liquid BG 619

11 medium (Rippka et al 1979) supplemented with 5 mM glucose (unless indicated 620

otherwise) at 30degC under continuous illumination at a photon irradiance of 30 μmol m-2 s-1 of 621

white light For growth during high-light experiments for investigation of D1 repair cells 622

were cultivated in a FMT150 photobioreactor (Photon Systems Instruments Draacutesov Czech 623

Republic) at 800 micromol photons m-2 s-1 in the presence or absence of lincomycin (100 microgml) 624

Cell density was monitored photometrically at 750 nm Doubling times were determined after 625

two days of growth To generate the insertion mutant curT- the curT gene (slr0483) was first 626

amplified from wild-type genomic DNA by PCR using the primer pair 04835 627

(GAAGCCTATTTAGCTAAGGCCGAAAG) and 04833 628

(TAGTACCTGGTCTTCCATGGCGT) and the resulting fragment was cloned into the 629

Bluescript pKS vector (Stratagene Waldbronn Germany) A kanamycin resistance cassette 630

was then inserted into the single AgeI restriction site (159 bp downstream of the start codon) 631

and this disruption construct was used to replace the wild-type gene as described (Wilde et al 632

2001) 633

634

Bioinformatic and computational analysis 635

CURT1 sequences of Synechocystis 6803 were obtained from CyanoBase 636

(httpgenomekazusaorjpcyanobaseSynechocystis) and CURT1 homologs in other 637

organisms were retrieved from NCBIBLAST (httpblastncbinlmnihgovBlastcgi) 638

Numbers and positions of putative transmembrane domains in the predicted proteins were 639

determined with TMHMM20 (httpwwwcbsdtudkservicesTMHMM) The sequence for 640

the N-terminal amphipathic helix was predicted by Jpred 3 641

(httpwwwcompbiodundeeacukwww-jpred) and plotted using a helical wheel projection 642

script (httprzlabucreduscriptswheelwheelcgi) The programs ClustalW2 643

(httpwwwebiacuktoolsclustalw2) and GeneDoc (httpwwwpscedubiomedgenedoc) 644

were used to generate multiple alignments of amino acid sequences Quantitative analysis of 645

immunoblots was performed with the AIDA Image Analyzer V325 (Raytest 646

Isotopenmessgeraumlte GmbH Straubenhardt Germany) 647

Co-expression patterns of curT were analyzed using the CyanoEXpress 22 database 648

(httpcyanoexpresssysbiolabeu Hernaacutendez-Prieto and Futschik 2012 Hernaacutendez-Prieto et 649

al 2016) 650

20

651

Measurement of chlorophyll concentration and oxygen production 652

Determination of chlorophyll content was carried out according to Wellburn and 653

Lichtenthaler (1984) For oxygen evolution measurements cells were grown in BG-11 654

without glucose harvested in mid-log phase and diluted to an OD750 nm = 05 Oxygen 655

evolution rates were measured with a Clark-type oxygen electrode (Hansatech Instruments 656

Ltd Kingrsquos Lynn Norfolk UK) at 1000 micromol photons m-2 s-1 (cool white light) after 5 min of 657

dark acclimation Oxygen evolution under saturating light conditions was measured without 658

any additives 659

660

Cell size and cell number estimation 661

Synechocystis 6803 strains were grown in liquid BG11 media containing 5 mM 662

glucose For cell size estimation the cells were analyzed with a confocal laser scanning 663

microscope TCS SP5 (Leica Wetzlar Germany) The diameter of the cells was measured 664

with the LAS AF Lite software (Leica Wetzlar Germany) Cells that were about to divide 665

were not taken into account For the determination of cell number cultures were set to an 666

OD750 = 1 and analyzed by using a Neubauer counting chamber (Paul Marienfeld GmbH amp 667

Co KG Lauda-Koumlnigshofen Germany) Statistical significance was determined by Studentrsquos 668

t-test 669

670

Measurements of P700+ reduction kinetics and relative electron transport rates 671

P700+ reduction kinetics and changes in chlorophyll fluorescence yield at different 672

light intensities were measured at a chlorophyll concentration of 5 microgml with a Dual-PAM-673

100 instrument (Heinz Walz GmbH Effeltrich Germany) Complete P700 oxidation was 674

achieved by a 50-ms multiple turnover pulse (10000 micromol photons m-2 s-1) after 2 min of dark 675

incubation P700+ reduction kinetics were recorded without any additions as well as in the 676

presence of 10 microM DCMU Ten technical replicates were averaged and fitted with single 677

exponential functions Data interpretation was done according to Bernaacutet et al (2009) 678

Light saturation measurements were performed according to Xu et al (2008) The 679

actinic light intensity was increased stepwise from 0 to 665 micromol photons m-2 s-1 with 30-s 680

adaptation periods Maximal fluorescence yields were obtained by applying saturating light 681

pulses (duration 600 ms intensity 10000 micromol photons m-2 s-1) 682

683

Low-temperature fluorescence measurements 684

21

Fluorescence emission spectra were measured with an AMINCO Bowman Series 2 685

Luminescence Spectrometer Wild-type and curT- cells were grown in the presence of 5 mM 686

glucose to mid log-phase and concentrated to 25 microgml chlorophyll adding 2 microM fluorescein 687

as an internal standard Samples (1 ml) were transferred to thin glass tubes dark-adapted for 688

30 min at 30 degC and shock frozen in liquid N2 To quantify chlorophyllfluorescein and 689

phycobilisome-mediated fluorescence samples were excited and emission recorded at 440 690

nm510 nm (chlorophyll and fluorescein excitationmax fluorescein emission) and 580 691

nm685 nm respectively Emission was scanned at 490-800 nm or at 640-800 nm 692

respectively 693

694

Antibody production and protein analysis 695

For generation of an αCurT antibody the N-terminal coding region of curT (amino 696

acid positions 1-58) was amplified by PCR using primers N04835 697

(AAGGATCCGTGGGCCGTAAACATTCAA) and N04833 698

(AAGTCGACGCACTTCCCACACCGGTTGTA) and cloned into the BamHI and XhoI sites 699

of the pGEX-4T-1 vector (GE Healthcare Freiburg Germany) Expression of the GST fusion 700

protein in Escherichia coli BL21(DE3) and subsequent affinity purification on Glutathione-701

Sepharose 4B (GE Healthcare) were carried out as described (Schottkowski et al 2009b) A 702

polyclonal antiserum was raised against this protein fragment in rabbits (Pineda Berlin 703

Germany) Other primary antibodies used in this study have been described previously ie 704

αpD1 (Schottkowski et al 2009b) αD1 (Schottkowski et al 2009b) αD2 (Klinkert et al 705

2006) αPratA (Klinkert et al 2004) αYcf48 (Rengstl et al 2011) αPitt (Schottkowski et 706

al 2009a) αPOR (Schottkowski et al 2009a) αYidC (Ossenbuumlhl et al 2006) αVIPP1 707

(Aseeva et al 2007) αSll0933 (Armbruster et al 2010) and αSlr0151 (Rast et al 2016) or 708

were purchased from Agrisera (Vaumlnnaumls Sweden) ie αCP43 αCP47 αPsaA αCyt f 709

αRbcL αIsiA The αGFP-HRP antibody was acquired from Miltenyi Biotech (Bergisch 710

Gladbach Germany) 711

Protein concentrations were determined according to Bradford (1976) using RotiQuant 712

(Carl Roth GmbH amp Co KG Karlsruhe Germany) Protein extraction membrane 713

fractionation on sucrose-density gradients and quantification of Western signal intensities was 714

performed as described previously (Rengstl et al 2011) Solubility properties of CurT were 715

determined according to Schottkowski et al (2009a) 716

22

Sucrose-density centrifugation separating PDM and thylakoid membrane fractions by 717

two consecutive gradients was carried out as described previously (Schottkowski et al 718

2009b Rengstl et al 2011) 719

Two-dimensional fractionations of cyanobacterial membrane proteins via BNSDS-720

PAGE and of pulse-labeled proteins by BNSDS-PAGE were performed as previously 721

reported (Klinkert et al 2004 Schottkowski et al 2009b Rengstl et al 2013) For the 722

analysis of native complexes in fractions obtained by sucrose-density centrifugation the 723

volume corresponding to 350 microg of protein in fraction 7 was applied to BNSDS-PAGE 724

For isoelectric focusing (IEF) the volume corresponding to 50 microg of protein from 725

fraction 7 in 200 microl of IEF buffer (8 M urea 4 CHAPS 1 IPG buffer pH 4-7 (GE 726

Healthcare)) was applied to an 11-cm Immobiline DryStrip pH 4-7 (GE Healthcare) in a 727

Protean IEF Cell (Bio-Rad Munich Germany) Strips were rehydrated for 12 h at 20 degC and 728

50V Focusing was carried out in the following steps 500 V rapid 1500 Vh 1000 V linear 729

880 Vh 6000 V linear 9680 Vh 6000 V rapid 5390 Vh 50 microA per gel focus temperature 730

20degC Subsequently the strips were incubated in equilibration buffer I (6 M urea 0375 M 731

Tris pH 88 20 glycerol 2 SDS 2 DTT) and equilibration buffer II (6 M urea 0375 732

M Tris pH 88 20 glycerol 2 SDS 25 iodoacetamide) for 10 min in each buffer 733

Then the IEF strips were applied to second-dimension SDS-PAGE 734

735

Transmission electron microscopy and immunogold labeling 736

Sample preparation for transmission electron microscopy including freeze substitution 737

and immunogold labeling of CurT was performed as described previously (Stengel et al 738

2012) Ultrathin sections were cut to thicknesses of 35 - 45 nm and 45 - 65 nm for 739

ultrastructural analyses and immunogold labeling respectively For immunogold labeling 740

sections collected on collodion-coated Ni grids were incubated for 18 h at 4degC with (rabbit) 741

αCurT (diluted 1100 1500 11000 or 14000 in blocking buffer (5 fetal calf serum) with 742

005 Tween 20) and further processed as described previously (Stengel et al 2012) As a 743

negative control wild-type Synechocystis 6803 cells were incubated without the primary 744

antibody and exposed to the gold-labeled anti-rabbit IgG To image the ultrastructure and the 745

immunogold-treated samples a Fei Morgagni 268 transmission electron microscope was used 746

and micrographs were taken at 80 kV 747

To avoid errors in the interpretation of the immunogold labeling experiment only 748

signals which were unambiguously localized to distinctly visible thylakoid membranes were 749

taken into account For each cell different regions (see Figure 10F) were defined and in each 750

23

region the signals on the convex and concave sides of the thylakoid membrane were analyzed 751

separately (see Supplemental Figure 11 for representative counts) Statistical significance was 752

assessed by χ2 test (Zoumlfel 1988) 753

For the analysis of clusters of CurT signals in biogenesis centers a cluster was defined 754

as a minimum of four signals in close proximity Overall 219 biogenesis centers were 755

examined with regard to CurT cluster formation 756

757

Preparation of proteoliposomes 758

Liposomes with a lipid mixture of 25 monogalactosyl diacylglycerol 42 759

digalactosyl diacylglycerol 16 sulfoquinovosyl diacylglycerol and 17 760

phosphatidylglycerol (Lipid Products South Nutfield UK) were prepared as described 761

previously (Armbruster et al 2013) To generate proteoliposomes CurT and CURT1A 762

proteins were expressed in the presence of liposomes for 3 h at 37degC using a PURExpress In 763

Vitro Protein Synthesis Kit (New England Biolabs Ipswich MA USA) The liposomes were 764

separated from the mix by centrifugation in a discontinuous sucrose gradient (100000 g 18 765

h) Subsequently the fraction containing the liposomes was extracted and dialyzed against 20 766

mM HEPES (pH 76) For transmission electron microscopy the proteoliposomes were 767

negatively stained with 1 uranyl acetate on a carbon-coated copper grid Micrographs were 768

taken on a Fei Morgagni 268 TEM at 80 kV 769

770

curT-CFP strain generation 771

Gibson assembly was used for single-step cloning (Gibson 2011) of the slr0483 gene 772

(together with its ~08 kb upstream region) the mTurquoise2 gene fragment the gentamycin-773

resistance cassette (aacC1) and an ~17-kb downstream region of slr0483 into pBR322 774

cleaved with EcoRV and NheI The slr0483 gene was fused in frame to the codon-optimized 775

mTurquoise2 (DNA20) preceded by a linker sequence encoding GSGSG The resulting 776

plasmid was used to transform Synechocystis 6803 as described previously (Zang et al 2007) 777

After ~ 10 days of incubation on BG11-GelRite (15 ) medium in the presence of 2 microgml 778

gentamycin several antibiotic resistant colonies were obtained and streaked out on fresh 779

medium These transformants were then tested for full segregation of the tagged allele by 780

colony PCR with primers flanking the slr0483 gene 781

782

Fluorescence microscopy 783

24

An aliquot of a cell suspension in mid-log phase was placed under a BG11-agarose 784

pad on a glass coverslip (15) and imaged on an inverted microscope (Zeiss 785

AxioObserverZ1) equipped with an ORCA Flash40 V2 (Hamamatsu) camera a Lumenecor 786

SOLA II Light Engine and a Plan-Apochromat 63x140 Oil DIC M27 (NA 14) objective 787

(Zeiss) Image acquisition was done with Zen 21 software in cyan and far-red fluorescence 788

channels (Zeiss Filter Sets 47 HE and 50) as Z-series with a step size of 250 nm and effective 789

pixel size of 103 nm Acquired image files were subsequently deconvolved (Constrained 790

Iterative Method) using a default theoretical Point Spread Function in Zen 20 (Zeiss) 791

Extraction of intensities for line profiles was performed by image thresholding the thylakoid 792

autofluorescence channel and eroding the resulting binary mask in Fiji (Schindelin et al 793

2012) 794

For immunofluorescence analysis cells were grown to mid-log phase as in the case of 795

the cells prepared for live-cell microscopy A 10-ml culture was fixed for 20 min in 37 796

formaldehyde and following extensive washing with phosphate-buffered saline (PBS) cells 797

were first permeabilized in 005 Triton-X for 20 min and then in lysis buffer (50 mM Tris-798

HCl 100 mM NaCl 5 mgml lysozyme) at 37degC for 2 h with gentle shaking To block 799

unspecific binding sites the cell pellet was incubated in 5 bovine serum albumin in PBS at 800

30degC for 1 h The αCurT serum (1500 dilution) was added to cells in fresh blocking buffer 801

for 1 h at 30degC with gentle shaking Cells were then washed three times with blocking buffer 802

and incubated with goat anti-rabbit IgG secondary antibodies conjugated to Oregon Green 488 803

(Invitrogen) (11000 dilution) under the conditions as for the primary antibodies Cells were 804

washed three times with PBS and prepared for microscopy as above Imaging was done as 805

described for live-cell microscopy except that a Colibri2 LED light source was employed for 806

illumination and a CoolSnap HQ camera (Photometrics) was used for image acquisition Cells 807

were imaged as Z-series (step size 280 nm) in the yellow and far-red fluorescent channels 808

(Zeiss Filter Sets 46 HE and 50) using the 505 nm and 625 nm LED modules Effective pixel 809

size in the final image was 102 nm Deconvolution and image analysis was done as described 810

above As judged by the staining intensity of the Oregon Green-conjugated antibodies 811

approximately half of the cells in any given field of view appeared to have been successfully 812

permeabilised a rate that is common in our experience No significant signal was detected in 813

the control sample that had not been exposed to the primary antibodies 814

815

25

Accession numbers 816

Sequence data from this article can be found in the CyanoBase and EMBLGenBank 817

data libraries under accession number slr0483 818

819

Supplemental Data 820

Supplemental Figure 1 Construction of the curT- mutant 821

Supplemental Figure 2 Growth phenotype of curT- 822

Supplemental Figure 3 Expression analysis of the open reading frame slr0482 (located 823

upstream of curT) in the curT- strain 824

Supplemental Figure 4 Absorbance spectra of curT- and wild-type cells 825

Supplemental Figure 5 High-light growth phenotypes of wild-type Synechocystis 6803 and 826

the curT- strain 827

Supplemental Figure 6 Ultrastructure of the TD41 mutant which lacks the psbA transcript 828

and the D1 protein 829

Supplemental Figure 7 Expression and localization of CurT-CFP 830

Supplemental Figure 8 Localization of CurT and CurT-CFP by fluorescence microscopy 831

Supplemental Figure 9 Chlorophyll autofluorescence of curT- 832

Supplemental Figure 10 The curT- mutant as a negative control for immunogold labeling 833

Supplemental Figure 11 Representative counts of immunogold signals 834

Supplemental Table 1 Overview of immunogold signals in curT- cells 835

Supplemental Table 2 Overview of immunogold signals in specific regions of Synechocystis 836

6803 wild-type cells 837

Supplemental Table 3 Statistical analysis of immunogold signals for wild-type 838

Synechocystis 6803 cells 839

Supplemental Table 4 Co-expression of curT 840

Supplemental Movie 1 Scan through the Z-axis of a curT-CFP cell 841

Supplemental Movie 2 Rendered 3D-model of a CurT-CFP detection 842

Supplemental Movie 3 Scan through the Z-axis of a curT-CFP cell with a traversing 843

thylakoid lamella 844

845

Acknowledgements 846

We thank Y Nishiyama for providing αpD1 and J Soll for αVIPP1 and αYidC antibodies 847

respectively and Nina Dyczmons-Nowaczyk for support with the fluorescence measurements 848

This work was supported by grants awarded to JN (Ni3909) MMN (NO 8363) and DL 849

26

(Le126529) by the Deutsche Forschungsgemeinschaft in the context of Research Unit 850

FOR2092 and the Cluster of Excellence RESOLV (EXC 1069) AG is a Howard Hughes 851

Medical Institute postdoctoral fellow in the laboratory of Erin OrsquoShea at Harvard University 852

LS was supported by a PhD fellowship from the Chinese Scholarship Council 853

854

Author Contributions 855

SH AR LS MMN DL and JN designed the research SH AR LS AG ILG EH ML BR 856

SV performed the research all authors contributed to data analysis SH AR and JN wrote the 857

paper 858

859

Competing Financial Interest statement 860

The authors declare no competing financial interests 861

862

We wish to dedicate this paper to Fabrice Rappaport an outstanding colleague and friend who 863

passed away so early 864

865

27

References 866

Allen JF de Paula WBM Puthiyaveetil S and Nield J (2011) A structural 867

phylogenetic map for chloroplast photosynthesis Trends Plant Sci 16 645-655 868

Anderson JM Horton P Kim E-H and Chow WS (2012) Towards elucidation of 869

dynamic structural changes of plant thylakoid architecture Philos Trans R Soc 870

Lond B Biol Sci 367 3515-3524 871

Armbruster U Zuumlhlke J Rengstl B Kreller R Makarenko E Ruumlhle T Schuumlnemann 872

D Jahns P Weisshaar B Nickelsen J and Leister D (2010) The Arabidopsis 873

thylakoid protein PAM68 is required for efficient D1 biogenesis and photosystem II 874

assembly Plant Cell 22 3439-3460 875

Armbruster U Labs M Pribil M Viola S Xu W Scharfenberg M Hertle AP 876

Rojahn U Jensen PE Rappaport F Joliot P Doumlrmann P Wanner G and 877

Leister D (2013) Arabidopsis CURVATURE THYLAKOID1 proteins modify 878

thylakoid architecture by inducing membrane curvature Plant Cell 25 2661-2678 879

Aseeva E Ossenbuumlhl F Sippel C Cho WK Stein B Eichacker LA Meurer J 880

Wanner G Westhoff P Soll J and Vothknecht UC (2007) Vipp1 is required for 881

basic thylakoid membrane formation but not for the assembly of thylakoid protein 882

complexes Plant Physiol Biochem 45 119-128 883

Bartsevich VV and Pakrasi HB (1995) Molecular identification of an ABC transporter 884

complex for manganese analysis of a cyanobacterial mutant strain impaired in the 885

photosynthetic oxygen evolution process EMBO J 14 1845-1853 886

Bartsevich VV and Pakrasi HB (1996) Manganese transport in the cyanobacterium 887

Synechocystis sp PCC 6803 J Biol Chem 271 26057-26061 888

Bernaacutet G Waschewski N and Roumlgner M (2009) Towards efficient hydrogen production 889

the impact of antenna size and external factors on electron transport dynamics in 890

Synechocystis PCC 6803 Photosynth Res 99 205-216 891

Boehm M Yu J Krynicka V Barker M Tichy M Komenda J Nixon PJ and Nield 892

J (2012) Subunit Organization of a Synechocystis Hetero-Oligomeric Thylakoid FtsH893

Complex Involved in Photosystem II Repair Plant Cell 24 3669-3683894

Bradford MM (1976) A rapid and sensitive method for the quantitation of microgram 895

quantities of protein utilizing the principle of protein-dye binding Anal Biochem 72 896

248-254897

28

Chang L Liu X Li Y Liu C-C Yang F Zhao J and Sui S-F (2015) Structural 898

organization of an intact phycobilisome and its association with photosystem II Cell 899

Res 25 726-737 900

Danielsson R Suorsa M Paakkarinen V Albertsson P-Aring Styring S Aro E-M and 901

Mamedov F (2006) Dimeric and monomeric organization of photosystem II 902

Distribution of five distinct complexes in the different domains of the thylakoid 903

membrane J Biol Chem 281 14241-14249 904

Daum B Nicastro D Austin J McIntosh JR and Kuumlhlbrandt W (2010) Arrangement 905

of photosystem II and ATP synthase in chloroplast membranes of Spinach and Pea 906

Plant Cell 22 1299-1312 907

Engel BD Schaffer M Kuhn Cuellar L Villa E Plitzko JM and Baumeister W 908

(2015) Native architecture of the Chlamydomonas chloroplast revealed by in situ 909

cryo-electron tomography eLife 4 e04889 910

Ford MGJ Mills IG Peter BJ Vallis Y Praefcke GJK Evans PR and McMahon 911

HT (2002) Curvature of clathrin-coated pits driven by epsin Nature 419 361-366 912

Fristedt R Willig A Granath P Cregravevecoeur M Rochaix J-D and Vener AV (2009) 913

Phosphorylation of photosystem II controls functional macroscopic folding of 914

photosynthetic membranes in Arabidopsis Plant Cell 21 3950-3964 915

Gallop JL and McMahon HT (2005) BAR domains and membrane curvature bringing 916

your curves to the BAR Biochem Soc Symp 72 223-231 917

Gibson DG (2011) Chapter fifteen - Enzymatic Assembly of Overlapping DNA Fragments 918

In Methods in Enzymology V Christopher ed (Academic Press) pp 349-361 919

Goedhart J von Stetten D Noirclerc-Savoye M Lelimousin M Joosen L Hink MA 920

van Weeren L Gadella TWJ and Royant A (2012) Structure-guided evolution of 921

cyan fluorescent proteins towards a quantum yield of 93 Nat Commun 3 751 922

Heinz S Liauw P Nickelsen J and Nowaczyk M (2016) Analysis of photosystem II 923

biogenesis in cyanobacteria Biochim Biophys Acta 1857 274-287 924

Hernaacutendez-Prieto M and Futschik M (2012) CyanoEXpress A web database for 925

exploration and visualisation of the integrated transcriptome of cyanobacterium 926

Synechocystis sp PCC6803 Bioinformation 8 634-638 927

Hernaacutendez-Prieto MA Semeniuk TA Giner-Lamia J and Futschik ME (2016) The 928

Transcriptional Landscape of the Photosynthetic Model Cyanobacterium 929

Synechocystis sp PCC6803 Sci Rep 6 22168 930

29

Huang F Fulda S Hagemann M and Norling B (2006) Proteomic screening of salt-931

stress-induced changes in plasma membranes of Synechocystis sp strain PCC 6803 932

Proteomics 6 910-920 933

Kirchhoff H (2013) Architectural switches in plant thylakoid membranes Photosynth Res 934

116 481-487 935

Klinkert B Elles I and Nickelsen J (2006) Translation of chloroplast psbD mRNA in 936

Chlamydomonas is controlled by a secondary RNA structure blocking the AUG start 937

codon Nucleic Acids Res 34 386-394 938

Klinkert B Ossenbuumlhl F Sikorski M Berry S Eichacker L and Nickelsen J (2004) 939

PratA a periplasmic tetratricopeptide repeat protein involved in biogenesis of 940

photosystem II in Synechocystis sp PCC 6803 J Biol Chem 279 44639-44644 941

Komenda J Nickelsen J Tichyacute M Praacutešil O Eichacker LA and Nixon PJ (2008) The 942

cyanobacterial homologue of HCF136YCF48 is a component of an early photosystem 943

II assembly complex and is important for both the efficient assembly and repair of 944

photosystem II in Synechocystis sp PCC 6803 J Biol Chem 283 22390-22399 945

Kopf M Klaumlhn S Scholz I Matthiessen JKF Hess WR and Voszlig B (2014) 946

Comparative analysis of the primary transcriptome of Synechocystis sp PCC 6803 947

DNA Res 21 527-539 948

Kunkel DD (1982) Thylakoid centers Structures associated with the cyanobacterial 949

photosynthetic membrane system Arch Microbiol 133 97-99 950

Liberton M Howard Berg R Heuser J Roth R and Pakrasi BH (2006) Ultrastructure 951

of the membrane systems in the unicellular cyanobacterium Synechocystis sp strain 952

PCC 6803 Protoplasma 227 129-138 953

Liberton M Saha R Jacobs JM Nguyen AY Gritsenko MA Smith RD 954

Koppenaal DW and Pakrasi HB (2016) Global Proteomic Analysis Reveals an 955

Exclusive Role of Thylakoid Membranes in Bioenergetics of a Model 956

Cyanobacterium Mol Cell Proteomics 15 2021-2032 957

Luque I and Ochoa de Alda JAG (2014) CURT1CAAD-containing aaRSs thylakoid 958

curvature and gene translation Trends Plant Sci 19 63-66 959

Marin K Stirnberg M Eisenhut M Kraumlmer R and Hagemann M (2006) Osmotic stress 960

in Synechocystis sp PCC 6803 low tolerance towards nonionic osmotic stress results 961

from lacking activation of glucosylglycerol accumulation Microbiology 152 2023-962

2030 963

Mullineaux CW (2005) Function and evolution of grana Trends Plant Sci 10 521-525 964

30

Mullineaux CW (2008) Biogenesis and dynamics of thylakoid membranes and the 965

photosynthetic apparatus In The Cyanobacteria A Herrero and E Flores eds 966

(Norfolk UK Caister Academic Press) pp 289ndash304 967

Nevo R Charuvi D Tsabari O and Reich Z (2012) Composition architecture and 968

dynamics of the photosynthetic apparatus in higher plants Plant J 70 157-176 969

Nickelsen J and Rengstl B (2013) Photosystem II assembly From cyanobacteria to plants 970

Annu Rev Plant Biol 64 609-635 971

Nickelsen J and Zerges W (2013) Thylakoid biogenesis has joined the new era of bacterial 972

cell biology Front Plant Sci 4 458 973

Nilsson F Simpson DJ Jansson C and Andersson B (1992) Ultrastructural and 974

biochemical characterization of a Synechocystis 6803 mutant with inactivated psbA 975

genes Arch Biochem Biophys 295 340-347 976

Odom WR Hodges R Chitnis PR and Guikema JA (1993) Characterization of 977

Synechocystis sp PCC 6803 in iron-supplied and iron-deficient media Plant Mol 978

Biol 23 1255-1264 979

Ossenbuumlhl F Inaba-Sulpice M Meurer J Soll J and Eichacker LA (2006) The 980

Synechocystis sp PCC 6803 Oxa1 homolog is essential for membrane integration of 981

reaction center precursor protein pD1 Plant Cell 18 2236-2246 982

Pisareva T Kwon J Oh J Kim S Ge C Wieslander Aring Choi J-S and Norling B 983

(2011) Model for Membrane Organization and Protein Sorting in the Cyanobacterium 984

Synechocystis sp PCC 6803 Inferred from Proteomics and Multivariate Sequence 985

Analyses J Proteome Res 10 3617-3631 986

Pribil M Labs M and Leister D (2014) Structure and dynamics of thylakoids in land 987

plants J Exp Bot 65 1955-1972 988

Rast A Heinz S and Nickelsen J (2015) Biogenesis of thylakoid membranes Biochim 989

Biophys Acta 1847 821-830 990

Rast A Rengstl B Heinz S Klingl A and Nickelsen J (2016) The role of Slr0151 a 991

tetratricopeptide repeat protein from Synechocystis sp PCC 6803 during Photosystem 992

II assembly and repair Front Plant Sci 7 605 993

Rengstl B Oster U Stengel A and Nickelsen J (2011) An Intermediate Membrane 994

Subfraction in Cyanobacteria Is Involved in an Assembly Network for Photosystem II 995

Biogenesis J Biol Chem 286 21944-21951 996

31

Rengstl B Knoppovaacute J Komenda J and Nickelsen J (2013) Characterization of a 997

Synechocystis double mutant lacking the photosystem II assembly factors YCF48 and 998

Sll0933 Planta 237 471-480 999

Rexroth S Mullineaux CW Ellinger D Sendtko E Roumlgner M and Koenig F (2011) 1000

The Plasma Membrane of the Cyanobacterium Gloeobacter violaceus Contains 1001

Segregated Bioenergetic Domains Plant Cell 23 2379-2390 1002

Rippka R Deruelles J Waterbury JB Herdman M and Stanier RY (1979) Generic 1003

Assignments Strain Histories and Properties of Pure Cultures of Cyanobacteria 1004

Microbiology 111 1-61 1005

Ruumltgers M and Schroda M (2013) A role of VIPP1 as a dynamic structure within 1006

thylakoid centers as sites of photosystem biogenesis Plant Signal Behav 8 e27037 1007

Sacharz J Bryan SJ Yu J Burroughs NJ Spence EM Nixon PJ and Mullineaux 1008

CW (2015) Sub-cellular location of FtsH proteases in the cyanobacterium1009

Synechocystis sp PCC 6803 suggests localised PSII repair zones in the thylakoid1010

membranes Mol Microbiol 96 448-4621011

Sandstroumlm S Park Y-I Oumlquist G and Gustafsson P (2001) CP43prime the isiA Gene 1012

Product Functions as an Excitation Energy Dissipator in the Cyanobacterium 1013

Synechococcus sp PCC 7942 Photochem Photobiol 74 431-437 1014

Schindelin J Arganda-Carreras I Frise E Kaynig V Longair M Pietzsch T 1015

Preibisch S Rueden C Saalfeld S Schmid B Tinevez J-Y White DJ 1016

Hartenstein V Eliceiri K Tomancak P and Cardona A (2012) Fiji an open-1017

source platform for biological-image analysis Nat Methods 9 676-682 1018

Schottkowski M Ratke J Oster U Nowaczyk M and Nickelsen J (2009a) Pitt a novel 1019

tetratricopeptide repeat protein involved in light-dependent chlorophyll biosynthesis 1020

and thylakoid membrane biogenesis in Synechocystis sp PCC 6803 Mol Plant 2 1021

1289-1297 1022

Schottkowski M Gkalympoudis S Tzekova N Stelljes C Schuumlnemann D Ankele E 1023

and Nickelsen J (2009b) Interaction of the periplasmic PratA factor and the PsbA 1024

(D1) protein during biogenesis of photosystem II in Synechocystis sp PCC 6803 J 1025

Biol Chem 284 1813-1819 1026

Selatildeo TT Zhang L Knoppovaaacute J Komenda J and Norling B (2016) Photosystem II 1027

Assembly Steps Take Place in the Thylakoid Membrane of the Cyanobacterium 1028

Synechocystis sp PCC6803 Plant Cell Physiol 57 878 1029

32

Spaumlt P Maček B and Forchhammer K (2015) Phosphoproteome of the cyanobacterium 1030

Synechocystis sp PCC 6803 and its dynamics during nitrogen starvation Front 1031

Microbiol 6 248 1032

Stengel A Guumlgel IL Hilger D Rengstl B Jung H and Nickelsen J (2012) Initial 1033

steps of photosystem II de novo assembly and preloading with manganese take place 1034

in biogenesis centers in Synechocystis Plant Cell 24 660-675 1035

Uniacke J and Zerges W (2007) Photosystem II assembly and repair are differentially 1036

localized in Chlamydomonas Plant Cell 19 3640-3654 1037

Uniacke J and Zerges W (2009) Chloroplast protein targeting involves localized 1038

translation in Chlamydomonas Proc Natl Acad Sci USA 106 1439-1444 1039

van de Meene AL Hohmann-Marriott M Vermaas WJ and Roberson R (2006) The 1040

three-dimensional structure of the cyanobacterium Synechocystis sp PCC 6803 Arch 1041

Microbiol 184 259-270 1042

van de Meene AML Sharp WP McDaniel JH Friedrich H Vermaas WFJ and 1043

Roberson RW (2012) Gross morphological changes in thylakoid membrane 1044

structure are associated with photosystem I deletion in Synechocystis sp PCC 6803 1045

Biochim Biophys Acta 1818 1427-1434 1046

Watanabe M and Ikeuchi M (2013) Phycobilisome architecture of a light-harvesting 1047

supercomplex Photosynth Res 116 265-276 1048

Wellburn AR and Lichtenthaler H (1984) Formulae and Program to Determine Total 1049

Carotenoids and Chlorophylls A and B of Leaf Extracts in Different Solvents In 1050

Advances in Photosynthesis Research Proceedings of the VIth International Congress 1051

on Photosynthesis Brussels Belgium August 1ndash6 1983 C Sybesma ed (Dordrecht 1052

Springer Netherlands) pp 9-12 1053

Wilde A Lunser K Ossenbuumlhl F Nickelsen J and Borner T (2001) Characterization of 1054

the cyanobacterial ycf37 mutation decreases the photosystem I content Biochem J 1055

357 211-216 1056

Wilson A Boulay C Wilde A Kerfeld CA and Kirilovsky D (2007) Light-Induced 1057

Energy Dissipation in Iron-Starved Cyanobacteria Roles of OCP and IsiA Proteins 1058

Plant Cell 19 656-672 1059

Xu M Bernaacutet G Singh A Mi H Roumlgner M Pakrasi HB and Ogawa T (2008) 1060

Properties of Mutants of Synechocystis sp Strain PCC 6803 Lacking Inorganic Carbon 1061

Sequestration Systems Plant Cell Physiol 49 1672-1677 1062

33

Yamamoto T Burke J Autz G and Jagendorf AT (1981) Bound ribosomes of Pea 1063

chloroplast thylakoid membranes location and release in vitro by high salt 1064

puromycin and RNase Plant Physiol 67 940-949 1065

Yang H Liao L Bo T Zhao L Sun X Lu X Norling B and Huang F (2014) 1066

Slr0151 in Synechocystis sp PCC 6803 is required for efficient repair of photosystem 1067

II under high-light condition J Integr Plant Biol 56 1136-1150 1068

Yeremenko N Kouřil R Ihalainen JA DHaene S van Oosterwijk N 1069

Andrizhiyevskaya EG Keegstra W Dekker HL Hagemann M Boekema EJ 1070

Matthijs HCP and Dekker JP (2004) Supramolecular Organization and Dual 1071

Function of the IsiA Chlorophyll-Binding Protein in Cyanobacteria Biochemistry 43 1072

10308-10313 1073

Zak E Norling B Maitra R Huang F Andersson B and Pakrasi HB (2001) The 1074

initial steps of biogenesis of cyanobacterial photosystems occur in plasma membranes 1075

Proc Natl Acad Sci USA 98 13443-13448 1076

Zang X Liu B Liu S Arunakumara KKIU and Zhang X (2007) Optimum 1077

Conditions for Transformation of Synechocystis sp PCC 6803 J Microbiol 45 241-1078

245 1079

Zhang L and Sakamoto W (2015) Possible function of VIPP1 in maintaining chloroplast 1080

membranes Biochim Biophys Acta 1847 831-837 1081

Zimmerberg J and Kozlov MM (2006) How proteins produce cellular membrane 1082

curvature Nat Rev Mol Cell Biol 7 9-19 1083

Zoumlfel P (1988) Statistik in der Praxis (Stuttgart Germany Gustav Fischer Verlag) 1084

1085

34

Figure Legends 1086

Figure 1 General characteristics of CurT A) Sequence alignment of CurT and CURT1A-D 1087

from A thaliana Predicted chloroplast transit-peptide sequences of CURT1A-D are omitted 1088

(Armbruster et al 2013) Positions of predicted C-terminal transmembrane domains (TDM) 1089

are marked (black bar) as is the position of the predicted amphipathic N-terminal helix in 1090

CurT (red bar) The green bar denotes the peptide sequence used for antibody production 1091

Identical and related amino acids that are conserved in 100 80 and 60 of the sequences 1092

are highlighted in black dark grey and light grey respectively B) Helical-wheel 1093

representation of the N-terminal amphipathic helix of CurT (red bar in A) The color code 1094

reflects the physicochemical properties of amino-acid side-chains green polar and 1095

uncharged blue polar and positively charged red polar and negatively charged yellow 1096

hydrophobic C) Solubility of CurT Membrane-associated proteins (50 microg) from wild-type 1097

cells were extracted with 5 mM HEPES (pH 76) containing either 1 M NaCl 01 M Na2CO3 1098

4 M urea 01 Triton X-100 or no additional solute After separation of membrane-bound 1099

(M) and solubilized (S) proteins by centrifugation proteins were fractionated by SDS-PAGE1100

and CurT was immunodetected on immunoblots As a control the integral membrane protein 1101

CP47 from PSII was analyzed in parallel D) Transmission electron micrographs of negatively 1102

stained liposomes Cell-free expression (CFE) of CurT and A thaliana CURT1A was 1103

performed in the presence of liposomes similar in composition to the lipids of the thylakoid 1104

membrane Liposomes before and after cell-free protein expression in the absence of DNA 1105

served as negative controls Black arrowheads indicate tubular connections between 1106

liposomes Scale bars 250 nm 1107

1108

Figure 2 Ultrastructural analysis of curT- cells Transmission electron micrographs of typical 1109

wild-type (A) and curT- (B-D) Synechocystis 6803 cells taken at 44000times (A B) and 28000times 1110

(C D) magnification respectively Ultrathin sections (35 to 45 nm) of cryofixed samples 1111

were stained with osmium tetroxide and post-stained using lead citrate Arrowheads indicate 1112

biogenesis centers Scale bars 200 nm (A B) and 500 nm (C D) respectively 1113

1114

Figure 3 Accumulation of components of photosynthetic complexes in the curT- mutant A) 1115

Whole cell extracts (30 microg protein) from wild-type and curT- strains were fractionated by 1116

SDS-PAGE and analyzed on immunoblots using the indicated antibodies B) The histogram 1117

shows levels of the indicated proteins in curT- extracts relative to wild-type samples (dashed 1118

red line) Data are means plusmn SD of three independent experiments Significant differences from 1119

35

wild-type protein levels according to Studentrsquos t-test with error probabilities of 5 and 1 1120

are indicated by and respectively 1121

1122

Figure 4 P700+ reduction kinetics and high-light effects in curT- cells A) Averaged traces 1123

(10 single measurements) of P700+ decay after complete oxidation by a 50-ms multiple 1124

turnover pulse (10000 micromol photons m-2 s-1) in the absence and presence of 10 microM DCMU 1125

B) Rate constants for P700+ reduction were obtained by fitting of the data with single1126

exponential functions Error bars indicate the SD of three independent measurements C) 1127

Impact of light intensity on the (relative) electron transport rate (rETR) Cells were exposed to 1128

gradually increasing light intensities which resulted in increasing electron transport until the 1129

capacity limit was reached PAR light intensity (micromol photons m-2 s-1) Error bars indicate the 1130

SD of three independent measurements D) D1 protein level in wild-type and curT- after high-1131

light treatment (800 micromol photons m-2s-1) in the presence and absence of lincomycin Samples 1132

were taken every 30 min and processed as in Figure 3 to determine the level of D1 present 1133

100 refers to wild-type D1 level at the beginning of the experiment 1134

1135

Figure 5 PSII assembly in curT- cells A) BNSDS-PAGE of membrane proteins Membrane 1136

fractions from wild-type and curT- cells were solubilized with 13 n-dodecyl-β-maltoside 1137

and proteins were fractionated by two-dimensional BNSDS-PAGE blotted and probed with 1138

antibodies against the PSII subunits D1 D2 CP47 and CP43 Wild-type blots were also 1139

probed with the αCurT antibody The sizes of marker proteins and the positions of PSII 1140

assembly intermediates (RCCII RCCI RC47) are shown above and below each image B) In 1141

vivo pulse labeling of membrane proteins with 35S Pulse-labeled PSII core proteins were 1142

separated via BNSDS-PAGE and visualized by autoradiography 1143

1144

Figure 6 Loss of CurT induces stress A) Low-temperature (77 K) fluorescence emission of 1145

Synechocystis 6803 wild-type (blue) and curT- (red) cells excited at 440 nm The spectra were 1146

normalized to the added fluorescein standard B) Low-temperature (77 K) fluorescence 1147

emission of Synechocystis 6803 wild-type (blue) and curT- (red) excited at 580 nm The 1148

spectra were normalized to 780 nm C) Level of IsiA in the curT- mutant relative to the wild-1149

type A mean value of 368 plusmn 96 (SD) was determined from three independent experiments 1150

1151

Figure 7 Membrane sublocalization of PSII-related factors Cell extracts from wild-type and 1152

curT- cells were fractionated by two consecutive rounds of sucrose-density gradient 1153

36

centrifugation (Schottkowski et al 2009b) The second linear gradient (20-60 sucrose) was 1154

apportioned into 14 fractions which were analyzed by immunoblotting using the indicated 1155

antibodies Fractions 1ndash6 represent PDMs and fractions 7ndash14 thylakoid membranes (TMs) 1156

To facilitate comparison between gradients sample volumes were normalized to the volume 1157

of fraction 7 that contained 40 microg of protein 1158

1159

Figure 8 Live-cell imaging of the curT-CFP strain by fluorescence microscopy In the curT-1160

CFP strain the native curT gene has been replaced by a CFP-tagged version resulting in the 1161

expression of the CurT-CFP fusion protein under the control of the native promotor A) 1162

Close-up views of the mid-cell plane in the CFP and far-red autofluorescence channels shown 1163

in slice 7 in panel B B) Synechocystis 6803 cells expressing CurT C-terminally fused to the 1164

mTurquoise2 variant of CFP from its native chromosomal promoter The two imaging 1165

channels are displayed as Z-axis montages (auto-scaled contrast step size 250 nm) in 1166

grayscale and color composite configuration The thylakoid autofluorescent channel as 1167

imaged in far-red fluorescence is depicted in magenta and CurT signal as imaged in cyan 1168

fluorescence is depicted in cyan C) Fluorescence intensity profiles of the two channels along 1169

the autofluorescent peripheral cell ldquoringrdquo are shown for slice 7 The maximum projection of 1170

the entire Z montage is also shown Scale bars (light grey) 2 microm 1171

1172

Figure 9 Immunofluorescence detection of CurT A) Close-ups of slice 5 in panel B B) 1173

Wild-type Synechocystis 6803 cells labeled with αCurT antibodies and detected with Oregon 1174

Green-conjugated secondary antibodies The Z-axis montages are shown as in Figure 8B 1175

except that the step size is 280 nm (1 to 10) C) Intensity profiles of the two channels along 1176

the autofluorescent peripheral cell ldquoringrdquo are shown for slice 5 The maximum projection of 1177

the entire Z montage is also shown Scale bars (light grey) 2 microm 1178

1179

Figure 10 Subcellular localization of CurT Ultrathin sections of wild-type Synechocystis 1180

6803 cells were incubated with rabbit αCurT prior to incubation with gold-conjugated goat 1181

anti-rabbit IgG A) Negative control (wild-type processed without addition of primary 1182

antibody) B C) Immunogold-labeled sections showing CurT localization at the cytoplasmic 1183

side of the thylakoid membrane D) Cluster formation of CurT signals at a putative biogenesis 1184

center from C E) Biogenesis center from the same cell (C) without any obvious CurT 1185

clustering of gold particles F) Schematic depiction of a wild-type cell (from Figure 2A) with 1186

color-coded curved membranes green = thylakoids that follow the curvature of the cell red = 1187

37

thylakoids that bend away from the plasma membrane yellow = thylakoids that bend toward 1188

the plasma membrane to converge on sites of biogenesis centers G) Relative distribution of 1189

gold signals between convex (dark color) and concave (light color) sides of membranes (n = 1190

1584 signals from a total of 95 cells) The undifferentiated overall signal distribution is given 1191

in blue Bars = 200 nm (overview) and 100 nm (details) 1192

1193

Figure 11 Differentially modified forms of CurT are found in different complexes in PDMs 1194

and thylakoid membranes Samples were isolated by fractionation of wild-type membranes 1195

via two consecutive sucrose density gradients according to Schottkowski et al (2009b) After 1196

density centrifugation samples were applied to BNSDS-PAGE analysis (A) or isoelectric 1197

focusing (B) Numbers on the right indicate the respective fraction from the second gradient 1198

(see Figure 7) Fraction 5 represents the PDMs and fraction 9 the thylakoid membrane 1199

1200

Figure 12 Loss of CurT increases sensitivity to abiotic stress A B) Doubling times of wild-1201

type and curT- under salt stress (A) or osmotic stress (B) Doubling times are means plusmn SD of 1202

three independent cultures C) Localization of CurT-CFP under salt and osmotic stress 1203

Samples were examined as described in Figure 8 Scale bars 1 microm D) Protein levels of wild-1204

type cells after growth in BG11 medium containing 500 mM NaCl Samples were analyzed on 1205

the same gel but unrelated samples between the presented signals were omitted E) 1206

Membrane preparations obtained from wild-type cells wild-type cells grown in the presence 1207

of 500 mM NaCl and curT- cells were subjected to the first gradient step in the membrane 1208

fractionation scheme The gradient was divided into five fractions and 10 of fractions I-IV 1209

and 02 of fraction V were analyzed by SDS-PAGE Fraction II includes the plasma 1210

membrane and fraction V consists of PratA-defined membrane and thylakoid membrane 1211

1212

Figure 13 Model of CurT distribution at convergence zones in Synechocystis 6803 The 1213

distribution of CurT in thylakoid (green) and plasma membranes (brown) is shown The 1214

pattern of localization of CurT in the thylakoid membrane is derived from membrane 1215

fractionation via sucrose density centrifugation fluorescence-based detection of the CurT-1216

CFP fusion and endogenous CurT and immunogold labeling experiments (Figures 7-10) The 1217

different CurT variants a b c and d identified in the IEF experiments (Figure 11) are depicted 1218

in yellow pink blue and black respectively CurT present in the plasma membrane is 1219

highlighted in gray as its precise nature and role remain to be defined (Figure 12) 1220

Membranes are represented as lipid bilayers Convex and concave faces of bent thylakoid 1221

38

sheets are indicated by black arrows The PDM which is dedicated to PSII assembly and 1222

repair is depicted in blue The dotted blue line emphasizes that the ultrastructure in this region 1223

has not yet been fully resolved PP periplasm PM plasma membrane TM thylakoid 1224

membrane L lumen PDM PratA-defined membrane 1225

1226

Tables 1227

Table 1 Physiological characteristics of the curT- mutant 1228

Strain Doubling time [h]

Oxygen Evolution[nmol h-1 OD750

-1]c

Chlorophyll content

[microg OD750-1]

d

Cell size [microm]e

Cell number [ml-1 OD750

-1]f

Wild type 817plusmn017a 1600plusmn042

b 1933plusmn187 251plusmn014 264plusmn020 390plusmn006 x 107

curT- 1259plusmn020a 3226plusmn056

b 1074plusmn20 195plusmn029 274plusmn044 367plusmn016 x 107

1229 abDoubling times in the presence (a) or absence (b) of 5 mM glucose measured under 1230

continuous illumination at 30 micromol photons m-2 s-1 and CO2-limiting conditions cOxygen 1231

evolution is expressed in nmol O2 produced per hour per OD750 unit dChlorophyll content is 1232

expressed in microg OD750-1 eThe diameter of non-dividing cells is presented in microm fCell number 1233

was determined per ml per OD750 Data are means plusmn SD of at least three independent 1234

experiments 1235

1236

Parsed CitationsAllen JF de Paula WBM Puthiyaveetil S and Nield J (2011) A structural phylogenetic map for chloroplast photosynthesisTrends Plant Sci 16 645-655

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Anderson JM Horton P Kim E-H and Chow WS (2012) Towards elucidation of dynamic structural changes of plant thylakoidarchitecture Philos Trans R Soc Lond B Biol Sci 367 3515-3524

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Armbruster U Zuumlhlke J Rengstl B Kreller R Makarenko E Ruumlhle T Schuumlnemann D Jahns P Weisshaar B NickelsenJ and Leister D (2010) The Arabidopsis thylakoid protein PAM68 is required for efficient D1 biogenesis and photosystem IIassembly Plant Cell 22 3439-3460

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Armbruster U Labs M Pribil M Viola S Xu W Scharfenberg M Hertle AP Rojahn U Jensen PE Rappaport F JoliotP Doumlrmann P Wanner G and Leister D (2013) Arabidopsis CURVATURE THYLAKOID1 proteins modify thylakoid architectureby inducing membrane curvature Plant Cell 25 2661-2678

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Aseeva E Ossenbuumlhl F Sippel C Cho WK Stein B Eichacker LA Meurer J Wanner G Westhoff P Soll J andVothknecht UC (2007) Vipp1 is required for basic thylakoid membrane formation but not for the assembly of thylakoid proteincomplexes Plant Physiol Biochem 45 119-128

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Bartsevich VV and Pakrasi HB (1995) Molecular identification of an ABC transporter complex for manganese analysis of acyanobacterial mutant strain impaired in the photosynthetic oxygen evolution process EMBO J 14 1845-1853

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Bartsevich VV and Pakrasi HB (1996) Manganese transport in the cyanobacterium Synechocystis sp PCC 6803 J Biol Chem271 26057-26061

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Bernaacutet G Waschewski N and Roumlgner M (2009) Towards efficient hydrogen production the impact of antenna size andexternal factors on electron transport dynamics in Synechocystis PCC 6803 Photosynth Res 99 205-216

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Boehm M Yu J Krynicka V Barker M Tichy M Komenda J Nixon PJ and Nield J (2012) Subunit Organization of aSynechocystis Hetero-Oligomeric Thylakoid FtsH Complex Involved in Photosystem II Repair Plant Cell 24 3669-3683

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Bradford MM (1976) A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle ofprotein-dye binding Anal Biochem 72 248-254

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Chang L Liu X Li Y Liu C-C Yang F Zhao J and Sui S-F (2015) Structural organization of an intact phycobilisome and itsassociation with photosystem II Cell Res 25 726-737

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Danielsson R Suorsa M Paakkarinen V Albertsson P-Aring Styring S Aro E-M and Mamedov F (2006) Dimeric andmonomeric organization of photosystem II Distribution of five distinct complexes in the different domains of the thylakoidmembrane J Biol Chem 281 14241-14249

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Daum B Nicastro D Austin J McIntosh JR and Kuumlhlbrandt W (2010) Arrangement of photosystem II and ATP synthase in

17

A scenario similar to that of Synechocystis 6803 holds for the situation in chloroplasts 550

of the green alga Chlamydomonas reinhardtii in which de novo PSII biogenesis has been 551

shown to be initiated in punctate regions named T-zones located close to the pyrenoid 552

(Uniacke and Zerges 2007) Unlike the mRNAs for the PSII components neither RNAs for 553

PSI subunits nor PSI assembly factors are localized to T-zones indicating that PSI and PSII 554

assembly processes are spatially separated (Uniacke and Zerges 2009 Nickelsen and Zerges 555

2013 Rast et al 2015) Interestingly a recent cryoelectron tomography study demonstrated 556

that next to T-zones at the chloroplast base-lobe junction the inner chloroplast envelope 557

exhibits invaginationsconnections to thylakoids that structurally resemble the organization of 558

cyanobacterial biogenesis centers (Engel et al 2015) For future investigations it will be 559

interesting to see if a homolog of the CURT1 family is involved in the formation of these 560

structures in C reinhardtii 561

562

Evolution of CURT1 function 563

Homologs of the CURT1 protein family can be found throughout cyanobacteria green 564

algae and plants (Armbruster et al 2013) The Arabidopsis CURT1A-D proteins have 565

recently been shown to induce bending of thylakoid membranes at grana margin regions 566

(Armbruster et al 2013) Interestingly and in contrast to the situation in Synechocystis 6803 567

their inactivation did not result in severe photosynthetic deficiencies although the thylakoids 568

formed lacked defined grana stacks Nevertheless the data available support the idea that the 569

function of thylakoid membrane structures that were regarded as being independent ie 570

cyanobacterial biogenesis centers and grana are closely related Intriguingly both of these 571

thylakoid membrane structures are dedicated to aspects of PSII function but do not involve 572

PSI (Pribil et al 2014) In both the prokaryotic and eukaryotic systems CURT1 homologs 573

appear to bend thylakoid membranes as indicated by (i) the distortion of membrane 574

ultrastructure seen in mutants devoid of curved thylakoids (ii) the localization of CURT1 575

homologs at grana margins and their local concentration at biogenesis centers (iii) the in vitro 576

membrane-curving activity of both CURT forms The phenotypic differences between 577

A thaliana and Synechocystis 6803 mutants may however be attributable to the different 578

functions of the membrane sub-compartments affected in the two model organisms Whereas 579

the role of grana is still under debate one function of the cyanobacterial biogenesis centers is 580

the above-mentioned high-throughput uptake of Mn2+ ions for efficient assembly of PSII 581

(Stengel et al 2012 Nickelsen and Rengstl 2013 Pribil et al 2014) However it appears 582

that in both cases the primary function of CURT1 proteins is to generate curved membrane 583

18

regions These discoveries suggest that until now two independently observed structures ie 584

cyanobacterial thylakoid biogenesis centers and chloroplast grana regions are closely related 585

The degree of curvature is much less pronounced in the cyanobacterial system As previously 586

discussed it was probably the subsequent evolution of a membrane-localized light-harvesting 587

system in chloroplasts that made the formation of tightly curved grana thylakoids possible 588

(Mullineaux 2005 Nevo et al 2012 Pribil et al 2014) 589

590

CurT is involved in osmotic stress response 591

One unexpected phenotype of the curT- mutant is its sensitivity to osmotic stress 592

These data revealed that in addition to shaping membranes CurT also influences their 593

functional integrity This latter function might be intrinsic to CurT or could be mediated by 594

the VIPP1 protein which has been shown to be required for membrane maintenance in 595

bacteria and chloroplasts probably by acting as a supplier of lipids (for an overview see 596

Zhang and Sakamoto 2015) Both factors accumulate in the plasma membrane upon osmotic 597

stress but VIPP1 localization is not severely affected by CurT inactivation which suggests 598

that VIPP1 operates independently of CurT In agreement with this repeated co-599

immunoprecipitations revealed no interaction between both proteins Therefore it remains to 600

be established whether a direct functional relationship between them exists 601

Previous investigations of osmotic stress in Synechocystis 6803 showed a kidney-602

shaped form of wild-type cells under very high concentrations of osmotically active 603

compounds (Marin et al 2006) The cells were severely deformed indicating changes in the 604

structure of the cellular envelope Since CurT shifts towards the plasma membrane already 605

under lower osmolyte concentrations we suggest a stabilizing function of CurT in the plasma 606

membrane CurT might be necessary to tolerate the forces trying to deform the cells under 607

osmotic stress 608

In conclusion this analysis has identified a crucial determinant for shaping and 609

maintaining the cyanobacterial thylakoid membrane system ie CurT a homolog of the 610

grana-forming CURT1 protein family from A thaliana In particular CurT is involved in the 611

formation of specific thylakoid substructures close to the plasma membrane at which PSII is 612

assembledrepaired Future work will dissect the precise ultrastructure of these centers and 613

enable us to elaborate a molecular model for the spatiotemporal organization of PSII assembly 614

in cyanobacteria 615

616

19

Methods 617

Strains and growth conditions 618

Wild-type and mutant Synechocystis 6803 cells were grown on solid or in liquid BG 619

11 medium (Rippka et al 1979) supplemented with 5 mM glucose (unless indicated 620

otherwise) at 30degC under continuous illumination at a photon irradiance of 30 μmol m-2 s-1 of 621

white light For growth during high-light experiments for investigation of D1 repair cells 622

were cultivated in a FMT150 photobioreactor (Photon Systems Instruments Draacutesov Czech 623

Republic) at 800 micromol photons m-2 s-1 in the presence or absence of lincomycin (100 microgml) 624

Cell density was monitored photometrically at 750 nm Doubling times were determined after 625

two days of growth To generate the insertion mutant curT- the curT gene (slr0483) was first 626

amplified from wild-type genomic DNA by PCR using the primer pair 04835 627

(GAAGCCTATTTAGCTAAGGCCGAAAG) and 04833 628

(TAGTACCTGGTCTTCCATGGCGT) and the resulting fragment was cloned into the 629

Bluescript pKS vector (Stratagene Waldbronn Germany) A kanamycin resistance cassette 630

was then inserted into the single AgeI restriction site (159 bp downstream of the start codon) 631

and this disruption construct was used to replace the wild-type gene as described (Wilde et al 632

2001) 633

634

Bioinformatic and computational analysis 635

CURT1 sequences of Synechocystis 6803 were obtained from CyanoBase 636

(httpgenomekazusaorjpcyanobaseSynechocystis) and CURT1 homologs in other 637

organisms were retrieved from NCBIBLAST (httpblastncbinlmnihgovBlastcgi) 638

Numbers and positions of putative transmembrane domains in the predicted proteins were 639

determined with TMHMM20 (httpwwwcbsdtudkservicesTMHMM) The sequence for 640

the N-terminal amphipathic helix was predicted by Jpred 3 641

(httpwwwcompbiodundeeacukwww-jpred) and plotted using a helical wheel projection 642

script (httprzlabucreduscriptswheelwheelcgi) The programs ClustalW2 643

(httpwwwebiacuktoolsclustalw2) and GeneDoc (httpwwwpscedubiomedgenedoc) 644

were used to generate multiple alignments of amino acid sequences Quantitative analysis of 645

immunoblots was performed with the AIDA Image Analyzer V325 (Raytest 646

Isotopenmessgeraumlte GmbH Straubenhardt Germany) 647

Co-expression patterns of curT were analyzed using the CyanoEXpress 22 database 648

(httpcyanoexpresssysbiolabeu Hernaacutendez-Prieto and Futschik 2012 Hernaacutendez-Prieto et 649

al 2016) 650

20

651

Measurement of chlorophyll concentration and oxygen production 652

Determination of chlorophyll content was carried out according to Wellburn and 653

Lichtenthaler (1984) For oxygen evolution measurements cells were grown in BG-11 654

without glucose harvested in mid-log phase and diluted to an OD750 nm = 05 Oxygen 655

evolution rates were measured with a Clark-type oxygen electrode (Hansatech Instruments 656

Ltd Kingrsquos Lynn Norfolk UK) at 1000 micromol photons m-2 s-1 (cool white light) after 5 min of 657

dark acclimation Oxygen evolution under saturating light conditions was measured without 658

any additives 659

660

Cell size and cell number estimation 661

Synechocystis 6803 strains were grown in liquid BG11 media containing 5 mM 662

glucose For cell size estimation the cells were analyzed with a confocal laser scanning 663

microscope TCS SP5 (Leica Wetzlar Germany) The diameter of the cells was measured 664

with the LAS AF Lite software (Leica Wetzlar Germany) Cells that were about to divide 665

were not taken into account For the determination of cell number cultures were set to an 666

OD750 = 1 and analyzed by using a Neubauer counting chamber (Paul Marienfeld GmbH amp 667

Co KG Lauda-Koumlnigshofen Germany) Statistical significance was determined by Studentrsquos 668

t-test 669

670

Measurements of P700+ reduction kinetics and relative electron transport rates 671

P700+ reduction kinetics and changes in chlorophyll fluorescence yield at different 672

light intensities were measured at a chlorophyll concentration of 5 microgml with a Dual-PAM-673

100 instrument (Heinz Walz GmbH Effeltrich Germany) Complete P700 oxidation was 674

achieved by a 50-ms multiple turnover pulse (10000 micromol photons m-2 s-1) after 2 min of dark 675

incubation P700+ reduction kinetics were recorded without any additions as well as in the 676

presence of 10 microM DCMU Ten technical replicates were averaged and fitted with single 677

exponential functions Data interpretation was done according to Bernaacutet et al (2009) 678

Light saturation measurements were performed according to Xu et al (2008) The 679

actinic light intensity was increased stepwise from 0 to 665 micromol photons m-2 s-1 with 30-s 680

adaptation periods Maximal fluorescence yields were obtained by applying saturating light 681

pulses (duration 600 ms intensity 10000 micromol photons m-2 s-1) 682

683

Low-temperature fluorescence measurements 684

21

Fluorescence emission spectra were measured with an AMINCO Bowman Series 2 685

Luminescence Spectrometer Wild-type and curT- cells were grown in the presence of 5 mM 686

glucose to mid log-phase and concentrated to 25 microgml chlorophyll adding 2 microM fluorescein 687

as an internal standard Samples (1 ml) were transferred to thin glass tubes dark-adapted for 688

30 min at 30 degC and shock frozen in liquid N2 To quantify chlorophyllfluorescein and 689

phycobilisome-mediated fluorescence samples were excited and emission recorded at 440 690

nm510 nm (chlorophyll and fluorescein excitationmax fluorescein emission) and 580 691

nm685 nm respectively Emission was scanned at 490-800 nm or at 640-800 nm 692

respectively 693

694

Antibody production and protein analysis 695

For generation of an αCurT antibody the N-terminal coding region of curT (amino 696

acid positions 1-58) was amplified by PCR using primers N04835 697

(AAGGATCCGTGGGCCGTAAACATTCAA) and N04833 698

(AAGTCGACGCACTTCCCACACCGGTTGTA) and cloned into the BamHI and XhoI sites 699

of the pGEX-4T-1 vector (GE Healthcare Freiburg Germany) Expression of the GST fusion 700

protein in Escherichia coli BL21(DE3) and subsequent affinity purification on Glutathione-701

Sepharose 4B (GE Healthcare) were carried out as described (Schottkowski et al 2009b) A 702

polyclonal antiserum was raised against this protein fragment in rabbits (Pineda Berlin 703

Germany) Other primary antibodies used in this study have been described previously ie 704

αpD1 (Schottkowski et al 2009b) αD1 (Schottkowski et al 2009b) αD2 (Klinkert et al 705

2006) αPratA (Klinkert et al 2004) αYcf48 (Rengstl et al 2011) αPitt (Schottkowski et 706

al 2009a) αPOR (Schottkowski et al 2009a) αYidC (Ossenbuumlhl et al 2006) αVIPP1 707

(Aseeva et al 2007) αSll0933 (Armbruster et al 2010) and αSlr0151 (Rast et al 2016) or 708

were purchased from Agrisera (Vaumlnnaumls Sweden) ie αCP43 αCP47 αPsaA αCyt f 709

αRbcL αIsiA The αGFP-HRP antibody was acquired from Miltenyi Biotech (Bergisch 710

Gladbach Germany) 711

Protein concentrations were determined according to Bradford (1976) using RotiQuant 712

(Carl Roth GmbH amp Co KG Karlsruhe Germany) Protein extraction membrane 713

fractionation on sucrose-density gradients and quantification of Western signal intensities was 714

performed as described previously (Rengstl et al 2011) Solubility properties of CurT were 715

determined according to Schottkowski et al (2009a) 716

22

Sucrose-density centrifugation separating PDM and thylakoid membrane fractions by 717

two consecutive gradients was carried out as described previously (Schottkowski et al 718

2009b Rengstl et al 2011) 719

Two-dimensional fractionations of cyanobacterial membrane proteins via BNSDS-720

PAGE and of pulse-labeled proteins by BNSDS-PAGE were performed as previously 721

reported (Klinkert et al 2004 Schottkowski et al 2009b Rengstl et al 2013) For the 722

analysis of native complexes in fractions obtained by sucrose-density centrifugation the 723

volume corresponding to 350 microg of protein in fraction 7 was applied to BNSDS-PAGE 724

For isoelectric focusing (IEF) the volume corresponding to 50 microg of protein from 725

fraction 7 in 200 microl of IEF buffer (8 M urea 4 CHAPS 1 IPG buffer pH 4-7 (GE 726

Healthcare)) was applied to an 11-cm Immobiline DryStrip pH 4-7 (GE Healthcare) in a 727

Protean IEF Cell (Bio-Rad Munich Germany) Strips were rehydrated for 12 h at 20 degC and 728

50V Focusing was carried out in the following steps 500 V rapid 1500 Vh 1000 V linear 729

880 Vh 6000 V linear 9680 Vh 6000 V rapid 5390 Vh 50 microA per gel focus temperature 730

20degC Subsequently the strips were incubated in equilibration buffer I (6 M urea 0375 M 731

Tris pH 88 20 glycerol 2 SDS 2 DTT) and equilibration buffer II (6 M urea 0375 732

M Tris pH 88 20 glycerol 2 SDS 25 iodoacetamide) for 10 min in each buffer 733

Then the IEF strips were applied to second-dimension SDS-PAGE 734

735

Transmission electron microscopy and immunogold labeling 736

Sample preparation for transmission electron microscopy including freeze substitution 737

and immunogold labeling of CurT was performed as described previously (Stengel et al 738

2012) Ultrathin sections were cut to thicknesses of 35 - 45 nm and 45 - 65 nm for 739

ultrastructural analyses and immunogold labeling respectively For immunogold labeling 740

sections collected on collodion-coated Ni grids were incubated for 18 h at 4degC with (rabbit) 741

αCurT (diluted 1100 1500 11000 or 14000 in blocking buffer (5 fetal calf serum) with 742

005 Tween 20) and further processed as described previously (Stengel et al 2012) As a 743

negative control wild-type Synechocystis 6803 cells were incubated without the primary 744

antibody and exposed to the gold-labeled anti-rabbit IgG To image the ultrastructure and the 745

immunogold-treated samples a Fei Morgagni 268 transmission electron microscope was used 746

and micrographs were taken at 80 kV 747

To avoid errors in the interpretation of the immunogold labeling experiment only 748

signals which were unambiguously localized to distinctly visible thylakoid membranes were 749

taken into account For each cell different regions (see Figure 10F) were defined and in each 750

23

region the signals on the convex and concave sides of the thylakoid membrane were analyzed 751

separately (see Supplemental Figure 11 for representative counts) Statistical significance was 752

assessed by χ2 test (Zoumlfel 1988) 753

For the analysis of clusters of CurT signals in biogenesis centers a cluster was defined 754

as a minimum of four signals in close proximity Overall 219 biogenesis centers were 755

examined with regard to CurT cluster formation 756

757

Preparation of proteoliposomes 758

Liposomes with a lipid mixture of 25 monogalactosyl diacylglycerol 42 759

digalactosyl diacylglycerol 16 sulfoquinovosyl diacylglycerol and 17 760

phosphatidylglycerol (Lipid Products South Nutfield UK) were prepared as described 761

previously (Armbruster et al 2013) To generate proteoliposomes CurT and CURT1A 762

proteins were expressed in the presence of liposomes for 3 h at 37degC using a PURExpress In 763

Vitro Protein Synthesis Kit (New England Biolabs Ipswich MA USA) The liposomes were 764

separated from the mix by centrifugation in a discontinuous sucrose gradient (100000 g 18 765

h) Subsequently the fraction containing the liposomes was extracted and dialyzed against 20 766

mM HEPES (pH 76) For transmission electron microscopy the proteoliposomes were 767

negatively stained with 1 uranyl acetate on a carbon-coated copper grid Micrographs were 768

taken on a Fei Morgagni 268 TEM at 80 kV 769

770

curT-CFP strain generation 771

Gibson assembly was used for single-step cloning (Gibson 2011) of the slr0483 gene 772

(together with its ~08 kb upstream region) the mTurquoise2 gene fragment the gentamycin-773

resistance cassette (aacC1) and an ~17-kb downstream region of slr0483 into pBR322 774

cleaved with EcoRV and NheI The slr0483 gene was fused in frame to the codon-optimized 775

mTurquoise2 (DNA20) preceded by a linker sequence encoding GSGSG The resulting 776

plasmid was used to transform Synechocystis 6803 as described previously (Zang et al 2007) 777

After ~ 10 days of incubation on BG11-GelRite (15 ) medium in the presence of 2 microgml 778

gentamycin several antibiotic resistant colonies were obtained and streaked out on fresh 779

medium These transformants were then tested for full segregation of the tagged allele by 780

colony PCR with primers flanking the slr0483 gene 781

782

Fluorescence microscopy 783

24

An aliquot of a cell suspension in mid-log phase was placed under a BG11-agarose 784

pad on a glass coverslip (15) and imaged on an inverted microscope (Zeiss 785

AxioObserverZ1) equipped with an ORCA Flash40 V2 (Hamamatsu) camera a Lumenecor 786

SOLA II Light Engine and a Plan-Apochromat 63x140 Oil DIC M27 (NA 14) objective 787

(Zeiss) Image acquisition was done with Zen 21 software in cyan and far-red fluorescence 788

channels (Zeiss Filter Sets 47 HE and 50) as Z-series with a step size of 250 nm and effective 789

pixel size of 103 nm Acquired image files were subsequently deconvolved (Constrained 790

Iterative Method) using a default theoretical Point Spread Function in Zen 20 (Zeiss) 791

Extraction of intensities for line profiles was performed by image thresholding the thylakoid 792

autofluorescence channel and eroding the resulting binary mask in Fiji (Schindelin et al 793

2012) 794

For immunofluorescence analysis cells were grown to mid-log phase as in the case of 795

the cells prepared for live-cell microscopy A 10-ml culture was fixed for 20 min in 37 796

formaldehyde and following extensive washing with phosphate-buffered saline (PBS) cells 797

were first permeabilized in 005 Triton-X for 20 min and then in lysis buffer (50 mM Tris-798

HCl 100 mM NaCl 5 mgml lysozyme) at 37degC for 2 h with gentle shaking To block 799

unspecific binding sites the cell pellet was incubated in 5 bovine serum albumin in PBS at 800

30degC for 1 h The αCurT serum (1500 dilution) was added to cells in fresh blocking buffer 801

for 1 h at 30degC with gentle shaking Cells were then washed three times with blocking buffer 802

and incubated with goat anti-rabbit IgG secondary antibodies conjugated to Oregon Green 488 803

(Invitrogen) (11000 dilution) under the conditions as for the primary antibodies Cells were 804

washed three times with PBS and prepared for microscopy as above Imaging was done as 805

described for live-cell microscopy except that a Colibri2 LED light source was employed for 806

illumination and a CoolSnap HQ camera (Photometrics) was used for image acquisition Cells 807

were imaged as Z-series (step size 280 nm) in the yellow and far-red fluorescent channels 808

(Zeiss Filter Sets 46 HE and 50) using the 505 nm and 625 nm LED modules Effective pixel 809

size in the final image was 102 nm Deconvolution and image analysis was done as described 810

above As judged by the staining intensity of the Oregon Green-conjugated antibodies 811

approximately half of the cells in any given field of view appeared to have been successfully 812

permeabilised a rate that is common in our experience No significant signal was detected in 813

the control sample that had not been exposed to the primary antibodies 814

815

25

Accession numbers 816

Sequence data from this article can be found in the CyanoBase and EMBLGenBank 817

data libraries under accession number slr0483 818

819

Supplemental Data 820

Supplemental Figure 1 Construction of the curT- mutant 821

Supplemental Figure 2 Growth phenotype of curT- 822

Supplemental Figure 3 Expression analysis of the open reading frame slr0482 (located 823

upstream of curT) in the curT- strain 824

Supplemental Figure 4 Absorbance spectra of curT- and wild-type cells 825

Supplemental Figure 5 High-light growth phenotypes of wild-type Synechocystis 6803 and 826

the curT- strain 827

Supplemental Figure 6 Ultrastructure of the TD41 mutant which lacks the psbA transcript 828

and the D1 protein 829

Supplemental Figure 7 Expression and localization of CurT-CFP 830

Supplemental Figure 8 Localization of CurT and CurT-CFP by fluorescence microscopy 831

Supplemental Figure 9 Chlorophyll autofluorescence of curT- 832

Supplemental Figure 10 The curT- mutant as a negative control for immunogold labeling 833

Supplemental Figure 11 Representative counts of immunogold signals 834

Supplemental Table 1 Overview of immunogold signals in curT- cells 835

Supplemental Table 2 Overview of immunogold signals in specific regions of Synechocystis 836

6803 wild-type cells 837

Supplemental Table 3 Statistical analysis of immunogold signals for wild-type 838

Synechocystis 6803 cells 839

Supplemental Table 4 Co-expression of curT 840

Supplemental Movie 1 Scan through the Z-axis of a curT-CFP cell 841

Supplemental Movie 2 Rendered 3D-model of a CurT-CFP detection 842

Supplemental Movie 3 Scan through the Z-axis of a curT-CFP cell with a traversing 843

thylakoid lamella 844

845

Acknowledgements 846

We thank Y Nishiyama for providing αpD1 and J Soll for αVIPP1 and αYidC antibodies 847

respectively and Nina Dyczmons-Nowaczyk for support with the fluorescence measurements 848

This work was supported by grants awarded to JN (Ni3909) MMN (NO 8363) and DL 849

26

(Le126529) by the Deutsche Forschungsgemeinschaft in the context of Research Unit 850

FOR2092 and the Cluster of Excellence RESOLV (EXC 1069) AG is a Howard Hughes 851

Medical Institute postdoctoral fellow in the laboratory of Erin OrsquoShea at Harvard University 852

LS was supported by a PhD fellowship from the Chinese Scholarship Council 853

854

Author Contributions 855

SH AR LS MMN DL and JN designed the research SH AR LS AG ILG EH ML BR 856

SV performed the research all authors contributed to data analysis SH AR and JN wrote the 857

paper 858

859

Competing Financial Interest statement 860

The authors declare no competing financial interests 861

862

We wish to dedicate this paper to Fabrice Rappaport an outstanding colleague and friend who 863

passed away so early 864

865

27

References 866

Allen JF de Paula WBM Puthiyaveetil S and Nield J (2011) A structural 867

phylogenetic map for chloroplast photosynthesis Trends Plant Sci 16 645-655 868

Anderson JM Horton P Kim E-H and Chow WS (2012) Towards elucidation of 869

dynamic structural changes of plant thylakoid architecture Philos Trans R Soc 870

Lond B Biol Sci 367 3515-3524 871

Armbruster U Zuumlhlke J Rengstl B Kreller R Makarenko E Ruumlhle T Schuumlnemann 872

D Jahns P Weisshaar B Nickelsen J and Leister D (2010) The Arabidopsis 873

thylakoid protein PAM68 is required for efficient D1 biogenesis and photosystem II 874

assembly Plant Cell 22 3439-3460 875

Armbruster U Labs M Pribil M Viola S Xu W Scharfenberg M Hertle AP 876

Rojahn U Jensen PE Rappaport F Joliot P Doumlrmann P Wanner G and 877

Leister D (2013) Arabidopsis CURVATURE THYLAKOID1 proteins modify 878

thylakoid architecture by inducing membrane curvature Plant Cell 25 2661-2678 879

Aseeva E Ossenbuumlhl F Sippel C Cho WK Stein B Eichacker LA Meurer J 880

Wanner G Westhoff P Soll J and Vothknecht UC (2007) Vipp1 is required for 881

basic thylakoid membrane formation but not for the assembly of thylakoid protein 882

complexes Plant Physiol Biochem 45 119-128 883

Bartsevich VV and Pakrasi HB (1995) Molecular identification of an ABC transporter 884

complex for manganese analysis of a cyanobacterial mutant strain impaired in the 885

photosynthetic oxygen evolution process EMBO J 14 1845-1853 886

Bartsevich VV and Pakrasi HB (1996) Manganese transport in the cyanobacterium 887

Synechocystis sp PCC 6803 J Biol Chem 271 26057-26061 888

Bernaacutet G Waschewski N and Roumlgner M (2009) Towards efficient hydrogen production 889

the impact of antenna size and external factors on electron transport dynamics in 890

Synechocystis PCC 6803 Photosynth Res 99 205-216 891

Boehm M Yu J Krynicka V Barker M Tichy M Komenda J Nixon PJ and Nield 892

J (2012) Subunit Organization of a Synechocystis Hetero-Oligomeric Thylakoid FtsH893

Complex Involved in Photosystem II Repair Plant Cell 24 3669-3683894

Bradford MM (1976) A rapid and sensitive method for the quantitation of microgram 895

quantities of protein utilizing the principle of protein-dye binding Anal Biochem 72 896

248-254897

28

Chang L Liu X Li Y Liu C-C Yang F Zhao J and Sui S-F (2015) Structural 898

organization of an intact phycobilisome and its association with photosystem II Cell 899

Res 25 726-737 900

Danielsson R Suorsa M Paakkarinen V Albertsson P-Aring Styring S Aro E-M and 901

Mamedov F (2006) Dimeric and monomeric organization of photosystem II 902

Distribution of five distinct complexes in the different domains of the thylakoid 903

membrane J Biol Chem 281 14241-14249 904

Daum B Nicastro D Austin J McIntosh JR and Kuumlhlbrandt W (2010) Arrangement 905

of photosystem II and ATP synthase in chloroplast membranes of Spinach and Pea 906

Plant Cell 22 1299-1312 907

Engel BD Schaffer M Kuhn Cuellar L Villa E Plitzko JM and Baumeister W 908

(2015) Native architecture of the Chlamydomonas chloroplast revealed by in situ 909

cryo-electron tomography eLife 4 e04889 910

Ford MGJ Mills IG Peter BJ Vallis Y Praefcke GJK Evans PR and McMahon 911

HT (2002) Curvature of clathrin-coated pits driven by epsin Nature 419 361-366 912

Fristedt R Willig A Granath P Cregravevecoeur M Rochaix J-D and Vener AV (2009) 913

Phosphorylation of photosystem II controls functional macroscopic folding of 914

photosynthetic membranes in Arabidopsis Plant Cell 21 3950-3964 915

Gallop JL and McMahon HT (2005) BAR domains and membrane curvature bringing 916

your curves to the BAR Biochem Soc Symp 72 223-231 917

Gibson DG (2011) Chapter fifteen - Enzymatic Assembly of Overlapping DNA Fragments 918

In Methods in Enzymology V Christopher ed (Academic Press) pp 349-361 919

Goedhart J von Stetten D Noirclerc-Savoye M Lelimousin M Joosen L Hink MA 920

van Weeren L Gadella TWJ and Royant A (2012) Structure-guided evolution of 921

cyan fluorescent proteins towards a quantum yield of 93 Nat Commun 3 751 922

Heinz S Liauw P Nickelsen J and Nowaczyk M (2016) Analysis of photosystem II 923

biogenesis in cyanobacteria Biochim Biophys Acta 1857 274-287 924

Hernaacutendez-Prieto M and Futschik M (2012) CyanoEXpress A web database for 925

exploration and visualisation of the integrated transcriptome of cyanobacterium 926

Synechocystis sp PCC6803 Bioinformation 8 634-638 927

Hernaacutendez-Prieto MA Semeniuk TA Giner-Lamia J and Futschik ME (2016) The 928

Transcriptional Landscape of the Photosynthetic Model Cyanobacterium 929

Synechocystis sp PCC6803 Sci Rep 6 22168 930

29

Huang F Fulda S Hagemann M and Norling B (2006) Proteomic screening of salt-931

stress-induced changes in plasma membranes of Synechocystis sp strain PCC 6803 932

Proteomics 6 910-920 933

Kirchhoff H (2013) Architectural switches in plant thylakoid membranes Photosynth Res 934

116 481-487 935

Klinkert B Elles I and Nickelsen J (2006) Translation of chloroplast psbD mRNA in 936

Chlamydomonas is controlled by a secondary RNA structure blocking the AUG start 937

codon Nucleic Acids Res 34 386-394 938

Klinkert B Ossenbuumlhl F Sikorski M Berry S Eichacker L and Nickelsen J (2004) 939

PratA a periplasmic tetratricopeptide repeat protein involved in biogenesis of 940

photosystem II in Synechocystis sp PCC 6803 J Biol Chem 279 44639-44644 941

Komenda J Nickelsen J Tichyacute M Praacutešil O Eichacker LA and Nixon PJ (2008) The 942

cyanobacterial homologue of HCF136YCF48 is a component of an early photosystem 943

II assembly complex and is important for both the efficient assembly and repair of 944

photosystem II in Synechocystis sp PCC 6803 J Biol Chem 283 22390-22399 945

Kopf M Klaumlhn S Scholz I Matthiessen JKF Hess WR and Voszlig B (2014) 946

Comparative analysis of the primary transcriptome of Synechocystis sp PCC 6803 947

DNA Res 21 527-539 948

Kunkel DD (1982) Thylakoid centers Structures associated with the cyanobacterial 949

photosynthetic membrane system Arch Microbiol 133 97-99 950

Liberton M Howard Berg R Heuser J Roth R and Pakrasi BH (2006) Ultrastructure 951

of the membrane systems in the unicellular cyanobacterium Synechocystis sp strain 952

PCC 6803 Protoplasma 227 129-138 953

Liberton M Saha R Jacobs JM Nguyen AY Gritsenko MA Smith RD 954

Koppenaal DW and Pakrasi HB (2016) Global Proteomic Analysis Reveals an 955

Exclusive Role of Thylakoid Membranes in Bioenergetics of a Model 956

Cyanobacterium Mol Cell Proteomics 15 2021-2032 957

Luque I and Ochoa de Alda JAG (2014) CURT1CAAD-containing aaRSs thylakoid 958

curvature and gene translation Trends Plant Sci 19 63-66 959

Marin K Stirnberg M Eisenhut M Kraumlmer R and Hagemann M (2006) Osmotic stress 960

in Synechocystis sp PCC 6803 low tolerance towards nonionic osmotic stress results 961

from lacking activation of glucosylglycerol accumulation Microbiology 152 2023-962

2030 963

Mullineaux CW (2005) Function and evolution of grana Trends Plant Sci 10 521-525 964

30

Mullineaux CW (2008) Biogenesis and dynamics of thylakoid membranes and the 965

photosynthetic apparatus In The Cyanobacteria A Herrero and E Flores eds 966

(Norfolk UK Caister Academic Press) pp 289ndash304 967

Nevo R Charuvi D Tsabari O and Reich Z (2012) Composition architecture and 968

dynamics of the photosynthetic apparatus in higher plants Plant J 70 157-176 969

Nickelsen J and Rengstl B (2013) Photosystem II assembly From cyanobacteria to plants 970

Annu Rev Plant Biol 64 609-635 971

Nickelsen J and Zerges W (2013) Thylakoid biogenesis has joined the new era of bacterial 972

cell biology Front Plant Sci 4 458 973

Nilsson F Simpson DJ Jansson C and Andersson B (1992) Ultrastructural and 974

biochemical characterization of a Synechocystis 6803 mutant with inactivated psbA 975

genes Arch Biochem Biophys 295 340-347 976

Odom WR Hodges R Chitnis PR and Guikema JA (1993) Characterization of 977

Synechocystis sp PCC 6803 in iron-supplied and iron-deficient media Plant Mol 978

Biol 23 1255-1264 979

Ossenbuumlhl F Inaba-Sulpice M Meurer J Soll J and Eichacker LA (2006) The 980

Synechocystis sp PCC 6803 Oxa1 homolog is essential for membrane integration of 981

reaction center precursor protein pD1 Plant Cell 18 2236-2246 982

Pisareva T Kwon J Oh J Kim S Ge C Wieslander Aring Choi J-S and Norling B 983

(2011) Model for Membrane Organization and Protein Sorting in the Cyanobacterium 984

Synechocystis sp PCC 6803 Inferred from Proteomics and Multivariate Sequence 985

Analyses J Proteome Res 10 3617-3631 986

Pribil M Labs M and Leister D (2014) Structure and dynamics of thylakoids in land 987

plants J Exp Bot 65 1955-1972 988

Rast A Heinz S and Nickelsen J (2015) Biogenesis of thylakoid membranes Biochim 989

Biophys Acta 1847 821-830 990

Rast A Rengstl B Heinz S Klingl A and Nickelsen J (2016) The role of Slr0151 a 991

tetratricopeptide repeat protein from Synechocystis sp PCC 6803 during Photosystem 992

II assembly and repair Front Plant Sci 7 605 993

Rengstl B Oster U Stengel A and Nickelsen J (2011) An Intermediate Membrane 994

Subfraction in Cyanobacteria Is Involved in an Assembly Network for Photosystem II 995

Biogenesis J Biol Chem 286 21944-21951 996

31

Rengstl B Knoppovaacute J Komenda J and Nickelsen J (2013) Characterization of a 997

Synechocystis double mutant lacking the photosystem II assembly factors YCF48 and 998

Sll0933 Planta 237 471-480 999

Rexroth S Mullineaux CW Ellinger D Sendtko E Roumlgner M and Koenig F (2011) 1000

The Plasma Membrane of the Cyanobacterium Gloeobacter violaceus Contains 1001

Segregated Bioenergetic Domains Plant Cell 23 2379-2390 1002

Rippka R Deruelles J Waterbury JB Herdman M and Stanier RY (1979) Generic 1003

Assignments Strain Histories and Properties of Pure Cultures of Cyanobacteria 1004

Microbiology 111 1-61 1005

Ruumltgers M and Schroda M (2013) A role of VIPP1 as a dynamic structure within 1006

thylakoid centers as sites of photosystem biogenesis Plant Signal Behav 8 e27037 1007

Sacharz J Bryan SJ Yu J Burroughs NJ Spence EM Nixon PJ and Mullineaux 1008

CW (2015) Sub-cellular location of FtsH proteases in the cyanobacterium1009

Synechocystis sp PCC 6803 suggests localised PSII repair zones in the thylakoid1010

membranes Mol Microbiol 96 448-4621011

Sandstroumlm S Park Y-I Oumlquist G and Gustafsson P (2001) CP43prime the isiA Gene 1012

Product Functions as an Excitation Energy Dissipator in the Cyanobacterium 1013

Synechococcus sp PCC 7942 Photochem Photobiol 74 431-437 1014

Schindelin J Arganda-Carreras I Frise E Kaynig V Longair M Pietzsch T 1015

Preibisch S Rueden C Saalfeld S Schmid B Tinevez J-Y White DJ 1016

Hartenstein V Eliceiri K Tomancak P and Cardona A (2012) Fiji an open-1017

source platform for biological-image analysis Nat Methods 9 676-682 1018

Schottkowski M Ratke J Oster U Nowaczyk M and Nickelsen J (2009a) Pitt a novel 1019

tetratricopeptide repeat protein involved in light-dependent chlorophyll biosynthesis 1020

and thylakoid membrane biogenesis in Synechocystis sp PCC 6803 Mol Plant 2 1021

1289-1297 1022

Schottkowski M Gkalympoudis S Tzekova N Stelljes C Schuumlnemann D Ankele E 1023

and Nickelsen J (2009b) Interaction of the periplasmic PratA factor and the PsbA 1024

(D1) protein during biogenesis of photosystem II in Synechocystis sp PCC 6803 J 1025

Biol Chem 284 1813-1819 1026

Selatildeo TT Zhang L Knoppovaaacute J Komenda J and Norling B (2016) Photosystem II 1027

Assembly Steps Take Place in the Thylakoid Membrane of the Cyanobacterium 1028

Synechocystis sp PCC6803 Plant Cell Physiol 57 878 1029

32

Spaumlt P Maček B and Forchhammer K (2015) Phosphoproteome of the cyanobacterium 1030

Synechocystis sp PCC 6803 and its dynamics during nitrogen starvation Front 1031

Microbiol 6 248 1032

Stengel A Guumlgel IL Hilger D Rengstl B Jung H and Nickelsen J (2012) Initial 1033

steps of photosystem II de novo assembly and preloading with manganese take place 1034

in biogenesis centers in Synechocystis Plant Cell 24 660-675 1035

Uniacke J and Zerges W (2007) Photosystem II assembly and repair are differentially 1036

localized in Chlamydomonas Plant Cell 19 3640-3654 1037

Uniacke J and Zerges W (2009) Chloroplast protein targeting involves localized 1038

translation in Chlamydomonas Proc Natl Acad Sci USA 106 1439-1444 1039

van de Meene AL Hohmann-Marriott M Vermaas WJ and Roberson R (2006) The 1040

three-dimensional structure of the cyanobacterium Synechocystis sp PCC 6803 Arch 1041

Microbiol 184 259-270 1042

van de Meene AML Sharp WP McDaniel JH Friedrich H Vermaas WFJ and 1043

Roberson RW (2012) Gross morphological changes in thylakoid membrane 1044

structure are associated with photosystem I deletion in Synechocystis sp PCC 6803 1045

Biochim Biophys Acta 1818 1427-1434 1046

Watanabe M and Ikeuchi M (2013) Phycobilisome architecture of a light-harvesting 1047

supercomplex Photosynth Res 116 265-276 1048

Wellburn AR and Lichtenthaler H (1984) Formulae and Program to Determine Total 1049

Carotenoids and Chlorophylls A and B of Leaf Extracts in Different Solvents In 1050

Advances in Photosynthesis Research Proceedings of the VIth International Congress 1051

on Photosynthesis Brussels Belgium August 1ndash6 1983 C Sybesma ed (Dordrecht 1052

Springer Netherlands) pp 9-12 1053

Wilde A Lunser K Ossenbuumlhl F Nickelsen J and Borner T (2001) Characterization of 1054

the cyanobacterial ycf37 mutation decreases the photosystem I content Biochem J 1055

357 211-216 1056

Wilson A Boulay C Wilde A Kerfeld CA and Kirilovsky D (2007) Light-Induced 1057

Energy Dissipation in Iron-Starved Cyanobacteria Roles of OCP and IsiA Proteins 1058

Plant Cell 19 656-672 1059

Xu M Bernaacutet G Singh A Mi H Roumlgner M Pakrasi HB and Ogawa T (2008) 1060

Properties of Mutants of Synechocystis sp Strain PCC 6803 Lacking Inorganic Carbon 1061

Sequestration Systems Plant Cell Physiol 49 1672-1677 1062

33

Yamamoto T Burke J Autz G and Jagendorf AT (1981) Bound ribosomes of Pea 1063

chloroplast thylakoid membranes location and release in vitro by high salt 1064

puromycin and RNase Plant Physiol 67 940-949 1065

Yang H Liao L Bo T Zhao L Sun X Lu X Norling B and Huang F (2014) 1066

Slr0151 in Synechocystis sp PCC 6803 is required for efficient repair of photosystem 1067

II under high-light condition J Integr Plant Biol 56 1136-1150 1068

Yeremenko N Kouřil R Ihalainen JA DHaene S van Oosterwijk N 1069

Andrizhiyevskaya EG Keegstra W Dekker HL Hagemann M Boekema EJ 1070

Matthijs HCP and Dekker JP (2004) Supramolecular Organization and Dual 1071

Function of the IsiA Chlorophyll-Binding Protein in Cyanobacteria Biochemistry 43 1072

10308-10313 1073

Zak E Norling B Maitra R Huang F Andersson B and Pakrasi HB (2001) The 1074

initial steps of biogenesis of cyanobacterial photosystems occur in plasma membranes 1075

Proc Natl Acad Sci USA 98 13443-13448 1076

Zang X Liu B Liu S Arunakumara KKIU and Zhang X (2007) Optimum 1077

Conditions for Transformation of Synechocystis sp PCC 6803 J Microbiol 45 241-1078

245 1079

Zhang L and Sakamoto W (2015) Possible function of VIPP1 in maintaining chloroplast 1080

membranes Biochim Biophys Acta 1847 831-837 1081

Zimmerberg J and Kozlov MM (2006) How proteins produce cellular membrane 1082

curvature Nat Rev Mol Cell Biol 7 9-19 1083

Zoumlfel P (1988) Statistik in der Praxis (Stuttgart Germany Gustav Fischer Verlag) 1084

1085

34

Figure Legends 1086

Figure 1 General characteristics of CurT A) Sequence alignment of CurT and CURT1A-D 1087

from A thaliana Predicted chloroplast transit-peptide sequences of CURT1A-D are omitted 1088

(Armbruster et al 2013) Positions of predicted C-terminal transmembrane domains (TDM) 1089

are marked (black bar) as is the position of the predicted amphipathic N-terminal helix in 1090

CurT (red bar) The green bar denotes the peptide sequence used for antibody production 1091

Identical and related amino acids that are conserved in 100 80 and 60 of the sequences 1092

are highlighted in black dark grey and light grey respectively B) Helical-wheel 1093

representation of the N-terminal amphipathic helix of CurT (red bar in A) The color code 1094

reflects the physicochemical properties of amino-acid side-chains green polar and 1095

uncharged blue polar and positively charged red polar and negatively charged yellow 1096

hydrophobic C) Solubility of CurT Membrane-associated proteins (50 microg) from wild-type 1097

cells were extracted with 5 mM HEPES (pH 76) containing either 1 M NaCl 01 M Na2CO3 1098

4 M urea 01 Triton X-100 or no additional solute After separation of membrane-bound 1099

(M) and solubilized (S) proteins by centrifugation proteins were fractionated by SDS-PAGE1100

and CurT was immunodetected on immunoblots As a control the integral membrane protein 1101

CP47 from PSII was analyzed in parallel D) Transmission electron micrographs of negatively 1102

stained liposomes Cell-free expression (CFE) of CurT and A thaliana CURT1A was 1103

performed in the presence of liposomes similar in composition to the lipids of the thylakoid 1104

membrane Liposomes before and after cell-free protein expression in the absence of DNA 1105

served as negative controls Black arrowheads indicate tubular connections between 1106

liposomes Scale bars 250 nm 1107

1108

Figure 2 Ultrastructural analysis of curT- cells Transmission electron micrographs of typical 1109

wild-type (A) and curT- (B-D) Synechocystis 6803 cells taken at 44000times (A B) and 28000times 1110

(C D) magnification respectively Ultrathin sections (35 to 45 nm) of cryofixed samples 1111

were stained with osmium tetroxide and post-stained using lead citrate Arrowheads indicate 1112

biogenesis centers Scale bars 200 nm (A B) and 500 nm (C D) respectively 1113

1114

Figure 3 Accumulation of components of photosynthetic complexes in the curT- mutant A) 1115

Whole cell extracts (30 microg protein) from wild-type and curT- strains were fractionated by 1116

SDS-PAGE and analyzed on immunoblots using the indicated antibodies B) The histogram 1117

shows levels of the indicated proteins in curT- extracts relative to wild-type samples (dashed 1118

red line) Data are means plusmn SD of three independent experiments Significant differences from 1119

35

wild-type protein levels according to Studentrsquos t-test with error probabilities of 5 and 1 1120

are indicated by and respectively 1121

1122

Figure 4 P700+ reduction kinetics and high-light effects in curT- cells A) Averaged traces 1123

(10 single measurements) of P700+ decay after complete oxidation by a 50-ms multiple 1124

turnover pulse (10000 micromol photons m-2 s-1) in the absence and presence of 10 microM DCMU 1125

B) Rate constants for P700+ reduction were obtained by fitting of the data with single1126

exponential functions Error bars indicate the SD of three independent measurements C) 1127

Impact of light intensity on the (relative) electron transport rate (rETR) Cells were exposed to 1128

gradually increasing light intensities which resulted in increasing electron transport until the 1129

capacity limit was reached PAR light intensity (micromol photons m-2 s-1) Error bars indicate the 1130

SD of three independent measurements D) D1 protein level in wild-type and curT- after high-1131

light treatment (800 micromol photons m-2s-1) in the presence and absence of lincomycin Samples 1132

were taken every 30 min and processed as in Figure 3 to determine the level of D1 present 1133

100 refers to wild-type D1 level at the beginning of the experiment 1134

1135

Figure 5 PSII assembly in curT- cells A) BNSDS-PAGE of membrane proteins Membrane 1136

fractions from wild-type and curT- cells were solubilized with 13 n-dodecyl-β-maltoside 1137

and proteins were fractionated by two-dimensional BNSDS-PAGE blotted and probed with 1138

antibodies against the PSII subunits D1 D2 CP47 and CP43 Wild-type blots were also 1139

probed with the αCurT antibody The sizes of marker proteins and the positions of PSII 1140

assembly intermediates (RCCII RCCI RC47) are shown above and below each image B) In 1141

vivo pulse labeling of membrane proteins with 35S Pulse-labeled PSII core proteins were 1142

separated via BNSDS-PAGE and visualized by autoradiography 1143

1144

Figure 6 Loss of CurT induces stress A) Low-temperature (77 K) fluorescence emission of 1145

Synechocystis 6803 wild-type (blue) and curT- (red) cells excited at 440 nm The spectra were 1146

normalized to the added fluorescein standard B) Low-temperature (77 K) fluorescence 1147

emission of Synechocystis 6803 wild-type (blue) and curT- (red) excited at 580 nm The 1148

spectra were normalized to 780 nm C) Level of IsiA in the curT- mutant relative to the wild-1149

type A mean value of 368 plusmn 96 (SD) was determined from three independent experiments 1150

1151

Figure 7 Membrane sublocalization of PSII-related factors Cell extracts from wild-type and 1152

curT- cells were fractionated by two consecutive rounds of sucrose-density gradient 1153

36

centrifugation (Schottkowski et al 2009b) The second linear gradient (20-60 sucrose) was 1154

apportioned into 14 fractions which were analyzed by immunoblotting using the indicated 1155

antibodies Fractions 1ndash6 represent PDMs and fractions 7ndash14 thylakoid membranes (TMs) 1156

To facilitate comparison between gradients sample volumes were normalized to the volume 1157

of fraction 7 that contained 40 microg of protein 1158

1159

Figure 8 Live-cell imaging of the curT-CFP strain by fluorescence microscopy In the curT-1160

CFP strain the native curT gene has been replaced by a CFP-tagged version resulting in the 1161

expression of the CurT-CFP fusion protein under the control of the native promotor A) 1162

Close-up views of the mid-cell plane in the CFP and far-red autofluorescence channels shown 1163

in slice 7 in panel B B) Synechocystis 6803 cells expressing CurT C-terminally fused to the 1164

mTurquoise2 variant of CFP from its native chromosomal promoter The two imaging 1165

channels are displayed as Z-axis montages (auto-scaled contrast step size 250 nm) in 1166

grayscale and color composite configuration The thylakoid autofluorescent channel as 1167

imaged in far-red fluorescence is depicted in magenta and CurT signal as imaged in cyan 1168

fluorescence is depicted in cyan C) Fluorescence intensity profiles of the two channels along 1169

the autofluorescent peripheral cell ldquoringrdquo are shown for slice 7 The maximum projection of 1170

the entire Z montage is also shown Scale bars (light grey) 2 microm 1171

1172

Figure 9 Immunofluorescence detection of CurT A) Close-ups of slice 5 in panel B B) 1173

Wild-type Synechocystis 6803 cells labeled with αCurT antibodies and detected with Oregon 1174

Green-conjugated secondary antibodies The Z-axis montages are shown as in Figure 8B 1175

except that the step size is 280 nm (1 to 10) C) Intensity profiles of the two channels along 1176

the autofluorescent peripheral cell ldquoringrdquo are shown for slice 5 The maximum projection of 1177

the entire Z montage is also shown Scale bars (light grey) 2 microm 1178

1179

Figure 10 Subcellular localization of CurT Ultrathin sections of wild-type Synechocystis 1180

6803 cells were incubated with rabbit αCurT prior to incubation with gold-conjugated goat 1181

anti-rabbit IgG A) Negative control (wild-type processed without addition of primary 1182

antibody) B C) Immunogold-labeled sections showing CurT localization at the cytoplasmic 1183

side of the thylakoid membrane D) Cluster formation of CurT signals at a putative biogenesis 1184

center from C E) Biogenesis center from the same cell (C) without any obvious CurT 1185

clustering of gold particles F) Schematic depiction of a wild-type cell (from Figure 2A) with 1186

color-coded curved membranes green = thylakoids that follow the curvature of the cell red = 1187

37

thylakoids that bend away from the plasma membrane yellow = thylakoids that bend toward 1188

the plasma membrane to converge on sites of biogenesis centers G) Relative distribution of 1189

gold signals between convex (dark color) and concave (light color) sides of membranes (n = 1190

1584 signals from a total of 95 cells) The undifferentiated overall signal distribution is given 1191

in blue Bars = 200 nm (overview) and 100 nm (details) 1192

1193

Figure 11 Differentially modified forms of CurT are found in different complexes in PDMs 1194

and thylakoid membranes Samples were isolated by fractionation of wild-type membranes 1195

via two consecutive sucrose density gradients according to Schottkowski et al (2009b) After 1196

density centrifugation samples were applied to BNSDS-PAGE analysis (A) or isoelectric 1197

focusing (B) Numbers on the right indicate the respective fraction from the second gradient 1198

(see Figure 7) Fraction 5 represents the PDMs and fraction 9 the thylakoid membrane 1199

1200

Figure 12 Loss of CurT increases sensitivity to abiotic stress A B) Doubling times of wild-1201

type and curT- under salt stress (A) or osmotic stress (B) Doubling times are means plusmn SD of 1202

three independent cultures C) Localization of CurT-CFP under salt and osmotic stress 1203

Samples were examined as described in Figure 8 Scale bars 1 microm D) Protein levels of wild-1204

type cells after growth in BG11 medium containing 500 mM NaCl Samples were analyzed on 1205

the same gel but unrelated samples between the presented signals were omitted E) 1206

Membrane preparations obtained from wild-type cells wild-type cells grown in the presence 1207

of 500 mM NaCl and curT- cells were subjected to the first gradient step in the membrane 1208

fractionation scheme The gradient was divided into five fractions and 10 of fractions I-IV 1209

and 02 of fraction V were analyzed by SDS-PAGE Fraction II includes the plasma 1210

membrane and fraction V consists of PratA-defined membrane and thylakoid membrane 1211

1212

Figure 13 Model of CurT distribution at convergence zones in Synechocystis 6803 The 1213

distribution of CurT in thylakoid (green) and plasma membranes (brown) is shown The 1214

pattern of localization of CurT in the thylakoid membrane is derived from membrane 1215

fractionation via sucrose density centrifugation fluorescence-based detection of the CurT-1216

CFP fusion and endogenous CurT and immunogold labeling experiments (Figures 7-10) The 1217

different CurT variants a b c and d identified in the IEF experiments (Figure 11) are depicted 1218

in yellow pink blue and black respectively CurT present in the plasma membrane is 1219

highlighted in gray as its precise nature and role remain to be defined (Figure 12) 1220

Membranes are represented as lipid bilayers Convex and concave faces of bent thylakoid 1221

38

sheets are indicated by black arrows The PDM which is dedicated to PSII assembly and 1222

repair is depicted in blue The dotted blue line emphasizes that the ultrastructure in this region 1223

has not yet been fully resolved PP periplasm PM plasma membrane TM thylakoid 1224

membrane L lumen PDM PratA-defined membrane 1225

1226

Tables 1227

Table 1 Physiological characteristics of the curT- mutant 1228

Strain Doubling time [h]

Oxygen Evolution[nmol h-1 OD750

-1]c

Chlorophyll content

[microg OD750-1]

d

Cell size [microm]e

Cell number [ml-1 OD750

-1]f

Wild type 817plusmn017a 1600plusmn042

b 1933plusmn187 251plusmn014 264plusmn020 390plusmn006 x 107

curT- 1259plusmn020a 3226plusmn056

b 1074plusmn20 195plusmn029 274plusmn044 367plusmn016 x 107

1229 abDoubling times in the presence (a) or absence (b) of 5 mM glucose measured under 1230

continuous illumination at 30 micromol photons m-2 s-1 and CO2-limiting conditions cOxygen 1231

evolution is expressed in nmol O2 produced per hour per OD750 unit dChlorophyll content is 1232

expressed in microg OD750-1 eThe diameter of non-dividing cells is presented in microm fCell number 1233

was determined per ml per OD750 Data are means plusmn SD of at least three independent 1234

experiments 1235

1236

Parsed CitationsAllen JF de Paula WBM Puthiyaveetil S and Nield J (2011) A structural phylogenetic map for chloroplast photosynthesisTrends Plant Sci 16 645-655

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Anderson JM Horton P Kim E-H and Chow WS (2012) Towards elucidation of dynamic structural changes of plant thylakoidarchitecture Philos Trans R Soc Lond B Biol Sci 367 3515-3524

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Armbruster U Zuumlhlke J Rengstl B Kreller R Makarenko E Ruumlhle T Schuumlnemann D Jahns P Weisshaar B NickelsenJ and Leister D (2010) The Arabidopsis thylakoid protein PAM68 is required for efficient D1 biogenesis and photosystem IIassembly Plant Cell 22 3439-3460

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Armbruster U Labs M Pribil M Viola S Xu W Scharfenberg M Hertle AP Rojahn U Jensen PE Rappaport F JoliotP Doumlrmann P Wanner G and Leister D (2013) Arabidopsis CURVATURE THYLAKOID1 proteins modify thylakoid architectureby inducing membrane curvature Plant Cell 25 2661-2678

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Aseeva E Ossenbuumlhl F Sippel C Cho WK Stein B Eichacker LA Meurer J Wanner G Westhoff P Soll J andVothknecht UC (2007) Vipp1 is required for basic thylakoid membrane formation but not for the assembly of thylakoid proteincomplexes Plant Physiol Biochem 45 119-128

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Bartsevich VV and Pakrasi HB (1995) Molecular identification of an ABC transporter complex for manganese analysis of acyanobacterial mutant strain impaired in the photosynthetic oxygen evolution process EMBO J 14 1845-1853

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Bartsevich VV and Pakrasi HB (1996) Manganese transport in the cyanobacterium Synechocystis sp PCC 6803 J Biol Chem271 26057-26061

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Bernaacutet G Waschewski N and Roumlgner M (2009) Towards efficient hydrogen production the impact of antenna size andexternal factors on electron transport dynamics in Synechocystis PCC 6803 Photosynth Res 99 205-216

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Boehm M Yu J Krynicka V Barker M Tichy M Komenda J Nixon PJ and Nield J (2012) Subunit Organization of aSynechocystis Hetero-Oligomeric Thylakoid FtsH Complex Involved in Photosystem II Repair Plant Cell 24 3669-3683

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Bradford MM (1976) A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle ofprotein-dye binding Anal Biochem 72 248-254

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Chang L Liu X Li Y Liu C-C Yang F Zhao J and Sui S-F (2015) Structural organization of an intact phycobilisome and itsassociation with photosystem II Cell Res 25 726-737

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Danielsson R Suorsa M Paakkarinen V Albertsson P-Aring Styring S Aro E-M and Mamedov F (2006) Dimeric andmonomeric organization of photosystem II Distribution of five distinct complexes in the different domains of the thylakoidmembrane J Biol Chem 281 14241-14249

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Daum B Nicastro D Austin J McIntosh JR and Kuumlhlbrandt W (2010) Arrangement of photosystem II and ATP synthase in

18

regions These discoveries suggest that until now two independently observed structures ie 584

cyanobacterial thylakoid biogenesis centers and chloroplast grana regions are closely related 585

The degree of curvature is much less pronounced in the cyanobacterial system As previously 586

discussed it was probably the subsequent evolution of a membrane-localized light-harvesting 587

system in chloroplasts that made the formation of tightly curved grana thylakoids possible 588

(Mullineaux 2005 Nevo et al 2012 Pribil et al 2014) 589

590

CurT is involved in osmotic stress response 591

One unexpected phenotype of the curT- mutant is its sensitivity to osmotic stress 592

These data revealed that in addition to shaping membranes CurT also influences their 593

functional integrity This latter function might be intrinsic to CurT or could be mediated by 594

the VIPP1 protein which has been shown to be required for membrane maintenance in 595

bacteria and chloroplasts probably by acting as a supplier of lipids (for an overview see 596

Zhang and Sakamoto 2015) Both factors accumulate in the plasma membrane upon osmotic 597

stress but VIPP1 localization is not severely affected by CurT inactivation which suggests 598

that VIPP1 operates independently of CurT In agreement with this repeated co-599

immunoprecipitations revealed no interaction between both proteins Therefore it remains to 600

be established whether a direct functional relationship between them exists 601

Previous investigations of osmotic stress in Synechocystis 6803 showed a kidney-602

shaped form of wild-type cells under very high concentrations of osmotically active 603

compounds (Marin et al 2006) The cells were severely deformed indicating changes in the 604

structure of the cellular envelope Since CurT shifts towards the plasma membrane already 605

under lower osmolyte concentrations we suggest a stabilizing function of CurT in the plasma 606

membrane CurT might be necessary to tolerate the forces trying to deform the cells under 607

osmotic stress 608

In conclusion this analysis has identified a crucial determinant for shaping and 609

maintaining the cyanobacterial thylakoid membrane system ie CurT a homolog of the 610

grana-forming CURT1 protein family from A thaliana In particular CurT is involved in the 611

formation of specific thylakoid substructures close to the plasma membrane at which PSII is 612

assembledrepaired Future work will dissect the precise ultrastructure of these centers and 613

enable us to elaborate a molecular model for the spatiotemporal organization of PSII assembly 614

in cyanobacteria 615

616

19

Methods 617

Strains and growth conditions 618

Wild-type and mutant Synechocystis 6803 cells were grown on solid or in liquid BG 619

11 medium (Rippka et al 1979) supplemented with 5 mM glucose (unless indicated 620

otherwise) at 30degC under continuous illumination at a photon irradiance of 30 μmol m-2 s-1 of 621

white light For growth during high-light experiments for investigation of D1 repair cells 622

were cultivated in a FMT150 photobioreactor (Photon Systems Instruments Draacutesov Czech 623

Republic) at 800 micromol photons m-2 s-1 in the presence or absence of lincomycin (100 microgml) 624

Cell density was monitored photometrically at 750 nm Doubling times were determined after 625

two days of growth To generate the insertion mutant curT- the curT gene (slr0483) was first 626

amplified from wild-type genomic DNA by PCR using the primer pair 04835 627

(GAAGCCTATTTAGCTAAGGCCGAAAG) and 04833 628

(TAGTACCTGGTCTTCCATGGCGT) and the resulting fragment was cloned into the 629

Bluescript pKS vector (Stratagene Waldbronn Germany) A kanamycin resistance cassette 630

was then inserted into the single AgeI restriction site (159 bp downstream of the start codon) 631

and this disruption construct was used to replace the wild-type gene as described (Wilde et al 632

2001) 633

634

Bioinformatic and computational analysis 635

CURT1 sequences of Synechocystis 6803 were obtained from CyanoBase 636

(httpgenomekazusaorjpcyanobaseSynechocystis) and CURT1 homologs in other 637

organisms were retrieved from NCBIBLAST (httpblastncbinlmnihgovBlastcgi) 638

Numbers and positions of putative transmembrane domains in the predicted proteins were 639

determined with TMHMM20 (httpwwwcbsdtudkservicesTMHMM) The sequence for 640

the N-terminal amphipathic helix was predicted by Jpred 3 641

(httpwwwcompbiodundeeacukwww-jpred) and plotted using a helical wheel projection 642

script (httprzlabucreduscriptswheelwheelcgi) The programs ClustalW2 643

(httpwwwebiacuktoolsclustalw2) and GeneDoc (httpwwwpscedubiomedgenedoc) 644

were used to generate multiple alignments of amino acid sequences Quantitative analysis of 645

immunoblots was performed with the AIDA Image Analyzer V325 (Raytest 646

Isotopenmessgeraumlte GmbH Straubenhardt Germany) 647

Co-expression patterns of curT were analyzed using the CyanoEXpress 22 database 648

(httpcyanoexpresssysbiolabeu Hernaacutendez-Prieto and Futschik 2012 Hernaacutendez-Prieto et 649

al 2016) 650

20

651

Measurement of chlorophyll concentration and oxygen production 652

Determination of chlorophyll content was carried out according to Wellburn and 653

Lichtenthaler (1984) For oxygen evolution measurements cells were grown in BG-11 654

without glucose harvested in mid-log phase and diluted to an OD750 nm = 05 Oxygen 655

evolution rates were measured with a Clark-type oxygen electrode (Hansatech Instruments 656

Ltd Kingrsquos Lynn Norfolk UK) at 1000 micromol photons m-2 s-1 (cool white light) after 5 min of 657

dark acclimation Oxygen evolution under saturating light conditions was measured without 658

any additives 659

660

Cell size and cell number estimation 661

Synechocystis 6803 strains were grown in liquid BG11 media containing 5 mM 662

glucose For cell size estimation the cells were analyzed with a confocal laser scanning 663

microscope TCS SP5 (Leica Wetzlar Germany) The diameter of the cells was measured 664

with the LAS AF Lite software (Leica Wetzlar Germany) Cells that were about to divide 665

were not taken into account For the determination of cell number cultures were set to an 666

OD750 = 1 and analyzed by using a Neubauer counting chamber (Paul Marienfeld GmbH amp 667

Co KG Lauda-Koumlnigshofen Germany) Statistical significance was determined by Studentrsquos 668

t-test 669

670

Measurements of P700+ reduction kinetics and relative electron transport rates 671

P700+ reduction kinetics and changes in chlorophyll fluorescence yield at different 672

light intensities were measured at a chlorophyll concentration of 5 microgml with a Dual-PAM-673

100 instrument (Heinz Walz GmbH Effeltrich Germany) Complete P700 oxidation was 674

achieved by a 50-ms multiple turnover pulse (10000 micromol photons m-2 s-1) after 2 min of dark 675

incubation P700+ reduction kinetics were recorded without any additions as well as in the 676

presence of 10 microM DCMU Ten technical replicates were averaged and fitted with single 677

exponential functions Data interpretation was done according to Bernaacutet et al (2009) 678

Light saturation measurements were performed according to Xu et al (2008) The 679

actinic light intensity was increased stepwise from 0 to 665 micromol photons m-2 s-1 with 30-s 680

adaptation periods Maximal fluorescence yields were obtained by applying saturating light 681

pulses (duration 600 ms intensity 10000 micromol photons m-2 s-1) 682

683

Low-temperature fluorescence measurements 684

21

Fluorescence emission spectra were measured with an AMINCO Bowman Series 2 685

Luminescence Spectrometer Wild-type and curT- cells were grown in the presence of 5 mM 686

glucose to mid log-phase and concentrated to 25 microgml chlorophyll adding 2 microM fluorescein 687

as an internal standard Samples (1 ml) were transferred to thin glass tubes dark-adapted for 688

30 min at 30 degC and shock frozen in liquid N2 To quantify chlorophyllfluorescein and 689

phycobilisome-mediated fluorescence samples were excited and emission recorded at 440 690

nm510 nm (chlorophyll and fluorescein excitationmax fluorescein emission) and 580 691

nm685 nm respectively Emission was scanned at 490-800 nm or at 640-800 nm 692

respectively 693

694

Antibody production and protein analysis 695

For generation of an αCurT antibody the N-terminal coding region of curT (amino 696

acid positions 1-58) was amplified by PCR using primers N04835 697

(AAGGATCCGTGGGCCGTAAACATTCAA) and N04833 698

(AAGTCGACGCACTTCCCACACCGGTTGTA) and cloned into the BamHI and XhoI sites 699

of the pGEX-4T-1 vector (GE Healthcare Freiburg Germany) Expression of the GST fusion 700

protein in Escherichia coli BL21(DE3) and subsequent affinity purification on Glutathione-701

Sepharose 4B (GE Healthcare) were carried out as described (Schottkowski et al 2009b) A 702

polyclonal antiserum was raised against this protein fragment in rabbits (Pineda Berlin 703

Germany) Other primary antibodies used in this study have been described previously ie 704

αpD1 (Schottkowski et al 2009b) αD1 (Schottkowski et al 2009b) αD2 (Klinkert et al 705

2006) αPratA (Klinkert et al 2004) αYcf48 (Rengstl et al 2011) αPitt (Schottkowski et 706

al 2009a) αPOR (Schottkowski et al 2009a) αYidC (Ossenbuumlhl et al 2006) αVIPP1 707

(Aseeva et al 2007) αSll0933 (Armbruster et al 2010) and αSlr0151 (Rast et al 2016) or 708

were purchased from Agrisera (Vaumlnnaumls Sweden) ie αCP43 αCP47 αPsaA αCyt f 709

αRbcL αIsiA The αGFP-HRP antibody was acquired from Miltenyi Biotech (Bergisch 710

Gladbach Germany) 711

Protein concentrations were determined according to Bradford (1976) using RotiQuant 712

(Carl Roth GmbH amp Co KG Karlsruhe Germany) Protein extraction membrane 713

fractionation on sucrose-density gradients and quantification of Western signal intensities was 714

performed as described previously (Rengstl et al 2011) Solubility properties of CurT were 715

determined according to Schottkowski et al (2009a) 716

22

Sucrose-density centrifugation separating PDM and thylakoid membrane fractions by 717

two consecutive gradients was carried out as described previously (Schottkowski et al 718

2009b Rengstl et al 2011) 719

Two-dimensional fractionations of cyanobacterial membrane proteins via BNSDS-720

PAGE and of pulse-labeled proteins by BNSDS-PAGE were performed as previously 721

reported (Klinkert et al 2004 Schottkowski et al 2009b Rengstl et al 2013) For the 722

analysis of native complexes in fractions obtained by sucrose-density centrifugation the 723

volume corresponding to 350 microg of protein in fraction 7 was applied to BNSDS-PAGE 724

For isoelectric focusing (IEF) the volume corresponding to 50 microg of protein from 725

fraction 7 in 200 microl of IEF buffer (8 M urea 4 CHAPS 1 IPG buffer pH 4-7 (GE 726

Healthcare)) was applied to an 11-cm Immobiline DryStrip pH 4-7 (GE Healthcare) in a 727

Protean IEF Cell (Bio-Rad Munich Germany) Strips were rehydrated for 12 h at 20 degC and 728

50V Focusing was carried out in the following steps 500 V rapid 1500 Vh 1000 V linear 729

880 Vh 6000 V linear 9680 Vh 6000 V rapid 5390 Vh 50 microA per gel focus temperature 730

20degC Subsequently the strips were incubated in equilibration buffer I (6 M urea 0375 M 731

Tris pH 88 20 glycerol 2 SDS 2 DTT) and equilibration buffer II (6 M urea 0375 732

M Tris pH 88 20 glycerol 2 SDS 25 iodoacetamide) for 10 min in each buffer 733

Then the IEF strips were applied to second-dimension SDS-PAGE 734

735

Transmission electron microscopy and immunogold labeling 736

Sample preparation for transmission electron microscopy including freeze substitution 737

and immunogold labeling of CurT was performed as described previously (Stengel et al 738

2012) Ultrathin sections were cut to thicknesses of 35 - 45 nm and 45 - 65 nm for 739

ultrastructural analyses and immunogold labeling respectively For immunogold labeling 740

sections collected on collodion-coated Ni grids were incubated for 18 h at 4degC with (rabbit) 741

αCurT (diluted 1100 1500 11000 or 14000 in blocking buffer (5 fetal calf serum) with 742

005 Tween 20) and further processed as described previously (Stengel et al 2012) As a 743

negative control wild-type Synechocystis 6803 cells were incubated without the primary 744

antibody and exposed to the gold-labeled anti-rabbit IgG To image the ultrastructure and the 745

immunogold-treated samples a Fei Morgagni 268 transmission electron microscope was used 746

and micrographs were taken at 80 kV 747

To avoid errors in the interpretation of the immunogold labeling experiment only 748

signals which were unambiguously localized to distinctly visible thylakoid membranes were 749

taken into account For each cell different regions (see Figure 10F) were defined and in each 750

23

region the signals on the convex and concave sides of the thylakoid membrane were analyzed 751

separately (see Supplemental Figure 11 for representative counts) Statistical significance was 752

assessed by χ2 test (Zoumlfel 1988) 753

For the analysis of clusters of CurT signals in biogenesis centers a cluster was defined 754

as a minimum of four signals in close proximity Overall 219 biogenesis centers were 755

examined with regard to CurT cluster formation 756

757

Preparation of proteoliposomes 758

Liposomes with a lipid mixture of 25 monogalactosyl diacylglycerol 42 759

digalactosyl diacylglycerol 16 sulfoquinovosyl diacylglycerol and 17 760

phosphatidylglycerol (Lipid Products South Nutfield UK) were prepared as described 761

previously (Armbruster et al 2013) To generate proteoliposomes CurT and CURT1A 762

proteins were expressed in the presence of liposomes for 3 h at 37degC using a PURExpress In 763

Vitro Protein Synthesis Kit (New England Biolabs Ipswich MA USA) The liposomes were 764

separated from the mix by centrifugation in a discontinuous sucrose gradient (100000 g 18 765

h) Subsequently the fraction containing the liposomes was extracted and dialyzed against 20 766

mM HEPES (pH 76) For transmission electron microscopy the proteoliposomes were 767

negatively stained with 1 uranyl acetate on a carbon-coated copper grid Micrographs were 768

taken on a Fei Morgagni 268 TEM at 80 kV 769

770

curT-CFP strain generation 771

Gibson assembly was used for single-step cloning (Gibson 2011) of the slr0483 gene 772

(together with its ~08 kb upstream region) the mTurquoise2 gene fragment the gentamycin-773

resistance cassette (aacC1) and an ~17-kb downstream region of slr0483 into pBR322 774

cleaved with EcoRV and NheI The slr0483 gene was fused in frame to the codon-optimized 775

mTurquoise2 (DNA20) preceded by a linker sequence encoding GSGSG The resulting 776

plasmid was used to transform Synechocystis 6803 as described previously (Zang et al 2007) 777

After ~ 10 days of incubation on BG11-GelRite (15 ) medium in the presence of 2 microgml 778

gentamycin several antibiotic resistant colonies were obtained and streaked out on fresh 779

medium These transformants were then tested for full segregation of the tagged allele by 780

colony PCR with primers flanking the slr0483 gene 781

782

Fluorescence microscopy 783

24

An aliquot of a cell suspension in mid-log phase was placed under a BG11-agarose 784

pad on a glass coverslip (15) and imaged on an inverted microscope (Zeiss 785

AxioObserverZ1) equipped with an ORCA Flash40 V2 (Hamamatsu) camera a Lumenecor 786

SOLA II Light Engine and a Plan-Apochromat 63x140 Oil DIC M27 (NA 14) objective 787

(Zeiss) Image acquisition was done with Zen 21 software in cyan and far-red fluorescence 788

channels (Zeiss Filter Sets 47 HE and 50) as Z-series with a step size of 250 nm and effective 789

pixel size of 103 nm Acquired image files were subsequently deconvolved (Constrained 790

Iterative Method) using a default theoretical Point Spread Function in Zen 20 (Zeiss) 791

Extraction of intensities for line profiles was performed by image thresholding the thylakoid 792

autofluorescence channel and eroding the resulting binary mask in Fiji (Schindelin et al 793

2012) 794

For immunofluorescence analysis cells were grown to mid-log phase as in the case of 795

the cells prepared for live-cell microscopy A 10-ml culture was fixed for 20 min in 37 796

formaldehyde and following extensive washing with phosphate-buffered saline (PBS) cells 797

were first permeabilized in 005 Triton-X for 20 min and then in lysis buffer (50 mM Tris-798

HCl 100 mM NaCl 5 mgml lysozyme) at 37degC for 2 h with gentle shaking To block 799

unspecific binding sites the cell pellet was incubated in 5 bovine serum albumin in PBS at 800

30degC for 1 h The αCurT serum (1500 dilution) was added to cells in fresh blocking buffer 801

for 1 h at 30degC with gentle shaking Cells were then washed three times with blocking buffer 802

and incubated with goat anti-rabbit IgG secondary antibodies conjugated to Oregon Green 488 803

(Invitrogen) (11000 dilution) under the conditions as for the primary antibodies Cells were 804

washed three times with PBS and prepared for microscopy as above Imaging was done as 805

described for live-cell microscopy except that a Colibri2 LED light source was employed for 806

illumination and a CoolSnap HQ camera (Photometrics) was used for image acquisition Cells 807

were imaged as Z-series (step size 280 nm) in the yellow and far-red fluorescent channels 808

(Zeiss Filter Sets 46 HE and 50) using the 505 nm and 625 nm LED modules Effective pixel 809

size in the final image was 102 nm Deconvolution and image analysis was done as described 810

above As judged by the staining intensity of the Oregon Green-conjugated antibodies 811

approximately half of the cells in any given field of view appeared to have been successfully 812

permeabilised a rate that is common in our experience No significant signal was detected in 813

the control sample that had not been exposed to the primary antibodies 814

815

25

Accession numbers 816

Sequence data from this article can be found in the CyanoBase and EMBLGenBank 817

data libraries under accession number slr0483 818

819

Supplemental Data 820

Supplemental Figure 1 Construction of the curT- mutant 821

Supplemental Figure 2 Growth phenotype of curT- 822

Supplemental Figure 3 Expression analysis of the open reading frame slr0482 (located 823

upstream of curT) in the curT- strain 824

Supplemental Figure 4 Absorbance spectra of curT- and wild-type cells 825

Supplemental Figure 5 High-light growth phenotypes of wild-type Synechocystis 6803 and 826

the curT- strain 827

Supplemental Figure 6 Ultrastructure of the TD41 mutant which lacks the psbA transcript 828

and the D1 protein 829

Supplemental Figure 7 Expression and localization of CurT-CFP 830

Supplemental Figure 8 Localization of CurT and CurT-CFP by fluorescence microscopy 831

Supplemental Figure 9 Chlorophyll autofluorescence of curT- 832

Supplemental Figure 10 The curT- mutant as a negative control for immunogold labeling 833

Supplemental Figure 11 Representative counts of immunogold signals 834

Supplemental Table 1 Overview of immunogold signals in curT- cells 835

Supplemental Table 2 Overview of immunogold signals in specific regions of Synechocystis 836

6803 wild-type cells 837

Supplemental Table 3 Statistical analysis of immunogold signals for wild-type 838

Synechocystis 6803 cells 839

Supplemental Table 4 Co-expression of curT 840

Supplemental Movie 1 Scan through the Z-axis of a curT-CFP cell 841

Supplemental Movie 2 Rendered 3D-model of a CurT-CFP detection 842

Supplemental Movie 3 Scan through the Z-axis of a curT-CFP cell with a traversing 843

thylakoid lamella 844

845

Acknowledgements 846

We thank Y Nishiyama for providing αpD1 and J Soll for αVIPP1 and αYidC antibodies 847

respectively and Nina Dyczmons-Nowaczyk for support with the fluorescence measurements 848

This work was supported by grants awarded to JN (Ni3909) MMN (NO 8363) and DL 849

26

(Le126529) by the Deutsche Forschungsgemeinschaft in the context of Research Unit 850

FOR2092 and the Cluster of Excellence RESOLV (EXC 1069) AG is a Howard Hughes 851

Medical Institute postdoctoral fellow in the laboratory of Erin OrsquoShea at Harvard University 852

LS was supported by a PhD fellowship from the Chinese Scholarship Council 853

854

Author Contributions 855

SH AR LS MMN DL and JN designed the research SH AR LS AG ILG EH ML BR 856

SV performed the research all authors contributed to data analysis SH AR and JN wrote the 857

paper 858

859

Competing Financial Interest statement 860

The authors declare no competing financial interests 861

862

We wish to dedicate this paper to Fabrice Rappaport an outstanding colleague and friend who 863

passed away so early 864

865

27

References 866

Allen JF de Paula WBM Puthiyaveetil S and Nield J (2011) A structural 867

phylogenetic map for chloroplast photosynthesis Trends Plant Sci 16 645-655 868

Anderson JM Horton P Kim E-H and Chow WS (2012) Towards elucidation of 869

dynamic structural changes of plant thylakoid architecture Philos Trans R Soc 870

Lond B Biol Sci 367 3515-3524 871

Armbruster U Zuumlhlke J Rengstl B Kreller R Makarenko E Ruumlhle T Schuumlnemann 872

D Jahns P Weisshaar B Nickelsen J and Leister D (2010) The Arabidopsis 873

thylakoid protein PAM68 is required for efficient D1 biogenesis and photosystem II 874

assembly Plant Cell 22 3439-3460 875

Armbruster U Labs M Pribil M Viola S Xu W Scharfenberg M Hertle AP 876

Rojahn U Jensen PE Rappaport F Joliot P Doumlrmann P Wanner G and 877

Leister D (2013) Arabidopsis CURVATURE THYLAKOID1 proteins modify 878

thylakoid architecture by inducing membrane curvature Plant Cell 25 2661-2678 879

Aseeva E Ossenbuumlhl F Sippel C Cho WK Stein B Eichacker LA Meurer J 880

Wanner G Westhoff P Soll J and Vothknecht UC (2007) Vipp1 is required for 881

basic thylakoid membrane formation but not for the assembly of thylakoid protein 882

complexes Plant Physiol Biochem 45 119-128 883

Bartsevich VV and Pakrasi HB (1995) Molecular identification of an ABC transporter 884

complex for manganese analysis of a cyanobacterial mutant strain impaired in the 885

photosynthetic oxygen evolution process EMBO J 14 1845-1853 886

Bartsevich VV and Pakrasi HB (1996) Manganese transport in the cyanobacterium 887

Synechocystis sp PCC 6803 J Biol Chem 271 26057-26061 888

Bernaacutet G Waschewski N and Roumlgner M (2009) Towards efficient hydrogen production 889

the impact of antenna size and external factors on electron transport dynamics in 890

Synechocystis PCC 6803 Photosynth Res 99 205-216 891

Boehm M Yu J Krynicka V Barker M Tichy M Komenda J Nixon PJ and Nield 892

J (2012) Subunit Organization of a Synechocystis Hetero-Oligomeric Thylakoid FtsH893

Complex Involved in Photosystem II Repair Plant Cell 24 3669-3683894

Bradford MM (1976) A rapid and sensitive method for the quantitation of microgram 895

quantities of protein utilizing the principle of protein-dye binding Anal Biochem 72 896

248-254897

28

Chang L Liu X Li Y Liu C-C Yang F Zhao J and Sui S-F (2015) Structural 898

organization of an intact phycobilisome and its association with photosystem II Cell 899

Res 25 726-737 900

Danielsson R Suorsa M Paakkarinen V Albertsson P-Aring Styring S Aro E-M and 901

Mamedov F (2006) Dimeric and monomeric organization of photosystem II 902

Distribution of five distinct complexes in the different domains of the thylakoid 903

membrane J Biol Chem 281 14241-14249 904

Daum B Nicastro D Austin J McIntosh JR and Kuumlhlbrandt W (2010) Arrangement 905

of photosystem II and ATP synthase in chloroplast membranes of Spinach and Pea 906

Plant Cell 22 1299-1312 907

Engel BD Schaffer M Kuhn Cuellar L Villa E Plitzko JM and Baumeister W 908

(2015) Native architecture of the Chlamydomonas chloroplast revealed by in situ 909

cryo-electron tomography eLife 4 e04889 910

Ford MGJ Mills IG Peter BJ Vallis Y Praefcke GJK Evans PR and McMahon 911

HT (2002) Curvature of clathrin-coated pits driven by epsin Nature 419 361-366 912

Fristedt R Willig A Granath P Cregravevecoeur M Rochaix J-D and Vener AV (2009) 913

Phosphorylation of photosystem II controls functional macroscopic folding of 914

photosynthetic membranes in Arabidopsis Plant Cell 21 3950-3964 915

Gallop JL and McMahon HT (2005) BAR domains and membrane curvature bringing 916

your curves to the BAR Biochem Soc Symp 72 223-231 917

Gibson DG (2011) Chapter fifteen - Enzymatic Assembly of Overlapping DNA Fragments 918

In Methods in Enzymology V Christopher ed (Academic Press) pp 349-361 919

Goedhart J von Stetten D Noirclerc-Savoye M Lelimousin M Joosen L Hink MA 920

van Weeren L Gadella TWJ and Royant A (2012) Structure-guided evolution of 921

cyan fluorescent proteins towards a quantum yield of 93 Nat Commun 3 751 922

Heinz S Liauw P Nickelsen J and Nowaczyk M (2016) Analysis of photosystem II 923

biogenesis in cyanobacteria Biochim Biophys Acta 1857 274-287 924

Hernaacutendez-Prieto M and Futschik M (2012) CyanoEXpress A web database for 925

exploration and visualisation of the integrated transcriptome of cyanobacterium 926

Synechocystis sp PCC6803 Bioinformation 8 634-638 927

Hernaacutendez-Prieto MA Semeniuk TA Giner-Lamia J and Futschik ME (2016) The 928

Transcriptional Landscape of the Photosynthetic Model Cyanobacterium 929

Synechocystis sp PCC6803 Sci Rep 6 22168 930

29

Huang F Fulda S Hagemann M and Norling B (2006) Proteomic screening of salt-931

stress-induced changes in plasma membranes of Synechocystis sp strain PCC 6803 932

Proteomics 6 910-920 933

Kirchhoff H (2013) Architectural switches in plant thylakoid membranes Photosynth Res 934

116 481-487 935

Klinkert B Elles I and Nickelsen J (2006) Translation of chloroplast psbD mRNA in 936

Chlamydomonas is controlled by a secondary RNA structure blocking the AUG start 937

codon Nucleic Acids Res 34 386-394 938

Klinkert B Ossenbuumlhl F Sikorski M Berry S Eichacker L and Nickelsen J (2004) 939

PratA a periplasmic tetratricopeptide repeat protein involved in biogenesis of 940

photosystem II in Synechocystis sp PCC 6803 J Biol Chem 279 44639-44644 941

Komenda J Nickelsen J Tichyacute M Praacutešil O Eichacker LA and Nixon PJ (2008) The 942

cyanobacterial homologue of HCF136YCF48 is a component of an early photosystem 943

II assembly complex and is important for both the efficient assembly and repair of 944

photosystem II in Synechocystis sp PCC 6803 J Biol Chem 283 22390-22399 945

Kopf M Klaumlhn S Scholz I Matthiessen JKF Hess WR and Voszlig B (2014) 946

Comparative analysis of the primary transcriptome of Synechocystis sp PCC 6803 947

DNA Res 21 527-539 948

Kunkel DD (1982) Thylakoid centers Structures associated with the cyanobacterial 949

photosynthetic membrane system Arch Microbiol 133 97-99 950

Liberton M Howard Berg R Heuser J Roth R and Pakrasi BH (2006) Ultrastructure 951

of the membrane systems in the unicellular cyanobacterium Synechocystis sp strain 952

PCC 6803 Protoplasma 227 129-138 953

Liberton M Saha R Jacobs JM Nguyen AY Gritsenko MA Smith RD 954

Koppenaal DW and Pakrasi HB (2016) Global Proteomic Analysis Reveals an 955

Exclusive Role of Thylakoid Membranes in Bioenergetics of a Model 956

Cyanobacterium Mol Cell Proteomics 15 2021-2032 957

Luque I and Ochoa de Alda JAG (2014) CURT1CAAD-containing aaRSs thylakoid 958

curvature and gene translation Trends Plant Sci 19 63-66 959

Marin K Stirnberg M Eisenhut M Kraumlmer R and Hagemann M (2006) Osmotic stress 960

in Synechocystis sp PCC 6803 low tolerance towards nonionic osmotic stress results 961

from lacking activation of glucosylglycerol accumulation Microbiology 152 2023-962

2030 963

Mullineaux CW (2005) Function and evolution of grana Trends Plant Sci 10 521-525 964

30

Mullineaux CW (2008) Biogenesis and dynamics of thylakoid membranes and the 965

photosynthetic apparatus In The Cyanobacteria A Herrero and E Flores eds 966

(Norfolk UK Caister Academic Press) pp 289ndash304 967

Nevo R Charuvi D Tsabari O and Reich Z (2012) Composition architecture and 968

dynamics of the photosynthetic apparatus in higher plants Plant J 70 157-176 969

Nickelsen J and Rengstl B (2013) Photosystem II assembly From cyanobacteria to plants 970

Annu Rev Plant Biol 64 609-635 971

Nickelsen J and Zerges W (2013) Thylakoid biogenesis has joined the new era of bacterial 972

cell biology Front Plant Sci 4 458 973

Nilsson F Simpson DJ Jansson C and Andersson B (1992) Ultrastructural and 974

biochemical characterization of a Synechocystis 6803 mutant with inactivated psbA 975

genes Arch Biochem Biophys 295 340-347 976

Odom WR Hodges R Chitnis PR and Guikema JA (1993) Characterization of 977

Synechocystis sp PCC 6803 in iron-supplied and iron-deficient media Plant Mol 978

Biol 23 1255-1264 979

Ossenbuumlhl F Inaba-Sulpice M Meurer J Soll J and Eichacker LA (2006) The 980

Synechocystis sp PCC 6803 Oxa1 homolog is essential for membrane integration of 981

reaction center precursor protein pD1 Plant Cell 18 2236-2246 982

Pisareva T Kwon J Oh J Kim S Ge C Wieslander Aring Choi J-S and Norling B 983

(2011) Model for Membrane Organization and Protein Sorting in the Cyanobacterium 984

Synechocystis sp PCC 6803 Inferred from Proteomics and Multivariate Sequence 985

Analyses J Proteome Res 10 3617-3631 986

Pribil M Labs M and Leister D (2014) Structure and dynamics of thylakoids in land 987

plants J Exp Bot 65 1955-1972 988

Rast A Heinz S and Nickelsen J (2015) Biogenesis of thylakoid membranes Biochim 989

Biophys Acta 1847 821-830 990

Rast A Rengstl B Heinz S Klingl A and Nickelsen J (2016) The role of Slr0151 a 991

tetratricopeptide repeat protein from Synechocystis sp PCC 6803 during Photosystem 992

II assembly and repair Front Plant Sci 7 605 993

Rengstl B Oster U Stengel A and Nickelsen J (2011) An Intermediate Membrane 994

Subfraction in Cyanobacteria Is Involved in an Assembly Network for Photosystem II 995

Biogenesis J Biol Chem 286 21944-21951 996

31

Rengstl B Knoppovaacute J Komenda J and Nickelsen J (2013) Characterization of a 997

Synechocystis double mutant lacking the photosystem II assembly factors YCF48 and 998

Sll0933 Planta 237 471-480 999

Rexroth S Mullineaux CW Ellinger D Sendtko E Roumlgner M and Koenig F (2011) 1000

The Plasma Membrane of the Cyanobacterium Gloeobacter violaceus Contains 1001

Segregated Bioenergetic Domains Plant Cell 23 2379-2390 1002

Rippka R Deruelles J Waterbury JB Herdman M and Stanier RY (1979) Generic 1003

Assignments Strain Histories and Properties of Pure Cultures of Cyanobacteria 1004

Microbiology 111 1-61 1005

Ruumltgers M and Schroda M (2013) A role of VIPP1 as a dynamic structure within 1006

thylakoid centers as sites of photosystem biogenesis Plant Signal Behav 8 e27037 1007

Sacharz J Bryan SJ Yu J Burroughs NJ Spence EM Nixon PJ and Mullineaux 1008

CW (2015) Sub-cellular location of FtsH proteases in the cyanobacterium1009

Synechocystis sp PCC 6803 suggests localised PSII repair zones in the thylakoid1010

membranes Mol Microbiol 96 448-4621011

Sandstroumlm S Park Y-I Oumlquist G and Gustafsson P (2001) CP43prime the isiA Gene 1012

Product Functions as an Excitation Energy Dissipator in the Cyanobacterium 1013

Synechococcus sp PCC 7942 Photochem Photobiol 74 431-437 1014

Schindelin J Arganda-Carreras I Frise E Kaynig V Longair M Pietzsch T 1015

Preibisch S Rueden C Saalfeld S Schmid B Tinevez J-Y White DJ 1016

Hartenstein V Eliceiri K Tomancak P and Cardona A (2012) Fiji an open-1017

source platform for biological-image analysis Nat Methods 9 676-682 1018

Schottkowski M Ratke J Oster U Nowaczyk M and Nickelsen J (2009a) Pitt a novel 1019

tetratricopeptide repeat protein involved in light-dependent chlorophyll biosynthesis 1020

and thylakoid membrane biogenesis in Synechocystis sp PCC 6803 Mol Plant 2 1021

1289-1297 1022

Schottkowski M Gkalympoudis S Tzekova N Stelljes C Schuumlnemann D Ankele E 1023

and Nickelsen J (2009b) Interaction of the periplasmic PratA factor and the PsbA 1024

(D1) protein during biogenesis of photosystem II in Synechocystis sp PCC 6803 J 1025

Biol Chem 284 1813-1819 1026

Selatildeo TT Zhang L Knoppovaaacute J Komenda J and Norling B (2016) Photosystem II 1027

Assembly Steps Take Place in the Thylakoid Membrane of the Cyanobacterium 1028

Synechocystis sp PCC6803 Plant Cell Physiol 57 878 1029

32

Spaumlt P Maček B and Forchhammer K (2015) Phosphoproteome of the cyanobacterium 1030

Synechocystis sp PCC 6803 and its dynamics during nitrogen starvation Front 1031

Microbiol 6 248 1032

Stengel A Guumlgel IL Hilger D Rengstl B Jung H and Nickelsen J (2012) Initial 1033

steps of photosystem II de novo assembly and preloading with manganese take place 1034

in biogenesis centers in Synechocystis Plant Cell 24 660-675 1035

Uniacke J and Zerges W (2007) Photosystem II assembly and repair are differentially 1036

localized in Chlamydomonas Plant Cell 19 3640-3654 1037

Uniacke J and Zerges W (2009) Chloroplast protein targeting involves localized 1038

translation in Chlamydomonas Proc Natl Acad Sci USA 106 1439-1444 1039

van de Meene AL Hohmann-Marriott M Vermaas WJ and Roberson R (2006) The 1040

three-dimensional structure of the cyanobacterium Synechocystis sp PCC 6803 Arch 1041

Microbiol 184 259-270 1042

van de Meene AML Sharp WP McDaniel JH Friedrich H Vermaas WFJ and 1043

Roberson RW (2012) Gross morphological changes in thylakoid membrane 1044

structure are associated with photosystem I deletion in Synechocystis sp PCC 6803 1045

Biochim Biophys Acta 1818 1427-1434 1046

Watanabe M and Ikeuchi M (2013) Phycobilisome architecture of a light-harvesting 1047

supercomplex Photosynth Res 116 265-276 1048

Wellburn AR and Lichtenthaler H (1984) Formulae and Program to Determine Total 1049

Carotenoids and Chlorophylls A and B of Leaf Extracts in Different Solvents In 1050

Advances in Photosynthesis Research Proceedings of the VIth International Congress 1051

on Photosynthesis Brussels Belgium August 1ndash6 1983 C Sybesma ed (Dordrecht 1052

Springer Netherlands) pp 9-12 1053

Wilde A Lunser K Ossenbuumlhl F Nickelsen J and Borner T (2001) Characterization of 1054

the cyanobacterial ycf37 mutation decreases the photosystem I content Biochem J 1055

357 211-216 1056

Wilson A Boulay C Wilde A Kerfeld CA and Kirilovsky D (2007) Light-Induced 1057

Energy Dissipation in Iron-Starved Cyanobacteria Roles of OCP and IsiA Proteins 1058

Plant Cell 19 656-672 1059

Xu M Bernaacutet G Singh A Mi H Roumlgner M Pakrasi HB and Ogawa T (2008) 1060

Properties of Mutants of Synechocystis sp Strain PCC 6803 Lacking Inorganic Carbon 1061

Sequestration Systems Plant Cell Physiol 49 1672-1677 1062

33

Yamamoto T Burke J Autz G and Jagendorf AT (1981) Bound ribosomes of Pea 1063

chloroplast thylakoid membranes location and release in vitro by high salt 1064

puromycin and RNase Plant Physiol 67 940-949 1065

Yang H Liao L Bo T Zhao L Sun X Lu X Norling B and Huang F (2014) 1066

Slr0151 in Synechocystis sp PCC 6803 is required for efficient repair of photosystem 1067

II under high-light condition J Integr Plant Biol 56 1136-1150 1068

Yeremenko N Kouřil R Ihalainen JA DHaene S van Oosterwijk N 1069

Andrizhiyevskaya EG Keegstra W Dekker HL Hagemann M Boekema EJ 1070

Matthijs HCP and Dekker JP (2004) Supramolecular Organization and Dual 1071

Function of the IsiA Chlorophyll-Binding Protein in Cyanobacteria Biochemistry 43 1072

10308-10313 1073

Zak E Norling B Maitra R Huang F Andersson B and Pakrasi HB (2001) The 1074

initial steps of biogenesis of cyanobacterial photosystems occur in plasma membranes 1075

Proc Natl Acad Sci USA 98 13443-13448 1076

Zang X Liu B Liu S Arunakumara KKIU and Zhang X (2007) Optimum 1077

Conditions for Transformation of Synechocystis sp PCC 6803 J Microbiol 45 241-1078

245 1079

Zhang L and Sakamoto W (2015) Possible function of VIPP1 in maintaining chloroplast 1080

membranes Biochim Biophys Acta 1847 831-837 1081

Zimmerberg J and Kozlov MM (2006) How proteins produce cellular membrane 1082

curvature Nat Rev Mol Cell Biol 7 9-19 1083

Zoumlfel P (1988) Statistik in der Praxis (Stuttgart Germany Gustav Fischer Verlag) 1084

1085

34

Figure Legends 1086

Figure 1 General characteristics of CurT A) Sequence alignment of CurT and CURT1A-D 1087

from A thaliana Predicted chloroplast transit-peptide sequences of CURT1A-D are omitted 1088

(Armbruster et al 2013) Positions of predicted C-terminal transmembrane domains (TDM) 1089

are marked (black bar) as is the position of the predicted amphipathic N-terminal helix in 1090

CurT (red bar) The green bar denotes the peptide sequence used for antibody production 1091

Identical and related amino acids that are conserved in 100 80 and 60 of the sequences 1092

are highlighted in black dark grey and light grey respectively B) Helical-wheel 1093

representation of the N-terminal amphipathic helix of CurT (red bar in A) The color code 1094

reflects the physicochemical properties of amino-acid side-chains green polar and 1095

uncharged blue polar and positively charged red polar and negatively charged yellow 1096

hydrophobic C) Solubility of CurT Membrane-associated proteins (50 microg) from wild-type 1097

cells were extracted with 5 mM HEPES (pH 76) containing either 1 M NaCl 01 M Na2CO3 1098

4 M urea 01 Triton X-100 or no additional solute After separation of membrane-bound 1099

(M) and solubilized (S) proteins by centrifugation proteins were fractionated by SDS-PAGE1100

and CurT was immunodetected on immunoblots As a control the integral membrane protein 1101

CP47 from PSII was analyzed in parallel D) Transmission electron micrographs of negatively 1102

stained liposomes Cell-free expression (CFE) of CurT and A thaliana CURT1A was 1103

performed in the presence of liposomes similar in composition to the lipids of the thylakoid 1104

membrane Liposomes before and after cell-free protein expression in the absence of DNA 1105

served as negative controls Black arrowheads indicate tubular connections between 1106

liposomes Scale bars 250 nm 1107

1108

Figure 2 Ultrastructural analysis of curT- cells Transmission electron micrographs of typical 1109

wild-type (A) and curT- (B-D) Synechocystis 6803 cells taken at 44000times (A B) and 28000times 1110

(C D) magnification respectively Ultrathin sections (35 to 45 nm) of cryofixed samples 1111

were stained with osmium tetroxide and post-stained using lead citrate Arrowheads indicate 1112

biogenesis centers Scale bars 200 nm (A B) and 500 nm (C D) respectively 1113

1114

Figure 3 Accumulation of components of photosynthetic complexes in the curT- mutant A) 1115

Whole cell extracts (30 microg protein) from wild-type and curT- strains were fractionated by 1116

SDS-PAGE and analyzed on immunoblots using the indicated antibodies B) The histogram 1117

shows levels of the indicated proteins in curT- extracts relative to wild-type samples (dashed 1118

red line) Data are means plusmn SD of three independent experiments Significant differences from 1119

35

wild-type protein levels according to Studentrsquos t-test with error probabilities of 5 and 1 1120

are indicated by and respectively 1121

1122

Figure 4 P700+ reduction kinetics and high-light effects in curT- cells A) Averaged traces 1123

(10 single measurements) of P700+ decay after complete oxidation by a 50-ms multiple 1124

turnover pulse (10000 micromol photons m-2 s-1) in the absence and presence of 10 microM DCMU 1125

B) Rate constants for P700+ reduction were obtained by fitting of the data with single1126

exponential functions Error bars indicate the SD of three independent measurements C) 1127

Impact of light intensity on the (relative) electron transport rate (rETR) Cells were exposed to 1128

gradually increasing light intensities which resulted in increasing electron transport until the 1129

capacity limit was reached PAR light intensity (micromol photons m-2 s-1) Error bars indicate the 1130

SD of three independent measurements D) D1 protein level in wild-type and curT- after high-1131

light treatment (800 micromol photons m-2s-1) in the presence and absence of lincomycin Samples 1132

were taken every 30 min and processed as in Figure 3 to determine the level of D1 present 1133

100 refers to wild-type D1 level at the beginning of the experiment 1134

1135

Figure 5 PSII assembly in curT- cells A) BNSDS-PAGE of membrane proteins Membrane 1136

fractions from wild-type and curT- cells were solubilized with 13 n-dodecyl-β-maltoside 1137

and proteins were fractionated by two-dimensional BNSDS-PAGE blotted and probed with 1138

antibodies against the PSII subunits D1 D2 CP47 and CP43 Wild-type blots were also 1139

probed with the αCurT antibody The sizes of marker proteins and the positions of PSII 1140

assembly intermediates (RCCII RCCI RC47) are shown above and below each image B) In 1141

vivo pulse labeling of membrane proteins with 35S Pulse-labeled PSII core proteins were 1142

separated via BNSDS-PAGE and visualized by autoradiography 1143

1144

Figure 6 Loss of CurT induces stress A) Low-temperature (77 K) fluorescence emission of 1145

Synechocystis 6803 wild-type (blue) and curT- (red) cells excited at 440 nm The spectra were 1146

normalized to the added fluorescein standard B) Low-temperature (77 K) fluorescence 1147

emission of Synechocystis 6803 wild-type (blue) and curT- (red) excited at 580 nm The 1148

spectra were normalized to 780 nm C) Level of IsiA in the curT- mutant relative to the wild-1149

type A mean value of 368 plusmn 96 (SD) was determined from three independent experiments 1150

1151

Figure 7 Membrane sublocalization of PSII-related factors Cell extracts from wild-type and 1152

curT- cells were fractionated by two consecutive rounds of sucrose-density gradient 1153

36

centrifugation (Schottkowski et al 2009b) The second linear gradient (20-60 sucrose) was 1154

apportioned into 14 fractions which were analyzed by immunoblotting using the indicated 1155

antibodies Fractions 1ndash6 represent PDMs and fractions 7ndash14 thylakoid membranes (TMs) 1156

To facilitate comparison between gradients sample volumes were normalized to the volume 1157

of fraction 7 that contained 40 microg of protein 1158

1159

Figure 8 Live-cell imaging of the curT-CFP strain by fluorescence microscopy In the curT-1160

CFP strain the native curT gene has been replaced by a CFP-tagged version resulting in the 1161

expression of the CurT-CFP fusion protein under the control of the native promotor A) 1162

Close-up views of the mid-cell plane in the CFP and far-red autofluorescence channels shown 1163

in slice 7 in panel B B) Synechocystis 6803 cells expressing CurT C-terminally fused to the 1164

mTurquoise2 variant of CFP from its native chromosomal promoter The two imaging 1165

channels are displayed as Z-axis montages (auto-scaled contrast step size 250 nm) in 1166

grayscale and color composite configuration The thylakoid autofluorescent channel as 1167

imaged in far-red fluorescence is depicted in magenta and CurT signal as imaged in cyan 1168

fluorescence is depicted in cyan C) Fluorescence intensity profiles of the two channels along 1169

the autofluorescent peripheral cell ldquoringrdquo are shown for slice 7 The maximum projection of 1170

the entire Z montage is also shown Scale bars (light grey) 2 microm 1171

1172

Figure 9 Immunofluorescence detection of CurT A) Close-ups of slice 5 in panel B B) 1173

Wild-type Synechocystis 6803 cells labeled with αCurT antibodies and detected with Oregon 1174

Green-conjugated secondary antibodies The Z-axis montages are shown as in Figure 8B 1175

except that the step size is 280 nm (1 to 10) C) Intensity profiles of the two channels along 1176

the autofluorescent peripheral cell ldquoringrdquo are shown for slice 5 The maximum projection of 1177

the entire Z montage is also shown Scale bars (light grey) 2 microm 1178

1179

Figure 10 Subcellular localization of CurT Ultrathin sections of wild-type Synechocystis 1180

6803 cells were incubated with rabbit αCurT prior to incubation with gold-conjugated goat 1181

anti-rabbit IgG A) Negative control (wild-type processed without addition of primary 1182

antibody) B C) Immunogold-labeled sections showing CurT localization at the cytoplasmic 1183

side of the thylakoid membrane D) Cluster formation of CurT signals at a putative biogenesis 1184

center from C E) Biogenesis center from the same cell (C) without any obvious CurT 1185

clustering of gold particles F) Schematic depiction of a wild-type cell (from Figure 2A) with 1186

color-coded curved membranes green = thylakoids that follow the curvature of the cell red = 1187

37

thylakoids that bend away from the plasma membrane yellow = thylakoids that bend toward 1188

the plasma membrane to converge on sites of biogenesis centers G) Relative distribution of 1189

gold signals between convex (dark color) and concave (light color) sides of membranes (n = 1190

1584 signals from a total of 95 cells) The undifferentiated overall signal distribution is given 1191

in blue Bars = 200 nm (overview) and 100 nm (details) 1192

1193

Figure 11 Differentially modified forms of CurT are found in different complexes in PDMs 1194

and thylakoid membranes Samples were isolated by fractionation of wild-type membranes 1195

via two consecutive sucrose density gradients according to Schottkowski et al (2009b) After 1196

density centrifugation samples were applied to BNSDS-PAGE analysis (A) or isoelectric 1197

focusing (B) Numbers on the right indicate the respective fraction from the second gradient 1198

(see Figure 7) Fraction 5 represents the PDMs and fraction 9 the thylakoid membrane 1199

1200

Figure 12 Loss of CurT increases sensitivity to abiotic stress A B) Doubling times of wild-1201

type and curT- under salt stress (A) or osmotic stress (B) Doubling times are means plusmn SD of 1202

three independent cultures C) Localization of CurT-CFP under salt and osmotic stress 1203

Samples were examined as described in Figure 8 Scale bars 1 microm D) Protein levels of wild-1204

type cells after growth in BG11 medium containing 500 mM NaCl Samples were analyzed on 1205

the same gel but unrelated samples between the presented signals were omitted E) 1206

Membrane preparations obtained from wild-type cells wild-type cells grown in the presence 1207

of 500 mM NaCl and curT- cells were subjected to the first gradient step in the membrane 1208

fractionation scheme The gradient was divided into five fractions and 10 of fractions I-IV 1209

and 02 of fraction V were analyzed by SDS-PAGE Fraction II includes the plasma 1210

membrane and fraction V consists of PratA-defined membrane and thylakoid membrane 1211

1212

Figure 13 Model of CurT distribution at convergence zones in Synechocystis 6803 The 1213

distribution of CurT in thylakoid (green) and plasma membranes (brown) is shown The 1214

pattern of localization of CurT in the thylakoid membrane is derived from membrane 1215

fractionation via sucrose density centrifugation fluorescence-based detection of the CurT-1216

CFP fusion and endogenous CurT and immunogold labeling experiments (Figures 7-10) The 1217

different CurT variants a b c and d identified in the IEF experiments (Figure 11) are depicted 1218

in yellow pink blue and black respectively CurT present in the plasma membrane is 1219

highlighted in gray as its precise nature and role remain to be defined (Figure 12) 1220

Membranes are represented as lipid bilayers Convex and concave faces of bent thylakoid 1221

38

sheets are indicated by black arrows The PDM which is dedicated to PSII assembly and 1222

repair is depicted in blue The dotted blue line emphasizes that the ultrastructure in this region 1223

has not yet been fully resolved PP periplasm PM plasma membrane TM thylakoid 1224

membrane L lumen PDM PratA-defined membrane 1225

1226

Tables 1227

Table 1 Physiological characteristics of the curT- mutant 1228

Strain Doubling time [h]

Oxygen Evolution[nmol h-1 OD750

-1]c

Chlorophyll content

[microg OD750-1]

d

Cell size [microm]e

Cell number [ml-1 OD750

-1]f

Wild type 817plusmn017a 1600plusmn042

b 1933plusmn187 251plusmn014 264plusmn020 390plusmn006 x 107

curT- 1259plusmn020a 3226plusmn056

b 1074plusmn20 195plusmn029 274plusmn044 367plusmn016 x 107

1229 abDoubling times in the presence (a) or absence (b) of 5 mM glucose measured under 1230

continuous illumination at 30 micromol photons m-2 s-1 and CO2-limiting conditions cOxygen 1231

evolution is expressed in nmol O2 produced per hour per OD750 unit dChlorophyll content is 1232

expressed in microg OD750-1 eThe diameter of non-dividing cells is presented in microm fCell number 1233

was determined per ml per OD750 Data are means plusmn SD of at least three independent 1234

experiments 1235

1236

Parsed CitationsAllen JF de Paula WBM Puthiyaveetil S and Nield J (2011) A structural phylogenetic map for chloroplast photosynthesisTrends Plant Sci 16 645-655

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Anderson JM Horton P Kim E-H and Chow WS (2012) Towards elucidation of dynamic structural changes of plant thylakoidarchitecture Philos Trans R Soc Lond B Biol Sci 367 3515-3524

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Armbruster U Zuumlhlke J Rengstl B Kreller R Makarenko E Ruumlhle T Schuumlnemann D Jahns P Weisshaar B NickelsenJ and Leister D (2010) The Arabidopsis thylakoid protein PAM68 is required for efficient D1 biogenesis and photosystem IIassembly Plant Cell 22 3439-3460

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Armbruster U Labs M Pribil M Viola S Xu W Scharfenberg M Hertle AP Rojahn U Jensen PE Rappaport F JoliotP Doumlrmann P Wanner G and Leister D (2013) Arabidopsis CURVATURE THYLAKOID1 proteins modify thylakoid architectureby inducing membrane curvature Plant Cell 25 2661-2678

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Aseeva E Ossenbuumlhl F Sippel C Cho WK Stein B Eichacker LA Meurer J Wanner G Westhoff P Soll J andVothknecht UC (2007) Vipp1 is required for basic thylakoid membrane formation but not for the assembly of thylakoid proteincomplexes Plant Physiol Biochem 45 119-128

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Bartsevich VV and Pakrasi HB (1995) Molecular identification of an ABC transporter complex for manganese analysis of acyanobacterial mutant strain impaired in the photosynthetic oxygen evolution process EMBO J 14 1845-1853

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Bartsevich VV and Pakrasi HB (1996) Manganese transport in the cyanobacterium Synechocystis sp PCC 6803 J Biol Chem271 26057-26061

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Bernaacutet G Waschewski N and Roumlgner M (2009) Towards efficient hydrogen production the impact of antenna size andexternal factors on electron transport dynamics in Synechocystis PCC 6803 Photosynth Res 99 205-216

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Boehm M Yu J Krynicka V Barker M Tichy M Komenda J Nixon PJ and Nield J (2012) Subunit Organization of aSynechocystis Hetero-Oligomeric Thylakoid FtsH Complex Involved in Photosystem II Repair Plant Cell 24 3669-3683

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Bradford MM (1976) A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle ofprotein-dye binding Anal Biochem 72 248-254

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Chang L Liu X Li Y Liu C-C Yang F Zhao J and Sui S-F (2015) Structural organization of an intact phycobilisome and itsassociation with photosystem II Cell Res 25 726-737

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Danielsson R Suorsa M Paakkarinen V Albertsson P-Aring Styring S Aro E-M and Mamedov F (2006) Dimeric andmonomeric organization of photosystem II Distribution of five distinct complexes in the different domains of the thylakoidmembrane J Biol Chem 281 14241-14249

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Daum B Nicastro D Austin J McIntosh JR and Kuumlhlbrandt W (2010) Arrangement of photosystem II and ATP synthase in

19

Methods 617

Strains and growth conditions 618

Wild-type and mutant Synechocystis 6803 cells were grown on solid or in liquid BG 619

11 medium (Rippka et al 1979) supplemented with 5 mM glucose (unless indicated 620

otherwise) at 30degC under continuous illumination at a photon irradiance of 30 μmol m-2 s-1 of 621

white light For growth during high-light experiments for investigation of D1 repair cells 622

were cultivated in a FMT150 photobioreactor (Photon Systems Instruments Draacutesov Czech 623

Republic) at 800 micromol photons m-2 s-1 in the presence or absence of lincomycin (100 microgml) 624

Cell density was monitored photometrically at 750 nm Doubling times were determined after 625

two days of growth To generate the insertion mutant curT- the curT gene (slr0483) was first 626

amplified from wild-type genomic DNA by PCR using the primer pair 04835 627

(GAAGCCTATTTAGCTAAGGCCGAAAG) and 04833 628

(TAGTACCTGGTCTTCCATGGCGT) and the resulting fragment was cloned into the 629

Bluescript pKS vector (Stratagene Waldbronn Germany) A kanamycin resistance cassette 630

was then inserted into the single AgeI restriction site (159 bp downstream of the start codon) 631

and this disruption construct was used to replace the wild-type gene as described (Wilde et al 632

2001) 633

634

Bioinformatic and computational analysis 635

CURT1 sequences of Synechocystis 6803 were obtained from CyanoBase 636

(httpgenomekazusaorjpcyanobaseSynechocystis) and CURT1 homologs in other 637

organisms were retrieved from NCBIBLAST (httpblastncbinlmnihgovBlastcgi) 638

Numbers and positions of putative transmembrane domains in the predicted proteins were 639

determined with TMHMM20 (httpwwwcbsdtudkservicesTMHMM) The sequence for 640

the N-terminal amphipathic helix was predicted by Jpred 3 641

(httpwwwcompbiodundeeacukwww-jpred) and plotted using a helical wheel projection 642

script (httprzlabucreduscriptswheelwheelcgi) The programs ClustalW2 643

(httpwwwebiacuktoolsclustalw2) and GeneDoc (httpwwwpscedubiomedgenedoc) 644

were used to generate multiple alignments of amino acid sequences Quantitative analysis of 645

immunoblots was performed with the AIDA Image Analyzer V325 (Raytest 646

Isotopenmessgeraumlte GmbH Straubenhardt Germany) 647

Co-expression patterns of curT were analyzed using the CyanoEXpress 22 database 648

(httpcyanoexpresssysbiolabeu Hernaacutendez-Prieto and Futschik 2012 Hernaacutendez-Prieto et 649

al 2016) 650

20

651

Measurement of chlorophyll concentration and oxygen production 652

Determination of chlorophyll content was carried out according to Wellburn and 653

Lichtenthaler (1984) For oxygen evolution measurements cells were grown in BG-11 654

without glucose harvested in mid-log phase and diluted to an OD750 nm = 05 Oxygen 655

evolution rates were measured with a Clark-type oxygen electrode (Hansatech Instruments 656

Ltd Kingrsquos Lynn Norfolk UK) at 1000 micromol photons m-2 s-1 (cool white light) after 5 min of 657

dark acclimation Oxygen evolution under saturating light conditions was measured without 658

any additives 659

660

Cell size and cell number estimation 661

Synechocystis 6803 strains were grown in liquid BG11 media containing 5 mM 662

glucose For cell size estimation the cells were analyzed with a confocal laser scanning 663

microscope TCS SP5 (Leica Wetzlar Germany) The diameter of the cells was measured 664

with the LAS AF Lite software (Leica Wetzlar Germany) Cells that were about to divide 665

were not taken into account For the determination of cell number cultures were set to an 666

OD750 = 1 and analyzed by using a Neubauer counting chamber (Paul Marienfeld GmbH amp 667

Co KG Lauda-Koumlnigshofen Germany) Statistical significance was determined by Studentrsquos 668

t-test 669

670

Measurements of P700+ reduction kinetics and relative electron transport rates 671

P700+ reduction kinetics and changes in chlorophyll fluorescence yield at different 672

light intensities were measured at a chlorophyll concentration of 5 microgml with a Dual-PAM-673

100 instrument (Heinz Walz GmbH Effeltrich Germany) Complete P700 oxidation was 674

achieved by a 50-ms multiple turnover pulse (10000 micromol photons m-2 s-1) after 2 min of dark 675

incubation P700+ reduction kinetics were recorded without any additions as well as in the 676

presence of 10 microM DCMU Ten technical replicates were averaged and fitted with single 677

exponential functions Data interpretation was done according to Bernaacutet et al (2009) 678

Light saturation measurements were performed according to Xu et al (2008) The 679

actinic light intensity was increased stepwise from 0 to 665 micromol photons m-2 s-1 with 30-s 680

adaptation periods Maximal fluorescence yields were obtained by applying saturating light 681

pulses (duration 600 ms intensity 10000 micromol photons m-2 s-1) 682

683

Low-temperature fluorescence measurements 684

21

Fluorescence emission spectra were measured with an AMINCO Bowman Series 2 685

Luminescence Spectrometer Wild-type and curT- cells were grown in the presence of 5 mM 686

glucose to mid log-phase and concentrated to 25 microgml chlorophyll adding 2 microM fluorescein 687

as an internal standard Samples (1 ml) were transferred to thin glass tubes dark-adapted for 688

30 min at 30 degC and shock frozen in liquid N2 To quantify chlorophyllfluorescein and 689

phycobilisome-mediated fluorescence samples were excited and emission recorded at 440 690

nm510 nm (chlorophyll and fluorescein excitationmax fluorescein emission) and 580 691

nm685 nm respectively Emission was scanned at 490-800 nm or at 640-800 nm 692

respectively 693

694

Antibody production and protein analysis 695

For generation of an αCurT antibody the N-terminal coding region of curT (amino 696

acid positions 1-58) was amplified by PCR using primers N04835 697

(AAGGATCCGTGGGCCGTAAACATTCAA) and N04833 698

(AAGTCGACGCACTTCCCACACCGGTTGTA) and cloned into the BamHI and XhoI sites 699

of the pGEX-4T-1 vector (GE Healthcare Freiburg Germany) Expression of the GST fusion 700

protein in Escherichia coli BL21(DE3) and subsequent affinity purification on Glutathione-701

Sepharose 4B (GE Healthcare) were carried out as described (Schottkowski et al 2009b) A 702

polyclonal antiserum was raised against this protein fragment in rabbits (Pineda Berlin 703

Germany) Other primary antibodies used in this study have been described previously ie 704

αpD1 (Schottkowski et al 2009b) αD1 (Schottkowski et al 2009b) αD2 (Klinkert et al 705

2006) αPratA (Klinkert et al 2004) αYcf48 (Rengstl et al 2011) αPitt (Schottkowski et 706

al 2009a) αPOR (Schottkowski et al 2009a) αYidC (Ossenbuumlhl et al 2006) αVIPP1 707

(Aseeva et al 2007) αSll0933 (Armbruster et al 2010) and αSlr0151 (Rast et al 2016) or 708

were purchased from Agrisera (Vaumlnnaumls Sweden) ie αCP43 αCP47 αPsaA αCyt f 709

αRbcL αIsiA The αGFP-HRP antibody was acquired from Miltenyi Biotech (Bergisch 710

Gladbach Germany) 711

Protein concentrations were determined according to Bradford (1976) using RotiQuant 712

(Carl Roth GmbH amp Co KG Karlsruhe Germany) Protein extraction membrane 713

fractionation on sucrose-density gradients and quantification of Western signal intensities was 714

performed as described previously (Rengstl et al 2011) Solubility properties of CurT were 715

determined according to Schottkowski et al (2009a) 716

22

Sucrose-density centrifugation separating PDM and thylakoid membrane fractions by 717

two consecutive gradients was carried out as described previously (Schottkowski et al 718

2009b Rengstl et al 2011) 719

Two-dimensional fractionations of cyanobacterial membrane proteins via BNSDS-720

PAGE and of pulse-labeled proteins by BNSDS-PAGE were performed as previously 721

reported (Klinkert et al 2004 Schottkowski et al 2009b Rengstl et al 2013) For the 722

analysis of native complexes in fractions obtained by sucrose-density centrifugation the 723

volume corresponding to 350 microg of protein in fraction 7 was applied to BNSDS-PAGE 724

For isoelectric focusing (IEF) the volume corresponding to 50 microg of protein from 725

fraction 7 in 200 microl of IEF buffer (8 M urea 4 CHAPS 1 IPG buffer pH 4-7 (GE 726

Healthcare)) was applied to an 11-cm Immobiline DryStrip pH 4-7 (GE Healthcare) in a 727

Protean IEF Cell (Bio-Rad Munich Germany) Strips were rehydrated for 12 h at 20 degC and 728

50V Focusing was carried out in the following steps 500 V rapid 1500 Vh 1000 V linear 729

880 Vh 6000 V linear 9680 Vh 6000 V rapid 5390 Vh 50 microA per gel focus temperature 730

20degC Subsequently the strips were incubated in equilibration buffer I (6 M urea 0375 M 731

Tris pH 88 20 glycerol 2 SDS 2 DTT) and equilibration buffer II (6 M urea 0375 732

M Tris pH 88 20 glycerol 2 SDS 25 iodoacetamide) for 10 min in each buffer 733

Then the IEF strips were applied to second-dimension SDS-PAGE 734

735

Transmission electron microscopy and immunogold labeling 736

Sample preparation for transmission electron microscopy including freeze substitution 737

and immunogold labeling of CurT was performed as described previously (Stengel et al 738

2012) Ultrathin sections were cut to thicknesses of 35 - 45 nm and 45 - 65 nm for 739

ultrastructural analyses and immunogold labeling respectively For immunogold labeling 740

sections collected on collodion-coated Ni grids were incubated for 18 h at 4degC with (rabbit) 741

αCurT (diluted 1100 1500 11000 or 14000 in blocking buffer (5 fetal calf serum) with 742

005 Tween 20) and further processed as described previously (Stengel et al 2012) As a 743

negative control wild-type Synechocystis 6803 cells were incubated without the primary 744

antibody and exposed to the gold-labeled anti-rabbit IgG To image the ultrastructure and the 745

immunogold-treated samples a Fei Morgagni 268 transmission electron microscope was used 746

and micrographs were taken at 80 kV 747

To avoid errors in the interpretation of the immunogold labeling experiment only 748

signals which were unambiguously localized to distinctly visible thylakoid membranes were 749

taken into account For each cell different regions (see Figure 10F) were defined and in each 750

23

region the signals on the convex and concave sides of the thylakoid membrane were analyzed 751

separately (see Supplemental Figure 11 for representative counts) Statistical significance was 752

assessed by χ2 test (Zoumlfel 1988) 753

For the analysis of clusters of CurT signals in biogenesis centers a cluster was defined 754

as a minimum of four signals in close proximity Overall 219 biogenesis centers were 755

examined with regard to CurT cluster formation 756

757

Preparation of proteoliposomes 758

Liposomes with a lipid mixture of 25 monogalactosyl diacylglycerol 42 759

digalactosyl diacylglycerol 16 sulfoquinovosyl diacylglycerol and 17 760

phosphatidylglycerol (Lipid Products South Nutfield UK) were prepared as described 761

previously (Armbruster et al 2013) To generate proteoliposomes CurT and CURT1A 762

proteins were expressed in the presence of liposomes for 3 h at 37degC using a PURExpress In 763

Vitro Protein Synthesis Kit (New England Biolabs Ipswich MA USA) The liposomes were 764

separated from the mix by centrifugation in a discontinuous sucrose gradient (100000 g 18 765

h) Subsequently the fraction containing the liposomes was extracted and dialyzed against 20 766

mM HEPES (pH 76) For transmission electron microscopy the proteoliposomes were 767

negatively stained with 1 uranyl acetate on a carbon-coated copper grid Micrographs were 768

taken on a Fei Morgagni 268 TEM at 80 kV 769

770

curT-CFP strain generation 771

Gibson assembly was used for single-step cloning (Gibson 2011) of the slr0483 gene 772

(together with its ~08 kb upstream region) the mTurquoise2 gene fragment the gentamycin-773

resistance cassette (aacC1) and an ~17-kb downstream region of slr0483 into pBR322 774

cleaved with EcoRV and NheI The slr0483 gene was fused in frame to the codon-optimized 775

mTurquoise2 (DNA20) preceded by a linker sequence encoding GSGSG The resulting 776

plasmid was used to transform Synechocystis 6803 as described previously (Zang et al 2007) 777

After ~ 10 days of incubation on BG11-GelRite (15 ) medium in the presence of 2 microgml 778

gentamycin several antibiotic resistant colonies were obtained and streaked out on fresh 779

medium These transformants were then tested for full segregation of the tagged allele by 780

colony PCR with primers flanking the slr0483 gene 781

782

Fluorescence microscopy 783

24

An aliquot of a cell suspension in mid-log phase was placed under a BG11-agarose 784

pad on a glass coverslip (15) and imaged on an inverted microscope (Zeiss 785

AxioObserverZ1) equipped with an ORCA Flash40 V2 (Hamamatsu) camera a Lumenecor 786

SOLA II Light Engine and a Plan-Apochromat 63x140 Oil DIC M27 (NA 14) objective 787

(Zeiss) Image acquisition was done with Zen 21 software in cyan and far-red fluorescence 788

channels (Zeiss Filter Sets 47 HE and 50) as Z-series with a step size of 250 nm and effective 789

pixel size of 103 nm Acquired image files were subsequently deconvolved (Constrained 790

Iterative Method) using a default theoretical Point Spread Function in Zen 20 (Zeiss) 791

Extraction of intensities for line profiles was performed by image thresholding the thylakoid 792

autofluorescence channel and eroding the resulting binary mask in Fiji (Schindelin et al 793

2012) 794

For immunofluorescence analysis cells were grown to mid-log phase as in the case of 795

the cells prepared for live-cell microscopy A 10-ml culture was fixed for 20 min in 37 796

formaldehyde and following extensive washing with phosphate-buffered saline (PBS) cells 797

were first permeabilized in 005 Triton-X for 20 min and then in lysis buffer (50 mM Tris-798

HCl 100 mM NaCl 5 mgml lysozyme) at 37degC for 2 h with gentle shaking To block 799

unspecific binding sites the cell pellet was incubated in 5 bovine serum albumin in PBS at 800

30degC for 1 h The αCurT serum (1500 dilution) was added to cells in fresh blocking buffer 801

for 1 h at 30degC with gentle shaking Cells were then washed three times with blocking buffer 802

and incubated with goat anti-rabbit IgG secondary antibodies conjugated to Oregon Green 488 803

(Invitrogen) (11000 dilution) under the conditions as for the primary antibodies Cells were 804

washed three times with PBS and prepared for microscopy as above Imaging was done as 805

described for live-cell microscopy except that a Colibri2 LED light source was employed for 806

illumination and a CoolSnap HQ camera (Photometrics) was used for image acquisition Cells 807

were imaged as Z-series (step size 280 nm) in the yellow and far-red fluorescent channels 808

(Zeiss Filter Sets 46 HE and 50) using the 505 nm and 625 nm LED modules Effective pixel 809

size in the final image was 102 nm Deconvolution and image analysis was done as described 810

above As judged by the staining intensity of the Oregon Green-conjugated antibodies 811

approximately half of the cells in any given field of view appeared to have been successfully 812

permeabilised a rate that is common in our experience No significant signal was detected in 813

the control sample that had not been exposed to the primary antibodies 814

815

25

Accession numbers 816

Sequence data from this article can be found in the CyanoBase and EMBLGenBank 817

data libraries under accession number slr0483 818

819

Supplemental Data 820

Supplemental Figure 1 Construction of the curT- mutant 821

Supplemental Figure 2 Growth phenotype of curT- 822

Supplemental Figure 3 Expression analysis of the open reading frame slr0482 (located 823

upstream of curT) in the curT- strain 824

Supplemental Figure 4 Absorbance spectra of curT- and wild-type cells 825

Supplemental Figure 5 High-light growth phenotypes of wild-type Synechocystis 6803 and 826

the curT- strain 827

Supplemental Figure 6 Ultrastructure of the TD41 mutant which lacks the psbA transcript 828

and the D1 protein 829

Supplemental Figure 7 Expression and localization of CurT-CFP 830

Supplemental Figure 8 Localization of CurT and CurT-CFP by fluorescence microscopy 831

Supplemental Figure 9 Chlorophyll autofluorescence of curT- 832

Supplemental Figure 10 The curT- mutant as a negative control for immunogold labeling 833

Supplemental Figure 11 Representative counts of immunogold signals 834

Supplemental Table 1 Overview of immunogold signals in curT- cells 835

Supplemental Table 2 Overview of immunogold signals in specific regions of Synechocystis 836

6803 wild-type cells 837

Supplemental Table 3 Statistical analysis of immunogold signals for wild-type 838

Synechocystis 6803 cells 839

Supplemental Table 4 Co-expression of curT 840

Supplemental Movie 1 Scan through the Z-axis of a curT-CFP cell 841

Supplemental Movie 2 Rendered 3D-model of a CurT-CFP detection 842

Supplemental Movie 3 Scan through the Z-axis of a curT-CFP cell with a traversing 843

thylakoid lamella 844

845

Acknowledgements 846

We thank Y Nishiyama for providing αpD1 and J Soll for αVIPP1 and αYidC antibodies 847

respectively and Nina Dyczmons-Nowaczyk for support with the fluorescence measurements 848

This work was supported by grants awarded to JN (Ni3909) MMN (NO 8363) and DL 849

26

(Le126529) by the Deutsche Forschungsgemeinschaft in the context of Research Unit 850

FOR2092 and the Cluster of Excellence RESOLV (EXC 1069) AG is a Howard Hughes 851

Medical Institute postdoctoral fellow in the laboratory of Erin OrsquoShea at Harvard University 852

LS was supported by a PhD fellowship from the Chinese Scholarship Council 853

854

Author Contributions 855

SH AR LS MMN DL and JN designed the research SH AR LS AG ILG EH ML BR 856

SV performed the research all authors contributed to data analysis SH AR and JN wrote the 857

paper 858

859

Competing Financial Interest statement 860

The authors declare no competing financial interests 861

862

We wish to dedicate this paper to Fabrice Rappaport an outstanding colleague and friend who 863

passed away so early 864

865

27

References 866

Allen JF de Paula WBM Puthiyaveetil S and Nield J (2011) A structural 867

phylogenetic map for chloroplast photosynthesis Trends Plant Sci 16 645-655 868

Anderson JM Horton P Kim E-H and Chow WS (2012) Towards elucidation of 869

dynamic structural changes of plant thylakoid architecture Philos Trans R Soc 870

Lond B Biol Sci 367 3515-3524 871

Armbruster U Zuumlhlke J Rengstl B Kreller R Makarenko E Ruumlhle T Schuumlnemann 872

D Jahns P Weisshaar B Nickelsen J and Leister D (2010) The Arabidopsis 873

thylakoid protein PAM68 is required for efficient D1 biogenesis and photosystem II 874

assembly Plant Cell 22 3439-3460 875

Armbruster U Labs M Pribil M Viola S Xu W Scharfenberg M Hertle AP 876

Rojahn U Jensen PE Rappaport F Joliot P Doumlrmann P Wanner G and 877

Leister D (2013) Arabidopsis CURVATURE THYLAKOID1 proteins modify 878

thylakoid architecture by inducing membrane curvature Plant Cell 25 2661-2678 879

Aseeva E Ossenbuumlhl F Sippel C Cho WK Stein B Eichacker LA Meurer J 880

Wanner G Westhoff P Soll J and Vothknecht UC (2007) Vipp1 is required for 881

basic thylakoid membrane formation but not for the assembly of thylakoid protein 882

complexes Plant Physiol Biochem 45 119-128 883

Bartsevich VV and Pakrasi HB (1995) Molecular identification of an ABC transporter 884

complex for manganese analysis of a cyanobacterial mutant strain impaired in the 885

photosynthetic oxygen evolution process EMBO J 14 1845-1853 886

Bartsevich VV and Pakrasi HB (1996) Manganese transport in the cyanobacterium 887

Synechocystis sp PCC 6803 J Biol Chem 271 26057-26061 888

Bernaacutet G Waschewski N and Roumlgner M (2009) Towards efficient hydrogen production 889

the impact of antenna size and external factors on electron transport dynamics in 890

Synechocystis PCC 6803 Photosynth Res 99 205-216 891

Boehm M Yu J Krynicka V Barker M Tichy M Komenda J Nixon PJ and Nield 892

J (2012) Subunit Organization of a Synechocystis Hetero-Oligomeric Thylakoid FtsH893

Complex Involved in Photosystem II Repair Plant Cell 24 3669-3683894

Bradford MM (1976) A rapid and sensitive method for the quantitation of microgram 895

quantities of protein utilizing the principle of protein-dye binding Anal Biochem 72 896

248-254897

28

Chang L Liu X Li Y Liu C-C Yang F Zhao J and Sui S-F (2015) Structural 898

organization of an intact phycobilisome and its association with photosystem II Cell 899

Res 25 726-737 900

Danielsson R Suorsa M Paakkarinen V Albertsson P-Aring Styring S Aro E-M and 901

Mamedov F (2006) Dimeric and monomeric organization of photosystem II 902

Distribution of five distinct complexes in the different domains of the thylakoid 903

membrane J Biol Chem 281 14241-14249 904

Daum B Nicastro D Austin J McIntosh JR and Kuumlhlbrandt W (2010) Arrangement 905

of photosystem II and ATP synthase in chloroplast membranes of Spinach and Pea 906

Plant Cell 22 1299-1312 907

Engel BD Schaffer M Kuhn Cuellar L Villa E Plitzko JM and Baumeister W 908

(2015) Native architecture of the Chlamydomonas chloroplast revealed by in situ 909

cryo-electron tomography eLife 4 e04889 910

Ford MGJ Mills IG Peter BJ Vallis Y Praefcke GJK Evans PR and McMahon 911

HT (2002) Curvature of clathrin-coated pits driven by epsin Nature 419 361-366 912

Fristedt R Willig A Granath P Cregravevecoeur M Rochaix J-D and Vener AV (2009) 913

Phosphorylation of photosystem II controls functional macroscopic folding of 914

photosynthetic membranes in Arabidopsis Plant Cell 21 3950-3964 915

Gallop JL and McMahon HT (2005) BAR domains and membrane curvature bringing 916

your curves to the BAR Biochem Soc Symp 72 223-231 917

Gibson DG (2011) Chapter fifteen - Enzymatic Assembly of Overlapping DNA Fragments 918

In Methods in Enzymology V Christopher ed (Academic Press) pp 349-361 919

Goedhart J von Stetten D Noirclerc-Savoye M Lelimousin M Joosen L Hink MA 920

van Weeren L Gadella TWJ and Royant A (2012) Structure-guided evolution of 921

cyan fluorescent proteins towards a quantum yield of 93 Nat Commun 3 751 922

Heinz S Liauw P Nickelsen J and Nowaczyk M (2016) Analysis of photosystem II 923

biogenesis in cyanobacteria Biochim Biophys Acta 1857 274-287 924

Hernaacutendez-Prieto M and Futschik M (2012) CyanoEXpress A web database for 925

exploration and visualisation of the integrated transcriptome of cyanobacterium 926

Synechocystis sp PCC6803 Bioinformation 8 634-638 927

Hernaacutendez-Prieto MA Semeniuk TA Giner-Lamia J and Futschik ME (2016) The 928

Transcriptional Landscape of the Photosynthetic Model Cyanobacterium 929

Synechocystis sp PCC6803 Sci Rep 6 22168 930

29

Huang F Fulda S Hagemann M and Norling B (2006) Proteomic screening of salt-931

stress-induced changes in plasma membranes of Synechocystis sp strain PCC 6803 932

Proteomics 6 910-920 933

Kirchhoff H (2013) Architectural switches in plant thylakoid membranes Photosynth Res 934

116 481-487 935

Klinkert B Elles I and Nickelsen J (2006) Translation of chloroplast psbD mRNA in 936

Chlamydomonas is controlled by a secondary RNA structure blocking the AUG start 937

codon Nucleic Acids Res 34 386-394 938

Klinkert B Ossenbuumlhl F Sikorski M Berry S Eichacker L and Nickelsen J (2004) 939

PratA a periplasmic tetratricopeptide repeat protein involved in biogenesis of 940

photosystem II in Synechocystis sp PCC 6803 J Biol Chem 279 44639-44644 941

Komenda J Nickelsen J Tichyacute M Praacutešil O Eichacker LA and Nixon PJ (2008) The 942

cyanobacterial homologue of HCF136YCF48 is a component of an early photosystem 943

II assembly complex and is important for both the efficient assembly and repair of 944

photosystem II in Synechocystis sp PCC 6803 J Biol Chem 283 22390-22399 945

Kopf M Klaumlhn S Scholz I Matthiessen JKF Hess WR and Voszlig B (2014) 946

Comparative analysis of the primary transcriptome of Synechocystis sp PCC 6803 947

DNA Res 21 527-539 948

Kunkel DD (1982) Thylakoid centers Structures associated with the cyanobacterial 949

photosynthetic membrane system Arch Microbiol 133 97-99 950

Liberton M Howard Berg R Heuser J Roth R and Pakrasi BH (2006) Ultrastructure 951

of the membrane systems in the unicellular cyanobacterium Synechocystis sp strain 952

PCC 6803 Protoplasma 227 129-138 953

Liberton M Saha R Jacobs JM Nguyen AY Gritsenko MA Smith RD 954

Koppenaal DW and Pakrasi HB (2016) Global Proteomic Analysis Reveals an 955

Exclusive Role of Thylakoid Membranes in Bioenergetics of a Model 956

Cyanobacterium Mol Cell Proteomics 15 2021-2032 957

Luque I and Ochoa de Alda JAG (2014) CURT1CAAD-containing aaRSs thylakoid 958

curvature and gene translation Trends Plant Sci 19 63-66 959

Marin K Stirnberg M Eisenhut M Kraumlmer R and Hagemann M (2006) Osmotic stress 960

in Synechocystis sp PCC 6803 low tolerance towards nonionic osmotic stress results 961

from lacking activation of glucosylglycerol accumulation Microbiology 152 2023-962

2030 963

Mullineaux CW (2005) Function and evolution of grana Trends Plant Sci 10 521-525 964

30

Mullineaux CW (2008) Biogenesis and dynamics of thylakoid membranes and the 965

photosynthetic apparatus In The Cyanobacteria A Herrero and E Flores eds 966

(Norfolk UK Caister Academic Press) pp 289ndash304 967

Nevo R Charuvi D Tsabari O and Reich Z (2012) Composition architecture and 968

dynamics of the photosynthetic apparatus in higher plants Plant J 70 157-176 969

Nickelsen J and Rengstl B (2013) Photosystem II assembly From cyanobacteria to plants 970

Annu Rev Plant Biol 64 609-635 971

Nickelsen J and Zerges W (2013) Thylakoid biogenesis has joined the new era of bacterial 972

cell biology Front Plant Sci 4 458 973

Nilsson F Simpson DJ Jansson C and Andersson B (1992) Ultrastructural and 974

biochemical characterization of a Synechocystis 6803 mutant with inactivated psbA 975

genes Arch Biochem Biophys 295 340-347 976

Odom WR Hodges R Chitnis PR and Guikema JA (1993) Characterization of 977

Synechocystis sp PCC 6803 in iron-supplied and iron-deficient media Plant Mol 978

Biol 23 1255-1264 979

Ossenbuumlhl F Inaba-Sulpice M Meurer J Soll J and Eichacker LA (2006) The 980

Synechocystis sp PCC 6803 Oxa1 homolog is essential for membrane integration of 981

reaction center precursor protein pD1 Plant Cell 18 2236-2246 982

Pisareva T Kwon J Oh J Kim S Ge C Wieslander Aring Choi J-S and Norling B 983

(2011) Model for Membrane Organization and Protein Sorting in the Cyanobacterium 984

Synechocystis sp PCC 6803 Inferred from Proteomics and Multivariate Sequence 985

Analyses J Proteome Res 10 3617-3631 986

Pribil M Labs M and Leister D (2014) Structure and dynamics of thylakoids in land 987

plants J Exp Bot 65 1955-1972 988

Rast A Heinz S and Nickelsen J (2015) Biogenesis of thylakoid membranes Biochim 989

Biophys Acta 1847 821-830 990

Rast A Rengstl B Heinz S Klingl A and Nickelsen J (2016) The role of Slr0151 a 991

tetratricopeptide repeat protein from Synechocystis sp PCC 6803 during Photosystem 992

II assembly and repair Front Plant Sci 7 605 993

Rengstl B Oster U Stengel A and Nickelsen J (2011) An Intermediate Membrane 994

Subfraction in Cyanobacteria Is Involved in an Assembly Network for Photosystem II 995

Biogenesis J Biol Chem 286 21944-21951 996

31

Rengstl B Knoppovaacute J Komenda J and Nickelsen J (2013) Characterization of a 997

Synechocystis double mutant lacking the photosystem II assembly factors YCF48 and 998

Sll0933 Planta 237 471-480 999

Rexroth S Mullineaux CW Ellinger D Sendtko E Roumlgner M and Koenig F (2011) 1000

The Plasma Membrane of the Cyanobacterium Gloeobacter violaceus Contains 1001

Segregated Bioenergetic Domains Plant Cell 23 2379-2390 1002

Rippka R Deruelles J Waterbury JB Herdman M and Stanier RY (1979) Generic 1003

Assignments Strain Histories and Properties of Pure Cultures of Cyanobacteria 1004

Microbiology 111 1-61 1005

Ruumltgers M and Schroda M (2013) A role of VIPP1 as a dynamic structure within 1006

thylakoid centers as sites of photosystem biogenesis Plant Signal Behav 8 e27037 1007

Sacharz J Bryan SJ Yu J Burroughs NJ Spence EM Nixon PJ and Mullineaux 1008

CW (2015) Sub-cellular location of FtsH proteases in the cyanobacterium1009

Synechocystis sp PCC 6803 suggests localised PSII repair zones in the thylakoid1010

membranes Mol Microbiol 96 448-4621011

Sandstroumlm S Park Y-I Oumlquist G and Gustafsson P (2001) CP43prime the isiA Gene 1012

Product Functions as an Excitation Energy Dissipator in the Cyanobacterium 1013

Synechococcus sp PCC 7942 Photochem Photobiol 74 431-437 1014

Schindelin J Arganda-Carreras I Frise E Kaynig V Longair M Pietzsch T 1015

Preibisch S Rueden C Saalfeld S Schmid B Tinevez J-Y White DJ 1016

Hartenstein V Eliceiri K Tomancak P and Cardona A (2012) Fiji an open-1017

source platform for biological-image analysis Nat Methods 9 676-682 1018

Schottkowski M Ratke J Oster U Nowaczyk M and Nickelsen J (2009a) Pitt a novel 1019

tetratricopeptide repeat protein involved in light-dependent chlorophyll biosynthesis 1020

and thylakoid membrane biogenesis in Synechocystis sp PCC 6803 Mol Plant 2 1021

1289-1297 1022

Schottkowski M Gkalympoudis S Tzekova N Stelljes C Schuumlnemann D Ankele E 1023

and Nickelsen J (2009b) Interaction of the periplasmic PratA factor and the PsbA 1024

(D1) protein during biogenesis of photosystem II in Synechocystis sp PCC 6803 J 1025

Biol Chem 284 1813-1819 1026

Selatildeo TT Zhang L Knoppovaaacute J Komenda J and Norling B (2016) Photosystem II 1027

Assembly Steps Take Place in the Thylakoid Membrane of the Cyanobacterium 1028

Synechocystis sp PCC6803 Plant Cell Physiol 57 878 1029

32

Spaumlt P Maček B and Forchhammer K (2015) Phosphoproteome of the cyanobacterium 1030

Synechocystis sp PCC 6803 and its dynamics during nitrogen starvation Front 1031

Microbiol 6 248 1032

Stengel A Guumlgel IL Hilger D Rengstl B Jung H and Nickelsen J (2012) Initial 1033

steps of photosystem II de novo assembly and preloading with manganese take place 1034

in biogenesis centers in Synechocystis Plant Cell 24 660-675 1035

Uniacke J and Zerges W (2007) Photosystem II assembly and repair are differentially 1036

localized in Chlamydomonas Plant Cell 19 3640-3654 1037

Uniacke J and Zerges W (2009) Chloroplast protein targeting involves localized 1038

translation in Chlamydomonas Proc Natl Acad Sci USA 106 1439-1444 1039

van de Meene AL Hohmann-Marriott M Vermaas WJ and Roberson R (2006) The 1040

three-dimensional structure of the cyanobacterium Synechocystis sp PCC 6803 Arch 1041

Microbiol 184 259-270 1042

van de Meene AML Sharp WP McDaniel JH Friedrich H Vermaas WFJ and 1043

Roberson RW (2012) Gross morphological changes in thylakoid membrane 1044

structure are associated with photosystem I deletion in Synechocystis sp PCC 6803 1045

Biochim Biophys Acta 1818 1427-1434 1046

Watanabe M and Ikeuchi M (2013) Phycobilisome architecture of a light-harvesting 1047

supercomplex Photosynth Res 116 265-276 1048

Wellburn AR and Lichtenthaler H (1984) Formulae and Program to Determine Total 1049

Carotenoids and Chlorophylls A and B of Leaf Extracts in Different Solvents In 1050

Advances in Photosynthesis Research Proceedings of the VIth International Congress 1051

on Photosynthesis Brussels Belgium August 1ndash6 1983 C Sybesma ed (Dordrecht 1052

Springer Netherlands) pp 9-12 1053

Wilde A Lunser K Ossenbuumlhl F Nickelsen J and Borner T (2001) Characterization of 1054

the cyanobacterial ycf37 mutation decreases the photosystem I content Biochem J 1055

357 211-216 1056

Wilson A Boulay C Wilde A Kerfeld CA and Kirilovsky D (2007) Light-Induced 1057

Energy Dissipation in Iron-Starved Cyanobacteria Roles of OCP and IsiA Proteins 1058

Plant Cell 19 656-672 1059

Xu M Bernaacutet G Singh A Mi H Roumlgner M Pakrasi HB and Ogawa T (2008) 1060

Properties of Mutants of Synechocystis sp Strain PCC 6803 Lacking Inorganic Carbon 1061

Sequestration Systems Plant Cell Physiol 49 1672-1677 1062

33

Yamamoto T Burke J Autz G and Jagendorf AT (1981) Bound ribosomes of Pea 1063

chloroplast thylakoid membranes location and release in vitro by high salt 1064

puromycin and RNase Plant Physiol 67 940-949 1065

Yang H Liao L Bo T Zhao L Sun X Lu X Norling B and Huang F (2014) 1066

Slr0151 in Synechocystis sp PCC 6803 is required for efficient repair of photosystem 1067

II under high-light condition J Integr Plant Biol 56 1136-1150 1068

Yeremenko N Kouřil R Ihalainen JA DHaene S van Oosterwijk N 1069

Andrizhiyevskaya EG Keegstra W Dekker HL Hagemann M Boekema EJ 1070

Matthijs HCP and Dekker JP (2004) Supramolecular Organization and Dual 1071

Function of the IsiA Chlorophyll-Binding Protein in Cyanobacteria Biochemistry 43 1072

10308-10313 1073

Zak E Norling B Maitra R Huang F Andersson B and Pakrasi HB (2001) The 1074

initial steps of biogenesis of cyanobacterial photosystems occur in plasma membranes 1075

Proc Natl Acad Sci USA 98 13443-13448 1076

Zang X Liu B Liu S Arunakumara KKIU and Zhang X (2007) Optimum 1077

Conditions for Transformation of Synechocystis sp PCC 6803 J Microbiol 45 241-1078

245 1079

Zhang L and Sakamoto W (2015) Possible function of VIPP1 in maintaining chloroplast 1080

membranes Biochim Biophys Acta 1847 831-837 1081

Zimmerberg J and Kozlov MM (2006) How proteins produce cellular membrane 1082

curvature Nat Rev Mol Cell Biol 7 9-19 1083

Zoumlfel P (1988) Statistik in der Praxis (Stuttgart Germany Gustav Fischer Verlag) 1084

1085

34

Figure Legends 1086

Figure 1 General characteristics of CurT A) Sequence alignment of CurT and CURT1A-D 1087

from A thaliana Predicted chloroplast transit-peptide sequences of CURT1A-D are omitted 1088

(Armbruster et al 2013) Positions of predicted C-terminal transmembrane domains (TDM) 1089

are marked (black bar) as is the position of the predicted amphipathic N-terminal helix in 1090

CurT (red bar) The green bar denotes the peptide sequence used for antibody production 1091

Identical and related amino acids that are conserved in 100 80 and 60 of the sequences 1092

are highlighted in black dark grey and light grey respectively B) Helical-wheel 1093

representation of the N-terminal amphipathic helix of CurT (red bar in A) The color code 1094

reflects the physicochemical properties of amino-acid side-chains green polar and 1095

uncharged blue polar and positively charged red polar and negatively charged yellow 1096

hydrophobic C) Solubility of CurT Membrane-associated proteins (50 microg) from wild-type 1097

cells were extracted with 5 mM HEPES (pH 76) containing either 1 M NaCl 01 M Na2CO3 1098

4 M urea 01 Triton X-100 or no additional solute After separation of membrane-bound 1099

(M) and solubilized (S) proteins by centrifugation proteins were fractionated by SDS-PAGE1100

and CurT was immunodetected on immunoblots As a control the integral membrane protein 1101

CP47 from PSII was analyzed in parallel D) Transmission electron micrographs of negatively 1102

stained liposomes Cell-free expression (CFE) of CurT and A thaliana CURT1A was 1103

performed in the presence of liposomes similar in composition to the lipids of the thylakoid 1104

membrane Liposomes before and after cell-free protein expression in the absence of DNA 1105

served as negative controls Black arrowheads indicate tubular connections between 1106

liposomes Scale bars 250 nm 1107

1108

Figure 2 Ultrastructural analysis of curT- cells Transmission electron micrographs of typical 1109

wild-type (A) and curT- (B-D) Synechocystis 6803 cells taken at 44000times (A B) and 28000times 1110

(C D) magnification respectively Ultrathin sections (35 to 45 nm) of cryofixed samples 1111

were stained with osmium tetroxide and post-stained using lead citrate Arrowheads indicate 1112

biogenesis centers Scale bars 200 nm (A B) and 500 nm (C D) respectively 1113

1114

Figure 3 Accumulation of components of photosynthetic complexes in the curT- mutant A) 1115

Whole cell extracts (30 microg protein) from wild-type and curT- strains were fractionated by 1116

SDS-PAGE and analyzed on immunoblots using the indicated antibodies B) The histogram 1117

shows levels of the indicated proteins in curT- extracts relative to wild-type samples (dashed 1118

red line) Data are means plusmn SD of three independent experiments Significant differences from 1119

35

wild-type protein levels according to Studentrsquos t-test with error probabilities of 5 and 1 1120

are indicated by and respectively 1121

1122

Figure 4 P700+ reduction kinetics and high-light effects in curT- cells A) Averaged traces 1123

(10 single measurements) of P700+ decay after complete oxidation by a 50-ms multiple 1124

turnover pulse (10000 micromol photons m-2 s-1) in the absence and presence of 10 microM DCMU 1125

B) Rate constants for P700+ reduction were obtained by fitting of the data with single1126

exponential functions Error bars indicate the SD of three independent measurements C) 1127

Impact of light intensity on the (relative) electron transport rate (rETR) Cells were exposed to 1128

gradually increasing light intensities which resulted in increasing electron transport until the 1129

capacity limit was reached PAR light intensity (micromol photons m-2 s-1) Error bars indicate the 1130

SD of three independent measurements D) D1 protein level in wild-type and curT- after high-1131

light treatment (800 micromol photons m-2s-1) in the presence and absence of lincomycin Samples 1132

were taken every 30 min and processed as in Figure 3 to determine the level of D1 present 1133

100 refers to wild-type D1 level at the beginning of the experiment 1134

1135

Figure 5 PSII assembly in curT- cells A) BNSDS-PAGE of membrane proteins Membrane 1136

fractions from wild-type and curT- cells were solubilized with 13 n-dodecyl-β-maltoside 1137

and proteins were fractionated by two-dimensional BNSDS-PAGE blotted and probed with 1138

antibodies against the PSII subunits D1 D2 CP47 and CP43 Wild-type blots were also 1139

probed with the αCurT antibody The sizes of marker proteins and the positions of PSII 1140

assembly intermediates (RCCII RCCI RC47) are shown above and below each image B) In 1141

vivo pulse labeling of membrane proteins with 35S Pulse-labeled PSII core proteins were 1142

separated via BNSDS-PAGE and visualized by autoradiography 1143

1144

Figure 6 Loss of CurT induces stress A) Low-temperature (77 K) fluorescence emission of 1145

Synechocystis 6803 wild-type (blue) and curT- (red) cells excited at 440 nm The spectra were 1146

normalized to the added fluorescein standard B) Low-temperature (77 K) fluorescence 1147

emission of Synechocystis 6803 wild-type (blue) and curT- (red) excited at 580 nm The 1148

spectra were normalized to 780 nm C) Level of IsiA in the curT- mutant relative to the wild-1149

type A mean value of 368 plusmn 96 (SD) was determined from three independent experiments 1150

1151

Figure 7 Membrane sublocalization of PSII-related factors Cell extracts from wild-type and 1152

curT- cells were fractionated by two consecutive rounds of sucrose-density gradient 1153

36

centrifugation (Schottkowski et al 2009b) The second linear gradient (20-60 sucrose) was 1154

apportioned into 14 fractions which were analyzed by immunoblotting using the indicated 1155

antibodies Fractions 1ndash6 represent PDMs and fractions 7ndash14 thylakoid membranes (TMs) 1156

To facilitate comparison between gradients sample volumes were normalized to the volume 1157

of fraction 7 that contained 40 microg of protein 1158

1159

Figure 8 Live-cell imaging of the curT-CFP strain by fluorescence microscopy In the curT-1160

CFP strain the native curT gene has been replaced by a CFP-tagged version resulting in the 1161

expression of the CurT-CFP fusion protein under the control of the native promotor A) 1162

Close-up views of the mid-cell plane in the CFP and far-red autofluorescence channels shown 1163

in slice 7 in panel B B) Synechocystis 6803 cells expressing CurT C-terminally fused to the 1164

mTurquoise2 variant of CFP from its native chromosomal promoter The two imaging 1165

channels are displayed as Z-axis montages (auto-scaled contrast step size 250 nm) in 1166

grayscale and color composite configuration The thylakoid autofluorescent channel as 1167

imaged in far-red fluorescence is depicted in magenta and CurT signal as imaged in cyan 1168

fluorescence is depicted in cyan C) Fluorescence intensity profiles of the two channels along 1169

the autofluorescent peripheral cell ldquoringrdquo are shown for slice 7 The maximum projection of 1170

the entire Z montage is also shown Scale bars (light grey) 2 microm 1171

1172

Figure 9 Immunofluorescence detection of CurT A) Close-ups of slice 5 in panel B B) 1173

Wild-type Synechocystis 6803 cells labeled with αCurT antibodies and detected with Oregon 1174

Green-conjugated secondary antibodies The Z-axis montages are shown as in Figure 8B 1175

except that the step size is 280 nm (1 to 10) C) Intensity profiles of the two channels along 1176

the autofluorescent peripheral cell ldquoringrdquo are shown for slice 5 The maximum projection of 1177

the entire Z montage is also shown Scale bars (light grey) 2 microm 1178

1179

Figure 10 Subcellular localization of CurT Ultrathin sections of wild-type Synechocystis 1180

6803 cells were incubated with rabbit αCurT prior to incubation with gold-conjugated goat 1181

anti-rabbit IgG A) Negative control (wild-type processed without addition of primary 1182

antibody) B C) Immunogold-labeled sections showing CurT localization at the cytoplasmic 1183

side of the thylakoid membrane D) Cluster formation of CurT signals at a putative biogenesis 1184

center from C E) Biogenesis center from the same cell (C) without any obvious CurT 1185

clustering of gold particles F) Schematic depiction of a wild-type cell (from Figure 2A) with 1186

color-coded curved membranes green = thylakoids that follow the curvature of the cell red = 1187

37

thylakoids that bend away from the plasma membrane yellow = thylakoids that bend toward 1188

the plasma membrane to converge on sites of biogenesis centers G) Relative distribution of 1189

gold signals between convex (dark color) and concave (light color) sides of membranes (n = 1190

1584 signals from a total of 95 cells) The undifferentiated overall signal distribution is given 1191

in blue Bars = 200 nm (overview) and 100 nm (details) 1192

1193

Figure 11 Differentially modified forms of CurT are found in different complexes in PDMs 1194

and thylakoid membranes Samples were isolated by fractionation of wild-type membranes 1195

via two consecutive sucrose density gradients according to Schottkowski et al (2009b) After 1196

density centrifugation samples were applied to BNSDS-PAGE analysis (A) or isoelectric 1197

focusing (B) Numbers on the right indicate the respective fraction from the second gradient 1198

(see Figure 7) Fraction 5 represents the PDMs and fraction 9 the thylakoid membrane 1199

1200

Figure 12 Loss of CurT increases sensitivity to abiotic stress A B) Doubling times of wild-1201

type and curT- under salt stress (A) or osmotic stress (B) Doubling times are means plusmn SD of 1202

three independent cultures C) Localization of CurT-CFP under salt and osmotic stress 1203

Samples were examined as described in Figure 8 Scale bars 1 microm D) Protein levels of wild-1204

type cells after growth in BG11 medium containing 500 mM NaCl Samples were analyzed on 1205

the same gel but unrelated samples between the presented signals were omitted E) 1206

Membrane preparations obtained from wild-type cells wild-type cells grown in the presence 1207

of 500 mM NaCl and curT- cells were subjected to the first gradient step in the membrane 1208

fractionation scheme The gradient was divided into five fractions and 10 of fractions I-IV 1209

and 02 of fraction V were analyzed by SDS-PAGE Fraction II includes the plasma 1210

membrane and fraction V consists of PratA-defined membrane and thylakoid membrane 1211

1212

Figure 13 Model of CurT distribution at convergence zones in Synechocystis 6803 The 1213

distribution of CurT in thylakoid (green) and plasma membranes (brown) is shown The 1214

pattern of localization of CurT in the thylakoid membrane is derived from membrane 1215

fractionation via sucrose density centrifugation fluorescence-based detection of the CurT-1216

CFP fusion and endogenous CurT and immunogold labeling experiments (Figures 7-10) The 1217

different CurT variants a b c and d identified in the IEF experiments (Figure 11) are depicted 1218

in yellow pink blue and black respectively CurT present in the plasma membrane is 1219

highlighted in gray as its precise nature and role remain to be defined (Figure 12) 1220

Membranes are represented as lipid bilayers Convex and concave faces of bent thylakoid 1221

38

sheets are indicated by black arrows The PDM which is dedicated to PSII assembly and 1222

repair is depicted in blue The dotted blue line emphasizes that the ultrastructure in this region 1223

has not yet been fully resolved PP periplasm PM plasma membrane TM thylakoid 1224

membrane L lumen PDM PratA-defined membrane 1225

1226

Tables 1227

Table 1 Physiological characteristics of the curT- mutant 1228

Strain Doubling time [h]

Oxygen Evolution[nmol h-1 OD750

-1]c

Chlorophyll content

[microg OD750-1]

d

Cell size [microm]e

Cell number [ml-1 OD750

-1]f

Wild type 817plusmn017a 1600plusmn042

b 1933plusmn187 251plusmn014 264plusmn020 390plusmn006 x 107

curT- 1259plusmn020a 3226plusmn056

b 1074plusmn20 195plusmn029 274plusmn044 367plusmn016 x 107

1229 abDoubling times in the presence (a) or absence (b) of 5 mM glucose measured under 1230

continuous illumination at 30 micromol photons m-2 s-1 and CO2-limiting conditions cOxygen 1231

evolution is expressed in nmol O2 produced per hour per OD750 unit dChlorophyll content is 1232

expressed in microg OD750-1 eThe diameter of non-dividing cells is presented in microm fCell number 1233

was determined per ml per OD750 Data are means plusmn SD of at least three independent 1234

experiments 1235

1236

Parsed CitationsAllen JF de Paula WBM Puthiyaveetil S and Nield J (2011) A structural phylogenetic map for chloroplast photosynthesisTrends Plant Sci 16 645-655

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Anderson JM Horton P Kim E-H and Chow WS (2012) Towards elucidation of dynamic structural changes of plant thylakoidarchitecture Philos Trans R Soc Lond B Biol Sci 367 3515-3524

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Armbruster U Zuumlhlke J Rengstl B Kreller R Makarenko E Ruumlhle T Schuumlnemann D Jahns P Weisshaar B NickelsenJ and Leister D (2010) The Arabidopsis thylakoid protein PAM68 is required for efficient D1 biogenesis and photosystem IIassembly Plant Cell 22 3439-3460

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Armbruster U Labs M Pribil M Viola S Xu W Scharfenberg M Hertle AP Rojahn U Jensen PE Rappaport F JoliotP Doumlrmann P Wanner G and Leister D (2013) Arabidopsis CURVATURE THYLAKOID1 proteins modify thylakoid architectureby inducing membrane curvature Plant Cell 25 2661-2678

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Aseeva E Ossenbuumlhl F Sippel C Cho WK Stein B Eichacker LA Meurer J Wanner G Westhoff P Soll J andVothknecht UC (2007) Vipp1 is required for basic thylakoid membrane formation but not for the assembly of thylakoid proteincomplexes Plant Physiol Biochem 45 119-128

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Bartsevich VV and Pakrasi HB (1995) Molecular identification of an ABC transporter complex for manganese analysis of acyanobacterial mutant strain impaired in the photosynthetic oxygen evolution process EMBO J 14 1845-1853

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Bartsevich VV and Pakrasi HB (1996) Manganese transport in the cyanobacterium Synechocystis sp PCC 6803 J Biol Chem271 26057-26061

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Bernaacutet G Waschewski N and Roumlgner M (2009) Towards efficient hydrogen production the impact of antenna size andexternal factors on electron transport dynamics in Synechocystis PCC 6803 Photosynth Res 99 205-216

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Boehm M Yu J Krynicka V Barker M Tichy M Komenda J Nixon PJ and Nield J (2012) Subunit Organization of aSynechocystis Hetero-Oligomeric Thylakoid FtsH Complex Involved in Photosystem II Repair Plant Cell 24 3669-3683

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Bradford MM (1976) A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle ofprotein-dye binding Anal Biochem 72 248-254

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Chang L Liu X Li Y Liu C-C Yang F Zhao J and Sui S-F (2015) Structural organization of an intact phycobilisome and itsassociation with photosystem II Cell Res 25 726-737

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Danielsson R Suorsa M Paakkarinen V Albertsson P-Aring Styring S Aro E-M and Mamedov F (2006) Dimeric andmonomeric organization of photosystem II Distribution of five distinct complexes in the different domains of the thylakoidmembrane J Biol Chem 281 14241-14249

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Daum B Nicastro D Austin J McIntosh JR and Kuumlhlbrandt W (2010) Arrangement of photosystem II and ATP synthase in

20

651

Measurement of chlorophyll concentration and oxygen production 652

Determination of chlorophyll content was carried out according to Wellburn and 653

Lichtenthaler (1984) For oxygen evolution measurements cells were grown in BG-11 654

without glucose harvested in mid-log phase and diluted to an OD750 nm = 05 Oxygen 655

evolution rates were measured with a Clark-type oxygen electrode (Hansatech Instruments 656

Ltd Kingrsquos Lynn Norfolk UK) at 1000 micromol photons m-2 s-1 (cool white light) after 5 min of 657

dark acclimation Oxygen evolution under saturating light conditions was measured without 658

any additives 659

660

Cell size and cell number estimation 661

Synechocystis 6803 strains were grown in liquid BG11 media containing 5 mM 662

glucose For cell size estimation the cells were analyzed with a confocal laser scanning 663

microscope TCS SP5 (Leica Wetzlar Germany) The diameter of the cells was measured 664

with the LAS AF Lite software (Leica Wetzlar Germany) Cells that were about to divide 665

were not taken into account For the determination of cell number cultures were set to an 666

OD750 = 1 and analyzed by using a Neubauer counting chamber (Paul Marienfeld GmbH amp 667

Co KG Lauda-Koumlnigshofen Germany) Statistical significance was determined by Studentrsquos 668

t-test 669

670

Measurements of P700+ reduction kinetics and relative electron transport rates 671

P700+ reduction kinetics and changes in chlorophyll fluorescence yield at different 672

light intensities were measured at a chlorophyll concentration of 5 microgml with a Dual-PAM-673

100 instrument (Heinz Walz GmbH Effeltrich Germany) Complete P700 oxidation was 674

achieved by a 50-ms multiple turnover pulse (10000 micromol photons m-2 s-1) after 2 min of dark 675

incubation P700+ reduction kinetics were recorded without any additions as well as in the 676

presence of 10 microM DCMU Ten technical replicates were averaged and fitted with single 677

exponential functions Data interpretation was done according to Bernaacutet et al (2009) 678

Light saturation measurements were performed according to Xu et al (2008) The 679

actinic light intensity was increased stepwise from 0 to 665 micromol photons m-2 s-1 with 30-s 680

adaptation periods Maximal fluorescence yields were obtained by applying saturating light 681

pulses (duration 600 ms intensity 10000 micromol photons m-2 s-1) 682

683

Low-temperature fluorescence measurements 684

21

Fluorescence emission spectra were measured with an AMINCO Bowman Series 2 685

Luminescence Spectrometer Wild-type and curT- cells were grown in the presence of 5 mM 686

glucose to mid log-phase and concentrated to 25 microgml chlorophyll adding 2 microM fluorescein 687

as an internal standard Samples (1 ml) were transferred to thin glass tubes dark-adapted for 688

30 min at 30 degC and shock frozen in liquid N2 To quantify chlorophyllfluorescein and 689

phycobilisome-mediated fluorescence samples were excited and emission recorded at 440 690

nm510 nm (chlorophyll and fluorescein excitationmax fluorescein emission) and 580 691

nm685 nm respectively Emission was scanned at 490-800 nm or at 640-800 nm 692

respectively 693

694

Antibody production and protein analysis 695

For generation of an αCurT antibody the N-terminal coding region of curT (amino 696

acid positions 1-58) was amplified by PCR using primers N04835 697

(AAGGATCCGTGGGCCGTAAACATTCAA) and N04833 698

(AAGTCGACGCACTTCCCACACCGGTTGTA) and cloned into the BamHI and XhoI sites 699

of the pGEX-4T-1 vector (GE Healthcare Freiburg Germany) Expression of the GST fusion 700

protein in Escherichia coli BL21(DE3) and subsequent affinity purification on Glutathione-701

Sepharose 4B (GE Healthcare) were carried out as described (Schottkowski et al 2009b) A 702

polyclonal antiserum was raised against this protein fragment in rabbits (Pineda Berlin 703

Germany) Other primary antibodies used in this study have been described previously ie 704

αpD1 (Schottkowski et al 2009b) αD1 (Schottkowski et al 2009b) αD2 (Klinkert et al 705

2006) αPratA (Klinkert et al 2004) αYcf48 (Rengstl et al 2011) αPitt (Schottkowski et 706

al 2009a) αPOR (Schottkowski et al 2009a) αYidC (Ossenbuumlhl et al 2006) αVIPP1 707

(Aseeva et al 2007) αSll0933 (Armbruster et al 2010) and αSlr0151 (Rast et al 2016) or 708

were purchased from Agrisera (Vaumlnnaumls Sweden) ie αCP43 αCP47 αPsaA αCyt f 709

αRbcL αIsiA The αGFP-HRP antibody was acquired from Miltenyi Biotech (Bergisch 710

Gladbach Germany) 711

Protein concentrations were determined according to Bradford (1976) using RotiQuant 712

(Carl Roth GmbH amp Co KG Karlsruhe Germany) Protein extraction membrane 713

fractionation on sucrose-density gradients and quantification of Western signal intensities was 714

performed as described previously (Rengstl et al 2011) Solubility properties of CurT were 715

determined according to Schottkowski et al (2009a) 716

22

Sucrose-density centrifugation separating PDM and thylakoid membrane fractions by 717

two consecutive gradients was carried out as described previously (Schottkowski et al 718

2009b Rengstl et al 2011) 719

Two-dimensional fractionations of cyanobacterial membrane proteins via BNSDS-720

PAGE and of pulse-labeled proteins by BNSDS-PAGE were performed as previously 721

reported (Klinkert et al 2004 Schottkowski et al 2009b Rengstl et al 2013) For the 722

analysis of native complexes in fractions obtained by sucrose-density centrifugation the 723

volume corresponding to 350 microg of protein in fraction 7 was applied to BNSDS-PAGE 724

For isoelectric focusing (IEF) the volume corresponding to 50 microg of protein from 725

fraction 7 in 200 microl of IEF buffer (8 M urea 4 CHAPS 1 IPG buffer pH 4-7 (GE 726

Healthcare)) was applied to an 11-cm Immobiline DryStrip pH 4-7 (GE Healthcare) in a 727

Protean IEF Cell (Bio-Rad Munich Germany) Strips were rehydrated for 12 h at 20 degC and 728

50V Focusing was carried out in the following steps 500 V rapid 1500 Vh 1000 V linear 729

880 Vh 6000 V linear 9680 Vh 6000 V rapid 5390 Vh 50 microA per gel focus temperature 730

20degC Subsequently the strips were incubated in equilibration buffer I (6 M urea 0375 M 731

Tris pH 88 20 glycerol 2 SDS 2 DTT) and equilibration buffer II (6 M urea 0375 732

M Tris pH 88 20 glycerol 2 SDS 25 iodoacetamide) for 10 min in each buffer 733

Then the IEF strips were applied to second-dimension SDS-PAGE 734

735

Transmission electron microscopy and immunogold labeling 736

Sample preparation for transmission electron microscopy including freeze substitution 737

and immunogold labeling of CurT was performed as described previously (Stengel et al 738

2012) Ultrathin sections were cut to thicknesses of 35 - 45 nm and 45 - 65 nm for 739

ultrastructural analyses and immunogold labeling respectively For immunogold labeling 740

sections collected on collodion-coated Ni grids were incubated for 18 h at 4degC with (rabbit) 741

αCurT (diluted 1100 1500 11000 or 14000 in blocking buffer (5 fetal calf serum) with 742

005 Tween 20) and further processed as described previously (Stengel et al 2012) As a 743

negative control wild-type Synechocystis 6803 cells were incubated without the primary 744

antibody and exposed to the gold-labeled anti-rabbit IgG To image the ultrastructure and the 745

immunogold-treated samples a Fei Morgagni 268 transmission electron microscope was used 746

and micrographs were taken at 80 kV 747

To avoid errors in the interpretation of the immunogold labeling experiment only 748

signals which were unambiguously localized to distinctly visible thylakoid membranes were 749

taken into account For each cell different regions (see Figure 10F) were defined and in each 750

23

region the signals on the convex and concave sides of the thylakoid membrane were analyzed 751

separately (see Supplemental Figure 11 for representative counts) Statistical significance was 752

assessed by χ2 test (Zoumlfel 1988) 753

For the analysis of clusters of CurT signals in biogenesis centers a cluster was defined 754

as a minimum of four signals in close proximity Overall 219 biogenesis centers were 755

examined with regard to CurT cluster formation 756

757

Preparation of proteoliposomes 758

Liposomes with a lipid mixture of 25 monogalactosyl diacylglycerol 42 759

digalactosyl diacylglycerol 16 sulfoquinovosyl diacylglycerol and 17 760

phosphatidylglycerol (Lipid Products South Nutfield UK) were prepared as described 761

previously (Armbruster et al 2013) To generate proteoliposomes CurT and CURT1A 762

proteins were expressed in the presence of liposomes for 3 h at 37degC using a PURExpress In 763

Vitro Protein Synthesis Kit (New England Biolabs Ipswich MA USA) The liposomes were 764

separated from the mix by centrifugation in a discontinuous sucrose gradient (100000 g 18 765

h) Subsequently the fraction containing the liposomes was extracted and dialyzed against 20 766

mM HEPES (pH 76) For transmission electron microscopy the proteoliposomes were 767

negatively stained with 1 uranyl acetate on a carbon-coated copper grid Micrographs were 768

taken on a Fei Morgagni 268 TEM at 80 kV 769

770

curT-CFP strain generation 771

Gibson assembly was used for single-step cloning (Gibson 2011) of the slr0483 gene 772

(together with its ~08 kb upstream region) the mTurquoise2 gene fragment the gentamycin-773

resistance cassette (aacC1) and an ~17-kb downstream region of slr0483 into pBR322 774

cleaved with EcoRV and NheI The slr0483 gene was fused in frame to the codon-optimized 775

mTurquoise2 (DNA20) preceded by a linker sequence encoding GSGSG The resulting 776

plasmid was used to transform Synechocystis 6803 as described previously (Zang et al 2007) 777

After ~ 10 days of incubation on BG11-GelRite (15 ) medium in the presence of 2 microgml 778

gentamycin several antibiotic resistant colonies were obtained and streaked out on fresh 779

medium These transformants were then tested for full segregation of the tagged allele by 780

colony PCR with primers flanking the slr0483 gene 781

782

Fluorescence microscopy 783

24

An aliquot of a cell suspension in mid-log phase was placed under a BG11-agarose 784

pad on a glass coverslip (15) and imaged on an inverted microscope (Zeiss 785

AxioObserverZ1) equipped with an ORCA Flash40 V2 (Hamamatsu) camera a Lumenecor 786

SOLA II Light Engine and a Plan-Apochromat 63x140 Oil DIC M27 (NA 14) objective 787

(Zeiss) Image acquisition was done with Zen 21 software in cyan and far-red fluorescence 788

channels (Zeiss Filter Sets 47 HE and 50) as Z-series with a step size of 250 nm and effective 789

pixel size of 103 nm Acquired image files were subsequently deconvolved (Constrained 790

Iterative Method) using a default theoretical Point Spread Function in Zen 20 (Zeiss) 791

Extraction of intensities for line profiles was performed by image thresholding the thylakoid 792

autofluorescence channel and eroding the resulting binary mask in Fiji (Schindelin et al 793

2012) 794

For immunofluorescence analysis cells were grown to mid-log phase as in the case of 795

the cells prepared for live-cell microscopy A 10-ml culture was fixed for 20 min in 37 796

formaldehyde and following extensive washing with phosphate-buffered saline (PBS) cells 797

were first permeabilized in 005 Triton-X for 20 min and then in lysis buffer (50 mM Tris-798

HCl 100 mM NaCl 5 mgml lysozyme) at 37degC for 2 h with gentle shaking To block 799

unspecific binding sites the cell pellet was incubated in 5 bovine serum albumin in PBS at 800

30degC for 1 h The αCurT serum (1500 dilution) was added to cells in fresh blocking buffer 801

for 1 h at 30degC with gentle shaking Cells were then washed three times with blocking buffer 802

and incubated with goat anti-rabbit IgG secondary antibodies conjugated to Oregon Green 488 803

(Invitrogen) (11000 dilution) under the conditions as for the primary antibodies Cells were 804

washed three times with PBS and prepared for microscopy as above Imaging was done as 805

described for live-cell microscopy except that a Colibri2 LED light source was employed for 806

illumination and a CoolSnap HQ camera (Photometrics) was used for image acquisition Cells 807

were imaged as Z-series (step size 280 nm) in the yellow and far-red fluorescent channels 808

(Zeiss Filter Sets 46 HE and 50) using the 505 nm and 625 nm LED modules Effective pixel 809

size in the final image was 102 nm Deconvolution and image analysis was done as described 810

above As judged by the staining intensity of the Oregon Green-conjugated antibodies 811

approximately half of the cells in any given field of view appeared to have been successfully 812

permeabilised a rate that is common in our experience No significant signal was detected in 813

the control sample that had not been exposed to the primary antibodies 814

815

25

Accession numbers 816

Sequence data from this article can be found in the CyanoBase and EMBLGenBank 817

data libraries under accession number slr0483 818

819

Supplemental Data 820

Supplemental Figure 1 Construction of the curT- mutant 821

Supplemental Figure 2 Growth phenotype of curT- 822

Supplemental Figure 3 Expression analysis of the open reading frame slr0482 (located 823

upstream of curT) in the curT- strain 824

Supplemental Figure 4 Absorbance spectra of curT- and wild-type cells 825

Supplemental Figure 5 High-light growth phenotypes of wild-type Synechocystis 6803 and 826

the curT- strain 827

Supplemental Figure 6 Ultrastructure of the TD41 mutant which lacks the psbA transcript 828

and the D1 protein 829

Supplemental Figure 7 Expression and localization of CurT-CFP 830

Supplemental Figure 8 Localization of CurT and CurT-CFP by fluorescence microscopy 831

Supplemental Figure 9 Chlorophyll autofluorescence of curT- 832

Supplemental Figure 10 The curT- mutant as a negative control for immunogold labeling 833

Supplemental Figure 11 Representative counts of immunogold signals 834

Supplemental Table 1 Overview of immunogold signals in curT- cells 835

Supplemental Table 2 Overview of immunogold signals in specific regions of Synechocystis 836

6803 wild-type cells 837

Supplemental Table 3 Statistical analysis of immunogold signals for wild-type 838

Synechocystis 6803 cells 839

Supplemental Table 4 Co-expression of curT 840

Supplemental Movie 1 Scan through the Z-axis of a curT-CFP cell 841

Supplemental Movie 2 Rendered 3D-model of a CurT-CFP detection 842

Supplemental Movie 3 Scan through the Z-axis of a curT-CFP cell with a traversing 843

thylakoid lamella 844

845

Acknowledgements 846

We thank Y Nishiyama for providing αpD1 and J Soll for αVIPP1 and αYidC antibodies 847

respectively and Nina Dyczmons-Nowaczyk for support with the fluorescence measurements 848

This work was supported by grants awarded to JN (Ni3909) MMN (NO 8363) and DL 849

26

(Le126529) by the Deutsche Forschungsgemeinschaft in the context of Research Unit 850

FOR2092 and the Cluster of Excellence RESOLV (EXC 1069) AG is a Howard Hughes 851

Medical Institute postdoctoral fellow in the laboratory of Erin OrsquoShea at Harvard University 852

LS was supported by a PhD fellowship from the Chinese Scholarship Council 853

854

Author Contributions 855

SH AR LS MMN DL and JN designed the research SH AR LS AG ILG EH ML BR 856

SV performed the research all authors contributed to data analysis SH AR and JN wrote the 857

paper 858

859

Competing Financial Interest statement 860

The authors declare no competing financial interests 861

862

We wish to dedicate this paper to Fabrice Rappaport an outstanding colleague and friend who 863

passed away so early 864

865

27

References 866

Allen JF de Paula WBM Puthiyaveetil S and Nield J (2011) A structural 867

phylogenetic map for chloroplast photosynthesis Trends Plant Sci 16 645-655 868

Anderson JM Horton P Kim E-H and Chow WS (2012) Towards elucidation of 869

dynamic structural changes of plant thylakoid architecture Philos Trans R Soc 870

Lond B Biol Sci 367 3515-3524 871

Armbruster U Zuumlhlke J Rengstl B Kreller R Makarenko E Ruumlhle T Schuumlnemann 872

D Jahns P Weisshaar B Nickelsen J and Leister D (2010) The Arabidopsis 873

thylakoid protein PAM68 is required for efficient D1 biogenesis and photosystem II 874

assembly Plant Cell 22 3439-3460 875

Armbruster U Labs M Pribil M Viola S Xu W Scharfenberg M Hertle AP 876

Rojahn U Jensen PE Rappaport F Joliot P Doumlrmann P Wanner G and 877

Leister D (2013) Arabidopsis CURVATURE THYLAKOID1 proteins modify 878

thylakoid architecture by inducing membrane curvature Plant Cell 25 2661-2678 879

Aseeva E Ossenbuumlhl F Sippel C Cho WK Stein B Eichacker LA Meurer J 880

Wanner G Westhoff P Soll J and Vothknecht UC (2007) Vipp1 is required for 881

basic thylakoid membrane formation but not for the assembly of thylakoid protein 882

complexes Plant Physiol Biochem 45 119-128 883

Bartsevich VV and Pakrasi HB (1995) Molecular identification of an ABC transporter 884

complex for manganese analysis of a cyanobacterial mutant strain impaired in the 885

photosynthetic oxygen evolution process EMBO J 14 1845-1853 886

Bartsevich VV and Pakrasi HB (1996) Manganese transport in the cyanobacterium 887

Synechocystis sp PCC 6803 J Biol Chem 271 26057-26061 888

Bernaacutet G Waschewski N and Roumlgner M (2009) Towards efficient hydrogen production 889

the impact of antenna size and external factors on electron transport dynamics in 890

Synechocystis PCC 6803 Photosynth Res 99 205-216 891

Boehm M Yu J Krynicka V Barker M Tichy M Komenda J Nixon PJ and Nield 892

J (2012) Subunit Organization of a Synechocystis Hetero-Oligomeric Thylakoid FtsH893

Complex Involved in Photosystem II Repair Plant Cell 24 3669-3683894

Bradford MM (1976) A rapid and sensitive method for the quantitation of microgram 895

quantities of protein utilizing the principle of protein-dye binding Anal Biochem 72 896

248-254897

28

Chang L Liu X Li Y Liu C-C Yang F Zhao J and Sui S-F (2015) Structural 898

organization of an intact phycobilisome and its association with photosystem II Cell 899

Res 25 726-737 900

Danielsson R Suorsa M Paakkarinen V Albertsson P-Aring Styring S Aro E-M and 901

Mamedov F (2006) Dimeric and monomeric organization of photosystem II 902

Distribution of five distinct complexes in the different domains of the thylakoid 903

membrane J Biol Chem 281 14241-14249 904

Daum B Nicastro D Austin J McIntosh JR and Kuumlhlbrandt W (2010) Arrangement 905

of photosystem II and ATP synthase in chloroplast membranes of Spinach and Pea 906

Plant Cell 22 1299-1312 907

Engel BD Schaffer M Kuhn Cuellar L Villa E Plitzko JM and Baumeister W 908

(2015) Native architecture of the Chlamydomonas chloroplast revealed by in situ 909

cryo-electron tomography eLife 4 e04889 910

Ford MGJ Mills IG Peter BJ Vallis Y Praefcke GJK Evans PR and McMahon 911

HT (2002) Curvature of clathrin-coated pits driven by epsin Nature 419 361-366 912

Fristedt R Willig A Granath P Cregravevecoeur M Rochaix J-D and Vener AV (2009) 913

Phosphorylation of photosystem II controls functional macroscopic folding of 914

photosynthetic membranes in Arabidopsis Plant Cell 21 3950-3964 915

Gallop JL and McMahon HT (2005) BAR domains and membrane curvature bringing 916

your curves to the BAR Biochem Soc Symp 72 223-231 917

Gibson DG (2011) Chapter fifteen - Enzymatic Assembly of Overlapping DNA Fragments 918

In Methods in Enzymology V Christopher ed (Academic Press) pp 349-361 919

Goedhart J von Stetten D Noirclerc-Savoye M Lelimousin M Joosen L Hink MA 920

van Weeren L Gadella TWJ and Royant A (2012) Structure-guided evolution of 921

cyan fluorescent proteins towards a quantum yield of 93 Nat Commun 3 751 922

Heinz S Liauw P Nickelsen J and Nowaczyk M (2016) Analysis of photosystem II 923

biogenesis in cyanobacteria Biochim Biophys Acta 1857 274-287 924

Hernaacutendez-Prieto M and Futschik M (2012) CyanoEXpress A web database for 925

exploration and visualisation of the integrated transcriptome of cyanobacterium 926

Synechocystis sp PCC6803 Bioinformation 8 634-638 927

Hernaacutendez-Prieto MA Semeniuk TA Giner-Lamia J and Futschik ME (2016) The 928

Transcriptional Landscape of the Photosynthetic Model Cyanobacterium 929

Synechocystis sp PCC6803 Sci Rep 6 22168 930

29

Huang F Fulda S Hagemann M and Norling B (2006) Proteomic screening of salt-931

stress-induced changes in plasma membranes of Synechocystis sp strain PCC 6803 932

Proteomics 6 910-920 933

Kirchhoff H (2013) Architectural switches in plant thylakoid membranes Photosynth Res 934

116 481-487 935

Klinkert B Elles I and Nickelsen J (2006) Translation of chloroplast psbD mRNA in 936

Chlamydomonas is controlled by a secondary RNA structure blocking the AUG start 937

codon Nucleic Acids Res 34 386-394 938

Klinkert B Ossenbuumlhl F Sikorski M Berry S Eichacker L and Nickelsen J (2004) 939

PratA a periplasmic tetratricopeptide repeat protein involved in biogenesis of 940

photosystem II in Synechocystis sp PCC 6803 J Biol Chem 279 44639-44644 941

Komenda J Nickelsen J Tichyacute M Praacutešil O Eichacker LA and Nixon PJ (2008) The 942

cyanobacterial homologue of HCF136YCF48 is a component of an early photosystem 943

II assembly complex and is important for both the efficient assembly and repair of 944

photosystem II in Synechocystis sp PCC 6803 J Biol Chem 283 22390-22399 945

Kopf M Klaumlhn S Scholz I Matthiessen JKF Hess WR and Voszlig B (2014) 946

Comparative analysis of the primary transcriptome of Synechocystis sp PCC 6803 947

DNA Res 21 527-539 948

Kunkel DD (1982) Thylakoid centers Structures associated with the cyanobacterial 949

photosynthetic membrane system Arch Microbiol 133 97-99 950

Liberton M Howard Berg R Heuser J Roth R and Pakrasi BH (2006) Ultrastructure 951

of the membrane systems in the unicellular cyanobacterium Synechocystis sp strain 952

PCC 6803 Protoplasma 227 129-138 953

Liberton M Saha R Jacobs JM Nguyen AY Gritsenko MA Smith RD 954

Koppenaal DW and Pakrasi HB (2016) Global Proteomic Analysis Reveals an 955

Exclusive Role of Thylakoid Membranes in Bioenergetics of a Model 956

Cyanobacterium Mol Cell Proteomics 15 2021-2032 957

Luque I and Ochoa de Alda JAG (2014) CURT1CAAD-containing aaRSs thylakoid 958

curvature and gene translation Trends Plant Sci 19 63-66 959

Marin K Stirnberg M Eisenhut M Kraumlmer R and Hagemann M (2006) Osmotic stress 960

in Synechocystis sp PCC 6803 low tolerance towards nonionic osmotic stress results 961

from lacking activation of glucosylglycerol accumulation Microbiology 152 2023-962

2030 963

Mullineaux CW (2005) Function and evolution of grana Trends Plant Sci 10 521-525 964

30

Mullineaux CW (2008) Biogenesis and dynamics of thylakoid membranes and the 965

photosynthetic apparatus In The Cyanobacteria A Herrero and E Flores eds 966

(Norfolk UK Caister Academic Press) pp 289ndash304 967

Nevo R Charuvi D Tsabari O and Reich Z (2012) Composition architecture and 968

dynamics of the photosynthetic apparatus in higher plants Plant J 70 157-176 969

Nickelsen J and Rengstl B (2013) Photosystem II assembly From cyanobacteria to plants 970

Annu Rev Plant Biol 64 609-635 971

Nickelsen J and Zerges W (2013) Thylakoid biogenesis has joined the new era of bacterial 972

cell biology Front Plant Sci 4 458 973

Nilsson F Simpson DJ Jansson C and Andersson B (1992) Ultrastructural and 974

biochemical characterization of a Synechocystis 6803 mutant with inactivated psbA 975

genes Arch Biochem Biophys 295 340-347 976

Odom WR Hodges R Chitnis PR and Guikema JA (1993) Characterization of 977

Synechocystis sp PCC 6803 in iron-supplied and iron-deficient media Plant Mol 978

Biol 23 1255-1264 979

Ossenbuumlhl F Inaba-Sulpice M Meurer J Soll J and Eichacker LA (2006) The 980

Synechocystis sp PCC 6803 Oxa1 homolog is essential for membrane integration of 981

reaction center precursor protein pD1 Plant Cell 18 2236-2246 982

Pisareva T Kwon J Oh J Kim S Ge C Wieslander Aring Choi J-S and Norling B 983

(2011) Model for Membrane Organization and Protein Sorting in the Cyanobacterium 984

Synechocystis sp PCC 6803 Inferred from Proteomics and Multivariate Sequence 985

Analyses J Proteome Res 10 3617-3631 986

Pribil M Labs M and Leister D (2014) Structure and dynamics of thylakoids in land 987

plants J Exp Bot 65 1955-1972 988

Rast A Heinz S and Nickelsen J (2015) Biogenesis of thylakoid membranes Biochim 989

Biophys Acta 1847 821-830 990

Rast A Rengstl B Heinz S Klingl A and Nickelsen J (2016) The role of Slr0151 a 991

tetratricopeptide repeat protein from Synechocystis sp PCC 6803 during Photosystem 992

II assembly and repair Front Plant Sci 7 605 993

Rengstl B Oster U Stengel A and Nickelsen J (2011) An Intermediate Membrane 994

Subfraction in Cyanobacteria Is Involved in an Assembly Network for Photosystem II 995

Biogenesis J Biol Chem 286 21944-21951 996

31

Rengstl B Knoppovaacute J Komenda J and Nickelsen J (2013) Characterization of a 997

Synechocystis double mutant lacking the photosystem II assembly factors YCF48 and 998

Sll0933 Planta 237 471-480 999

Rexroth S Mullineaux CW Ellinger D Sendtko E Roumlgner M and Koenig F (2011) 1000

The Plasma Membrane of the Cyanobacterium Gloeobacter violaceus Contains 1001

Segregated Bioenergetic Domains Plant Cell 23 2379-2390 1002

Rippka R Deruelles J Waterbury JB Herdman M and Stanier RY (1979) Generic 1003

Assignments Strain Histories and Properties of Pure Cultures of Cyanobacteria 1004

Microbiology 111 1-61 1005

Ruumltgers M and Schroda M (2013) A role of VIPP1 as a dynamic structure within 1006

thylakoid centers as sites of photosystem biogenesis Plant Signal Behav 8 e27037 1007

Sacharz J Bryan SJ Yu J Burroughs NJ Spence EM Nixon PJ and Mullineaux 1008

CW (2015) Sub-cellular location of FtsH proteases in the cyanobacterium1009

Synechocystis sp PCC 6803 suggests localised PSII repair zones in the thylakoid1010

membranes Mol Microbiol 96 448-4621011

Sandstroumlm S Park Y-I Oumlquist G and Gustafsson P (2001) CP43prime the isiA Gene 1012

Product Functions as an Excitation Energy Dissipator in the Cyanobacterium 1013

Synechococcus sp PCC 7942 Photochem Photobiol 74 431-437 1014

Schindelin J Arganda-Carreras I Frise E Kaynig V Longair M Pietzsch T 1015

Preibisch S Rueden C Saalfeld S Schmid B Tinevez J-Y White DJ 1016

Hartenstein V Eliceiri K Tomancak P and Cardona A (2012) Fiji an open-1017

source platform for biological-image analysis Nat Methods 9 676-682 1018

Schottkowski M Ratke J Oster U Nowaczyk M and Nickelsen J (2009a) Pitt a novel 1019

tetratricopeptide repeat protein involved in light-dependent chlorophyll biosynthesis 1020

and thylakoid membrane biogenesis in Synechocystis sp PCC 6803 Mol Plant 2 1021

1289-1297 1022

Schottkowski M Gkalympoudis S Tzekova N Stelljes C Schuumlnemann D Ankele E 1023

and Nickelsen J (2009b) Interaction of the periplasmic PratA factor and the PsbA 1024

(D1) protein during biogenesis of photosystem II in Synechocystis sp PCC 6803 J 1025

Biol Chem 284 1813-1819 1026

Selatildeo TT Zhang L Knoppovaaacute J Komenda J and Norling B (2016) Photosystem II 1027

Assembly Steps Take Place in the Thylakoid Membrane of the Cyanobacterium 1028

Synechocystis sp PCC6803 Plant Cell Physiol 57 878 1029

32

Spaumlt P Maček B and Forchhammer K (2015) Phosphoproteome of the cyanobacterium 1030

Synechocystis sp PCC 6803 and its dynamics during nitrogen starvation Front 1031

Microbiol 6 248 1032

Stengel A Guumlgel IL Hilger D Rengstl B Jung H and Nickelsen J (2012) Initial 1033

steps of photosystem II de novo assembly and preloading with manganese take place 1034

in biogenesis centers in Synechocystis Plant Cell 24 660-675 1035

Uniacke J and Zerges W (2007) Photosystem II assembly and repair are differentially 1036

localized in Chlamydomonas Plant Cell 19 3640-3654 1037

Uniacke J and Zerges W (2009) Chloroplast protein targeting involves localized 1038

translation in Chlamydomonas Proc Natl Acad Sci USA 106 1439-1444 1039

van de Meene AL Hohmann-Marriott M Vermaas WJ and Roberson R (2006) The 1040

three-dimensional structure of the cyanobacterium Synechocystis sp PCC 6803 Arch 1041

Microbiol 184 259-270 1042

van de Meene AML Sharp WP McDaniel JH Friedrich H Vermaas WFJ and 1043

Roberson RW (2012) Gross morphological changes in thylakoid membrane 1044

structure are associated with photosystem I deletion in Synechocystis sp PCC 6803 1045

Biochim Biophys Acta 1818 1427-1434 1046

Watanabe M and Ikeuchi M (2013) Phycobilisome architecture of a light-harvesting 1047

supercomplex Photosynth Res 116 265-276 1048

Wellburn AR and Lichtenthaler H (1984) Formulae and Program to Determine Total 1049

Carotenoids and Chlorophylls A and B of Leaf Extracts in Different Solvents In 1050

Advances in Photosynthesis Research Proceedings of the VIth International Congress 1051

on Photosynthesis Brussels Belgium August 1ndash6 1983 C Sybesma ed (Dordrecht 1052

Springer Netherlands) pp 9-12 1053

Wilde A Lunser K Ossenbuumlhl F Nickelsen J and Borner T (2001) Characterization of 1054

the cyanobacterial ycf37 mutation decreases the photosystem I content Biochem J 1055

357 211-216 1056

Wilson A Boulay C Wilde A Kerfeld CA and Kirilovsky D (2007) Light-Induced 1057

Energy Dissipation in Iron-Starved Cyanobacteria Roles of OCP and IsiA Proteins 1058

Plant Cell 19 656-672 1059

Xu M Bernaacutet G Singh A Mi H Roumlgner M Pakrasi HB and Ogawa T (2008) 1060

Properties of Mutants of Synechocystis sp Strain PCC 6803 Lacking Inorganic Carbon 1061

Sequestration Systems Plant Cell Physiol 49 1672-1677 1062

33

Yamamoto T Burke J Autz G and Jagendorf AT (1981) Bound ribosomes of Pea 1063

chloroplast thylakoid membranes location and release in vitro by high salt 1064

puromycin and RNase Plant Physiol 67 940-949 1065

Yang H Liao L Bo T Zhao L Sun X Lu X Norling B and Huang F (2014) 1066

Slr0151 in Synechocystis sp PCC 6803 is required for efficient repair of photosystem 1067

II under high-light condition J Integr Plant Biol 56 1136-1150 1068

Yeremenko N Kouřil R Ihalainen JA DHaene S van Oosterwijk N 1069

Andrizhiyevskaya EG Keegstra W Dekker HL Hagemann M Boekema EJ 1070

Matthijs HCP and Dekker JP (2004) Supramolecular Organization and Dual 1071

Function of the IsiA Chlorophyll-Binding Protein in Cyanobacteria Biochemistry 43 1072

10308-10313 1073

Zak E Norling B Maitra R Huang F Andersson B and Pakrasi HB (2001) The 1074

initial steps of biogenesis of cyanobacterial photosystems occur in plasma membranes 1075

Proc Natl Acad Sci USA 98 13443-13448 1076

Zang X Liu B Liu S Arunakumara KKIU and Zhang X (2007) Optimum 1077

Conditions for Transformation of Synechocystis sp PCC 6803 J Microbiol 45 241-1078

245 1079

Zhang L and Sakamoto W (2015) Possible function of VIPP1 in maintaining chloroplast 1080

membranes Biochim Biophys Acta 1847 831-837 1081

Zimmerberg J and Kozlov MM (2006) How proteins produce cellular membrane 1082

curvature Nat Rev Mol Cell Biol 7 9-19 1083

Zoumlfel P (1988) Statistik in der Praxis (Stuttgart Germany Gustav Fischer Verlag) 1084

1085

34

Figure Legends 1086

Figure 1 General characteristics of CurT A) Sequence alignment of CurT and CURT1A-D 1087

from A thaliana Predicted chloroplast transit-peptide sequences of CURT1A-D are omitted 1088

(Armbruster et al 2013) Positions of predicted C-terminal transmembrane domains (TDM) 1089

are marked (black bar) as is the position of the predicted amphipathic N-terminal helix in 1090

CurT (red bar) The green bar denotes the peptide sequence used for antibody production 1091

Identical and related amino acids that are conserved in 100 80 and 60 of the sequences 1092

are highlighted in black dark grey and light grey respectively B) Helical-wheel 1093

representation of the N-terminal amphipathic helix of CurT (red bar in A) The color code 1094

reflects the physicochemical properties of amino-acid side-chains green polar and 1095

uncharged blue polar and positively charged red polar and negatively charged yellow 1096

hydrophobic C) Solubility of CurT Membrane-associated proteins (50 microg) from wild-type 1097

cells were extracted with 5 mM HEPES (pH 76) containing either 1 M NaCl 01 M Na2CO3 1098

4 M urea 01 Triton X-100 or no additional solute After separation of membrane-bound 1099

(M) and solubilized (S) proteins by centrifugation proteins were fractionated by SDS-PAGE1100

and CurT was immunodetected on immunoblots As a control the integral membrane protein 1101

CP47 from PSII was analyzed in parallel D) Transmission electron micrographs of negatively 1102

stained liposomes Cell-free expression (CFE) of CurT and A thaliana CURT1A was 1103

performed in the presence of liposomes similar in composition to the lipids of the thylakoid 1104

membrane Liposomes before and after cell-free protein expression in the absence of DNA 1105

served as negative controls Black arrowheads indicate tubular connections between 1106

liposomes Scale bars 250 nm 1107

1108

Figure 2 Ultrastructural analysis of curT- cells Transmission electron micrographs of typical 1109

wild-type (A) and curT- (B-D) Synechocystis 6803 cells taken at 44000times (A B) and 28000times 1110

(C D) magnification respectively Ultrathin sections (35 to 45 nm) of cryofixed samples 1111

were stained with osmium tetroxide and post-stained using lead citrate Arrowheads indicate 1112

biogenesis centers Scale bars 200 nm (A B) and 500 nm (C D) respectively 1113

1114

Figure 3 Accumulation of components of photosynthetic complexes in the curT- mutant A) 1115

Whole cell extracts (30 microg protein) from wild-type and curT- strains were fractionated by 1116

SDS-PAGE and analyzed on immunoblots using the indicated antibodies B) The histogram 1117

shows levels of the indicated proteins in curT- extracts relative to wild-type samples (dashed 1118

red line) Data are means plusmn SD of three independent experiments Significant differences from 1119

35

wild-type protein levels according to Studentrsquos t-test with error probabilities of 5 and 1 1120

are indicated by and respectively 1121

1122

Figure 4 P700+ reduction kinetics and high-light effects in curT- cells A) Averaged traces 1123

(10 single measurements) of P700+ decay after complete oxidation by a 50-ms multiple 1124

turnover pulse (10000 micromol photons m-2 s-1) in the absence and presence of 10 microM DCMU 1125

B) Rate constants for P700+ reduction were obtained by fitting of the data with single1126

exponential functions Error bars indicate the SD of three independent measurements C) 1127

Impact of light intensity on the (relative) electron transport rate (rETR) Cells were exposed to 1128

gradually increasing light intensities which resulted in increasing electron transport until the 1129

capacity limit was reached PAR light intensity (micromol photons m-2 s-1) Error bars indicate the 1130

SD of three independent measurements D) D1 protein level in wild-type and curT- after high-1131

light treatment (800 micromol photons m-2s-1) in the presence and absence of lincomycin Samples 1132

were taken every 30 min and processed as in Figure 3 to determine the level of D1 present 1133

100 refers to wild-type D1 level at the beginning of the experiment 1134

1135

Figure 5 PSII assembly in curT- cells A) BNSDS-PAGE of membrane proteins Membrane 1136

fractions from wild-type and curT- cells were solubilized with 13 n-dodecyl-β-maltoside 1137

and proteins were fractionated by two-dimensional BNSDS-PAGE blotted and probed with 1138

antibodies against the PSII subunits D1 D2 CP47 and CP43 Wild-type blots were also 1139

probed with the αCurT antibody The sizes of marker proteins and the positions of PSII 1140

assembly intermediates (RCCII RCCI RC47) are shown above and below each image B) In 1141

vivo pulse labeling of membrane proteins with 35S Pulse-labeled PSII core proteins were 1142

separated via BNSDS-PAGE and visualized by autoradiography 1143

1144

Figure 6 Loss of CurT induces stress A) Low-temperature (77 K) fluorescence emission of 1145

Synechocystis 6803 wild-type (blue) and curT- (red) cells excited at 440 nm The spectra were 1146

normalized to the added fluorescein standard B) Low-temperature (77 K) fluorescence 1147

emission of Synechocystis 6803 wild-type (blue) and curT- (red) excited at 580 nm The 1148

spectra were normalized to 780 nm C) Level of IsiA in the curT- mutant relative to the wild-1149

type A mean value of 368 plusmn 96 (SD) was determined from three independent experiments 1150

1151

Figure 7 Membrane sublocalization of PSII-related factors Cell extracts from wild-type and 1152

curT- cells were fractionated by two consecutive rounds of sucrose-density gradient 1153

36

centrifugation (Schottkowski et al 2009b) The second linear gradient (20-60 sucrose) was 1154

apportioned into 14 fractions which were analyzed by immunoblotting using the indicated 1155

antibodies Fractions 1ndash6 represent PDMs and fractions 7ndash14 thylakoid membranes (TMs) 1156

To facilitate comparison between gradients sample volumes were normalized to the volume 1157

of fraction 7 that contained 40 microg of protein 1158

1159

Figure 8 Live-cell imaging of the curT-CFP strain by fluorescence microscopy In the curT-1160

CFP strain the native curT gene has been replaced by a CFP-tagged version resulting in the 1161

expression of the CurT-CFP fusion protein under the control of the native promotor A) 1162

Close-up views of the mid-cell plane in the CFP and far-red autofluorescence channels shown 1163

in slice 7 in panel B B) Synechocystis 6803 cells expressing CurT C-terminally fused to the 1164

mTurquoise2 variant of CFP from its native chromosomal promoter The two imaging 1165

channels are displayed as Z-axis montages (auto-scaled contrast step size 250 nm) in 1166

grayscale and color composite configuration The thylakoid autofluorescent channel as 1167

imaged in far-red fluorescence is depicted in magenta and CurT signal as imaged in cyan 1168

fluorescence is depicted in cyan C) Fluorescence intensity profiles of the two channels along 1169

the autofluorescent peripheral cell ldquoringrdquo are shown for slice 7 The maximum projection of 1170

the entire Z montage is also shown Scale bars (light grey) 2 microm 1171

1172

Figure 9 Immunofluorescence detection of CurT A) Close-ups of slice 5 in panel B B) 1173

Wild-type Synechocystis 6803 cells labeled with αCurT antibodies and detected with Oregon 1174

Green-conjugated secondary antibodies The Z-axis montages are shown as in Figure 8B 1175

except that the step size is 280 nm (1 to 10) C) Intensity profiles of the two channels along 1176

the autofluorescent peripheral cell ldquoringrdquo are shown for slice 5 The maximum projection of 1177

the entire Z montage is also shown Scale bars (light grey) 2 microm 1178

1179

Figure 10 Subcellular localization of CurT Ultrathin sections of wild-type Synechocystis 1180

6803 cells were incubated with rabbit αCurT prior to incubation with gold-conjugated goat 1181

anti-rabbit IgG A) Negative control (wild-type processed without addition of primary 1182

antibody) B C) Immunogold-labeled sections showing CurT localization at the cytoplasmic 1183

side of the thylakoid membrane D) Cluster formation of CurT signals at a putative biogenesis 1184

center from C E) Biogenesis center from the same cell (C) without any obvious CurT 1185

clustering of gold particles F) Schematic depiction of a wild-type cell (from Figure 2A) with 1186

color-coded curved membranes green = thylakoids that follow the curvature of the cell red = 1187

37

thylakoids that bend away from the plasma membrane yellow = thylakoids that bend toward 1188

the plasma membrane to converge on sites of biogenesis centers G) Relative distribution of 1189

gold signals between convex (dark color) and concave (light color) sides of membranes (n = 1190

1584 signals from a total of 95 cells) The undifferentiated overall signal distribution is given 1191

in blue Bars = 200 nm (overview) and 100 nm (details) 1192

1193

Figure 11 Differentially modified forms of CurT are found in different complexes in PDMs 1194

and thylakoid membranes Samples were isolated by fractionation of wild-type membranes 1195

via two consecutive sucrose density gradients according to Schottkowski et al (2009b) After 1196

density centrifugation samples were applied to BNSDS-PAGE analysis (A) or isoelectric 1197

focusing (B) Numbers on the right indicate the respective fraction from the second gradient 1198

(see Figure 7) Fraction 5 represents the PDMs and fraction 9 the thylakoid membrane 1199

1200

Figure 12 Loss of CurT increases sensitivity to abiotic stress A B) Doubling times of wild-1201

type and curT- under salt stress (A) or osmotic stress (B) Doubling times are means plusmn SD of 1202

three independent cultures C) Localization of CurT-CFP under salt and osmotic stress 1203

Samples were examined as described in Figure 8 Scale bars 1 microm D) Protein levels of wild-1204

type cells after growth in BG11 medium containing 500 mM NaCl Samples were analyzed on 1205

the same gel but unrelated samples between the presented signals were omitted E) 1206

Membrane preparations obtained from wild-type cells wild-type cells grown in the presence 1207

of 500 mM NaCl and curT- cells were subjected to the first gradient step in the membrane 1208

fractionation scheme The gradient was divided into five fractions and 10 of fractions I-IV 1209

and 02 of fraction V were analyzed by SDS-PAGE Fraction II includes the plasma 1210

membrane and fraction V consists of PratA-defined membrane and thylakoid membrane 1211

1212

Figure 13 Model of CurT distribution at convergence zones in Synechocystis 6803 The 1213

distribution of CurT in thylakoid (green) and plasma membranes (brown) is shown The 1214

pattern of localization of CurT in the thylakoid membrane is derived from membrane 1215

fractionation via sucrose density centrifugation fluorescence-based detection of the CurT-1216

CFP fusion and endogenous CurT and immunogold labeling experiments (Figures 7-10) The 1217

different CurT variants a b c and d identified in the IEF experiments (Figure 11) are depicted 1218

in yellow pink blue and black respectively CurT present in the plasma membrane is 1219

highlighted in gray as its precise nature and role remain to be defined (Figure 12) 1220

Membranes are represented as lipid bilayers Convex and concave faces of bent thylakoid 1221

38

sheets are indicated by black arrows The PDM which is dedicated to PSII assembly and 1222

repair is depicted in blue The dotted blue line emphasizes that the ultrastructure in this region 1223

has not yet been fully resolved PP periplasm PM plasma membrane TM thylakoid 1224

membrane L lumen PDM PratA-defined membrane 1225

1226

Tables 1227

Table 1 Physiological characteristics of the curT- mutant 1228

Strain Doubling time [h]

Oxygen Evolution[nmol h-1 OD750

-1]c

Chlorophyll content

[microg OD750-1]

d

Cell size [microm]e

Cell number [ml-1 OD750

-1]f

Wild type 817plusmn017a 1600plusmn042

b 1933plusmn187 251plusmn014 264plusmn020 390plusmn006 x 107

curT- 1259plusmn020a 3226plusmn056

b 1074plusmn20 195plusmn029 274plusmn044 367plusmn016 x 107

1229 abDoubling times in the presence (a) or absence (b) of 5 mM glucose measured under 1230

continuous illumination at 30 micromol photons m-2 s-1 and CO2-limiting conditions cOxygen 1231

evolution is expressed in nmol O2 produced per hour per OD750 unit dChlorophyll content is 1232

expressed in microg OD750-1 eThe diameter of non-dividing cells is presented in microm fCell number 1233

was determined per ml per OD750 Data are means plusmn SD of at least three independent 1234

experiments 1235

1236

Parsed CitationsAllen JF de Paula WBM Puthiyaveetil S and Nield J (2011) A structural phylogenetic map for chloroplast photosynthesisTrends Plant Sci 16 645-655

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Anderson JM Horton P Kim E-H and Chow WS (2012) Towards elucidation of dynamic structural changes of plant thylakoidarchitecture Philos Trans R Soc Lond B Biol Sci 367 3515-3524

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Armbruster U Zuumlhlke J Rengstl B Kreller R Makarenko E Ruumlhle T Schuumlnemann D Jahns P Weisshaar B NickelsenJ and Leister D (2010) The Arabidopsis thylakoid protein PAM68 is required for efficient D1 biogenesis and photosystem IIassembly Plant Cell 22 3439-3460

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Armbruster U Labs M Pribil M Viola S Xu W Scharfenberg M Hertle AP Rojahn U Jensen PE Rappaport F JoliotP Doumlrmann P Wanner G and Leister D (2013) Arabidopsis CURVATURE THYLAKOID1 proteins modify thylakoid architectureby inducing membrane curvature Plant Cell 25 2661-2678

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Aseeva E Ossenbuumlhl F Sippel C Cho WK Stein B Eichacker LA Meurer J Wanner G Westhoff P Soll J andVothknecht UC (2007) Vipp1 is required for basic thylakoid membrane formation but not for the assembly of thylakoid proteincomplexes Plant Physiol Biochem 45 119-128

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Bartsevich VV and Pakrasi HB (1995) Molecular identification of an ABC transporter complex for manganese analysis of acyanobacterial mutant strain impaired in the photosynthetic oxygen evolution process EMBO J 14 1845-1853

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Bartsevich VV and Pakrasi HB (1996) Manganese transport in the cyanobacterium Synechocystis sp PCC 6803 J Biol Chem271 26057-26061

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Bernaacutet G Waschewski N and Roumlgner M (2009) Towards efficient hydrogen production the impact of antenna size andexternal factors on electron transport dynamics in Synechocystis PCC 6803 Photosynth Res 99 205-216

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Boehm M Yu J Krynicka V Barker M Tichy M Komenda J Nixon PJ and Nield J (2012) Subunit Organization of aSynechocystis Hetero-Oligomeric Thylakoid FtsH Complex Involved in Photosystem II Repair Plant Cell 24 3669-3683

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Bradford MM (1976) A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle ofprotein-dye binding Anal Biochem 72 248-254

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Chang L Liu X Li Y Liu C-C Yang F Zhao J and Sui S-F (2015) Structural organization of an intact phycobilisome and itsassociation with photosystem II Cell Res 25 726-737

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Danielsson R Suorsa M Paakkarinen V Albertsson P-Aring Styring S Aro E-M and Mamedov F (2006) Dimeric andmonomeric organization of photosystem II Distribution of five distinct complexes in the different domains of the thylakoidmembrane J Biol Chem 281 14241-14249

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Daum B Nicastro D Austin J McIntosh JR and Kuumlhlbrandt W (2010) Arrangement of photosystem II and ATP synthase in

21

Fluorescence emission spectra were measured with an AMINCO Bowman Series 2 685

Luminescence Spectrometer Wild-type and curT- cells were grown in the presence of 5 mM 686

glucose to mid log-phase and concentrated to 25 microgml chlorophyll adding 2 microM fluorescein 687

as an internal standard Samples (1 ml) were transferred to thin glass tubes dark-adapted for 688

30 min at 30 degC and shock frozen in liquid N2 To quantify chlorophyllfluorescein and 689

phycobilisome-mediated fluorescence samples were excited and emission recorded at 440 690

nm510 nm (chlorophyll and fluorescein excitationmax fluorescein emission) and 580 691

nm685 nm respectively Emission was scanned at 490-800 nm or at 640-800 nm 692

respectively 693

694

Antibody production and protein analysis 695

For generation of an αCurT antibody the N-terminal coding region of curT (amino 696

acid positions 1-58) was amplified by PCR using primers N04835 697

(AAGGATCCGTGGGCCGTAAACATTCAA) and N04833 698

(AAGTCGACGCACTTCCCACACCGGTTGTA) and cloned into the BamHI and XhoI sites 699

of the pGEX-4T-1 vector (GE Healthcare Freiburg Germany) Expression of the GST fusion 700

protein in Escherichia coli BL21(DE3) and subsequent affinity purification on Glutathione-701

Sepharose 4B (GE Healthcare) were carried out as described (Schottkowski et al 2009b) A 702

polyclonal antiserum was raised against this protein fragment in rabbits (Pineda Berlin 703

Germany) Other primary antibodies used in this study have been described previously ie 704

αpD1 (Schottkowski et al 2009b) αD1 (Schottkowski et al 2009b) αD2 (Klinkert et al 705

2006) αPratA (Klinkert et al 2004) αYcf48 (Rengstl et al 2011) αPitt (Schottkowski et 706

al 2009a) αPOR (Schottkowski et al 2009a) αYidC (Ossenbuumlhl et al 2006) αVIPP1 707

(Aseeva et al 2007) αSll0933 (Armbruster et al 2010) and αSlr0151 (Rast et al 2016) or 708

were purchased from Agrisera (Vaumlnnaumls Sweden) ie αCP43 αCP47 αPsaA αCyt f 709

αRbcL αIsiA The αGFP-HRP antibody was acquired from Miltenyi Biotech (Bergisch 710

Gladbach Germany) 711

Protein concentrations were determined according to Bradford (1976) using RotiQuant 712

(Carl Roth GmbH amp Co KG Karlsruhe Germany) Protein extraction membrane 713

fractionation on sucrose-density gradients and quantification of Western signal intensities was 714

performed as described previously (Rengstl et al 2011) Solubility properties of CurT were 715

determined according to Schottkowski et al (2009a) 716

22

Sucrose-density centrifugation separating PDM and thylakoid membrane fractions by 717

two consecutive gradients was carried out as described previously (Schottkowski et al 718

2009b Rengstl et al 2011) 719

Two-dimensional fractionations of cyanobacterial membrane proteins via BNSDS-720

PAGE and of pulse-labeled proteins by BNSDS-PAGE were performed as previously 721

reported (Klinkert et al 2004 Schottkowski et al 2009b Rengstl et al 2013) For the 722

analysis of native complexes in fractions obtained by sucrose-density centrifugation the 723

volume corresponding to 350 microg of protein in fraction 7 was applied to BNSDS-PAGE 724

For isoelectric focusing (IEF) the volume corresponding to 50 microg of protein from 725

fraction 7 in 200 microl of IEF buffer (8 M urea 4 CHAPS 1 IPG buffer pH 4-7 (GE 726

Healthcare)) was applied to an 11-cm Immobiline DryStrip pH 4-7 (GE Healthcare) in a 727

Protean IEF Cell (Bio-Rad Munich Germany) Strips were rehydrated for 12 h at 20 degC and 728

50V Focusing was carried out in the following steps 500 V rapid 1500 Vh 1000 V linear 729

880 Vh 6000 V linear 9680 Vh 6000 V rapid 5390 Vh 50 microA per gel focus temperature 730

20degC Subsequently the strips were incubated in equilibration buffer I (6 M urea 0375 M 731

Tris pH 88 20 glycerol 2 SDS 2 DTT) and equilibration buffer II (6 M urea 0375 732

M Tris pH 88 20 glycerol 2 SDS 25 iodoacetamide) for 10 min in each buffer 733

Then the IEF strips were applied to second-dimension SDS-PAGE 734

735

Transmission electron microscopy and immunogold labeling 736

Sample preparation for transmission electron microscopy including freeze substitution 737

and immunogold labeling of CurT was performed as described previously (Stengel et al 738

2012) Ultrathin sections were cut to thicknesses of 35 - 45 nm and 45 - 65 nm for 739

ultrastructural analyses and immunogold labeling respectively For immunogold labeling 740

sections collected on collodion-coated Ni grids were incubated for 18 h at 4degC with (rabbit) 741

αCurT (diluted 1100 1500 11000 or 14000 in blocking buffer (5 fetal calf serum) with 742

005 Tween 20) and further processed as described previously (Stengel et al 2012) As a 743

negative control wild-type Synechocystis 6803 cells were incubated without the primary 744

antibody and exposed to the gold-labeled anti-rabbit IgG To image the ultrastructure and the 745

immunogold-treated samples a Fei Morgagni 268 transmission electron microscope was used 746

and micrographs were taken at 80 kV 747

To avoid errors in the interpretation of the immunogold labeling experiment only 748

signals which were unambiguously localized to distinctly visible thylakoid membranes were 749

taken into account For each cell different regions (see Figure 10F) were defined and in each 750

23

region the signals on the convex and concave sides of the thylakoid membrane were analyzed 751

separately (see Supplemental Figure 11 for representative counts) Statistical significance was 752

assessed by χ2 test (Zoumlfel 1988) 753

For the analysis of clusters of CurT signals in biogenesis centers a cluster was defined 754

as a minimum of four signals in close proximity Overall 219 biogenesis centers were 755

examined with regard to CurT cluster formation 756

757

Preparation of proteoliposomes 758

Liposomes with a lipid mixture of 25 monogalactosyl diacylglycerol 42 759

digalactosyl diacylglycerol 16 sulfoquinovosyl diacylglycerol and 17 760

phosphatidylglycerol (Lipid Products South Nutfield UK) were prepared as described 761

previously (Armbruster et al 2013) To generate proteoliposomes CurT and CURT1A 762

proteins were expressed in the presence of liposomes for 3 h at 37degC using a PURExpress In 763

Vitro Protein Synthesis Kit (New England Biolabs Ipswich MA USA) The liposomes were 764

separated from the mix by centrifugation in a discontinuous sucrose gradient (100000 g 18 765

h) Subsequently the fraction containing the liposomes was extracted and dialyzed against 20 766

mM HEPES (pH 76) For transmission electron microscopy the proteoliposomes were 767

negatively stained with 1 uranyl acetate on a carbon-coated copper grid Micrographs were 768

taken on a Fei Morgagni 268 TEM at 80 kV 769

770

curT-CFP strain generation 771

Gibson assembly was used for single-step cloning (Gibson 2011) of the slr0483 gene 772

(together with its ~08 kb upstream region) the mTurquoise2 gene fragment the gentamycin-773

resistance cassette (aacC1) and an ~17-kb downstream region of slr0483 into pBR322 774

cleaved with EcoRV and NheI The slr0483 gene was fused in frame to the codon-optimized 775

mTurquoise2 (DNA20) preceded by a linker sequence encoding GSGSG The resulting 776

plasmid was used to transform Synechocystis 6803 as described previously (Zang et al 2007) 777

After ~ 10 days of incubation on BG11-GelRite (15 ) medium in the presence of 2 microgml 778

gentamycin several antibiotic resistant colonies were obtained and streaked out on fresh 779

medium These transformants were then tested for full segregation of the tagged allele by 780

colony PCR with primers flanking the slr0483 gene 781

782

Fluorescence microscopy 783

24

An aliquot of a cell suspension in mid-log phase was placed under a BG11-agarose 784

pad on a glass coverslip (15) and imaged on an inverted microscope (Zeiss 785

AxioObserverZ1) equipped with an ORCA Flash40 V2 (Hamamatsu) camera a Lumenecor 786

SOLA II Light Engine and a Plan-Apochromat 63x140 Oil DIC M27 (NA 14) objective 787

(Zeiss) Image acquisition was done with Zen 21 software in cyan and far-red fluorescence 788

channels (Zeiss Filter Sets 47 HE and 50) as Z-series with a step size of 250 nm and effective 789

pixel size of 103 nm Acquired image files were subsequently deconvolved (Constrained 790

Iterative Method) using a default theoretical Point Spread Function in Zen 20 (Zeiss) 791

Extraction of intensities for line profiles was performed by image thresholding the thylakoid 792

autofluorescence channel and eroding the resulting binary mask in Fiji (Schindelin et al 793

2012) 794

For immunofluorescence analysis cells were grown to mid-log phase as in the case of 795

the cells prepared for live-cell microscopy A 10-ml culture was fixed for 20 min in 37 796

formaldehyde and following extensive washing with phosphate-buffered saline (PBS) cells 797

were first permeabilized in 005 Triton-X for 20 min and then in lysis buffer (50 mM Tris-798

HCl 100 mM NaCl 5 mgml lysozyme) at 37degC for 2 h with gentle shaking To block 799

unspecific binding sites the cell pellet was incubated in 5 bovine serum albumin in PBS at 800

30degC for 1 h The αCurT serum (1500 dilution) was added to cells in fresh blocking buffer 801

for 1 h at 30degC with gentle shaking Cells were then washed three times with blocking buffer 802

and incubated with goat anti-rabbit IgG secondary antibodies conjugated to Oregon Green 488 803

(Invitrogen) (11000 dilution) under the conditions as for the primary antibodies Cells were 804

washed three times with PBS and prepared for microscopy as above Imaging was done as 805

described for live-cell microscopy except that a Colibri2 LED light source was employed for 806

illumination and a CoolSnap HQ camera (Photometrics) was used for image acquisition Cells 807

were imaged as Z-series (step size 280 nm) in the yellow and far-red fluorescent channels 808

(Zeiss Filter Sets 46 HE and 50) using the 505 nm and 625 nm LED modules Effective pixel 809

size in the final image was 102 nm Deconvolution and image analysis was done as described 810

above As judged by the staining intensity of the Oregon Green-conjugated antibodies 811

approximately half of the cells in any given field of view appeared to have been successfully 812

permeabilised a rate that is common in our experience No significant signal was detected in 813

the control sample that had not been exposed to the primary antibodies 814

815

25

Accession numbers 816

Sequence data from this article can be found in the CyanoBase and EMBLGenBank 817

data libraries under accession number slr0483 818

819

Supplemental Data 820

Supplemental Figure 1 Construction of the curT- mutant 821

Supplemental Figure 2 Growth phenotype of curT- 822

Supplemental Figure 3 Expression analysis of the open reading frame slr0482 (located 823

upstream of curT) in the curT- strain 824

Supplemental Figure 4 Absorbance spectra of curT- and wild-type cells 825

Supplemental Figure 5 High-light growth phenotypes of wild-type Synechocystis 6803 and 826

the curT- strain 827

Supplemental Figure 6 Ultrastructure of the TD41 mutant which lacks the psbA transcript 828

and the D1 protein 829

Supplemental Figure 7 Expression and localization of CurT-CFP 830

Supplemental Figure 8 Localization of CurT and CurT-CFP by fluorescence microscopy 831

Supplemental Figure 9 Chlorophyll autofluorescence of curT- 832

Supplemental Figure 10 The curT- mutant as a negative control for immunogold labeling 833

Supplemental Figure 11 Representative counts of immunogold signals 834

Supplemental Table 1 Overview of immunogold signals in curT- cells 835

Supplemental Table 2 Overview of immunogold signals in specific regions of Synechocystis 836

6803 wild-type cells 837

Supplemental Table 3 Statistical analysis of immunogold signals for wild-type 838

Synechocystis 6803 cells 839

Supplemental Table 4 Co-expression of curT 840

Supplemental Movie 1 Scan through the Z-axis of a curT-CFP cell 841

Supplemental Movie 2 Rendered 3D-model of a CurT-CFP detection 842

Supplemental Movie 3 Scan through the Z-axis of a curT-CFP cell with a traversing 843

thylakoid lamella 844

845

Acknowledgements 846

We thank Y Nishiyama for providing αpD1 and J Soll for αVIPP1 and αYidC antibodies 847

respectively and Nina Dyczmons-Nowaczyk for support with the fluorescence measurements 848

This work was supported by grants awarded to JN (Ni3909) MMN (NO 8363) and DL 849

26

(Le126529) by the Deutsche Forschungsgemeinschaft in the context of Research Unit 850

FOR2092 and the Cluster of Excellence RESOLV (EXC 1069) AG is a Howard Hughes 851

Medical Institute postdoctoral fellow in the laboratory of Erin OrsquoShea at Harvard University 852

LS was supported by a PhD fellowship from the Chinese Scholarship Council 853

854

Author Contributions 855

SH AR LS MMN DL and JN designed the research SH AR LS AG ILG EH ML BR 856

SV performed the research all authors contributed to data analysis SH AR and JN wrote the 857

paper 858

859

Competing Financial Interest statement 860

The authors declare no competing financial interests 861

862

We wish to dedicate this paper to Fabrice Rappaport an outstanding colleague and friend who 863

passed away so early 864

865

27

References 866

Allen JF de Paula WBM Puthiyaveetil S and Nield J (2011) A structural 867

phylogenetic map for chloroplast photosynthesis Trends Plant Sci 16 645-655 868

Anderson JM Horton P Kim E-H and Chow WS (2012) Towards elucidation of 869

dynamic structural changes of plant thylakoid architecture Philos Trans R Soc 870

Lond B Biol Sci 367 3515-3524 871

Armbruster U Zuumlhlke J Rengstl B Kreller R Makarenko E Ruumlhle T Schuumlnemann 872

D Jahns P Weisshaar B Nickelsen J and Leister D (2010) The Arabidopsis 873

thylakoid protein PAM68 is required for efficient D1 biogenesis and photosystem II 874

assembly Plant Cell 22 3439-3460 875

Armbruster U Labs M Pribil M Viola S Xu W Scharfenberg M Hertle AP 876

Rojahn U Jensen PE Rappaport F Joliot P Doumlrmann P Wanner G and 877

Leister D (2013) Arabidopsis CURVATURE THYLAKOID1 proteins modify 878

thylakoid architecture by inducing membrane curvature Plant Cell 25 2661-2678 879

Aseeva E Ossenbuumlhl F Sippel C Cho WK Stein B Eichacker LA Meurer J 880

Wanner G Westhoff P Soll J and Vothknecht UC (2007) Vipp1 is required for 881

basic thylakoid membrane formation but not for the assembly of thylakoid protein 882

complexes Plant Physiol Biochem 45 119-128 883

Bartsevich VV and Pakrasi HB (1995) Molecular identification of an ABC transporter 884

complex for manganese analysis of a cyanobacterial mutant strain impaired in the 885

photosynthetic oxygen evolution process EMBO J 14 1845-1853 886

Bartsevich VV and Pakrasi HB (1996) Manganese transport in the cyanobacterium 887

Synechocystis sp PCC 6803 J Biol Chem 271 26057-26061 888

Bernaacutet G Waschewski N and Roumlgner M (2009) Towards efficient hydrogen production 889

the impact of antenna size and external factors on electron transport dynamics in 890

Synechocystis PCC 6803 Photosynth Res 99 205-216 891

Boehm M Yu J Krynicka V Barker M Tichy M Komenda J Nixon PJ and Nield 892

J (2012) Subunit Organization of a Synechocystis Hetero-Oligomeric Thylakoid FtsH893

Complex Involved in Photosystem II Repair Plant Cell 24 3669-3683894

Bradford MM (1976) A rapid and sensitive method for the quantitation of microgram 895

quantities of protein utilizing the principle of protein-dye binding Anal Biochem 72 896

248-254897

28

Chang L Liu X Li Y Liu C-C Yang F Zhao J and Sui S-F (2015) Structural 898

organization of an intact phycobilisome and its association with photosystem II Cell 899

Res 25 726-737 900

Danielsson R Suorsa M Paakkarinen V Albertsson P-Aring Styring S Aro E-M and 901

Mamedov F (2006) Dimeric and monomeric organization of photosystem II 902

Distribution of five distinct complexes in the different domains of the thylakoid 903

membrane J Biol Chem 281 14241-14249 904

Daum B Nicastro D Austin J McIntosh JR and Kuumlhlbrandt W (2010) Arrangement 905

of photosystem II and ATP synthase in chloroplast membranes of Spinach and Pea 906

Plant Cell 22 1299-1312 907

Engel BD Schaffer M Kuhn Cuellar L Villa E Plitzko JM and Baumeister W 908

(2015) Native architecture of the Chlamydomonas chloroplast revealed by in situ 909

cryo-electron tomography eLife 4 e04889 910

Ford MGJ Mills IG Peter BJ Vallis Y Praefcke GJK Evans PR and McMahon 911

HT (2002) Curvature of clathrin-coated pits driven by epsin Nature 419 361-366 912

Fristedt R Willig A Granath P Cregravevecoeur M Rochaix J-D and Vener AV (2009) 913

Phosphorylation of photosystem II controls functional macroscopic folding of 914

photosynthetic membranes in Arabidopsis Plant Cell 21 3950-3964 915

Gallop JL and McMahon HT (2005) BAR domains and membrane curvature bringing 916

your curves to the BAR Biochem Soc Symp 72 223-231 917

Gibson DG (2011) Chapter fifteen - Enzymatic Assembly of Overlapping DNA Fragments 918

In Methods in Enzymology V Christopher ed (Academic Press) pp 349-361 919

Goedhart J von Stetten D Noirclerc-Savoye M Lelimousin M Joosen L Hink MA 920

van Weeren L Gadella TWJ and Royant A (2012) Structure-guided evolution of 921

cyan fluorescent proteins towards a quantum yield of 93 Nat Commun 3 751 922

Heinz S Liauw P Nickelsen J and Nowaczyk M (2016) Analysis of photosystem II 923

biogenesis in cyanobacteria Biochim Biophys Acta 1857 274-287 924

Hernaacutendez-Prieto M and Futschik M (2012) CyanoEXpress A web database for 925

exploration and visualisation of the integrated transcriptome of cyanobacterium 926

Synechocystis sp PCC6803 Bioinformation 8 634-638 927

Hernaacutendez-Prieto MA Semeniuk TA Giner-Lamia J and Futschik ME (2016) The 928

Transcriptional Landscape of the Photosynthetic Model Cyanobacterium 929

Synechocystis sp PCC6803 Sci Rep 6 22168 930

29

Huang F Fulda S Hagemann M and Norling B (2006) Proteomic screening of salt-931

stress-induced changes in plasma membranes of Synechocystis sp strain PCC 6803 932

Proteomics 6 910-920 933

Kirchhoff H (2013) Architectural switches in plant thylakoid membranes Photosynth Res 934

116 481-487 935

Klinkert B Elles I and Nickelsen J (2006) Translation of chloroplast psbD mRNA in 936

Chlamydomonas is controlled by a secondary RNA structure blocking the AUG start 937

codon Nucleic Acids Res 34 386-394 938

Klinkert B Ossenbuumlhl F Sikorski M Berry S Eichacker L and Nickelsen J (2004) 939

PratA a periplasmic tetratricopeptide repeat protein involved in biogenesis of 940

photosystem II in Synechocystis sp PCC 6803 J Biol Chem 279 44639-44644 941

Komenda J Nickelsen J Tichyacute M Praacutešil O Eichacker LA and Nixon PJ (2008) The 942

cyanobacterial homologue of HCF136YCF48 is a component of an early photosystem 943

II assembly complex and is important for both the efficient assembly and repair of 944

photosystem II in Synechocystis sp PCC 6803 J Biol Chem 283 22390-22399 945

Kopf M Klaumlhn S Scholz I Matthiessen JKF Hess WR and Voszlig B (2014) 946

Comparative analysis of the primary transcriptome of Synechocystis sp PCC 6803 947

DNA Res 21 527-539 948

Kunkel DD (1982) Thylakoid centers Structures associated with the cyanobacterial 949

photosynthetic membrane system Arch Microbiol 133 97-99 950

Liberton M Howard Berg R Heuser J Roth R and Pakrasi BH (2006) Ultrastructure 951

of the membrane systems in the unicellular cyanobacterium Synechocystis sp strain 952

PCC 6803 Protoplasma 227 129-138 953

Liberton M Saha R Jacobs JM Nguyen AY Gritsenko MA Smith RD 954

Koppenaal DW and Pakrasi HB (2016) Global Proteomic Analysis Reveals an 955

Exclusive Role of Thylakoid Membranes in Bioenergetics of a Model 956

Cyanobacterium Mol Cell Proteomics 15 2021-2032 957

Luque I and Ochoa de Alda JAG (2014) CURT1CAAD-containing aaRSs thylakoid 958

curvature and gene translation Trends Plant Sci 19 63-66 959

Marin K Stirnberg M Eisenhut M Kraumlmer R and Hagemann M (2006) Osmotic stress 960

in Synechocystis sp PCC 6803 low tolerance towards nonionic osmotic stress results 961

from lacking activation of glucosylglycerol accumulation Microbiology 152 2023-962

2030 963

Mullineaux CW (2005) Function and evolution of grana Trends Plant Sci 10 521-525 964

30

Mullineaux CW (2008) Biogenesis and dynamics of thylakoid membranes and the 965

photosynthetic apparatus In The Cyanobacteria A Herrero and E Flores eds 966

(Norfolk UK Caister Academic Press) pp 289ndash304 967

Nevo R Charuvi D Tsabari O and Reich Z (2012) Composition architecture and 968

dynamics of the photosynthetic apparatus in higher plants Plant J 70 157-176 969

Nickelsen J and Rengstl B (2013) Photosystem II assembly From cyanobacteria to plants 970

Annu Rev Plant Biol 64 609-635 971

Nickelsen J and Zerges W (2013) Thylakoid biogenesis has joined the new era of bacterial 972

cell biology Front Plant Sci 4 458 973

Nilsson F Simpson DJ Jansson C and Andersson B (1992) Ultrastructural and 974

biochemical characterization of a Synechocystis 6803 mutant with inactivated psbA 975

genes Arch Biochem Biophys 295 340-347 976

Odom WR Hodges R Chitnis PR and Guikema JA (1993) Characterization of 977

Synechocystis sp PCC 6803 in iron-supplied and iron-deficient media Plant Mol 978

Biol 23 1255-1264 979

Ossenbuumlhl F Inaba-Sulpice M Meurer J Soll J and Eichacker LA (2006) The 980

Synechocystis sp PCC 6803 Oxa1 homolog is essential for membrane integration of 981

reaction center precursor protein pD1 Plant Cell 18 2236-2246 982

Pisareva T Kwon J Oh J Kim S Ge C Wieslander Aring Choi J-S and Norling B 983

(2011) Model for Membrane Organization and Protein Sorting in the Cyanobacterium 984

Synechocystis sp PCC 6803 Inferred from Proteomics and Multivariate Sequence 985

Analyses J Proteome Res 10 3617-3631 986

Pribil M Labs M and Leister D (2014) Structure and dynamics of thylakoids in land 987

plants J Exp Bot 65 1955-1972 988

Rast A Heinz S and Nickelsen J (2015) Biogenesis of thylakoid membranes Biochim 989

Biophys Acta 1847 821-830 990

Rast A Rengstl B Heinz S Klingl A and Nickelsen J (2016) The role of Slr0151 a 991

tetratricopeptide repeat protein from Synechocystis sp PCC 6803 during Photosystem 992

II assembly and repair Front Plant Sci 7 605 993

Rengstl B Oster U Stengel A and Nickelsen J (2011) An Intermediate Membrane 994

Subfraction in Cyanobacteria Is Involved in an Assembly Network for Photosystem II 995

Biogenesis J Biol Chem 286 21944-21951 996

31

Rengstl B Knoppovaacute J Komenda J and Nickelsen J (2013) Characterization of a 997

Synechocystis double mutant lacking the photosystem II assembly factors YCF48 and 998

Sll0933 Planta 237 471-480 999

Rexroth S Mullineaux CW Ellinger D Sendtko E Roumlgner M and Koenig F (2011) 1000

The Plasma Membrane of the Cyanobacterium Gloeobacter violaceus Contains 1001

Segregated Bioenergetic Domains Plant Cell 23 2379-2390 1002

Rippka R Deruelles J Waterbury JB Herdman M and Stanier RY (1979) Generic 1003

Assignments Strain Histories and Properties of Pure Cultures of Cyanobacteria 1004

Microbiology 111 1-61 1005

Ruumltgers M and Schroda M (2013) A role of VIPP1 as a dynamic structure within 1006

thylakoid centers as sites of photosystem biogenesis Plant Signal Behav 8 e27037 1007

Sacharz J Bryan SJ Yu J Burroughs NJ Spence EM Nixon PJ and Mullineaux 1008

CW (2015) Sub-cellular location of FtsH proteases in the cyanobacterium1009

Synechocystis sp PCC 6803 suggests localised PSII repair zones in the thylakoid1010

membranes Mol Microbiol 96 448-4621011

Sandstroumlm S Park Y-I Oumlquist G and Gustafsson P (2001) CP43prime the isiA Gene 1012

Product Functions as an Excitation Energy Dissipator in the Cyanobacterium 1013

Synechococcus sp PCC 7942 Photochem Photobiol 74 431-437 1014

Schindelin J Arganda-Carreras I Frise E Kaynig V Longair M Pietzsch T 1015

Preibisch S Rueden C Saalfeld S Schmid B Tinevez J-Y White DJ 1016

Hartenstein V Eliceiri K Tomancak P and Cardona A (2012) Fiji an open-1017

source platform for biological-image analysis Nat Methods 9 676-682 1018

Schottkowski M Ratke J Oster U Nowaczyk M and Nickelsen J (2009a) Pitt a novel 1019

tetratricopeptide repeat protein involved in light-dependent chlorophyll biosynthesis 1020

and thylakoid membrane biogenesis in Synechocystis sp PCC 6803 Mol Plant 2 1021

1289-1297 1022

Schottkowski M Gkalympoudis S Tzekova N Stelljes C Schuumlnemann D Ankele E 1023

and Nickelsen J (2009b) Interaction of the periplasmic PratA factor and the PsbA 1024

(D1) protein during biogenesis of photosystem II in Synechocystis sp PCC 6803 J 1025

Biol Chem 284 1813-1819 1026

Selatildeo TT Zhang L Knoppovaaacute J Komenda J and Norling B (2016) Photosystem II 1027

Assembly Steps Take Place in the Thylakoid Membrane of the Cyanobacterium 1028

Synechocystis sp PCC6803 Plant Cell Physiol 57 878 1029

32

Spaumlt P Maček B and Forchhammer K (2015) Phosphoproteome of the cyanobacterium 1030

Synechocystis sp PCC 6803 and its dynamics during nitrogen starvation Front 1031

Microbiol 6 248 1032

Stengel A Guumlgel IL Hilger D Rengstl B Jung H and Nickelsen J (2012) Initial 1033

steps of photosystem II de novo assembly and preloading with manganese take place 1034

in biogenesis centers in Synechocystis Plant Cell 24 660-675 1035

Uniacke J and Zerges W (2007) Photosystem II assembly and repair are differentially 1036

localized in Chlamydomonas Plant Cell 19 3640-3654 1037

Uniacke J and Zerges W (2009) Chloroplast protein targeting involves localized 1038

translation in Chlamydomonas Proc Natl Acad Sci USA 106 1439-1444 1039

van de Meene AL Hohmann-Marriott M Vermaas WJ and Roberson R (2006) The 1040

three-dimensional structure of the cyanobacterium Synechocystis sp PCC 6803 Arch 1041

Microbiol 184 259-270 1042

van de Meene AML Sharp WP McDaniel JH Friedrich H Vermaas WFJ and 1043

Roberson RW (2012) Gross morphological changes in thylakoid membrane 1044

structure are associated with photosystem I deletion in Synechocystis sp PCC 6803 1045

Biochim Biophys Acta 1818 1427-1434 1046

Watanabe M and Ikeuchi M (2013) Phycobilisome architecture of a light-harvesting 1047

supercomplex Photosynth Res 116 265-276 1048

Wellburn AR and Lichtenthaler H (1984) Formulae and Program to Determine Total 1049

Carotenoids and Chlorophylls A and B of Leaf Extracts in Different Solvents In 1050

Advances in Photosynthesis Research Proceedings of the VIth International Congress 1051

on Photosynthesis Brussels Belgium August 1ndash6 1983 C Sybesma ed (Dordrecht 1052

Springer Netherlands) pp 9-12 1053

Wilde A Lunser K Ossenbuumlhl F Nickelsen J and Borner T (2001) Characterization of 1054

the cyanobacterial ycf37 mutation decreases the photosystem I content Biochem J 1055

357 211-216 1056

Wilson A Boulay C Wilde A Kerfeld CA and Kirilovsky D (2007) Light-Induced 1057

Energy Dissipation in Iron-Starved Cyanobacteria Roles of OCP and IsiA Proteins 1058

Plant Cell 19 656-672 1059

Xu M Bernaacutet G Singh A Mi H Roumlgner M Pakrasi HB and Ogawa T (2008) 1060

Properties of Mutants of Synechocystis sp Strain PCC 6803 Lacking Inorganic Carbon 1061

Sequestration Systems Plant Cell Physiol 49 1672-1677 1062

33

Yamamoto T Burke J Autz G and Jagendorf AT (1981) Bound ribosomes of Pea 1063

chloroplast thylakoid membranes location and release in vitro by high salt 1064

puromycin and RNase Plant Physiol 67 940-949 1065

Yang H Liao L Bo T Zhao L Sun X Lu X Norling B and Huang F (2014) 1066

Slr0151 in Synechocystis sp PCC 6803 is required for efficient repair of photosystem 1067

II under high-light condition J Integr Plant Biol 56 1136-1150 1068

Yeremenko N Kouřil R Ihalainen JA DHaene S van Oosterwijk N 1069

Andrizhiyevskaya EG Keegstra W Dekker HL Hagemann M Boekema EJ 1070

Matthijs HCP and Dekker JP (2004) Supramolecular Organization and Dual 1071

Function of the IsiA Chlorophyll-Binding Protein in Cyanobacteria Biochemistry 43 1072

10308-10313 1073

Zak E Norling B Maitra R Huang F Andersson B and Pakrasi HB (2001) The 1074

initial steps of biogenesis of cyanobacterial photosystems occur in plasma membranes 1075

Proc Natl Acad Sci USA 98 13443-13448 1076

Zang X Liu B Liu S Arunakumara KKIU and Zhang X (2007) Optimum 1077

Conditions for Transformation of Synechocystis sp PCC 6803 J Microbiol 45 241-1078

245 1079

Zhang L and Sakamoto W (2015) Possible function of VIPP1 in maintaining chloroplast 1080

membranes Biochim Biophys Acta 1847 831-837 1081

Zimmerberg J and Kozlov MM (2006) How proteins produce cellular membrane 1082

curvature Nat Rev Mol Cell Biol 7 9-19 1083

Zoumlfel P (1988) Statistik in der Praxis (Stuttgart Germany Gustav Fischer Verlag) 1084

1085

34

Figure Legends 1086

Figure 1 General characteristics of CurT A) Sequence alignment of CurT and CURT1A-D 1087

from A thaliana Predicted chloroplast transit-peptide sequences of CURT1A-D are omitted 1088

(Armbruster et al 2013) Positions of predicted C-terminal transmembrane domains (TDM) 1089

are marked (black bar) as is the position of the predicted amphipathic N-terminal helix in 1090

CurT (red bar) The green bar denotes the peptide sequence used for antibody production 1091

Identical and related amino acids that are conserved in 100 80 and 60 of the sequences 1092

are highlighted in black dark grey and light grey respectively B) Helical-wheel 1093

representation of the N-terminal amphipathic helix of CurT (red bar in A) The color code 1094

reflects the physicochemical properties of amino-acid side-chains green polar and 1095

uncharged blue polar and positively charged red polar and negatively charged yellow 1096

hydrophobic C) Solubility of CurT Membrane-associated proteins (50 microg) from wild-type 1097

cells were extracted with 5 mM HEPES (pH 76) containing either 1 M NaCl 01 M Na2CO3 1098

4 M urea 01 Triton X-100 or no additional solute After separation of membrane-bound 1099

(M) and solubilized (S) proteins by centrifugation proteins were fractionated by SDS-PAGE1100

and CurT was immunodetected on immunoblots As a control the integral membrane protein 1101

CP47 from PSII was analyzed in parallel D) Transmission electron micrographs of negatively 1102

stained liposomes Cell-free expression (CFE) of CurT and A thaliana CURT1A was 1103

performed in the presence of liposomes similar in composition to the lipids of the thylakoid 1104

membrane Liposomes before and after cell-free protein expression in the absence of DNA 1105

served as negative controls Black arrowheads indicate tubular connections between 1106

liposomes Scale bars 250 nm 1107

1108

Figure 2 Ultrastructural analysis of curT- cells Transmission electron micrographs of typical 1109

wild-type (A) and curT- (B-D) Synechocystis 6803 cells taken at 44000times (A B) and 28000times 1110

(C D) magnification respectively Ultrathin sections (35 to 45 nm) of cryofixed samples 1111

were stained with osmium tetroxide and post-stained using lead citrate Arrowheads indicate 1112

biogenesis centers Scale bars 200 nm (A B) and 500 nm (C D) respectively 1113

1114

Figure 3 Accumulation of components of photosynthetic complexes in the curT- mutant A) 1115

Whole cell extracts (30 microg protein) from wild-type and curT- strains were fractionated by 1116

SDS-PAGE and analyzed on immunoblots using the indicated antibodies B) The histogram 1117

shows levels of the indicated proteins in curT- extracts relative to wild-type samples (dashed 1118

red line) Data are means plusmn SD of three independent experiments Significant differences from 1119

35

wild-type protein levels according to Studentrsquos t-test with error probabilities of 5 and 1 1120

are indicated by and respectively 1121

1122

Figure 4 P700+ reduction kinetics and high-light effects in curT- cells A) Averaged traces 1123

(10 single measurements) of P700+ decay after complete oxidation by a 50-ms multiple 1124

turnover pulse (10000 micromol photons m-2 s-1) in the absence and presence of 10 microM DCMU 1125

B) Rate constants for P700+ reduction were obtained by fitting of the data with single1126

exponential functions Error bars indicate the SD of three independent measurements C) 1127

Impact of light intensity on the (relative) electron transport rate (rETR) Cells were exposed to 1128

gradually increasing light intensities which resulted in increasing electron transport until the 1129

capacity limit was reached PAR light intensity (micromol photons m-2 s-1) Error bars indicate the 1130

SD of three independent measurements D) D1 protein level in wild-type and curT- after high-1131

light treatment (800 micromol photons m-2s-1) in the presence and absence of lincomycin Samples 1132

were taken every 30 min and processed as in Figure 3 to determine the level of D1 present 1133

100 refers to wild-type D1 level at the beginning of the experiment 1134

1135

Figure 5 PSII assembly in curT- cells A) BNSDS-PAGE of membrane proteins Membrane 1136

fractions from wild-type and curT- cells were solubilized with 13 n-dodecyl-β-maltoside 1137

and proteins were fractionated by two-dimensional BNSDS-PAGE blotted and probed with 1138

antibodies against the PSII subunits D1 D2 CP47 and CP43 Wild-type blots were also 1139

probed with the αCurT antibody The sizes of marker proteins and the positions of PSII 1140

assembly intermediates (RCCII RCCI RC47) are shown above and below each image B) In 1141

vivo pulse labeling of membrane proteins with 35S Pulse-labeled PSII core proteins were 1142

separated via BNSDS-PAGE and visualized by autoradiography 1143

1144

Figure 6 Loss of CurT induces stress A) Low-temperature (77 K) fluorescence emission of 1145

Synechocystis 6803 wild-type (blue) and curT- (red) cells excited at 440 nm The spectra were 1146

normalized to the added fluorescein standard B) Low-temperature (77 K) fluorescence 1147

emission of Synechocystis 6803 wild-type (blue) and curT- (red) excited at 580 nm The 1148

spectra were normalized to 780 nm C) Level of IsiA in the curT- mutant relative to the wild-1149

type A mean value of 368 plusmn 96 (SD) was determined from three independent experiments 1150

1151

Figure 7 Membrane sublocalization of PSII-related factors Cell extracts from wild-type and 1152

curT- cells were fractionated by two consecutive rounds of sucrose-density gradient 1153

36

centrifugation (Schottkowski et al 2009b) The second linear gradient (20-60 sucrose) was 1154

apportioned into 14 fractions which were analyzed by immunoblotting using the indicated 1155

antibodies Fractions 1ndash6 represent PDMs and fractions 7ndash14 thylakoid membranes (TMs) 1156

To facilitate comparison between gradients sample volumes were normalized to the volume 1157

of fraction 7 that contained 40 microg of protein 1158

1159

Figure 8 Live-cell imaging of the curT-CFP strain by fluorescence microscopy In the curT-1160

CFP strain the native curT gene has been replaced by a CFP-tagged version resulting in the 1161

expression of the CurT-CFP fusion protein under the control of the native promotor A) 1162

Close-up views of the mid-cell plane in the CFP and far-red autofluorescence channels shown 1163

in slice 7 in panel B B) Synechocystis 6803 cells expressing CurT C-terminally fused to the 1164

mTurquoise2 variant of CFP from its native chromosomal promoter The two imaging 1165

channels are displayed as Z-axis montages (auto-scaled contrast step size 250 nm) in 1166

grayscale and color composite configuration The thylakoid autofluorescent channel as 1167

imaged in far-red fluorescence is depicted in magenta and CurT signal as imaged in cyan 1168

fluorescence is depicted in cyan C) Fluorescence intensity profiles of the two channels along 1169

the autofluorescent peripheral cell ldquoringrdquo are shown for slice 7 The maximum projection of 1170

the entire Z montage is also shown Scale bars (light grey) 2 microm 1171

1172

Figure 9 Immunofluorescence detection of CurT A) Close-ups of slice 5 in panel B B) 1173

Wild-type Synechocystis 6803 cells labeled with αCurT antibodies and detected with Oregon 1174

Green-conjugated secondary antibodies The Z-axis montages are shown as in Figure 8B 1175

except that the step size is 280 nm (1 to 10) C) Intensity profiles of the two channels along 1176

the autofluorescent peripheral cell ldquoringrdquo are shown for slice 5 The maximum projection of 1177

the entire Z montage is also shown Scale bars (light grey) 2 microm 1178

1179

Figure 10 Subcellular localization of CurT Ultrathin sections of wild-type Synechocystis 1180

6803 cells were incubated with rabbit αCurT prior to incubation with gold-conjugated goat 1181

anti-rabbit IgG A) Negative control (wild-type processed without addition of primary 1182

antibody) B C) Immunogold-labeled sections showing CurT localization at the cytoplasmic 1183

side of the thylakoid membrane D) Cluster formation of CurT signals at a putative biogenesis 1184

center from C E) Biogenesis center from the same cell (C) without any obvious CurT 1185

clustering of gold particles F) Schematic depiction of a wild-type cell (from Figure 2A) with 1186

color-coded curved membranes green = thylakoids that follow the curvature of the cell red = 1187

37

thylakoids that bend away from the plasma membrane yellow = thylakoids that bend toward 1188

the plasma membrane to converge on sites of biogenesis centers G) Relative distribution of 1189

gold signals between convex (dark color) and concave (light color) sides of membranes (n = 1190

1584 signals from a total of 95 cells) The undifferentiated overall signal distribution is given 1191

in blue Bars = 200 nm (overview) and 100 nm (details) 1192

1193

Figure 11 Differentially modified forms of CurT are found in different complexes in PDMs 1194

and thylakoid membranes Samples were isolated by fractionation of wild-type membranes 1195

via two consecutive sucrose density gradients according to Schottkowski et al (2009b) After 1196

density centrifugation samples were applied to BNSDS-PAGE analysis (A) or isoelectric 1197

focusing (B) Numbers on the right indicate the respective fraction from the second gradient 1198

(see Figure 7) Fraction 5 represents the PDMs and fraction 9 the thylakoid membrane 1199

1200

Figure 12 Loss of CurT increases sensitivity to abiotic stress A B) Doubling times of wild-1201

type and curT- under salt stress (A) or osmotic stress (B) Doubling times are means plusmn SD of 1202

three independent cultures C) Localization of CurT-CFP under salt and osmotic stress 1203

Samples were examined as described in Figure 8 Scale bars 1 microm D) Protein levels of wild-1204

type cells after growth in BG11 medium containing 500 mM NaCl Samples were analyzed on 1205

the same gel but unrelated samples between the presented signals were omitted E) 1206

Membrane preparations obtained from wild-type cells wild-type cells grown in the presence 1207

of 500 mM NaCl and curT- cells were subjected to the first gradient step in the membrane 1208

fractionation scheme The gradient was divided into five fractions and 10 of fractions I-IV 1209

and 02 of fraction V were analyzed by SDS-PAGE Fraction II includes the plasma 1210

membrane and fraction V consists of PratA-defined membrane and thylakoid membrane 1211

1212

Figure 13 Model of CurT distribution at convergence zones in Synechocystis 6803 The 1213

distribution of CurT in thylakoid (green) and plasma membranes (brown) is shown The 1214

pattern of localization of CurT in the thylakoid membrane is derived from membrane 1215

fractionation via sucrose density centrifugation fluorescence-based detection of the CurT-1216

CFP fusion and endogenous CurT and immunogold labeling experiments (Figures 7-10) The 1217

different CurT variants a b c and d identified in the IEF experiments (Figure 11) are depicted 1218

in yellow pink blue and black respectively CurT present in the plasma membrane is 1219

highlighted in gray as its precise nature and role remain to be defined (Figure 12) 1220

Membranes are represented as lipid bilayers Convex and concave faces of bent thylakoid 1221

38

sheets are indicated by black arrows The PDM which is dedicated to PSII assembly and 1222

repair is depicted in blue The dotted blue line emphasizes that the ultrastructure in this region 1223

has not yet been fully resolved PP periplasm PM plasma membrane TM thylakoid 1224

membrane L lumen PDM PratA-defined membrane 1225

1226

Tables 1227

Table 1 Physiological characteristics of the curT- mutant 1228

Strain Doubling time [h]

Oxygen Evolution[nmol h-1 OD750

-1]c

Chlorophyll content

[microg OD750-1]

d

Cell size [microm]e

Cell number [ml-1 OD750

-1]f

Wild type 817plusmn017a 1600plusmn042

b 1933plusmn187 251plusmn014 264plusmn020 390plusmn006 x 107

curT- 1259plusmn020a 3226plusmn056

b 1074plusmn20 195plusmn029 274plusmn044 367plusmn016 x 107

1229 abDoubling times in the presence (a) or absence (b) of 5 mM glucose measured under 1230

continuous illumination at 30 micromol photons m-2 s-1 and CO2-limiting conditions cOxygen 1231

evolution is expressed in nmol O2 produced per hour per OD750 unit dChlorophyll content is 1232

expressed in microg OD750-1 eThe diameter of non-dividing cells is presented in microm fCell number 1233

was determined per ml per OD750 Data are means plusmn SD of at least three independent 1234

experiments 1235

1236

Parsed CitationsAllen JF de Paula WBM Puthiyaveetil S and Nield J (2011) A structural phylogenetic map for chloroplast photosynthesisTrends Plant Sci 16 645-655

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Anderson JM Horton P Kim E-H and Chow WS (2012) Towards elucidation of dynamic structural changes of plant thylakoidarchitecture Philos Trans R Soc Lond B Biol Sci 367 3515-3524

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Armbruster U Zuumlhlke J Rengstl B Kreller R Makarenko E Ruumlhle T Schuumlnemann D Jahns P Weisshaar B NickelsenJ and Leister D (2010) The Arabidopsis thylakoid protein PAM68 is required for efficient D1 biogenesis and photosystem IIassembly Plant Cell 22 3439-3460

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Armbruster U Labs M Pribil M Viola S Xu W Scharfenberg M Hertle AP Rojahn U Jensen PE Rappaport F JoliotP Doumlrmann P Wanner G and Leister D (2013) Arabidopsis CURVATURE THYLAKOID1 proteins modify thylakoid architectureby inducing membrane curvature Plant Cell 25 2661-2678

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Aseeva E Ossenbuumlhl F Sippel C Cho WK Stein B Eichacker LA Meurer J Wanner G Westhoff P Soll J andVothknecht UC (2007) Vipp1 is required for basic thylakoid membrane formation but not for the assembly of thylakoid proteincomplexes Plant Physiol Biochem 45 119-128

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Bartsevich VV and Pakrasi HB (1995) Molecular identification of an ABC transporter complex for manganese analysis of acyanobacterial mutant strain impaired in the photosynthetic oxygen evolution process EMBO J 14 1845-1853

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Bartsevich VV and Pakrasi HB (1996) Manganese transport in the cyanobacterium Synechocystis sp PCC 6803 J Biol Chem271 26057-26061

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Bernaacutet G Waschewski N and Roumlgner M (2009) Towards efficient hydrogen production the impact of antenna size andexternal factors on electron transport dynamics in Synechocystis PCC 6803 Photosynth Res 99 205-216

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Boehm M Yu J Krynicka V Barker M Tichy M Komenda J Nixon PJ and Nield J (2012) Subunit Organization of aSynechocystis Hetero-Oligomeric Thylakoid FtsH Complex Involved in Photosystem II Repair Plant Cell 24 3669-3683

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Bradford MM (1976) A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle ofprotein-dye binding Anal Biochem 72 248-254

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Chang L Liu X Li Y Liu C-C Yang F Zhao J and Sui S-F (2015) Structural organization of an intact phycobilisome and itsassociation with photosystem II Cell Res 25 726-737

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Danielsson R Suorsa M Paakkarinen V Albertsson P-Aring Styring S Aro E-M and Mamedov F (2006) Dimeric andmonomeric organization of photosystem II Distribution of five distinct complexes in the different domains of the thylakoidmembrane J Biol Chem 281 14241-14249

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Daum B Nicastro D Austin J McIntosh JR and Kuumlhlbrandt W (2010) Arrangement of photosystem II and ATP synthase in

22

Sucrose-density centrifugation separating PDM and thylakoid membrane fractions by 717

two consecutive gradients was carried out as described previously (Schottkowski et al 718

2009b Rengstl et al 2011) 719

Two-dimensional fractionations of cyanobacterial membrane proteins via BNSDS-720

PAGE and of pulse-labeled proteins by BNSDS-PAGE were performed as previously 721

reported (Klinkert et al 2004 Schottkowski et al 2009b Rengstl et al 2013) For the 722

analysis of native complexes in fractions obtained by sucrose-density centrifugation the 723

volume corresponding to 350 microg of protein in fraction 7 was applied to BNSDS-PAGE 724

For isoelectric focusing (IEF) the volume corresponding to 50 microg of protein from 725

fraction 7 in 200 microl of IEF buffer (8 M urea 4 CHAPS 1 IPG buffer pH 4-7 (GE 726

Healthcare)) was applied to an 11-cm Immobiline DryStrip pH 4-7 (GE Healthcare) in a 727

Protean IEF Cell (Bio-Rad Munich Germany) Strips were rehydrated for 12 h at 20 degC and 728

50V Focusing was carried out in the following steps 500 V rapid 1500 Vh 1000 V linear 729

880 Vh 6000 V linear 9680 Vh 6000 V rapid 5390 Vh 50 microA per gel focus temperature 730

20degC Subsequently the strips were incubated in equilibration buffer I (6 M urea 0375 M 731

Tris pH 88 20 glycerol 2 SDS 2 DTT) and equilibration buffer II (6 M urea 0375 732

M Tris pH 88 20 glycerol 2 SDS 25 iodoacetamide) for 10 min in each buffer 733

Then the IEF strips were applied to second-dimension SDS-PAGE 734

735

Transmission electron microscopy and immunogold labeling 736

Sample preparation for transmission electron microscopy including freeze substitution 737

and immunogold labeling of CurT was performed as described previously (Stengel et al 738

2012) Ultrathin sections were cut to thicknesses of 35 - 45 nm and 45 - 65 nm for 739

ultrastructural analyses and immunogold labeling respectively For immunogold labeling 740

sections collected on collodion-coated Ni grids were incubated for 18 h at 4degC with (rabbit) 741

αCurT (diluted 1100 1500 11000 or 14000 in blocking buffer (5 fetal calf serum) with 742

005 Tween 20) and further processed as described previously (Stengel et al 2012) As a 743

negative control wild-type Synechocystis 6803 cells were incubated without the primary 744

antibody and exposed to the gold-labeled anti-rabbit IgG To image the ultrastructure and the 745

immunogold-treated samples a Fei Morgagni 268 transmission electron microscope was used 746

and micrographs were taken at 80 kV 747

To avoid errors in the interpretation of the immunogold labeling experiment only 748

signals which were unambiguously localized to distinctly visible thylakoid membranes were 749

taken into account For each cell different regions (see Figure 10F) were defined and in each 750

23

region the signals on the convex and concave sides of the thylakoid membrane were analyzed 751

separately (see Supplemental Figure 11 for representative counts) Statistical significance was 752

assessed by χ2 test (Zoumlfel 1988) 753

For the analysis of clusters of CurT signals in biogenesis centers a cluster was defined 754

as a minimum of four signals in close proximity Overall 219 biogenesis centers were 755

examined with regard to CurT cluster formation 756

757

Preparation of proteoliposomes 758

Liposomes with a lipid mixture of 25 monogalactosyl diacylglycerol 42 759

digalactosyl diacylglycerol 16 sulfoquinovosyl diacylglycerol and 17 760

phosphatidylglycerol (Lipid Products South Nutfield UK) were prepared as described 761

previously (Armbruster et al 2013) To generate proteoliposomes CurT and CURT1A 762

proteins were expressed in the presence of liposomes for 3 h at 37degC using a PURExpress In 763

Vitro Protein Synthesis Kit (New England Biolabs Ipswich MA USA) The liposomes were 764

separated from the mix by centrifugation in a discontinuous sucrose gradient (100000 g 18 765

h) Subsequently the fraction containing the liposomes was extracted and dialyzed against 20 766

mM HEPES (pH 76) For transmission electron microscopy the proteoliposomes were 767

negatively stained with 1 uranyl acetate on a carbon-coated copper grid Micrographs were 768

taken on a Fei Morgagni 268 TEM at 80 kV 769

770

curT-CFP strain generation 771

Gibson assembly was used for single-step cloning (Gibson 2011) of the slr0483 gene 772

(together with its ~08 kb upstream region) the mTurquoise2 gene fragment the gentamycin-773

resistance cassette (aacC1) and an ~17-kb downstream region of slr0483 into pBR322 774

cleaved with EcoRV and NheI The slr0483 gene was fused in frame to the codon-optimized 775

mTurquoise2 (DNA20) preceded by a linker sequence encoding GSGSG The resulting 776

plasmid was used to transform Synechocystis 6803 as described previously (Zang et al 2007) 777

After ~ 10 days of incubation on BG11-GelRite (15 ) medium in the presence of 2 microgml 778

gentamycin several antibiotic resistant colonies were obtained and streaked out on fresh 779

medium These transformants were then tested for full segregation of the tagged allele by 780

colony PCR with primers flanking the slr0483 gene 781

782

Fluorescence microscopy 783

24

An aliquot of a cell suspension in mid-log phase was placed under a BG11-agarose 784

pad on a glass coverslip (15) and imaged on an inverted microscope (Zeiss 785

AxioObserverZ1) equipped with an ORCA Flash40 V2 (Hamamatsu) camera a Lumenecor 786

SOLA II Light Engine and a Plan-Apochromat 63x140 Oil DIC M27 (NA 14) objective 787

(Zeiss) Image acquisition was done with Zen 21 software in cyan and far-red fluorescence 788

channels (Zeiss Filter Sets 47 HE and 50) as Z-series with a step size of 250 nm and effective 789

pixel size of 103 nm Acquired image files were subsequently deconvolved (Constrained 790

Iterative Method) using a default theoretical Point Spread Function in Zen 20 (Zeiss) 791

Extraction of intensities for line profiles was performed by image thresholding the thylakoid 792

autofluorescence channel and eroding the resulting binary mask in Fiji (Schindelin et al 793

2012) 794

For immunofluorescence analysis cells were grown to mid-log phase as in the case of 795

the cells prepared for live-cell microscopy A 10-ml culture was fixed for 20 min in 37 796

formaldehyde and following extensive washing with phosphate-buffered saline (PBS) cells 797

were first permeabilized in 005 Triton-X for 20 min and then in lysis buffer (50 mM Tris-798

HCl 100 mM NaCl 5 mgml lysozyme) at 37degC for 2 h with gentle shaking To block 799

unspecific binding sites the cell pellet was incubated in 5 bovine serum albumin in PBS at 800

30degC for 1 h The αCurT serum (1500 dilution) was added to cells in fresh blocking buffer 801

for 1 h at 30degC with gentle shaking Cells were then washed three times with blocking buffer 802

and incubated with goat anti-rabbit IgG secondary antibodies conjugated to Oregon Green 488 803

(Invitrogen) (11000 dilution) under the conditions as for the primary antibodies Cells were 804

washed three times with PBS and prepared for microscopy as above Imaging was done as 805

described for live-cell microscopy except that a Colibri2 LED light source was employed for 806

illumination and a CoolSnap HQ camera (Photometrics) was used for image acquisition Cells 807

were imaged as Z-series (step size 280 nm) in the yellow and far-red fluorescent channels 808

(Zeiss Filter Sets 46 HE and 50) using the 505 nm and 625 nm LED modules Effective pixel 809

size in the final image was 102 nm Deconvolution and image analysis was done as described 810

above As judged by the staining intensity of the Oregon Green-conjugated antibodies 811

approximately half of the cells in any given field of view appeared to have been successfully 812

permeabilised a rate that is common in our experience No significant signal was detected in 813

the control sample that had not been exposed to the primary antibodies 814

815

25

Accession numbers 816

Sequence data from this article can be found in the CyanoBase and EMBLGenBank 817

data libraries under accession number slr0483 818

819

Supplemental Data 820

Supplemental Figure 1 Construction of the curT- mutant 821

Supplemental Figure 2 Growth phenotype of curT- 822

Supplemental Figure 3 Expression analysis of the open reading frame slr0482 (located 823

upstream of curT) in the curT- strain 824

Supplemental Figure 4 Absorbance spectra of curT- and wild-type cells 825

Supplemental Figure 5 High-light growth phenotypes of wild-type Synechocystis 6803 and 826

the curT- strain 827

Supplemental Figure 6 Ultrastructure of the TD41 mutant which lacks the psbA transcript 828

and the D1 protein 829

Supplemental Figure 7 Expression and localization of CurT-CFP 830

Supplemental Figure 8 Localization of CurT and CurT-CFP by fluorescence microscopy 831

Supplemental Figure 9 Chlorophyll autofluorescence of curT- 832

Supplemental Figure 10 The curT- mutant as a negative control for immunogold labeling 833

Supplemental Figure 11 Representative counts of immunogold signals 834

Supplemental Table 1 Overview of immunogold signals in curT- cells 835

Supplemental Table 2 Overview of immunogold signals in specific regions of Synechocystis 836

6803 wild-type cells 837

Supplemental Table 3 Statistical analysis of immunogold signals for wild-type 838

Synechocystis 6803 cells 839

Supplemental Table 4 Co-expression of curT 840

Supplemental Movie 1 Scan through the Z-axis of a curT-CFP cell 841

Supplemental Movie 2 Rendered 3D-model of a CurT-CFP detection 842

Supplemental Movie 3 Scan through the Z-axis of a curT-CFP cell with a traversing 843

thylakoid lamella 844

845

Acknowledgements 846

We thank Y Nishiyama for providing αpD1 and J Soll for αVIPP1 and αYidC antibodies 847

respectively and Nina Dyczmons-Nowaczyk for support with the fluorescence measurements 848

This work was supported by grants awarded to JN (Ni3909) MMN (NO 8363) and DL 849

26

(Le126529) by the Deutsche Forschungsgemeinschaft in the context of Research Unit 850

FOR2092 and the Cluster of Excellence RESOLV (EXC 1069) AG is a Howard Hughes 851

Medical Institute postdoctoral fellow in the laboratory of Erin OrsquoShea at Harvard University 852

LS was supported by a PhD fellowship from the Chinese Scholarship Council 853

854

Author Contributions 855

SH AR LS MMN DL and JN designed the research SH AR LS AG ILG EH ML BR 856

SV performed the research all authors contributed to data analysis SH AR and JN wrote the 857

paper 858

859

Competing Financial Interest statement 860

The authors declare no competing financial interests 861

862

We wish to dedicate this paper to Fabrice Rappaport an outstanding colleague and friend who 863

passed away so early 864

865

27

References 866

Allen JF de Paula WBM Puthiyaveetil S and Nield J (2011) A structural 867

phylogenetic map for chloroplast photosynthesis Trends Plant Sci 16 645-655 868

Anderson JM Horton P Kim E-H and Chow WS (2012) Towards elucidation of 869

dynamic structural changes of plant thylakoid architecture Philos Trans R Soc 870

Lond B Biol Sci 367 3515-3524 871

Armbruster U Zuumlhlke J Rengstl B Kreller R Makarenko E Ruumlhle T Schuumlnemann 872

D Jahns P Weisshaar B Nickelsen J and Leister D (2010) The Arabidopsis 873

thylakoid protein PAM68 is required for efficient D1 biogenesis and photosystem II 874

assembly Plant Cell 22 3439-3460 875

Armbruster U Labs M Pribil M Viola S Xu W Scharfenberg M Hertle AP 876

Rojahn U Jensen PE Rappaport F Joliot P Doumlrmann P Wanner G and 877

Leister D (2013) Arabidopsis CURVATURE THYLAKOID1 proteins modify 878

thylakoid architecture by inducing membrane curvature Plant Cell 25 2661-2678 879

Aseeva E Ossenbuumlhl F Sippel C Cho WK Stein B Eichacker LA Meurer J 880

Wanner G Westhoff P Soll J and Vothknecht UC (2007) Vipp1 is required for 881

basic thylakoid membrane formation but not for the assembly of thylakoid protein 882

complexes Plant Physiol Biochem 45 119-128 883

Bartsevich VV and Pakrasi HB (1995) Molecular identification of an ABC transporter 884

complex for manganese analysis of a cyanobacterial mutant strain impaired in the 885

photosynthetic oxygen evolution process EMBO J 14 1845-1853 886

Bartsevich VV and Pakrasi HB (1996) Manganese transport in the cyanobacterium 887

Synechocystis sp PCC 6803 J Biol Chem 271 26057-26061 888

Bernaacutet G Waschewski N and Roumlgner M (2009) Towards efficient hydrogen production 889

the impact of antenna size and external factors on electron transport dynamics in 890

Synechocystis PCC 6803 Photosynth Res 99 205-216 891

Boehm M Yu J Krynicka V Barker M Tichy M Komenda J Nixon PJ and Nield 892

J (2012) Subunit Organization of a Synechocystis Hetero-Oligomeric Thylakoid FtsH893

Complex Involved in Photosystem II Repair Plant Cell 24 3669-3683894

Bradford MM (1976) A rapid and sensitive method for the quantitation of microgram 895

quantities of protein utilizing the principle of protein-dye binding Anal Biochem 72 896

248-254897

28

Chang L Liu X Li Y Liu C-C Yang F Zhao J and Sui S-F (2015) Structural 898

organization of an intact phycobilisome and its association with photosystem II Cell 899

Res 25 726-737 900

Danielsson R Suorsa M Paakkarinen V Albertsson P-Aring Styring S Aro E-M and 901

Mamedov F (2006) Dimeric and monomeric organization of photosystem II 902

Distribution of five distinct complexes in the different domains of the thylakoid 903

membrane J Biol Chem 281 14241-14249 904

Daum B Nicastro D Austin J McIntosh JR and Kuumlhlbrandt W (2010) Arrangement 905

of photosystem II and ATP synthase in chloroplast membranes of Spinach and Pea 906

Plant Cell 22 1299-1312 907

Engel BD Schaffer M Kuhn Cuellar L Villa E Plitzko JM and Baumeister W 908

(2015) Native architecture of the Chlamydomonas chloroplast revealed by in situ 909

cryo-electron tomography eLife 4 e04889 910

Ford MGJ Mills IG Peter BJ Vallis Y Praefcke GJK Evans PR and McMahon 911

HT (2002) Curvature of clathrin-coated pits driven by epsin Nature 419 361-366 912

Fristedt R Willig A Granath P Cregravevecoeur M Rochaix J-D and Vener AV (2009) 913

Phosphorylation of photosystem II controls functional macroscopic folding of 914

photosynthetic membranes in Arabidopsis Plant Cell 21 3950-3964 915

Gallop JL and McMahon HT (2005) BAR domains and membrane curvature bringing 916

your curves to the BAR Biochem Soc Symp 72 223-231 917

Gibson DG (2011) Chapter fifteen - Enzymatic Assembly of Overlapping DNA Fragments 918

In Methods in Enzymology V Christopher ed (Academic Press) pp 349-361 919

Goedhart J von Stetten D Noirclerc-Savoye M Lelimousin M Joosen L Hink MA 920

van Weeren L Gadella TWJ and Royant A (2012) Structure-guided evolution of 921

cyan fluorescent proteins towards a quantum yield of 93 Nat Commun 3 751 922

Heinz S Liauw P Nickelsen J and Nowaczyk M (2016) Analysis of photosystem II 923

biogenesis in cyanobacteria Biochim Biophys Acta 1857 274-287 924

Hernaacutendez-Prieto M and Futschik M (2012) CyanoEXpress A web database for 925

exploration and visualisation of the integrated transcriptome of cyanobacterium 926

Synechocystis sp PCC6803 Bioinformation 8 634-638 927

Hernaacutendez-Prieto MA Semeniuk TA Giner-Lamia J and Futschik ME (2016) The 928

Transcriptional Landscape of the Photosynthetic Model Cyanobacterium 929

Synechocystis sp PCC6803 Sci Rep 6 22168 930

29

Huang F Fulda S Hagemann M and Norling B (2006) Proteomic screening of salt-931

stress-induced changes in plasma membranes of Synechocystis sp strain PCC 6803 932

Proteomics 6 910-920 933

Kirchhoff H (2013) Architectural switches in plant thylakoid membranes Photosynth Res 934

116 481-487 935

Klinkert B Elles I and Nickelsen J (2006) Translation of chloroplast psbD mRNA in 936

Chlamydomonas is controlled by a secondary RNA structure blocking the AUG start 937

codon Nucleic Acids Res 34 386-394 938

Klinkert B Ossenbuumlhl F Sikorski M Berry S Eichacker L and Nickelsen J (2004) 939

PratA a periplasmic tetratricopeptide repeat protein involved in biogenesis of 940

photosystem II in Synechocystis sp PCC 6803 J Biol Chem 279 44639-44644 941

Komenda J Nickelsen J Tichyacute M Praacutešil O Eichacker LA and Nixon PJ (2008) The 942

cyanobacterial homologue of HCF136YCF48 is a component of an early photosystem 943

II assembly complex and is important for both the efficient assembly and repair of 944

photosystem II in Synechocystis sp PCC 6803 J Biol Chem 283 22390-22399 945

Kopf M Klaumlhn S Scholz I Matthiessen JKF Hess WR and Voszlig B (2014) 946

Comparative analysis of the primary transcriptome of Synechocystis sp PCC 6803 947

DNA Res 21 527-539 948

Kunkel DD (1982) Thylakoid centers Structures associated with the cyanobacterial 949

photosynthetic membrane system Arch Microbiol 133 97-99 950

Liberton M Howard Berg R Heuser J Roth R and Pakrasi BH (2006) Ultrastructure 951

of the membrane systems in the unicellular cyanobacterium Synechocystis sp strain 952

PCC 6803 Protoplasma 227 129-138 953

Liberton M Saha R Jacobs JM Nguyen AY Gritsenko MA Smith RD 954

Koppenaal DW and Pakrasi HB (2016) Global Proteomic Analysis Reveals an 955

Exclusive Role of Thylakoid Membranes in Bioenergetics of a Model 956

Cyanobacterium Mol Cell Proteomics 15 2021-2032 957

Luque I and Ochoa de Alda JAG (2014) CURT1CAAD-containing aaRSs thylakoid 958

curvature and gene translation Trends Plant Sci 19 63-66 959

Marin K Stirnberg M Eisenhut M Kraumlmer R and Hagemann M (2006) Osmotic stress 960

in Synechocystis sp PCC 6803 low tolerance towards nonionic osmotic stress results 961

from lacking activation of glucosylglycerol accumulation Microbiology 152 2023-962

2030 963

Mullineaux CW (2005) Function and evolution of grana Trends Plant Sci 10 521-525 964

30

Mullineaux CW (2008) Biogenesis and dynamics of thylakoid membranes and the 965

photosynthetic apparatus In The Cyanobacteria A Herrero and E Flores eds 966

(Norfolk UK Caister Academic Press) pp 289ndash304 967

Nevo R Charuvi D Tsabari O and Reich Z (2012) Composition architecture and 968

dynamics of the photosynthetic apparatus in higher plants Plant J 70 157-176 969

Nickelsen J and Rengstl B (2013) Photosystem II assembly From cyanobacteria to plants 970

Annu Rev Plant Biol 64 609-635 971

Nickelsen J and Zerges W (2013) Thylakoid biogenesis has joined the new era of bacterial 972

cell biology Front Plant Sci 4 458 973

Nilsson F Simpson DJ Jansson C and Andersson B (1992) Ultrastructural and 974

biochemical characterization of a Synechocystis 6803 mutant with inactivated psbA 975

genes Arch Biochem Biophys 295 340-347 976

Odom WR Hodges R Chitnis PR and Guikema JA (1993) Characterization of 977

Synechocystis sp PCC 6803 in iron-supplied and iron-deficient media Plant Mol 978

Biol 23 1255-1264 979

Ossenbuumlhl F Inaba-Sulpice M Meurer J Soll J and Eichacker LA (2006) The 980

Synechocystis sp PCC 6803 Oxa1 homolog is essential for membrane integration of 981

reaction center precursor protein pD1 Plant Cell 18 2236-2246 982

Pisareva T Kwon J Oh J Kim S Ge C Wieslander Aring Choi J-S and Norling B 983

(2011) Model for Membrane Organization and Protein Sorting in the Cyanobacterium 984

Synechocystis sp PCC 6803 Inferred from Proteomics and Multivariate Sequence 985

Analyses J Proteome Res 10 3617-3631 986

Pribil M Labs M and Leister D (2014) Structure and dynamics of thylakoids in land 987

plants J Exp Bot 65 1955-1972 988

Rast A Heinz S and Nickelsen J (2015) Biogenesis of thylakoid membranes Biochim 989

Biophys Acta 1847 821-830 990

Rast A Rengstl B Heinz S Klingl A and Nickelsen J (2016) The role of Slr0151 a 991

tetratricopeptide repeat protein from Synechocystis sp PCC 6803 during Photosystem 992

II assembly and repair Front Plant Sci 7 605 993

Rengstl B Oster U Stengel A and Nickelsen J (2011) An Intermediate Membrane 994

Subfraction in Cyanobacteria Is Involved in an Assembly Network for Photosystem II 995

Biogenesis J Biol Chem 286 21944-21951 996

31

Rengstl B Knoppovaacute J Komenda J and Nickelsen J (2013) Characterization of a 997

Synechocystis double mutant lacking the photosystem II assembly factors YCF48 and 998

Sll0933 Planta 237 471-480 999

Rexroth S Mullineaux CW Ellinger D Sendtko E Roumlgner M and Koenig F (2011) 1000

The Plasma Membrane of the Cyanobacterium Gloeobacter violaceus Contains 1001

Segregated Bioenergetic Domains Plant Cell 23 2379-2390 1002

Rippka R Deruelles J Waterbury JB Herdman M and Stanier RY (1979) Generic 1003

Assignments Strain Histories and Properties of Pure Cultures of Cyanobacteria 1004

Microbiology 111 1-61 1005

Ruumltgers M and Schroda M (2013) A role of VIPP1 as a dynamic structure within 1006

thylakoid centers as sites of photosystem biogenesis Plant Signal Behav 8 e27037 1007

Sacharz J Bryan SJ Yu J Burroughs NJ Spence EM Nixon PJ and Mullineaux 1008

CW (2015) Sub-cellular location of FtsH proteases in the cyanobacterium1009

Synechocystis sp PCC 6803 suggests localised PSII repair zones in the thylakoid1010

membranes Mol Microbiol 96 448-4621011

Sandstroumlm S Park Y-I Oumlquist G and Gustafsson P (2001) CP43prime the isiA Gene 1012

Product Functions as an Excitation Energy Dissipator in the Cyanobacterium 1013

Synechococcus sp PCC 7942 Photochem Photobiol 74 431-437 1014

Schindelin J Arganda-Carreras I Frise E Kaynig V Longair M Pietzsch T 1015

Preibisch S Rueden C Saalfeld S Schmid B Tinevez J-Y White DJ 1016

Hartenstein V Eliceiri K Tomancak P and Cardona A (2012) Fiji an open-1017

source platform for biological-image analysis Nat Methods 9 676-682 1018

Schottkowski M Ratke J Oster U Nowaczyk M and Nickelsen J (2009a) Pitt a novel 1019

tetratricopeptide repeat protein involved in light-dependent chlorophyll biosynthesis 1020

and thylakoid membrane biogenesis in Synechocystis sp PCC 6803 Mol Plant 2 1021

1289-1297 1022

Schottkowski M Gkalympoudis S Tzekova N Stelljes C Schuumlnemann D Ankele E 1023

and Nickelsen J (2009b) Interaction of the periplasmic PratA factor and the PsbA 1024

(D1) protein during biogenesis of photosystem II in Synechocystis sp PCC 6803 J 1025

Biol Chem 284 1813-1819 1026

Selatildeo TT Zhang L Knoppovaaacute J Komenda J and Norling B (2016) Photosystem II 1027

Assembly Steps Take Place in the Thylakoid Membrane of the Cyanobacterium 1028

Synechocystis sp PCC6803 Plant Cell Physiol 57 878 1029

32

Spaumlt P Maček B and Forchhammer K (2015) Phosphoproteome of the cyanobacterium 1030

Synechocystis sp PCC 6803 and its dynamics during nitrogen starvation Front 1031

Microbiol 6 248 1032

Stengel A Guumlgel IL Hilger D Rengstl B Jung H and Nickelsen J (2012) Initial 1033

steps of photosystem II de novo assembly and preloading with manganese take place 1034

in biogenesis centers in Synechocystis Plant Cell 24 660-675 1035

Uniacke J and Zerges W (2007) Photosystem II assembly and repair are differentially 1036

localized in Chlamydomonas Plant Cell 19 3640-3654 1037

Uniacke J and Zerges W (2009) Chloroplast protein targeting involves localized 1038

translation in Chlamydomonas Proc Natl Acad Sci USA 106 1439-1444 1039

van de Meene AL Hohmann-Marriott M Vermaas WJ and Roberson R (2006) The 1040

three-dimensional structure of the cyanobacterium Synechocystis sp PCC 6803 Arch 1041

Microbiol 184 259-270 1042

van de Meene AML Sharp WP McDaniel JH Friedrich H Vermaas WFJ and 1043

Roberson RW (2012) Gross morphological changes in thylakoid membrane 1044

structure are associated with photosystem I deletion in Synechocystis sp PCC 6803 1045

Biochim Biophys Acta 1818 1427-1434 1046

Watanabe M and Ikeuchi M (2013) Phycobilisome architecture of a light-harvesting 1047

supercomplex Photosynth Res 116 265-276 1048

Wellburn AR and Lichtenthaler H (1984) Formulae and Program to Determine Total 1049

Carotenoids and Chlorophylls A and B of Leaf Extracts in Different Solvents In 1050

Advances in Photosynthesis Research Proceedings of the VIth International Congress 1051

on Photosynthesis Brussels Belgium August 1ndash6 1983 C Sybesma ed (Dordrecht 1052

Springer Netherlands) pp 9-12 1053

Wilde A Lunser K Ossenbuumlhl F Nickelsen J and Borner T (2001) Characterization of 1054

the cyanobacterial ycf37 mutation decreases the photosystem I content Biochem J 1055

357 211-216 1056

Wilson A Boulay C Wilde A Kerfeld CA and Kirilovsky D (2007) Light-Induced 1057

Energy Dissipation in Iron-Starved Cyanobacteria Roles of OCP and IsiA Proteins 1058

Plant Cell 19 656-672 1059

Xu M Bernaacutet G Singh A Mi H Roumlgner M Pakrasi HB and Ogawa T (2008) 1060

Properties of Mutants of Synechocystis sp Strain PCC 6803 Lacking Inorganic Carbon 1061

Sequestration Systems Plant Cell Physiol 49 1672-1677 1062

33

Yamamoto T Burke J Autz G and Jagendorf AT (1981) Bound ribosomes of Pea 1063

chloroplast thylakoid membranes location and release in vitro by high salt 1064

puromycin and RNase Plant Physiol 67 940-949 1065

Yang H Liao L Bo T Zhao L Sun X Lu X Norling B and Huang F (2014) 1066

Slr0151 in Synechocystis sp PCC 6803 is required for efficient repair of photosystem 1067

II under high-light condition J Integr Plant Biol 56 1136-1150 1068

Yeremenko N Kouřil R Ihalainen JA DHaene S van Oosterwijk N 1069

Andrizhiyevskaya EG Keegstra W Dekker HL Hagemann M Boekema EJ 1070

Matthijs HCP and Dekker JP (2004) Supramolecular Organization and Dual 1071

Function of the IsiA Chlorophyll-Binding Protein in Cyanobacteria Biochemistry 43 1072

10308-10313 1073

Zak E Norling B Maitra R Huang F Andersson B and Pakrasi HB (2001) The 1074

initial steps of biogenesis of cyanobacterial photosystems occur in plasma membranes 1075

Proc Natl Acad Sci USA 98 13443-13448 1076

Zang X Liu B Liu S Arunakumara KKIU and Zhang X (2007) Optimum 1077

Conditions for Transformation of Synechocystis sp PCC 6803 J Microbiol 45 241-1078

245 1079

Zhang L and Sakamoto W (2015) Possible function of VIPP1 in maintaining chloroplast 1080

membranes Biochim Biophys Acta 1847 831-837 1081

Zimmerberg J and Kozlov MM (2006) How proteins produce cellular membrane 1082

curvature Nat Rev Mol Cell Biol 7 9-19 1083

Zoumlfel P (1988) Statistik in der Praxis (Stuttgart Germany Gustav Fischer Verlag) 1084

1085

34

Figure Legends 1086

Figure 1 General characteristics of CurT A) Sequence alignment of CurT and CURT1A-D 1087

from A thaliana Predicted chloroplast transit-peptide sequences of CURT1A-D are omitted 1088

(Armbruster et al 2013) Positions of predicted C-terminal transmembrane domains (TDM) 1089

are marked (black bar) as is the position of the predicted amphipathic N-terminal helix in 1090

CurT (red bar) The green bar denotes the peptide sequence used for antibody production 1091

Identical and related amino acids that are conserved in 100 80 and 60 of the sequences 1092

are highlighted in black dark grey and light grey respectively B) Helical-wheel 1093

representation of the N-terminal amphipathic helix of CurT (red bar in A) The color code 1094

reflects the physicochemical properties of amino-acid side-chains green polar and 1095

uncharged blue polar and positively charged red polar and negatively charged yellow 1096

hydrophobic C) Solubility of CurT Membrane-associated proteins (50 microg) from wild-type 1097

cells were extracted with 5 mM HEPES (pH 76) containing either 1 M NaCl 01 M Na2CO3 1098

4 M urea 01 Triton X-100 or no additional solute After separation of membrane-bound 1099

(M) and solubilized (S) proteins by centrifugation proteins were fractionated by SDS-PAGE1100

and CurT was immunodetected on immunoblots As a control the integral membrane protein 1101

CP47 from PSII was analyzed in parallel D) Transmission electron micrographs of negatively 1102

stained liposomes Cell-free expression (CFE) of CurT and A thaliana CURT1A was 1103

performed in the presence of liposomes similar in composition to the lipids of the thylakoid 1104

membrane Liposomes before and after cell-free protein expression in the absence of DNA 1105

served as negative controls Black arrowheads indicate tubular connections between 1106

liposomes Scale bars 250 nm 1107

1108

Figure 2 Ultrastructural analysis of curT- cells Transmission electron micrographs of typical 1109

wild-type (A) and curT- (B-D) Synechocystis 6803 cells taken at 44000times (A B) and 28000times 1110

(C D) magnification respectively Ultrathin sections (35 to 45 nm) of cryofixed samples 1111

were stained with osmium tetroxide and post-stained using lead citrate Arrowheads indicate 1112

biogenesis centers Scale bars 200 nm (A B) and 500 nm (C D) respectively 1113

1114

Figure 3 Accumulation of components of photosynthetic complexes in the curT- mutant A) 1115

Whole cell extracts (30 microg protein) from wild-type and curT- strains were fractionated by 1116

SDS-PAGE and analyzed on immunoblots using the indicated antibodies B) The histogram 1117

shows levels of the indicated proteins in curT- extracts relative to wild-type samples (dashed 1118

red line) Data are means plusmn SD of three independent experiments Significant differences from 1119

35

wild-type protein levels according to Studentrsquos t-test with error probabilities of 5 and 1 1120

are indicated by and respectively 1121

1122

Figure 4 P700+ reduction kinetics and high-light effects in curT- cells A) Averaged traces 1123

(10 single measurements) of P700+ decay after complete oxidation by a 50-ms multiple 1124

turnover pulse (10000 micromol photons m-2 s-1) in the absence and presence of 10 microM DCMU 1125

B) Rate constants for P700+ reduction were obtained by fitting of the data with single1126

exponential functions Error bars indicate the SD of three independent measurements C) 1127

Impact of light intensity on the (relative) electron transport rate (rETR) Cells were exposed to 1128

gradually increasing light intensities which resulted in increasing electron transport until the 1129

capacity limit was reached PAR light intensity (micromol photons m-2 s-1) Error bars indicate the 1130

SD of three independent measurements D) D1 protein level in wild-type and curT- after high-1131

light treatment (800 micromol photons m-2s-1) in the presence and absence of lincomycin Samples 1132

were taken every 30 min and processed as in Figure 3 to determine the level of D1 present 1133

100 refers to wild-type D1 level at the beginning of the experiment 1134

1135

Figure 5 PSII assembly in curT- cells A) BNSDS-PAGE of membrane proteins Membrane 1136

fractions from wild-type and curT- cells were solubilized with 13 n-dodecyl-β-maltoside 1137

and proteins were fractionated by two-dimensional BNSDS-PAGE blotted and probed with 1138

antibodies against the PSII subunits D1 D2 CP47 and CP43 Wild-type blots were also 1139

probed with the αCurT antibody The sizes of marker proteins and the positions of PSII 1140

assembly intermediates (RCCII RCCI RC47) are shown above and below each image B) In 1141

vivo pulse labeling of membrane proteins with 35S Pulse-labeled PSII core proteins were 1142

separated via BNSDS-PAGE and visualized by autoradiography 1143

1144

Figure 6 Loss of CurT induces stress A) Low-temperature (77 K) fluorescence emission of 1145

Synechocystis 6803 wild-type (blue) and curT- (red) cells excited at 440 nm The spectra were 1146

normalized to the added fluorescein standard B) Low-temperature (77 K) fluorescence 1147

emission of Synechocystis 6803 wild-type (blue) and curT- (red) excited at 580 nm The 1148

spectra were normalized to 780 nm C) Level of IsiA in the curT- mutant relative to the wild-1149

type A mean value of 368 plusmn 96 (SD) was determined from three independent experiments 1150

1151

Figure 7 Membrane sublocalization of PSII-related factors Cell extracts from wild-type and 1152

curT- cells were fractionated by two consecutive rounds of sucrose-density gradient 1153

36

centrifugation (Schottkowski et al 2009b) The second linear gradient (20-60 sucrose) was 1154

apportioned into 14 fractions which were analyzed by immunoblotting using the indicated 1155

antibodies Fractions 1ndash6 represent PDMs and fractions 7ndash14 thylakoid membranes (TMs) 1156

To facilitate comparison between gradients sample volumes were normalized to the volume 1157

of fraction 7 that contained 40 microg of protein 1158

1159

Figure 8 Live-cell imaging of the curT-CFP strain by fluorescence microscopy In the curT-1160

CFP strain the native curT gene has been replaced by a CFP-tagged version resulting in the 1161

expression of the CurT-CFP fusion protein under the control of the native promotor A) 1162

Close-up views of the mid-cell plane in the CFP and far-red autofluorescence channels shown 1163

in slice 7 in panel B B) Synechocystis 6803 cells expressing CurT C-terminally fused to the 1164

mTurquoise2 variant of CFP from its native chromosomal promoter The two imaging 1165

channels are displayed as Z-axis montages (auto-scaled contrast step size 250 nm) in 1166

grayscale and color composite configuration The thylakoid autofluorescent channel as 1167

imaged in far-red fluorescence is depicted in magenta and CurT signal as imaged in cyan 1168

fluorescence is depicted in cyan C) Fluorescence intensity profiles of the two channels along 1169

the autofluorescent peripheral cell ldquoringrdquo are shown for slice 7 The maximum projection of 1170

the entire Z montage is also shown Scale bars (light grey) 2 microm 1171

1172

Figure 9 Immunofluorescence detection of CurT A) Close-ups of slice 5 in panel B B) 1173

Wild-type Synechocystis 6803 cells labeled with αCurT antibodies and detected with Oregon 1174

Green-conjugated secondary antibodies The Z-axis montages are shown as in Figure 8B 1175

except that the step size is 280 nm (1 to 10) C) Intensity profiles of the two channels along 1176

the autofluorescent peripheral cell ldquoringrdquo are shown for slice 5 The maximum projection of 1177

the entire Z montage is also shown Scale bars (light grey) 2 microm 1178

1179

Figure 10 Subcellular localization of CurT Ultrathin sections of wild-type Synechocystis 1180

6803 cells were incubated with rabbit αCurT prior to incubation with gold-conjugated goat 1181

anti-rabbit IgG A) Negative control (wild-type processed without addition of primary 1182

antibody) B C) Immunogold-labeled sections showing CurT localization at the cytoplasmic 1183

side of the thylakoid membrane D) Cluster formation of CurT signals at a putative biogenesis 1184

center from C E) Biogenesis center from the same cell (C) without any obvious CurT 1185

clustering of gold particles F) Schematic depiction of a wild-type cell (from Figure 2A) with 1186

color-coded curved membranes green = thylakoids that follow the curvature of the cell red = 1187

37

thylakoids that bend away from the plasma membrane yellow = thylakoids that bend toward 1188

the plasma membrane to converge on sites of biogenesis centers G) Relative distribution of 1189

gold signals between convex (dark color) and concave (light color) sides of membranes (n = 1190

1584 signals from a total of 95 cells) The undifferentiated overall signal distribution is given 1191

in blue Bars = 200 nm (overview) and 100 nm (details) 1192

1193

Figure 11 Differentially modified forms of CurT are found in different complexes in PDMs 1194

and thylakoid membranes Samples were isolated by fractionation of wild-type membranes 1195

via two consecutive sucrose density gradients according to Schottkowski et al (2009b) After 1196

density centrifugation samples were applied to BNSDS-PAGE analysis (A) or isoelectric 1197

focusing (B) Numbers on the right indicate the respective fraction from the second gradient 1198

(see Figure 7) Fraction 5 represents the PDMs and fraction 9 the thylakoid membrane 1199

1200

Figure 12 Loss of CurT increases sensitivity to abiotic stress A B) Doubling times of wild-1201

type and curT- under salt stress (A) or osmotic stress (B) Doubling times are means plusmn SD of 1202

three independent cultures C) Localization of CurT-CFP under salt and osmotic stress 1203

Samples were examined as described in Figure 8 Scale bars 1 microm D) Protein levels of wild-1204

type cells after growth in BG11 medium containing 500 mM NaCl Samples were analyzed on 1205

the same gel but unrelated samples between the presented signals were omitted E) 1206

Membrane preparations obtained from wild-type cells wild-type cells grown in the presence 1207

of 500 mM NaCl and curT- cells were subjected to the first gradient step in the membrane 1208

fractionation scheme The gradient was divided into five fractions and 10 of fractions I-IV 1209

and 02 of fraction V were analyzed by SDS-PAGE Fraction II includes the plasma 1210

membrane and fraction V consists of PratA-defined membrane and thylakoid membrane 1211

1212

Figure 13 Model of CurT distribution at convergence zones in Synechocystis 6803 The 1213

distribution of CurT in thylakoid (green) and plasma membranes (brown) is shown The 1214

pattern of localization of CurT in the thylakoid membrane is derived from membrane 1215

fractionation via sucrose density centrifugation fluorescence-based detection of the CurT-1216

CFP fusion and endogenous CurT and immunogold labeling experiments (Figures 7-10) The 1217

different CurT variants a b c and d identified in the IEF experiments (Figure 11) are depicted 1218

in yellow pink blue and black respectively CurT present in the plasma membrane is 1219

highlighted in gray as its precise nature and role remain to be defined (Figure 12) 1220

Membranes are represented as lipid bilayers Convex and concave faces of bent thylakoid 1221

38

sheets are indicated by black arrows The PDM which is dedicated to PSII assembly and 1222

repair is depicted in blue The dotted blue line emphasizes that the ultrastructure in this region 1223

has not yet been fully resolved PP periplasm PM plasma membrane TM thylakoid 1224

membrane L lumen PDM PratA-defined membrane 1225

1226

Tables 1227

Table 1 Physiological characteristics of the curT- mutant 1228

Strain Doubling time [h]

Oxygen Evolution[nmol h-1 OD750

-1]c

Chlorophyll content

[microg OD750-1]

d

Cell size [microm]e

Cell number [ml-1 OD750

-1]f

Wild type 817plusmn017a 1600plusmn042

b 1933plusmn187 251plusmn014 264plusmn020 390plusmn006 x 107

curT- 1259plusmn020a 3226plusmn056

b 1074plusmn20 195plusmn029 274plusmn044 367plusmn016 x 107

1229 abDoubling times in the presence (a) or absence (b) of 5 mM glucose measured under 1230

continuous illumination at 30 micromol photons m-2 s-1 and CO2-limiting conditions cOxygen 1231

evolution is expressed in nmol O2 produced per hour per OD750 unit dChlorophyll content is 1232

expressed in microg OD750-1 eThe diameter of non-dividing cells is presented in microm fCell number 1233

was determined per ml per OD750 Data are means plusmn SD of at least three independent 1234

experiments 1235

1236

Parsed CitationsAllen JF de Paula WBM Puthiyaveetil S and Nield J (2011) A structural phylogenetic map for chloroplast photosynthesisTrends Plant Sci 16 645-655

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Anderson JM Horton P Kim E-H and Chow WS (2012) Towards elucidation of dynamic structural changes of plant thylakoidarchitecture Philos Trans R Soc Lond B Biol Sci 367 3515-3524

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Armbruster U Zuumlhlke J Rengstl B Kreller R Makarenko E Ruumlhle T Schuumlnemann D Jahns P Weisshaar B NickelsenJ and Leister D (2010) The Arabidopsis thylakoid protein PAM68 is required for efficient D1 biogenesis and photosystem IIassembly Plant Cell 22 3439-3460

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Armbruster U Labs M Pribil M Viola S Xu W Scharfenberg M Hertle AP Rojahn U Jensen PE Rappaport F JoliotP Doumlrmann P Wanner G and Leister D (2013) Arabidopsis CURVATURE THYLAKOID1 proteins modify thylakoid architectureby inducing membrane curvature Plant Cell 25 2661-2678

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Aseeva E Ossenbuumlhl F Sippel C Cho WK Stein B Eichacker LA Meurer J Wanner G Westhoff P Soll J andVothknecht UC (2007) Vipp1 is required for basic thylakoid membrane formation but not for the assembly of thylakoid proteincomplexes Plant Physiol Biochem 45 119-128

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Bartsevich VV and Pakrasi HB (1995) Molecular identification of an ABC transporter complex for manganese analysis of acyanobacterial mutant strain impaired in the photosynthetic oxygen evolution process EMBO J 14 1845-1853

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Bartsevich VV and Pakrasi HB (1996) Manganese transport in the cyanobacterium Synechocystis sp PCC 6803 J Biol Chem271 26057-26061

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Bernaacutet G Waschewski N and Roumlgner M (2009) Towards efficient hydrogen production the impact of antenna size andexternal factors on electron transport dynamics in Synechocystis PCC 6803 Photosynth Res 99 205-216

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Boehm M Yu J Krynicka V Barker M Tichy M Komenda J Nixon PJ and Nield J (2012) Subunit Organization of aSynechocystis Hetero-Oligomeric Thylakoid FtsH Complex Involved in Photosystem II Repair Plant Cell 24 3669-3683

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Bradford MM (1976) A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle ofprotein-dye binding Anal Biochem 72 248-254

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Chang L Liu X Li Y Liu C-C Yang F Zhao J and Sui S-F (2015) Structural organization of an intact phycobilisome and itsassociation with photosystem II Cell Res 25 726-737

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Danielsson R Suorsa M Paakkarinen V Albertsson P-Aring Styring S Aro E-M and Mamedov F (2006) Dimeric andmonomeric organization of photosystem II Distribution of five distinct complexes in the different domains of the thylakoidmembrane J Biol Chem 281 14241-14249

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Daum B Nicastro D Austin J McIntosh JR and Kuumlhlbrandt W (2010) Arrangement of photosystem II and ATP synthase in

23

region the signals on the convex and concave sides of the thylakoid membrane were analyzed 751

separately (see Supplemental Figure 11 for representative counts) Statistical significance was 752

assessed by χ2 test (Zoumlfel 1988) 753

For the analysis of clusters of CurT signals in biogenesis centers a cluster was defined 754

as a minimum of four signals in close proximity Overall 219 biogenesis centers were 755

examined with regard to CurT cluster formation 756

757

Preparation of proteoliposomes 758

Liposomes with a lipid mixture of 25 monogalactosyl diacylglycerol 42 759

digalactosyl diacylglycerol 16 sulfoquinovosyl diacylglycerol and 17 760

phosphatidylglycerol (Lipid Products South Nutfield UK) were prepared as described 761

previously (Armbruster et al 2013) To generate proteoliposomes CurT and CURT1A 762

proteins were expressed in the presence of liposomes for 3 h at 37degC using a PURExpress In 763

Vitro Protein Synthesis Kit (New England Biolabs Ipswich MA USA) The liposomes were 764

separated from the mix by centrifugation in a discontinuous sucrose gradient (100000 g 18 765

h) Subsequently the fraction containing the liposomes was extracted and dialyzed against 20 766

mM HEPES (pH 76) For transmission electron microscopy the proteoliposomes were 767

negatively stained with 1 uranyl acetate on a carbon-coated copper grid Micrographs were 768

taken on a Fei Morgagni 268 TEM at 80 kV 769

770

curT-CFP strain generation 771

Gibson assembly was used for single-step cloning (Gibson 2011) of the slr0483 gene 772

(together with its ~08 kb upstream region) the mTurquoise2 gene fragment the gentamycin-773

resistance cassette (aacC1) and an ~17-kb downstream region of slr0483 into pBR322 774

cleaved with EcoRV and NheI The slr0483 gene was fused in frame to the codon-optimized 775

mTurquoise2 (DNA20) preceded by a linker sequence encoding GSGSG The resulting 776

plasmid was used to transform Synechocystis 6803 as described previously (Zang et al 2007) 777

After ~ 10 days of incubation on BG11-GelRite (15 ) medium in the presence of 2 microgml 778

gentamycin several antibiotic resistant colonies were obtained and streaked out on fresh 779

medium These transformants were then tested for full segregation of the tagged allele by 780

colony PCR with primers flanking the slr0483 gene 781

782

Fluorescence microscopy 783

24

An aliquot of a cell suspension in mid-log phase was placed under a BG11-agarose 784

pad on a glass coverslip (15) and imaged on an inverted microscope (Zeiss 785

AxioObserverZ1) equipped with an ORCA Flash40 V2 (Hamamatsu) camera a Lumenecor 786

SOLA II Light Engine and a Plan-Apochromat 63x140 Oil DIC M27 (NA 14) objective 787

(Zeiss) Image acquisition was done with Zen 21 software in cyan and far-red fluorescence 788

channels (Zeiss Filter Sets 47 HE and 50) as Z-series with a step size of 250 nm and effective 789

pixel size of 103 nm Acquired image files were subsequently deconvolved (Constrained 790

Iterative Method) using a default theoretical Point Spread Function in Zen 20 (Zeiss) 791

Extraction of intensities for line profiles was performed by image thresholding the thylakoid 792

autofluorescence channel and eroding the resulting binary mask in Fiji (Schindelin et al 793

2012) 794

For immunofluorescence analysis cells were grown to mid-log phase as in the case of 795

the cells prepared for live-cell microscopy A 10-ml culture was fixed for 20 min in 37 796

formaldehyde and following extensive washing with phosphate-buffered saline (PBS) cells 797

were first permeabilized in 005 Triton-X for 20 min and then in lysis buffer (50 mM Tris-798

HCl 100 mM NaCl 5 mgml lysozyme) at 37degC for 2 h with gentle shaking To block 799

unspecific binding sites the cell pellet was incubated in 5 bovine serum albumin in PBS at 800

30degC for 1 h The αCurT serum (1500 dilution) was added to cells in fresh blocking buffer 801

for 1 h at 30degC with gentle shaking Cells were then washed three times with blocking buffer 802

and incubated with goat anti-rabbit IgG secondary antibodies conjugated to Oregon Green 488 803

(Invitrogen) (11000 dilution) under the conditions as for the primary antibodies Cells were 804

washed three times with PBS and prepared for microscopy as above Imaging was done as 805

described for live-cell microscopy except that a Colibri2 LED light source was employed for 806

illumination and a CoolSnap HQ camera (Photometrics) was used for image acquisition Cells 807

were imaged as Z-series (step size 280 nm) in the yellow and far-red fluorescent channels 808

(Zeiss Filter Sets 46 HE and 50) using the 505 nm and 625 nm LED modules Effective pixel 809

size in the final image was 102 nm Deconvolution and image analysis was done as described 810

above As judged by the staining intensity of the Oregon Green-conjugated antibodies 811

approximately half of the cells in any given field of view appeared to have been successfully 812

permeabilised a rate that is common in our experience No significant signal was detected in 813

the control sample that had not been exposed to the primary antibodies 814

815

25

Accession numbers 816

Sequence data from this article can be found in the CyanoBase and EMBLGenBank 817

data libraries under accession number slr0483 818

819

Supplemental Data 820

Supplemental Figure 1 Construction of the curT- mutant 821

Supplemental Figure 2 Growth phenotype of curT- 822

Supplemental Figure 3 Expression analysis of the open reading frame slr0482 (located 823

upstream of curT) in the curT- strain 824

Supplemental Figure 4 Absorbance spectra of curT- and wild-type cells 825

Supplemental Figure 5 High-light growth phenotypes of wild-type Synechocystis 6803 and 826

the curT- strain 827

Supplemental Figure 6 Ultrastructure of the TD41 mutant which lacks the psbA transcript 828

and the D1 protein 829

Supplemental Figure 7 Expression and localization of CurT-CFP 830

Supplemental Figure 8 Localization of CurT and CurT-CFP by fluorescence microscopy 831

Supplemental Figure 9 Chlorophyll autofluorescence of curT- 832

Supplemental Figure 10 The curT- mutant as a negative control for immunogold labeling 833

Supplemental Figure 11 Representative counts of immunogold signals 834

Supplemental Table 1 Overview of immunogold signals in curT- cells 835

Supplemental Table 2 Overview of immunogold signals in specific regions of Synechocystis 836

6803 wild-type cells 837

Supplemental Table 3 Statistical analysis of immunogold signals for wild-type 838

Synechocystis 6803 cells 839

Supplemental Table 4 Co-expression of curT 840

Supplemental Movie 1 Scan through the Z-axis of a curT-CFP cell 841

Supplemental Movie 2 Rendered 3D-model of a CurT-CFP detection 842

Supplemental Movie 3 Scan through the Z-axis of a curT-CFP cell with a traversing 843

thylakoid lamella 844

845

Acknowledgements 846

We thank Y Nishiyama for providing αpD1 and J Soll for αVIPP1 and αYidC antibodies 847

respectively and Nina Dyczmons-Nowaczyk for support with the fluorescence measurements 848

This work was supported by grants awarded to JN (Ni3909) MMN (NO 8363) and DL 849

26

(Le126529) by the Deutsche Forschungsgemeinschaft in the context of Research Unit 850

FOR2092 and the Cluster of Excellence RESOLV (EXC 1069) AG is a Howard Hughes 851

Medical Institute postdoctoral fellow in the laboratory of Erin OrsquoShea at Harvard University 852

LS was supported by a PhD fellowship from the Chinese Scholarship Council 853

854

Author Contributions 855

SH AR LS MMN DL and JN designed the research SH AR LS AG ILG EH ML BR 856

SV performed the research all authors contributed to data analysis SH AR and JN wrote the 857

paper 858

859

Competing Financial Interest statement 860

The authors declare no competing financial interests 861

862

We wish to dedicate this paper to Fabrice Rappaport an outstanding colleague and friend who 863

passed away so early 864

865

27

References 866

Allen JF de Paula WBM Puthiyaveetil S and Nield J (2011) A structural 867

phylogenetic map for chloroplast photosynthesis Trends Plant Sci 16 645-655 868

Anderson JM Horton P Kim E-H and Chow WS (2012) Towards elucidation of 869

dynamic structural changes of plant thylakoid architecture Philos Trans R Soc 870

Lond B Biol Sci 367 3515-3524 871

Armbruster U Zuumlhlke J Rengstl B Kreller R Makarenko E Ruumlhle T Schuumlnemann 872

D Jahns P Weisshaar B Nickelsen J and Leister D (2010) The Arabidopsis 873

thylakoid protein PAM68 is required for efficient D1 biogenesis and photosystem II 874

assembly Plant Cell 22 3439-3460 875

Armbruster U Labs M Pribil M Viola S Xu W Scharfenberg M Hertle AP 876

Rojahn U Jensen PE Rappaport F Joliot P Doumlrmann P Wanner G and 877

Leister D (2013) Arabidopsis CURVATURE THYLAKOID1 proteins modify 878

thylakoid architecture by inducing membrane curvature Plant Cell 25 2661-2678 879

Aseeva E Ossenbuumlhl F Sippel C Cho WK Stein B Eichacker LA Meurer J 880

Wanner G Westhoff P Soll J and Vothknecht UC (2007) Vipp1 is required for 881

basic thylakoid membrane formation but not for the assembly of thylakoid protein 882

complexes Plant Physiol Biochem 45 119-128 883

Bartsevich VV and Pakrasi HB (1995) Molecular identification of an ABC transporter 884

complex for manganese analysis of a cyanobacterial mutant strain impaired in the 885

photosynthetic oxygen evolution process EMBO J 14 1845-1853 886

Bartsevich VV and Pakrasi HB (1996) Manganese transport in the cyanobacterium 887

Synechocystis sp PCC 6803 J Biol Chem 271 26057-26061 888

Bernaacutet G Waschewski N and Roumlgner M (2009) Towards efficient hydrogen production 889

the impact of antenna size and external factors on electron transport dynamics in 890

Synechocystis PCC 6803 Photosynth Res 99 205-216 891

Boehm M Yu J Krynicka V Barker M Tichy M Komenda J Nixon PJ and Nield 892

J (2012) Subunit Organization of a Synechocystis Hetero-Oligomeric Thylakoid FtsH893

Complex Involved in Photosystem II Repair Plant Cell 24 3669-3683894

Bradford MM (1976) A rapid and sensitive method for the quantitation of microgram 895

quantities of protein utilizing the principle of protein-dye binding Anal Biochem 72 896

248-254897

28

Chang L Liu X Li Y Liu C-C Yang F Zhao J and Sui S-F (2015) Structural 898

organization of an intact phycobilisome and its association with photosystem II Cell 899

Res 25 726-737 900

Danielsson R Suorsa M Paakkarinen V Albertsson P-Aring Styring S Aro E-M and 901

Mamedov F (2006) Dimeric and monomeric organization of photosystem II 902

Distribution of five distinct complexes in the different domains of the thylakoid 903

membrane J Biol Chem 281 14241-14249 904

Daum B Nicastro D Austin J McIntosh JR and Kuumlhlbrandt W (2010) Arrangement 905

of photosystem II and ATP synthase in chloroplast membranes of Spinach and Pea 906

Plant Cell 22 1299-1312 907

Engel BD Schaffer M Kuhn Cuellar L Villa E Plitzko JM and Baumeister W 908

(2015) Native architecture of the Chlamydomonas chloroplast revealed by in situ 909

cryo-electron tomography eLife 4 e04889 910

Ford MGJ Mills IG Peter BJ Vallis Y Praefcke GJK Evans PR and McMahon 911

HT (2002) Curvature of clathrin-coated pits driven by epsin Nature 419 361-366 912

Fristedt R Willig A Granath P Cregravevecoeur M Rochaix J-D and Vener AV (2009) 913

Phosphorylation of photosystem II controls functional macroscopic folding of 914

photosynthetic membranes in Arabidopsis Plant Cell 21 3950-3964 915

Gallop JL and McMahon HT (2005) BAR domains and membrane curvature bringing 916

your curves to the BAR Biochem Soc Symp 72 223-231 917

Gibson DG (2011) Chapter fifteen - Enzymatic Assembly of Overlapping DNA Fragments 918

In Methods in Enzymology V Christopher ed (Academic Press) pp 349-361 919

Goedhart J von Stetten D Noirclerc-Savoye M Lelimousin M Joosen L Hink MA 920

van Weeren L Gadella TWJ and Royant A (2012) Structure-guided evolution of 921

cyan fluorescent proteins towards a quantum yield of 93 Nat Commun 3 751 922

Heinz S Liauw P Nickelsen J and Nowaczyk M (2016) Analysis of photosystem II 923

biogenesis in cyanobacteria Biochim Biophys Acta 1857 274-287 924

Hernaacutendez-Prieto M and Futschik M (2012) CyanoEXpress A web database for 925

exploration and visualisation of the integrated transcriptome of cyanobacterium 926

Synechocystis sp PCC6803 Bioinformation 8 634-638 927

Hernaacutendez-Prieto MA Semeniuk TA Giner-Lamia J and Futschik ME (2016) The 928

Transcriptional Landscape of the Photosynthetic Model Cyanobacterium 929

Synechocystis sp PCC6803 Sci Rep 6 22168 930

29

Huang F Fulda S Hagemann M and Norling B (2006) Proteomic screening of salt-931

stress-induced changes in plasma membranes of Synechocystis sp strain PCC 6803 932

Proteomics 6 910-920 933

Kirchhoff H (2013) Architectural switches in plant thylakoid membranes Photosynth Res 934

116 481-487 935

Klinkert B Elles I and Nickelsen J (2006) Translation of chloroplast psbD mRNA in 936

Chlamydomonas is controlled by a secondary RNA structure blocking the AUG start 937

codon Nucleic Acids Res 34 386-394 938

Klinkert B Ossenbuumlhl F Sikorski M Berry S Eichacker L and Nickelsen J (2004) 939

PratA a periplasmic tetratricopeptide repeat protein involved in biogenesis of 940

photosystem II in Synechocystis sp PCC 6803 J Biol Chem 279 44639-44644 941

Komenda J Nickelsen J Tichyacute M Praacutešil O Eichacker LA and Nixon PJ (2008) The 942

cyanobacterial homologue of HCF136YCF48 is a component of an early photosystem 943

II assembly complex and is important for both the efficient assembly and repair of 944

photosystem II in Synechocystis sp PCC 6803 J Biol Chem 283 22390-22399 945

Kopf M Klaumlhn S Scholz I Matthiessen JKF Hess WR and Voszlig B (2014) 946

Comparative analysis of the primary transcriptome of Synechocystis sp PCC 6803 947

DNA Res 21 527-539 948

Kunkel DD (1982) Thylakoid centers Structures associated with the cyanobacterial 949

photosynthetic membrane system Arch Microbiol 133 97-99 950

Liberton M Howard Berg R Heuser J Roth R and Pakrasi BH (2006) Ultrastructure 951

of the membrane systems in the unicellular cyanobacterium Synechocystis sp strain 952

PCC 6803 Protoplasma 227 129-138 953

Liberton M Saha R Jacobs JM Nguyen AY Gritsenko MA Smith RD 954

Koppenaal DW and Pakrasi HB (2016) Global Proteomic Analysis Reveals an 955

Exclusive Role of Thylakoid Membranes in Bioenergetics of a Model 956

Cyanobacterium Mol Cell Proteomics 15 2021-2032 957

Luque I and Ochoa de Alda JAG (2014) CURT1CAAD-containing aaRSs thylakoid 958

curvature and gene translation Trends Plant Sci 19 63-66 959

Marin K Stirnberg M Eisenhut M Kraumlmer R and Hagemann M (2006) Osmotic stress 960

in Synechocystis sp PCC 6803 low tolerance towards nonionic osmotic stress results 961

from lacking activation of glucosylglycerol accumulation Microbiology 152 2023-962

2030 963

Mullineaux CW (2005) Function and evolution of grana Trends Plant Sci 10 521-525 964

30

Mullineaux CW (2008) Biogenesis and dynamics of thylakoid membranes and the 965

photosynthetic apparatus In The Cyanobacteria A Herrero and E Flores eds 966

(Norfolk UK Caister Academic Press) pp 289ndash304 967

Nevo R Charuvi D Tsabari O and Reich Z (2012) Composition architecture and 968

dynamics of the photosynthetic apparatus in higher plants Plant J 70 157-176 969

Nickelsen J and Rengstl B (2013) Photosystem II assembly From cyanobacteria to plants 970

Annu Rev Plant Biol 64 609-635 971

Nickelsen J and Zerges W (2013) Thylakoid biogenesis has joined the new era of bacterial 972

cell biology Front Plant Sci 4 458 973

Nilsson F Simpson DJ Jansson C and Andersson B (1992) Ultrastructural and 974

biochemical characterization of a Synechocystis 6803 mutant with inactivated psbA 975

genes Arch Biochem Biophys 295 340-347 976

Odom WR Hodges R Chitnis PR and Guikema JA (1993) Characterization of 977

Synechocystis sp PCC 6803 in iron-supplied and iron-deficient media Plant Mol 978

Biol 23 1255-1264 979

Ossenbuumlhl F Inaba-Sulpice M Meurer J Soll J and Eichacker LA (2006) The 980

Synechocystis sp PCC 6803 Oxa1 homolog is essential for membrane integration of 981

reaction center precursor protein pD1 Plant Cell 18 2236-2246 982

Pisareva T Kwon J Oh J Kim S Ge C Wieslander Aring Choi J-S and Norling B 983

(2011) Model for Membrane Organization and Protein Sorting in the Cyanobacterium 984

Synechocystis sp PCC 6803 Inferred from Proteomics and Multivariate Sequence 985

Analyses J Proteome Res 10 3617-3631 986

Pribil M Labs M and Leister D (2014) Structure and dynamics of thylakoids in land 987

plants J Exp Bot 65 1955-1972 988

Rast A Heinz S and Nickelsen J (2015) Biogenesis of thylakoid membranes Biochim 989

Biophys Acta 1847 821-830 990

Rast A Rengstl B Heinz S Klingl A and Nickelsen J (2016) The role of Slr0151 a 991

tetratricopeptide repeat protein from Synechocystis sp PCC 6803 during Photosystem 992

II assembly and repair Front Plant Sci 7 605 993

Rengstl B Oster U Stengel A and Nickelsen J (2011) An Intermediate Membrane 994

Subfraction in Cyanobacteria Is Involved in an Assembly Network for Photosystem II 995

Biogenesis J Biol Chem 286 21944-21951 996

31

Rengstl B Knoppovaacute J Komenda J and Nickelsen J (2013) Characterization of a 997

Synechocystis double mutant lacking the photosystem II assembly factors YCF48 and 998

Sll0933 Planta 237 471-480 999

Rexroth S Mullineaux CW Ellinger D Sendtko E Roumlgner M and Koenig F (2011) 1000

The Plasma Membrane of the Cyanobacterium Gloeobacter violaceus Contains 1001

Segregated Bioenergetic Domains Plant Cell 23 2379-2390 1002

Rippka R Deruelles J Waterbury JB Herdman M and Stanier RY (1979) Generic 1003

Assignments Strain Histories and Properties of Pure Cultures of Cyanobacteria 1004

Microbiology 111 1-61 1005

Ruumltgers M and Schroda M (2013) A role of VIPP1 as a dynamic structure within 1006

thylakoid centers as sites of photosystem biogenesis Plant Signal Behav 8 e27037 1007

Sacharz J Bryan SJ Yu J Burroughs NJ Spence EM Nixon PJ and Mullineaux 1008

CW (2015) Sub-cellular location of FtsH proteases in the cyanobacterium1009

Synechocystis sp PCC 6803 suggests localised PSII repair zones in the thylakoid1010

membranes Mol Microbiol 96 448-4621011

Sandstroumlm S Park Y-I Oumlquist G and Gustafsson P (2001) CP43prime the isiA Gene 1012

Product Functions as an Excitation Energy Dissipator in the Cyanobacterium 1013

Synechococcus sp PCC 7942 Photochem Photobiol 74 431-437 1014

Schindelin J Arganda-Carreras I Frise E Kaynig V Longair M Pietzsch T 1015

Preibisch S Rueden C Saalfeld S Schmid B Tinevez J-Y White DJ 1016

Hartenstein V Eliceiri K Tomancak P and Cardona A (2012) Fiji an open-1017

source platform for biological-image analysis Nat Methods 9 676-682 1018

Schottkowski M Ratke J Oster U Nowaczyk M and Nickelsen J (2009a) Pitt a novel 1019

tetratricopeptide repeat protein involved in light-dependent chlorophyll biosynthesis 1020

and thylakoid membrane biogenesis in Synechocystis sp PCC 6803 Mol Plant 2 1021

1289-1297 1022

Schottkowski M Gkalympoudis S Tzekova N Stelljes C Schuumlnemann D Ankele E 1023

and Nickelsen J (2009b) Interaction of the periplasmic PratA factor and the PsbA 1024

(D1) protein during biogenesis of photosystem II in Synechocystis sp PCC 6803 J 1025

Biol Chem 284 1813-1819 1026

Selatildeo TT Zhang L Knoppovaaacute J Komenda J and Norling B (2016) Photosystem II 1027

Assembly Steps Take Place in the Thylakoid Membrane of the Cyanobacterium 1028

Synechocystis sp PCC6803 Plant Cell Physiol 57 878 1029

32

Spaumlt P Maček B and Forchhammer K (2015) Phosphoproteome of the cyanobacterium 1030

Synechocystis sp PCC 6803 and its dynamics during nitrogen starvation Front 1031

Microbiol 6 248 1032

Stengel A Guumlgel IL Hilger D Rengstl B Jung H and Nickelsen J (2012) Initial 1033

steps of photosystem II de novo assembly and preloading with manganese take place 1034

in biogenesis centers in Synechocystis Plant Cell 24 660-675 1035

Uniacke J and Zerges W (2007) Photosystem II assembly and repair are differentially 1036

localized in Chlamydomonas Plant Cell 19 3640-3654 1037

Uniacke J and Zerges W (2009) Chloroplast protein targeting involves localized 1038

translation in Chlamydomonas Proc Natl Acad Sci USA 106 1439-1444 1039

van de Meene AL Hohmann-Marriott M Vermaas WJ and Roberson R (2006) The 1040

three-dimensional structure of the cyanobacterium Synechocystis sp PCC 6803 Arch 1041

Microbiol 184 259-270 1042

van de Meene AML Sharp WP McDaniel JH Friedrich H Vermaas WFJ and 1043

Roberson RW (2012) Gross morphological changes in thylakoid membrane 1044

structure are associated with photosystem I deletion in Synechocystis sp PCC 6803 1045

Biochim Biophys Acta 1818 1427-1434 1046

Watanabe M and Ikeuchi M (2013) Phycobilisome architecture of a light-harvesting 1047

supercomplex Photosynth Res 116 265-276 1048

Wellburn AR and Lichtenthaler H (1984) Formulae and Program to Determine Total 1049

Carotenoids and Chlorophylls A and B of Leaf Extracts in Different Solvents In 1050

Advances in Photosynthesis Research Proceedings of the VIth International Congress 1051

on Photosynthesis Brussels Belgium August 1ndash6 1983 C Sybesma ed (Dordrecht 1052

Springer Netherlands) pp 9-12 1053

Wilde A Lunser K Ossenbuumlhl F Nickelsen J and Borner T (2001) Characterization of 1054

the cyanobacterial ycf37 mutation decreases the photosystem I content Biochem J 1055

357 211-216 1056

Wilson A Boulay C Wilde A Kerfeld CA and Kirilovsky D (2007) Light-Induced 1057

Energy Dissipation in Iron-Starved Cyanobacteria Roles of OCP and IsiA Proteins 1058

Plant Cell 19 656-672 1059

Xu M Bernaacutet G Singh A Mi H Roumlgner M Pakrasi HB and Ogawa T (2008) 1060

Properties of Mutants of Synechocystis sp Strain PCC 6803 Lacking Inorganic Carbon 1061

Sequestration Systems Plant Cell Physiol 49 1672-1677 1062

33

Yamamoto T Burke J Autz G and Jagendorf AT (1981) Bound ribosomes of Pea 1063

chloroplast thylakoid membranes location and release in vitro by high salt 1064

puromycin and RNase Plant Physiol 67 940-949 1065

Yang H Liao L Bo T Zhao L Sun X Lu X Norling B and Huang F (2014) 1066

Slr0151 in Synechocystis sp PCC 6803 is required for efficient repair of photosystem 1067

II under high-light condition J Integr Plant Biol 56 1136-1150 1068

Yeremenko N Kouřil R Ihalainen JA DHaene S van Oosterwijk N 1069

Andrizhiyevskaya EG Keegstra W Dekker HL Hagemann M Boekema EJ 1070

Matthijs HCP and Dekker JP (2004) Supramolecular Organization and Dual 1071

Function of the IsiA Chlorophyll-Binding Protein in Cyanobacteria Biochemistry 43 1072

10308-10313 1073

Zak E Norling B Maitra R Huang F Andersson B and Pakrasi HB (2001) The 1074

initial steps of biogenesis of cyanobacterial photosystems occur in plasma membranes 1075

Proc Natl Acad Sci USA 98 13443-13448 1076

Zang X Liu B Liu S Arunakumara KKIU and Zhang X (2007) Optimum 1077

Conditions for Transformation of Synechocystis sp PCC 6803 J Microbiol 45 241-1078

245 1079

Zhang L and Sakamoto W (2015) Possible function of VIPP1 in maintaining chloroplast 1080

membranes Biochim Biophys Acta 1847 831-837 1081

Zimmerberg J and Kozlov MM (2006) How proteins produce cellular membrane 1082

curvature Nat Rev Mol Cell Biol 7 9-19 1083

Zoumlfel P (1988) Statistik in der Praxis (Stuttgart Germany Gustav Fischer Verlag) 1084

1085

34

Figure Legends 1086

Figure 1 General characteristics of CurT A) Sequence alignment of CurT and CURT1A-D 1087

from A thaliana Predicted chloroplast transit-peptide sequences of CURT1A-D are omitted 1088

(Armbruster et al 2013) Positions of predicted C-terminal transmembrane domains (TDM) 1089

are marked (black bar) as is the position of the predicted amphipathic N-terminal helix in 1090

CurT (red bar) The green bar denotes the peptide sequence used for antibody production 1091

Identical and related amino acids that are conserved in 100 80 and 60 of the sequences 1092

are highlighted in black dark grey and light grey respectively B) Helical-wheel 1093

representation of the N-terminal amphipathic helix of CurT (red bar in A) The color code 1094

reflects the physicochemical properties of amino-acid side-chains green polar and 1095

uncharged blue polar and positively charged red polar and negatively charged yellow 1096

hydrophobic C) Solubility of CurT Membrane-associated proteins (50 microg) from wild-type 1097

cells were extracted with 5 mM HEPES (pH 76) containing either 1 M NaCl 01 M Na2CO3 1098

4 M urea 01 Triton X-100 or no additional solute After separation of membrane-bound 1099

(M) and solubilized (S) proteins by centrifugation proteins were fractionated by SDS-PAGE1100

and CurT was immunodetected on immunoblots As a control the integral membrane protein 1101

CP47 from PSII was analyzed in parallel D) Transmission electron micrographs of negatively 1102

stained liposomes Cell-free expression (CFE) of CurT and A thaliana CURT1A was 1103

performed in the presence of liposomes similar in composition to the lipids of the thylakoid 1104

membrane Liposomes before and after cell-free protein expression in the absence of DNA 1105

served as negative controls Black arrowheads indicate tubular connections between 1106

liposomes Scale bars 250 nm 1107

1108

Figure 2 Ultrastructural analysis of curT- cells Transmission electron micrographs of typical 1109

wild-type (A) and curT- (B-D) Synechocystis 6803 cells taken at 44000times (A B) and 28000times 1110

(C D) magnification respectively Ultrathin sections (35 to 45 nm) of cryofixed samples 1111

were stained with osmium tetroxide and post-stained using lead citrate Arrowheads indicate 1112

biogenesis centers Scale bars 200 nm (A B) and 500 nm (C D) respectively 1113

1114

Figure 3 Accumulation of components of photosynthetic complexes in the curT- mutant A) 1115

Whole cell extracts (30 microg protein) from wild-type and curT- strains were fractionated by 1116

SDS-PAGE and analyzed on immunoblots using the indicated antibodies B) The histogram 1117

shows levels of the indicated proteins in curT- extracts relative to wild-type samples (dashed 1118

red line) Data are means plusmn SD of three independent experiments Significant differences from 1119

35

wild-type protein levels according to Studentrsquos t-test with error probabilities of 5 and 1 1120

are indicated by and respectively 1121

1122

Figure 4 P700+ reduction kinetics and high-light effects in curT- cells A) Averaged traces 1123

(10 single measurements) of P700+ decay after complete oxidation by a 50-ms multiple 1124

turnover pulse (10000 micromol photons m-2 s-1) in the absence and presence of 10 microM DCMU 1125

B) Rate constants for P700+ reduction were obtained by fitting of the data with single1126

exponential functions Error bars indicate the SD of three independent measurements C) 1127

Impact of light intensity on the (relative) electron transport rate (rETR) Cells were exposed to 1128

gradually increasing light intensities which resulted in increasing electron transport until the 1129

capacity limit was reached PAR light intensity (micromol photons m-2 s-1) Error bars indicate the 1130

SD of three independent measurements D) D1 protein level in wild-type and curT- after high-1131

light treatment (800 micromol photons m-2s-1) in the presence and absence of lincomycin Samples 1132

were taken every 30 min and processed as in Figure 3 to determine the level of D1 present 1133

100 refers to wild-type D1 level at the beginning of the experiment 1134

1135

Figure 5 PSII assembly in curT- cells A) BNSDS-PAGE of membrane proteins Membrane 1136

fractions from wild-type and curT- cells were solubilized with 13 n-dodecyl-β-maltoside 1137

and proteins were fractionated by two-dimensional BNSDS-PAGE blotted and probed with 1138

antibodies against the PSII subunits D1 D2 CP47 and CP43 Wild-type blots were also 1139

probed with the αCurT antibody The sizes of marker proteins and the positions of PSII 1140

assembly intermediates (RCCII RCCI RC47) are shown above and below each image B) In 1141

vivo pulse labeling of membrane proteins with 35S Pulse-labeled PSII core proteins were 1142

separated via BNSDS-PAGE and visualized by autoradiography 1143

1144

Figure 6 Loss of CurT induces stress A) Low-temperature (77 K) fluorescence emission of 1145

Synechocystis 6803 wild-type (blue) and curT- (red) cells excited at 440 nm The spectra were 1146

normalized to the added fluorescein standard B) Low-temperature (77 K) fluorescence 1147

emission of Synechocystis 6803 wild-type (blue) and curT- (red) excited at 580 nm The 1148

spectra were normalized to 780 nm C) Level of IsiA in the curT- mutant relative to the wild-1149

type A mean value of 368 plusmn 96 (SD) was determined from three independent experiments 1150

1151

Figure 7 Membrane sublocalization of PSII-related factors Cell extracts from wild-type and 1152

curT- cells were fractionated by two consecutive rounds of sucrose-density gradient 1153

36

centrifugation (Schottkowski et al 2009b) The second linear gradient (20-60 sucrose) was 1154

apportioned into 14 fractions which were analyzed by immunoblotting using the indicated 1155

antibodies Fractions 1ndash6 represent PDMs and fractions 7ndash14 thylakoid membranes (TMs) 1156

To facilitate comparison between gradients sample volumes were normalized to the volume 1157

of fraction 7 that contained 40 microg of protein 1158

1159

Figure 8 Live-cell imaging of the curT-CFP strain by fluorescence microscopy In the curT-1160

CFP strain the native curT gene has been replaced by a CFP-tagged version resulting in the 1161

expression of the CurT-CFP fusion protein under the control of the native promotor A) 1162

Close-up views of the mid-cell plane in the CFP and far-red autofluorescence channels shown 1163

in slice 7 in panel B B) Synechocystis 6803 cells expressing CurT C-terminally fused to the 1164

mTurquoise2 variant of CFP from its native chromosomal promoter The two imaging 1165

channels are displayed as Z-axis montages (auto-scaled contrast step size 250 nm) in 1166

grayscale and color composite configuration The thylakoid autofluorescent channel as 1167

imaged in far-red fluorescence is depicted in magenta and CurT signal as imaged in cyan 1168

fluorescence is depicted in cyan C) Fluorescence intensity profiles of the two channels along 1169

the autofluorescent peripheral cell ldquoringrdquo are shown for slice 7 The maximum projection of 1170

the entire Z montage is also shown Scale bars (light grey) 2 microm 1171

1172

Figure 9 Immunofluorescence detection of CurT A) Close-ups of slice 5 in panel B B) 1173

Wild-type Synechocystis 6803 cells labeled with αCurT antibodies and detected with Oregon 1174

Green-conjugated secondary antibodies The Z-axis montages are shown as in Figure 8B 1175

except that the step size is 280 nm (1 to 10) C) Intensity profiles of the two channels along 1176

the autofluorescent peripheral cell ldquoringrdquo are shown for slice 5 The maximum projection of 1177

the entire Z montage is also shown Scale bars (light grey) 2 microm 1178

1179

Figure 10 Subcellular localization of CurT Ultrathin sections of wild-type Synechocystis 1180

6803 cells were incubated with rabbit αCurT prior to incubation with gold-conjugated goat 1181

anti-rabbit IgG A) Negative control (wild-type processed without addition of primary 1182

antibody) B C) Immunogold-labeled sections showing CurT localization at the cytoplasmic 1183

side of the thylakoid membrane D) Cluster formation of CurT signals at a putative biogenesis 1184

center from C E) Biogenesis center from the same cell (C) without any obvious CurT 1185

clustering of gold particles F) Schematic depiction of a wild-type cell (from Figure 2A) with 1186

color-coded curved membranes green = thylakoids that follow the curvature of the cell red = 1187

37

thylakoids that bend away from the plasma membrane yellow = thylakoids that bend toward 1188

the plasma membrane to converge on sites of biogenesis centers G) Relative distribution of 1189

gold signals between convex (dark color) and concave (light color) sides of membranes (n = 1190

1584 signals from a total of 95 cells) The undifferentiated overall signal distribution is given 1191

in blue Bars = 200 nm (overview) and 100 nm (details) 1192

1193

Figure 11 Differentially modified forms of CurT are found in different complexes in PDMs 1194

and thylakoid membranes Samples were isolated by fractionation of wild-type membranes 1195

via two consecutive sucrose density gradients according to Schottkowski et al (2009b) After 1196

density centrifugation samples were applied to BNSDS-PAGE analysis (A) or isoelectric 1197

focusing (B) Numbers on the right indicate the respective fraction from the second gradient 1198

(see Figure 7) Fraction 5 represents the PDMs and fraction 9 the thylakoid membrane 1199

1200

Figure 12 Loss of CurT increases sensitivity to abiotic stress A B) Doubling times of wild-1201

type and curT- under salt stress (A) or osmotic stress (B) Doubling times are means plusmn SD of 1202

three independent cultures C) Localization of CurT-CFP under salt and osmotic stress 1203

Samples were examined as described in Figure 8 Scale bars 1 microm D) Protein levels of wild-1204

type cells after growth in BG11 medium containing 500 mM NaCl Samples were analyzed on 1205

the same gel but unrelated samples between the presented signals were omitted E) 1206

Membrane preparations obtained from wild-type cells wild-type cells grown in the presence 1207

of 500 mM NaCl and curT- cells were subjected to the first gradient step in the membrane 1208

fractionation scheme The gradient was divided into five fractions and 10 of fractions I-IV 1209

and 02 of fraction V were analyzed by SDS-PAGE Fraction II includes the plasma 1210

membrane and fraction V consists of PratA-defined membrane and thylakoid membrane 1211

1212

Figure 13 Model of CurT distribution at convergence zones in Synechocystis 6803 The 1213

distribution of CurT in thylakoid (green) and plasma membranes (brown) is shown The 1214

pattern of localization of CurT in the thylakoid membrane is derived from membrane 1215

fractionation via sucrose density centrifugation fluorescence-based detection of the CurT-1216

CFP fusion and endogenous CurT and immunogold labeling experiments (Figures 7-10) The 1217

different CurT variants a b c and d identified in the IEF experiments (Figure 11) are depicted 1218

in yellow pink blue and black respectively CurT present in the plasma membrane is 1219

highlighted in gray as its precise nature and role remain to be defined (Figure 12) 1220

Membranes are represented as lipid bilayers Convex and concave faces of bent thylakoid 1221

38

sheets are indicated by black arrows The PDM which is dedicated to PSII assembly and 1222

repair is depicted in blue The dotted blue line emphasizes that the ultrastructure in this region 1223

has not yet been fully resolved PP periplasm PM plasma membrane TM thylakoid 1224

membrane L lumen PDM PratA-defined membrane 1225

1226

Tables 1227

Table 1 Physiological characteristics of the curT- mutant 1228

Strain Doubling time [h]

Oxygen Evolution[nmol h-1 OD750

-1]c

Chlorophyll content

[microg OD750-1]

d

Cell size [microm]e

Cell number [ml-1 OD750

-1]f

Wild type 817plusmn017a 1600plusmn042

b 1933plusmn187 251plusmn014 264plusmn020 390plusmn006 x 107

curT- 1259plusmn020a 3226plusmn056

b 1074plusmn20 195plusmn029 274plusmn044 367plusmn016 x 107

1229 abDoubling times in the presence (a) or absence (b) of 5 mM glucose measured under 1230

continuous illumination at 30 micromol photons m-2 s-1 and CO2-limiting conditions cOxygen 1231

evolution is expressed in nmol O2 produced per hour per OD750 unit dChlorophyll content is 1232

expressed in microg OD750-1 eThe diameter of non-dividing cells is presented in microm fCell number 1233

was determined per ml per OD750 Data are means plusmn SD of at least three independent 1234

experiments 1235

1236

Parsed CitationsAllen JF de Paula WBM Puthiyaveetil S and Nield J (2011) A structural phylogenetic map for chloroplast photosynthesisTrends Plant Sci 16 645-655

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Anderson JM Horton P Kim E-H and Chow WS (2012) Towards elucidation of dynamic structural changes of plant thylakoidarchitecture Philos Trans R Soc Lond B Biol Sci 367 3515-3524

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Armbruster U Zuumlhlke J Rengstl B Kreller R Makarenko E Ruumlhle T Schuumlnemann D Jahns P Weisshaar B NickelsenJ and Leister D (2010) The Arabidopsis thylakoid protein PAM68 is required for efficient D1 biogenesis and photosystem IIassembly Plant Cell 22 3439-3460

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Armbruster U Labs M Pribil M Viola S Xu W Scharfenberg M Hertle AP Rojahn U Jensen PE Rappaport F JoliotP Doumlrmann P Wanner G and Leister D (2013) Arabidopsis CURVATURE THYLAKOID1 proteins modify thylakoid architectureby inducing membrane curvature Plant Cell 25 2661-2678

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Aseeva E Ossenbuumlhl F Sippel C Cho WK Stein B Eichacker LA Meurer J Wanner G Westhoff P Soll J andVothknecht UC (2007) Vipp1 is required for basic thylakoid membrane formation but not for the assembly of thylakoid proteincomplexes Plant Physiol Biochem 45 119-128

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Bartsevich VV and Pakrasi HB (1995) Molecular identification of an ABC transporter complex for manganese analysis of acyanobacterial mutant strain impaired in the photosynthetic oxygen evolution process EMBO J 14 1845-1853

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Bartsevich VV and Pakrasi HB (1996) Manganese transport in the cyanobacterium Synechocystis sp PCC 6803 J Biol Chem271 26057-26061

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Bernaacutet G Waschewski N and Roumlgner M (2009) Towards efficient hydrogen production the impact of antenna size andexternal factors on electron transport dynamics in Synechocystis PCC 6803 Photosynth Res 99 205-216

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Boehm M Yu J Krynicka V Barker M Tichy M Komenda J Nixon PJ and Nield J (2012) Subunit Organization of aSynechocystis Hetero-Oligomeric Thylakoid FtsH Complex Involved in Photosystem II Repair Plant Cell 24 3669-3683

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Bradford MM (1976) A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle ofprotein-dye binding Anal Biochem 72 248-254

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Chang L Liu X Li Y Liu C-C Yang F Zhao J and Sui S-F (2015) Structural organization of an intact phycobilisome and itsassociation with photosystem II Cell Res 25 726-737

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Danielsson R Suorsa M Paakkarinen V Albertsson P-Aring Styring S Aro E-M and Mamedov F (2006) Dimeric andmonomeric organization of photosystem II Distribution of five distinct complexes in the different domains of the thylakoidmembrane J Biol Chem 281 14241-14249

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Daum B Nicastro D Austin J McIntosh JR and Kuumlhlbrandt W (2010) Arrangement of photosystem II and ATP synthase in

24

An aliquot of a cell suspension in mid-log phase was placed under a BG11-agarose 784

pad on a glass coverslip (15) and imaged on an inverted microscope (Zeiss 785

AxioObserverZ1) equipped with an ORCA Flash40 V2 (Hamamatsu) camera a Lumenecor 786

SOLA II Light Engine and a Plan-Apochromat 63x140 Oil DIC M27 (NA 14) objective 787

(Zeiss) Image acquisition was done with Zen 21 software in cyan and far-red fluorescence 788

channels (Zeiss Filter Sets 47 HE and 50) as Z-series with a step size of 250 nm and effective 789

pixel size of 103 nm Acquired image files were subsequently deconvolved (Constrained 790

Iterative Method) using a default theoretical Point Spread Function in Zen 20 (Zeiss) 791

Extraction of intensities for line profiles was performed by image thresholding the thylakoid 792

autofluorescence channel and eroding the resulting binary mask in Fiji (Schindelin et al 793

2012) 794

For immunofluorescence analysis cells were grown to mid-log phase as in the case of 795

the cells prepared for live-cell microscopy A 10-ml culture was fixed for 20 min in 37 796

formaldehyde and following extensive washing with phosphate-buffered saline (PBS) cells 797

were first permeabilized in 005 Triton-X for 20 min and then in lysis buffer (50 mM Tris-798

HCl 100 mM NaCl 5 mgml lysozyme) at 37degC for 2 h with gentle shaking To block 799

unspecific binding sites the cell pellet was incubated in 5 bovine serum albumin in PBS at 800

30degC for 1 h The αCurT serum (1500 dilution) was added to cells in fresh blocking buffer 801

for 1 h at 30degC with gentle shaking Cells were then washed three times with blocking buffer 802

and incubated with goat anti-rabbit IgG secondary antibodies conjugated to Oregon Green 488 803

(Invitrogen) (11000 dilution) under the conditions as for the primary antibodies Cells were 804

washed three times with PBS and prepared for microscopy as above Imaging was done as 805

described for live-cell microscopy except that a Colibri2 LED light source was employed for 806

illumination and a CoolSnap HQ camera (Photometrics) was used for image acquisition Cells 807

were imaged as Z-series (step size 280 nm) in the yellow and far-red fluorescent channels 808

(Zeiss Filter Sets 46 HE and 50) using the 505 nm and 625 nm LED modules Effective pixel 809

size in the final image was 102 nm Deconvolution and image analysis was done as described 810

above As judged by the staining intensity of the Oregon Green-conjugated antibodies 811

approximately half of the cells in any given field of view appeared to have been successfully 812

permeabilised a rate that is common in our experience No significant signal was detected in 813

the control sample that had not been exposed to the primary antibodies 814

815

25

Accession numbers 816

Sequence data from this article can be found in the CyanoBase and EMBLGenBank 817

data libraries under accession number slr0483 818

819

Supplemental Data 820

Supplemental Figure 1 Construction of the curT- mutant 821

Supplemental Figure 2 Growth phenotype of curT- 822

Supplemental Figure 3 Expression analysis of the open reading frame slr0482 (located 823

upstream of curT) in the curT- strain 824

Supplemental Figure 4 Absorbance spectra of curT- and wild-type cells 825

Supplemental Figure 5 High-light growth phenotypes of wild-type Synechocystis 6803 and 826

the curT- strain 827

Supplemental Figure 6 Ultrastructure of the TD41 mutant which lacks the psbA transcript 828

and the D1 protein 829

Supplemental Figure 7 Expression and localization of CurT-CFP 830

Supplemental Figure 8 Localization of CurT and CurT-CFP by fluorescence microscopy 831

Supplemental Figure 9 Chlorophyll autofluorescence of curT- 832

Supplemental Figure 10 The curT- mutant as a negative control for immunogold labeling 833

Supplemental Figure 11 Representative counts of immunogold signals 834

Supplemental Table 1 Overview of immunogold signals in curT- cells 835

Supplemental Table 2 Overview of immunogold signals in specific regions of Synechocystis 836

6803 wild-type cells 837

Supplemental Table 3 Statistical analysis of immunogold signals for wild-type 838

Synechocystis 6803 cells 839

Supplemental Table 4 Co-expression of curT 840

Supplemental Movie 1 Scan through the Z-axis of a curT-CFP cell 841

Supplemental Movie 2 Rendered 3D-model of a CurT-CFP detection 842

Supplemental Movie 3 Scan through the Z-axis of a curT-CFP cell with a traversing 843

thylakoid lamella 844

845

Acknowledgements 846

We thank Y Nishiyama for providing αpD1 and J Soll for αVIPP1 and αYidC antibodies 847

respectively and Nina Dyczmons-Nowaczyk for support with the fluorescence measurements 848

This work was supported by grants awarded to JN (Ni3909) MMN (NO 8363) and DL 849

26

(Le126529) by the Deutsche Forschungsgemeinschaft in the context of Research Unit 850

FOR2092 and the Cluster of Excellence RESOLV (EXC 1069) AG is a Howard Hughes 851

Medical Institute postdoctoral fellow in the laboratory of Erin OrsquoShea at Harvard University 852

LS was supported by a PhD fellowship from the Chinese Scholarship Council 853

854

Author Contributions 855

SH AR LS MMN DL and JN designed the research SH AR LS AG ILG EH ML BR 856

SV performed the research all authors contributed to data analysis SH AR and JN wrote the 857

paper 858

859

Competing Financial Interest statement 860

The authors declare no competing financial interests 861

862

We wish to dedicate this paper to Fabrice Rappaport an outstanding colleague and friend who 863

passed away so early 864

865

27

References 866

Allen JF de Paula WBM Puthiyaveetil S and Nield J (2011) A structural 867

phylogenetic map for chloroplast photosynthesis Trends Plant Sci 16 645-655 868

Anderson JM Horton P Kim E-H and Chow WS (2012) Towards elucidation of 869

dynamic structural changes of plant thylakoid architecture Philos Trans R Soc 870

Lond B Biol Sci 367 3515-3524 871

Armbruster U Zuumlhlke J Rengstl B Kreller R Makarenko E Ruumlhle T Schuumlnemann 872

D Jahns P Weisshaar B Nickelsen J and Leister D (2010) The Arabidopsis 873

thylakoid protein PAM68 is required for efficient D1 biogenesis and photosystem II 874

assembly Plant Cell 22 3439-3460 875

Armbruster U Labs M Pribil M Viola S Xu W Scharfenberg M Hertle AP 876

Rojahn U Jensen PE Rappaport F Joliot P Doumlrmann P Wanner G and 877

Leister D (2013) Arabidopsis CURVATURE THYLAKOID1 proteins modify 878

thylakoid architecture by inducing membrane curvature Plant Cell 25 2661-2678 879

Aseeva E Ossenbuumlhl F Sippel C Cho WK Stein B Eichacker LA Meurer J 880

Wanner G Westhoff P Soll J and Vothknecht UC (2007) Vipp1 is required for 881

basic thylakoid membrane formation but not for the assembly of thylakoid protein 882

complexes Plant Physiol Biochem 45 119-128 883

Bartsevich VV and Pakrasi HB (1995) Molecular identification of an ABC transporter 884

complex for manganese analysis of a cyanobacterial mutant strain impaired in the 885

photosynthetic oxygen evolution process EMBO J 14 1845-1853 886

Bartsevich VV and Pakrasi HB (1996) Manganese transport in the cyanobacterium 887

Synechocystis sp PCC 6803 J Biol Chem 271 26057-26061 888

Bernaacutet G Waschewski N and Roumlgner M (2009) Towards efficient hydrogen production 889

the impact of antenna size and external factors on electron transport dynamics in 890

Synechocystis PCC 6803 Photosynth Res 99 205-216 891

Boehm M Yu J Krynicka V Barker M Tichy M Komenda J Nixon PJ and Nield 892

J (2012) Subunit Organization of a Synechocystis Hetero-Oligomeric Thylakoid FtsH893

Complex Involved in Photosystem II Repair Plant Cell 24 3669-3683894

Bradford MM (1976) A rapid and sensitive method for the quantitation of microgram 895

quantities of protein utilizing the principle of protein-dye binding Anal Biochem 72 896

248-254897

28

Chang L Liu X Li Y Liu C-C Yang F Zhao J and Sui S-F (2015) Structural 898

organization of an intact phycobilisome and its association with photosystem II Cell 899

Res 25 726-737 900

Danielsson R Suorsa M Paakkarinen V Albertsson P-Aring Styring S Aro E-M and 901

Mamedov F (2006) Dimeric and monomeric organization of photosystem II 902

Distribution of five distinct complexes in the different domains of the thylakoid 903

membrane J Biol Chem 281 14241-14249 904

Daum B Nicastro D Austin J McIntosh JR and Kuumlhlbrandt W (2010) Arrangement 905

of photosystem II and ATP synthase in chloroplast membranes of Spinach and Pea 906

Plant Cell 22 1299-1312 907

Engel BD Schaffer M Kuhn Cuellar L Villa E Plitzko JM and Baumeister W 908

(2015) Native architecture of the Chlamydomonas chloroplast revealed by in situ 909

cryo-electron tomography eLife 4 e04889 910

Ford MGJ Mills IG Peter BJ Vallis Y Praefcke GJK Evans PR and McMahon 911

HT (2002) Curvature of clathrin-coated pits driven by epsin Nature 419 361-366 912

Fristedt R Willig A Granath P Cregravevecoeur M Rochaix J-D and Vener AV (2009) 913

Phosphorylation of photosystem II controls functional macroscopic folding of 914

photosynthetic membranes in Arabidopsis Plant Cell 21 3950-3964 915

Gallop JL and McMahon HT (2005) BAR domains and membrane curvature bringing 916

your curves to the BAR Biochem Soc Symp 72 223-231 917

Gibson DG (2011) Chapter fifteen - Enzymatic Assembly of Overlapping DNA Fragments 918

In Methods in Enzymology V Christopher ed (Academic Press) pp 349-361 919

Goedhart J von Stetten D Noirclerc-Savoye M Lelimousin M Joosen L Hink MA 920

van Weeren L Gadella TWJ and Royant A (2012) Structure-guided evolution of 921

cyan fluorescent proteins towards a quantum yield of 93 Nat Commun 3 751 922

Heinz S Liauw P Nickelsen J and Nowaczyk M (2016) Analysis of photosystem II 923

biogenesis in cyanobacteria Biochim Biophys Acta 1857 274-287 924

Hernaacutendez-Prieto M and Futschik M (2012) CyanoEXpress A web database for 925

exploration and visualisation of the integrated transcriptome of cyanobacterium 926

Synechocystis sp PCC6803 Bioinformation 8 634-638 927

Hernaacutendez-Prieto MA Semeniuk TA Giner-Lamia J and Futschik ME (2016) The 928

Transcriptional Landscape of the Photosynthetic Model Cyanobacterium 929

Synechocystis sp PCC6803 Sci Rep 6 22168 930

29

Huang F Fulda S Hagemann M and Norling B (2006) Proteomic screening of salt-931

stress-induced changes in plasma membranes of Synechocystis sp strain PCC 6803 932

Proteomics 6 910-920 933

Kirchhoff H (2013) Architectural switches in plant thylakoid membranes Photosynth Res 934

116 481-487 935

Klinkert B Elles I and Nickelsen J (2006) Translation of chloroplast psbD mRNA in 936

Chlamydomonas is controlled by a secondary RNA structure blocking the AUG start 937

codon Nucleic Acids Res 34 386-394 938

Klinkert B Ossenbuumlhl F Sikorski M Berry S Eichacker L and Nickelsen J (2004) 939

PratA a periplasmic tetratricopeptide repeat protein involved in biogenesis of 940

photosystem II in Synechocystis sp PCC 6803 J Biol Chem 279 44639-44644 941

Komenda J Nickelsen J Tichyacute M Praacutešil O Eichacker LA and Nixon PJ (2008) The 942

cyanobacterial homologue of HCF136YCF48 is a component of an early photosystem 943

II assembly complex and is important for both the efficient assembly and repair of 944

photosystem II in Synechocystis sp PCC 6803 J Biol Chem 283 22390-22399 945

Kopf M Klaumlhn S Scholz I Matthiessen JKF Hess WR and Voszlig B (2014) 946

Comparative analysis of the primary transcriptome of Synechocystis sp PCC 6803 947

DNA Res 21 527-539 948

Kunkel DD (1982) Thylakoid centers Structures associated with the cyanobacterial 949

photosynthetic membrane system Arch Microbiol 133 97-99 950

Liberton M Howard Berg R Heuser J Roth R and Pakrasi BH (2006) Ultrastructure 951

of the membrane systems in the unicellular cyanobacterium Synechocystis sp strain 952

PCC 6803 Protoplasma 227 129-138 953

Liberton M Saha R Jacobs JM Nguyen AY Gritsenko MA Smith RD 954

Koppenaal DW and Pakrasi HB (2016) Global Proteomic Analysis Reveals an 955

Exclusive Role of Thylakoid Membranes in Bioenergetics of a Model 956

Cyanobacterium Mol Cell Proteomics 15 2021-2032 957

Luque I and Ochoa de Alda JAG (2014) CURT1CAAD-containing aaRSs thylakoid 958

curvature and gene translation Trends Plant Sci 19 63-66 959

Marin K Stirnberg M Eisenhut M Kraumlmer R and Hagemann M (2006) Osmotic stress 960

in Synechocystis sp PCC 6803 low tolerance towards nonionic osmotic stress results 961

from lacking activation of glucosylglycerol accumulation Microbiology 152 2023-962

2030 963

Mullineaux CW (2005) Function and evolution of grana Trends Plant Sci 10 521-525 964

30

Mullineaux CW (2008) Biogenesis and dynamics of thylakoid membranes and the 965

photosynthetic apparatus In The Cyanobacteria A Herrero and E Flores eds 966

(Norfolk UK Caister Academic Press) pp 289ndash304 967

Nevo R Charuvi D Tsabari O and Reich Z (2012) Composition architecture and 968

dynamics of the photosynthetic apparatus in higher plants Plant J 70 157-176 969

Nickelsen J and Rengstl B (2013) Photosystem II assembly From cyanobacteria to plants 970

Annu Rev Plant Biol 64 609-635 971

Nickelsen J and Zerges W (2013) Thylakoid biogenesis has joined the new era of bacterial 972

cell biology Front Plant Sci 4 458 973

Nilsson F Simpson DJ Jansson C and Andersson B (1992) Ultrastructural and 974

biochemical characterization of a Synechocystis 6803 mutant with inactivated psbA 975

genes Arch Biochem Biophys 295 340-347 976

Odom WR Hodges R Chitnis PR and Guikema JA (1993) Characterization of 977

Synechocystis sp PCC 6803 in iron-supplied and iron-deficient media Plant Mol 978

Biol 23 1255-1264 979

Ossenbuumlhl F Inaba-Sulpice M Meurer J Soll J and Eichacker LA (2006) The 980

Synechocystis sp PCC 6803 Oxa1 homolog is essential for membrane integration of 981

reaction center precursor protein pD1 Plant Cell 18 2236-2246 982

Pisareva T Kwon J Oh J Kim S Ge C Wieslander Aring Choi J-S and Norling B 983

(2011) Model for Membrane Organization and Protein Sorting in the Cyanobacterium 984

Synechocystis sp PCC 6803 Inferred from Proteomics and Multivariate Sequence 985

Analyses J Proteome Res 10 3617-3631 986

Pribil M Labs M and Leister D (2014) Structure and dynamics of thylakoids in land 987

plants J Exp Bot 65 1955-1972 988

Rast A Heinz S and Nickelsen J (2015) Biogenesis of thylakoid membranes Biochim 989

Biophys Acta 1847 821-830 990

Rast A Rengstl B Heinz S Klingl A and Nickelsen J (2016) The role of Slr0151 a 991

tetratricopeptide repeat protein from Synechocystis sp PCC 6803 during Photosystem 992

II assembly and repair Front Plant Sci 7 605 993

Rengstl B Oster U Stengel A and Nickelsen J (2011) An Intermediate Membrane 994

Subfraction in Cyanobacteria Is Involved in an Assembly Network for Photosystem II 995

Biogenesis J Biol Chem 286 21944-21951 996

31

Rengstl B Knoppovaacute J Komenda J and Nickelsen J (2013) Characterization of a 997

Synechocystis double mutant lacking the photosystem II assembly factors YCF48 and 998

Sll0933 Planta 237 471-480 999

Rexroth S Mullineaux CW Ellinger D Sendtko E Roumlgner M and Koenig F (2011) 1000

The Plasma Membrane of the Cyanobacterium Gloeobacter violaceus Contains 1001

Segregated Bioenergetic Domains Plant Cell 23 2379-2390 1002

Rippka R Deruelles J Waterbury JB Herdman M and Stanier RY (1979) Generic 1003

Assignments Strain Histories and Properties of Pure Cultures of Cyanobacteria 1004

Microbiology 111 1-61 1005

Ruumltgers M and Schroda M (2013) A role of VIPP1 as a dynamic structure within 1006

thylakoid centers as sites of photosystem biogenesis Plant Signal Behav 8 e27037 1007

Sacharz J Bryan SJ Yu J Burroughs NJ Spence EM Nixon PJ and Mullineaux 1008

CW (2015) Sub-cellular location of FtsH proteases in the cyanobacterium1009

Synechocystis sp PCC 6803 suggests localised PSII repair zones in the thylakoid1010

membranes Mol Microbiol 96 448-4621011

Sandstroumlm S Park Y-I Oumlquist G and Gustafsson P (2001) CP43prime the isiA Gene 1012

Product Functions as an Excitation Energy Dissipator in the Cyanobacterium 1013

Synechococcus sp PCC 7942 Photochem Photobiol 74 431-437 1014

Schindelin J Arganda-Carreras I Frise E Kaynig V Longair M Pietzsch T 1015

Preibisch S Rueden C Saalfeld S Schmid B Tinevez J-Y White DJ 1016

Hartenstein V Eliceiri K Tomancak P and Cardona A (2012) Fiji an open-1017

source platform for biological-image analysis Nat Methods 9 676-682 1018

Schottkowski M Ratke J Oster U Nowaczyk M and Nickelsen J (2009a) Pitt a novel 1019

tetratricopeptide repeat protein involved in light-dependent chlorophyll biosynthesis 1020

and thylakoid membrane biogenesis in Synechocystis sp PCC 6803 Mol Plant 2 1021

1289-1297 1022

Schottkowski M Gkalympoudis S Tzekova N Stelljes C Schuumlnemann D Ankele E 1023

and Nickelsen J (2009b) Interaction of the periplasmic PratA factor and the PsbA 1024

(D1) protein during biogenesis of photosystem II in Synechocystis sp PCC 6803 J 1025

Biol Chem 284 1813-1819 1026

Selatildeo TT Zhang L Knoppovaaacute J Komenda J and Norling B (2016) Photosystem II 1027

Assembly Steps Take Place in the Thylakoid Membrane of the Cyanobacterium 1028

Synechocystis sp PCC6803 Plant Cell Physiol 57 878 1029

32

Spaumlt P Maček B and Forchhammer K (2015) Phosphoproteome of the cyanobacterium 1030

Synechocystis sp PCC 6803 and its dynamics during nitrogen starvation Front 1031

Microbiol 6 248 1032

Stengel A Guumlgel IL Hilger D Rengstl B Jung H and Nickelsen J (2012) Initial 1033

steps of photosystem II de novo assembly and preloading with manganese take place 1034

in biogenesis centers in Synechocystis Plant Cell 24 660-675 1035

Uniacke J and Zerges W (2007) Photosystem II assembly and repair are differentially 1036

localized in Chlamydomonas Plant Cell 19 3640-3654 1037

Uniacke J and Zerges W (2009) Chloroplast protein targeting involves localized 1038

translation in Chlamydomonas Proc Natl Acad Sci USA 106 1439-1444 1039

van de Meene AL Hohmann-Marriott M Vermaas WJ and Roberson R (2006) The 1040

three-dimensional structure of the cyanobacterium Synechocystis sp PCC 6803 Arch 1041

Microbiol 184 259-270 1042

van de Meene AML Sharp WP McDaniel JH Friedrich H Vermaas WFJ and 1043

Roberson RW (2012) Gross morphological changes in thylakoid membrane 1044

structure are associated with photosystem I deletion in Synechocystis sp PCC 6803 1045

Biochim Biophys Acta 1818 1427-1434 1046

Watanabe M and Ikeuchi M (2013) Phycobilisome architecture of a light-harvesting 1047

supercomplex Photosynth Res 116 265-276 1048

Wellburn AR and Lichtenthaler H (1984) Formulae and Program to Determine Total 1049

Carotenoids and Chlorophylls A and B of Leaf Extracts in Different Solvents In 1050

Advances in Photosynthesis Research Proceedings of the VIth International Congress 1051

on Photosynthesis Brussels Belgium August 1ndash6 1983 C Sybesma ed (Dordrecht 1052

Springer Netherlands) pp 9-12 1053

Wilde A Lunser K Ossenbuumlhl F Nickelsen J and Borner T (2001) Characterization of 1054

the cyanobacterial ycf37 mutation decreases the photosystem I content Biochem J 1055

357 211-216 1056

Wilson A Boulay C Wilde A Kerfeld CA and Kirilovsky D (2007) Light-Induced 1057

Energy Dissipation in Iron-Starved Cyanobacteria Roles of OCP and IsiA Proteins 1058

Plant Cell 19 656-672 1059

Xu M Bernaacutet G Singh A Mi H Roumlgner M Pakrasi HB and Ogawa T (2008) 1060

Properties of Mutants of Synechocystis sp Strain PCC 6803 Lacking Inorganic Carbon 1061

Sequestration Systems Plant Cell Physiol 49 1672-1677 1062

33

Yamamoto T Burke J Autz G and Jagendorf AT (1981) Bound ribosomes of Pea 1063

chloroplast thylakoid membranes location and release in vitro by high salt 1064

puromycin and RNase Plant Physiol 67 940-949 1065

Yang H Liao L Bo T Zhao L Sun X Lu X Norling B and Huang F (2014) 1066

Slr0151 in Synechocystis sp PCC 6803 is required for efficient repair of photosystem 1067

II under high-light condition J Integr Plant Biol 56 1136-1150 1068

Yeremenko N Kouřil R Ihalainen JA DHaene S van Oosterwijk N 1069

Andrizhiyevskaya EG Keegstra W Dekker HL Hagemann M Boekema EJ 1070

Matthijs HCP and Dekker JP (2004) Supramolecular Organization and Dual 1071

Function of the IsiA Chlorophyll-Binding Protein in Cyanobacteria Biochemistry 43 1072

10308-10313 1073

Zak E Norling B Maitra R Huang F Andersson B and Pakrasi HB (2001) The 1074

initial steps of biogenesis of cyanobacterial photosystems occur in plasma membranes 1075

Proc Natl Acad Sci USA 98 13443-13448 1076

Zang X Liu B Liu S Arunakumara KKIU and Zhang X (2007) Optimum 1077

Conditions for Transformation of Synechocystis sp PCC 6803 J Microbiol 45 241-1078

245 1079

Zhang L and Sakamoto W (2015) Possible function of VIPP1 in maintaining chloroplast 1080

membranes Biochim Biophys Acta 1847 831-837 1081

Zimmerberg J and Kozlov MM (2006) How proteins produce cellular membrane 1082

curvature Nat Rev Mol Cell Biol 7 9-19 1083

Zoumlfel P (1988) Statistik in der Praxis (Stuttgart Germany Gustav Fischer Verlag) 1084

1085

34

Figure Legends 1086

Figure 1 General characteristics of CurT A) Sequence alignment of CurT and CURT1A-D 1087

from A thaliana Predicted chloroplast transit-peptide sequences of CURT1A-D are omitted 1088

(Armbruster et al 2013) Positions of predicted C-terminal transmembrane domains (TDM) 1089

are marked (black bar) as is the position of the predicted amphipathic N-terminal helix in 1090

CurT (red bar) The green bar denotes the peptide sequence used for antibody production 1091

Identical and related amino acids that are conserved in 100 80 and 60 of the sequences 1092

are highlighted in black dark grey and light grey respectively B) Helical-wheel 1093

representation of the N-terminal amphipathic helix of CurT (red bar in A) The color code 1094

reflects the physicochemical properties of amino-acid side-chains green polar and 1095

uncharged blue polar and positively charged red polar and negatively charged yellow 1096

hydrophobic C) Solubility of CurT Membrane-associated proteins (50 microg) from wild-type 1097

cells were extracted with 5 mM HEPES (pH 76) containing either 1 M NaCl 01 M Na2CO3 1098

4 M urea 01 Triton X-100 or no additional solute After separation of membrane-bound 1099

(M) and solubilized (S) proteins by centrifugation proteins were fractionated by SDS-PAGE1100

and CurT was immunodetected on immunoblots As a control the integral membrane protein 1101

CP47 from PSII was analyzed in parallel D) Transmission electron micrographs of negatively 1102

stained liposomes Cell-free expression (CFE) of CurT and A thaliana CURT1A was 1103

performed in the presence of liposomes similar in composition to the lipids of the thylakoid 1104

membrane Liposomes before and after cell-free protein expression in the absence of DNA 1105

served as negative controls Black arrowheads indicate tubular connections between 1106

liposomes Scale bars 250 nm 1107

1108

Figure 2 Ultrastructural analysis of curT- cells Transmission electron micrographs of typical 1109

wild-type (A) and curT- (B-D) Synechocystis 6803 cells taken at 44000times (A B) and 28000times 1110

(C D) magnification respectively Ultrathin sections (35 to 45 nm) of cryofixed samples 1111

were stained with osmium tetroxide and post-stained using lead citrate Arrowheads indicate 1112

biogenesis centers Scale bars 200 nm (A B) and 500 nm (C D) respectively 1113

1114

Figure 3 Accumulation of components of photosynthetic complexes in the curT- mutant A) 1115

Whole cell extracts (30 microg protein) from wild-type and curT- strains were fractionated by 1116

SDS-PAGE and analyzed on immunoblots using the indicated antibodies B) The histogram 1117

shows levels of the indicated proteins in curT- extracts relative to wild-type samples (dashed 1118

red line) Data are means plusmn SD of three independent experiments Significant differences from 1119

35

wild-type protein levels according to Studentrsquos t-test with error probabilities of 5 and 1 1120

are indicated by and respectively 1121

1122

Figure 4 P700+ reduction kinetics and high-light effects in curT- cells A) Averaged traces 1123

(10 single measurements) of P700+ decay after complete oxidation by a 50-ms multiple 1124

turnover pulse (10000 micromol photons m-2 s-1) in the absence and presence of 10 microM DCMU 1125

B) Rate constants for P700+ reduction were obtained by fitting of the data with single1126

exponential functions Error bars indicate the SD of three independent measurements C) 1127

Impact of light intensity on the (relative) electron transport rate (rETR) Cells were exposed to 1128

gradually increasing light intensities which resulted in increasing electron transport until the 1129

capacity limit was reached PAR light intensity (micromol photons m-2 s-1) Error bars indicate the 1130

SD of three independent measurements D) D1 protein level in wild-type and curT- after high-1131

light treatment (800 micromol photons m-2s-1) in the presence and absence of lincomycin Samples 1132

were taken every 30 min and processed as in Figure 3 to determine the level of D1 present 1133

100 refers to wild-type D1 level at the beginning of the experiment 1134

1135

Figure 5 PSII assembly in curT- cells A) BNSDS-PAGE of membrane proteins Membrane 1136

fractions from wild-type and curT- cells were solubilized with 13 n-dodecyl-β-maltoside 1137

and proteins were fractionated by two-dimensional BNSDS-PAGE blotted and probed with 1138

antibodies against the PSII subunits D1 D2 CP47 and CP43 Wild-type blots were also 1139

probed with the αCurT antibody The sizes of marker proteins and the positions of PSII 1140

assembly intermediates (RCCII RCCI RC47) are shown above and below each image B) In 1141

vivo pulse labeling of membrane proteins with 35S Pulse-labeled PSII core proteins were 1142

separated via BNSDS-PAGE and visualized by autoradiography 1143

1144

Figure 6 Loss of CurT induces stress A) Low-temperature (77 K) fluorescence emission of 1145

Synechocystis 6803 wild-type (blue) and curT- (red) cells excited at 440 nm The spectra were 1146

normalized to the added fluorescein standard B) Low-temperature (77 K) fluorescence 1147

emission of Synechocystis 6803 wild-type (blue) and curT- (red) excited at 580 nm The 1148

spectra were normalized to 780 nm C) Level of IsiA in the curT- mutant relative to the wild-1149

type A mean value of 368 plusmn 96 (SD) was determined from three independent experiments 1150

1151

Figure 7 Membrane sublocalization of PSII-related factors Cell extracts from wild-type and 1152

curT- cells were fractionated by two consecutive rounds of sucrose-density gradient 1153

36

centrifugation (Schottkowski et al 2009b) The second linear gradient (20-60 sucrose) was 1154

apportioned into 14 fractions which were analyzed by immunoblotting using the indicated 1155

antibodies Fractions 1ndash6 represent PDMs and fractions 7ndash14 thylakoid membranes (TMs) 1156

To facilitate comparison between gradients sample volumes were normalized to the volume 1157

of fraction 7 that contained 40 microg of protein 1158

1159

Figure 8 Live-cell imaging of the curT-CFP strain by fluorescence microscopy In the curT-1160

CFP strain the native curT gene has been replaced by a CFP-tagged version resulting in the 1161

expression of the CurT-CFP fusion protein under the control of the native promotor A) 1162

Close-up views of the mid-cell plane in the CFP and far-red autofluorescence channels shown 1163

in slice 7 in panel B B) Synechocystis 6803 cells expressing CurT C-terminally fused to the 1164

mTurquoise2 variant of CFP from its native chromosomal promoter The two imaging 1165

channels are displayed as Z-axis montages (auto-scaled contrast step size 250 nm) in 1166

grayscale and color composite configuration The thylakoid autofluorescent channel as 1167

imaged in far-red fluorescence is depicted in magenta and CurT signal as imaged in cyan 1168

fluorescence is depicted in cyan C) Fluorescence intensity profiles of the two channels along 1169

the autofluorescent peripheral cell ldquoringrdquo are shown for slice 7 The maximum projection of 1170

the entire Z montage is also shown Scale bars (light grey) 2 microm 1171

1172

Figure 9 Immunofluorescence detection of CurT A) Close-ups of slice 5 in panel B B) 1173

Wild-type Synechocystis 6803 cells labeled with αCurT antibodies and detected with Oregon 1174

Green-conjugated secondary antibodies The Z-axis montages are shown as in Figure 8B 1175

except that the step size is 280 nm (1 to 10) C) Intensity profiles of the two channels along 1176

the autofluorescent peripheral cell ldquoringrdquo are shown for slice 5 The maximum projection of 1177

the entire Z montage is also shown Scale bars (light grey) 2 microm 1178

1179

Figure 10 Subcellular localization of CurT Ultrathin sections of wild-type Synechocystis 1180

6803 cells were incubated with rabbit αCurT prior to incubation with gold-conjugated goat 1181

anti-rabbit IgG A) Negative control (wild-type processed without addition of primary 1182

antibody) B C) Immunogold-labeled sections showing CurT localization at the cytoplasmic 1183

side of the thylakoid membrane D) Cluster formation of CurT signals at a putative biogenesis 1184

center from C E) Biogenesis center from the same cell (C) without any obvious CurT 1185

clustering of gold particles F) Schematic depiction of a wild-type cell (from Figure 2A) with 1186

color-coded curved membranes green = thylakoids that follow the curvature of the cell red = 1187

37

thylakoids that bend away from the plasma membrane yellow = thylakoids that bend toward 1188

the plasma membrane to converge on sites of biogenesis centers G) Relative distribution of 1189

gold signals between convex (dark color) and concave (light color) sides of membranes (n = 1190

1584 signals from a total of 95 cells) The undifferentiated overall signal distribution is given 1191

in blue Bars = 200 nm (overview) and 100 nm (details) 1192

1193

Figure 11 Differentially modified forms of CurT are found in different complexes in PDMs 1194

and thylakoid membranes Samples were isolated by fractionation of wild-type membranes 1195

via two consecutive sucrose density gradients according to Schottkowski et al (2009b) After 1196

density centrifugation samples were applied to BNSDS-PAGE analysis (A) or isoelectric 1197

focusing (B) Numbers on the right indicate the respective fraction from the second gradient 1198

(see Figure 7) Fraction 5 represents the PDMs and fraction 9 the thylakoid membrane 1199

1200

Figure 12 Loss of CurT increases sensitivity to abiotic stress A B) Doubling times of wild-1201

type and curT- under salt stress (A) or osmotic stress (B) Doubling times are means plusmn SD of 1202

three independent cultures C) Localization of CurT-CFP under salt and osmotic stress 1203

Samples were examined as described in Figure 8 Scale bars 1 microm D) Protein levels of wild-1204

type cells after growth in BG11 medium containing 500 mM NaCl Samples were analyzed on 1205

the same gel but unrelated samples between the presented signals were omitted E) 1206

Membrane preparations obtained from wild-type cells wild-type cells grown in the presence 1207

of 500 mM NaCl and curT- cells were subjected to the first gradient step in the membrane 1208

fractionation scheme The gradient was divided into five fractions and 10 of fractions I-IV 1209

and 02 of fraction V were analyzed by SDS-PAGE Fraction II includes the plasma 1210

membrane and fraction V consists of PratA-defined membrane and thylakoid membrane 1211

1212

Figure 13 Model of CurT distribution at convergence zones in Synechocystis 6803 The 1213

distribution of CurT in thylakoid (green) and plasma membranes (brown) is shown The 1214

pattern of localization of CurT in the thylakoid membrane is derived from membrane 1215

fractionation via sucrose density centrifugation fluorescence-based detection of the CurT-1216

CFP fusion and endogenous CurT and immunogold labeling experiments (Figures 7-10) The 1217

different CurT variants a b c and d identified in the IEF experiments (Figure 11) are depicted 1218

in yellow pink blue and black respectively CurT present in the plasma membrane is 1219

highlighted in gray as its precise nature and role remain to be defined (Figure 12) 1220

Membranes are represented as lipid bilayers Convex and concave faces of bent thylakoid 1221

38

sheets are indicated by black arrows The PDM which is dedicated to PSII assembly and 1222

repair is depicted in blue The dotted blue line emphasizes that the ultrastructure in this region 1223

has not yet been fully resolved PP periplasm PM plasma membrane TM thylakoid 1224

membrane L lumen PDM PratA-defined membrane 1225

1226

Tables 1227

Table 1 Physiological characteristics of the curT- mutant 1228

Strain Doubling time [h]

Oxygen Evolution[nmol h-1 OD750

-1]c

Chlorophyll content

[microg OD750-1]

d

Cell size [microm]e

Cell number [ml-1 OD750

-1]f

Wild type 817plusmn017a 1600plusmn042

b 1933plusmn187 251plusmn014 264plusmn020 390plusmn006 x 107

curT- 1259plusmn020a 3226plusmn056

b 1074plusmn20 195plusmn029 274plusmn044 367plusmn016 x 107

1229 abDoubling times in the presence (a) or absence (b) of 5 mM glucose measured under 1230

continuous illumination at 30 micromol photons m-2 s-1 and CO2-limiting conditions cOxygen 1231

evolution is expressed in nmol O2 produced per hour per OD750 unit dChlorophyll content is 1232

expressed in microg OD750-1 eThe diameter of non-dividing cells is presented in microm fCell number 1233

was determined per ml per OD750 Data are means plusmn SD of at least three independent 1234

experiments 1235

1236

Parsed CitationsAllen JF de Paula WBM Puthiyaveetil S and Nield J (2011) A structural phylogenetic map for chloroplast photosynthesisTrends Plant Sci 16 645-655

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Anderson JM Horton P Kim E-H and Chow WS (2012) Towards elucidation of dynamic structural changes of plant thylakoidarchitecture Philos Trans R Soc Lond B Biol Sci 367 3515-3524

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Armbruster U Zuumlhlke J Rengstl B Kreller R Makarenko E Ruumlhle T Schuumlnemann D Jahns P Weisshaar B NickelsenJ and Leister D (2010) The Arabidopsis thylakoid protein PAM68 is required for efficient D1 biogenesis and photosystem IIassembly Plant Cell 22 3439-3460

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Armbruster U Labs M Pribil M Viola S Xu W Scharfenberg M Hertle AP Rojahn U Jensen PE Rappaport F JoliotP Doumlrmann P Wanner G and Leister D (2013) Arabidopsis CURVATURE THYLAKOID1 proteins modify thylakoid architectureby inducing membrane curvature Plant Cell 25 2661-2678

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Aseeva E Ossenbuumlhl F Sippel C Cho WK Stein B Eichacker LA Meurer J Wanner G Westhoff P Soll J andVothknecht UC (2007) Vipp1 is required for basic thylakoid membrane formation but not for the assembly of thylakoid proteincomplexes Plant Physiol Biochem 45 119-128

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Bartsevich VV and Pakrasi HB (1995) Molecular identification of an ABC transporter complex for manganese analysis of acyanobacterial mutant strain impaired in the photosynthetic oxygen evolution process EMBO J 14 1845-1853

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Bartsevich VV and Pakrasi HB (1996) Manganese transport in the cyanobacterium Synechocystis sp PCC 6803 J Biol Chem271 26057-26061

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Bernaacutet G Waschewski N and Roumlgner M (2009) Towards efficient hydrogen production the impact of antenna size andexternal factors on electron transport dynamics in Synechocystis PCC 6803 Photosynth Res 99 205-216

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Boehm M Yu J Krynicka V Barker M Tichy M Komenda J Nixon PJ and Nield J (2012) Subunit Organization of aSynechocystis Hetero-Oligomeric Thylakoid FtsH Complex Involved in Photosystem II Repair Plant Cell 24 3669-3683

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Bradford MM (1976) A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle ofprotein-dye binding Anal Biochem 72 248-254

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Chang L Liu X Li Y Liu C-C Yang F Zhao J and Sui S-F (2015) Structural organization of an intact phycobilisome and itsassociation with photosystem II Cell Res 25 726-737

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Danielsson R Suorsa M Paakkarinen V Albertsson P-Aring Styring S Aro E-M and Mamedov F (2006) Dimeric andmonomeric organization of photosystem II Distribution of five distinct complexes in the different domains of the thylakoidmembrane J Biol Chem 281 14241-14249

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Daum B Nicastro D Austin J McIntosh JR and Kuumlhlbrandt W (2010) Arrangement of photosystem II and ATP synthase in

25

Accession numbers 816

Sequence data from this article can be found in the CyanoBase and EMBLGenBank 817

data libraries under accession number slr0483 818

819

Supplemental Data 820

Supplemental Figure 1 Construction of the curT- mutant 821

Supplemental Figure 2 Growth phenotype of curT- 822

Supplemental Figure 3 Expression analysis of the open reading frame slr0482 (located 823

upstream of curT) in the curT- strain 824

Supplemental Figure 4 Absorbance spectra of curT- and wild-type cells 825

Supplemental Figure 5 High-light growth phenotypes of wild-type Synechocystis 6803 and 826

the curT- strain 827

Supplemental Figure 6 Ultrastructure of the TD41 mutant which lacks the psbA transcript 828

and the D1 protein 829

Supplemental Figure 7 Expression and localization of CurT-CFP 830

Supplemental Figure 8 Localization of CurT and CurT-CFP by fluorescence microscopy 831

Supplemental Figure 9 Chlorophyll autofluorescence of curT- 832

Supplemental Figure 10 The curT- mutant as a negative control for immunogold labeling 833

Supplemental Figure 11 Representative counts of immunogold signals 834

Supplemental Table 1 Overview of immunogold signals in curT- cells 835

Supplemental Table 2 Overview of immunogold signals in specific regions of Synechocystis 836

6803 wild-type cells 837

Supplemental Table 3 Statistical analysis of immunogold signals for wild-type 838

Synechocystis 6803 cells 839

Supplemental Table 4 Co-expression of curT 840

Supplemental Movie 1 Scan through the Z-axis of a curT-CFP cell 841

Supplemental Movie 2 Rendered 3D-model of a CurT-CFP detection 842

Supplemental Movie 3 Scan through the Z-axis of a curT-CFP cell with a traversing 843

thylakoid lamella 844

845

Acknowledgements 846

We thank Y Nishiyama for providing αpD1 and J Soll for αVIPP1 and αYidC antibodies 847

respectively and Nina Dyczmons-Nowaczyk for support with the fluorescence measurements 848

This work was supported by grants awarded to JN (Ni3909) MMN (NO 8363) and DL 849

26

(Le126529) by the Deutsche Forschungsgemeinschaft in the context of Research Unit 850

FOR2092 and the Cluster of Excellence RESOLV (EXC 1069) AG is a Howard Hughes 851

Medical Institute postdoctoral fellow in the laboratory of Erin OrsquoShea at Harvard University 852

LS was supported by a PhD fellowship from the Chinese Scholarship Council 853

854

Author Contributions 855

SH AR LS MMN DL and JN designed the research SH AR LS AG ILG EH ML BR 856

SV performed the research all authors contributed to data analysis SH AR and JN wrote the 857

paper 858

859

Competing Financial Interest statement 860

The authors declare no competing financial interests 861

862

We wish to dedicate this paper to Fabrice Rappaport an outstanding colleague and friend who 863

passed away so early 864

865

27

References 866

Allen JF de Paula WBM Puthiyaveetil S and Nield J (2011) A structural 867

phylogenetic map for chloroplast photosynthesis Trends Plant Sci 16 645-655 868

Anderson JM Horton P Kim E-H and Chow WS (2012) Towards elucidation of 869

dynamic structural changes of plant thylakoid architecture Philos Trans R Soc 870

Lond B Biol Sci 367 3515-3524 871

Armbruster U Zuumlhlke J Rengstl B Kreller R Makarenko E Ruumlhle T Schuumlnemann 872

D Jahns P Weisshaar B Nickelsen J and Leister D (2010) The Arabidopsis 873

thylakoid protein PAM68 is required for efficient D1 biogenesis and photosystem II 874

assembly Plant Cell 22 3439-3460 875

Armbruster U Labs M Pribil M Viola S Xu W Scharfenberg M Hertle AP 876

Rojahn U Jensen PE Rappaport F Joliot P Doumlrmann P Wanner G and 877

Leister D (2013) Arabidopsis CURVATURE THYLAKOID1 proteins modify 878

thylakoid architecture by inducing membrane curvature Plant Cell 25 2661-2678 879

Aseeva E Ossenbuumlhl F Sippel C Cho WK Stein B Eichacker LA Meurer J 880

Wanner G Westhoff P Soll J and Vothknecht UC (2007) Vipp1 is required for 881

basic thylakoid membrane formation but not for the assembly of thylakoid protein 882

complexes Plant Physiol Biochem 45 119-128 883

Bartsevich VV and Pakrasi HB (1995) Molecular identification of an ABC transporter 884

complex for manganese analysis of a cyanobacterial mutant strain impaired in the 885

photosynthetic oxygen evolution process EMBO J 14 1845-1853 886

Bartsevich VV and Pakrasi HB (1996) Manganese transport in the cyanobacterium 887

Synechocystis sp PCC 6803 J Biol Chem 271 26057-26061 888

Bernaacutet G Waschewski N and Roumlgner M (2009) Towards efficient hydrogen production 889

the impact of antenna size and external factors on electron transport dynamics in 890

Synechocystis PCC 6803 Photosynth Res 99 205-216 891

Boehm M Yu J Krynicka V Barker M Tichy M Komenda J Nixon PJ and Nield 892

J (2012) Subunit Organization of a Synechocystis Hetero-Oligomeric Thylakoid FtsH893

Complex Involved in Photosystem II Repair Plant Cell 24 3669-3683894

Bradford MM (1976) A rapid and sensitive method for the quantitation of microgram 895

quantities of protein utilizing the principle of protein-dye binding Anal Biochem 72 896

248-254897

28

Chang L Liu X Li Y Liu C-C Yang F Zhao J and Sui S-F (2015) Structural 898

organization of an intact phycobilisome and its association with photosystem II Cell 899

Res 25 726-737 900

Danielsson R Suorsa M Paakkarinen V Albertsson P-Aring Styring S Aro E-M and 901

Mamedov F (2006) Dimeric and monomeric organization of photosystem II 902

Distribution of five distinct complexes in the different domains of the thylakoid 903

membrane J Biol Chem 281 14241-14249 904

Daum B Nicastro D Austin J McIntosh JR and Kuumlhlbrandt W (2010) Arrangement 905

of photosystem II and ATP synthase in chloroplast membranes of Spinach and Pea 906

Plant Cell 22 1299-1312 907

Engel BD Schaffer M Kuhn Cuellar L Villa E Plitzko JM and Baumeister W 908

(2015) Native architecture of the Chlamydomonas chloroplast revealed by in situ 909

cryo-electron tomography eLife 4 e04889 910

Ford MGJ Mills IG Peter BJ Vallis Y Praefcke GJK Evans PR and McMahon 911

HT (2002) Curvature of clathrin-coated pits driven by epsin Nature 419 361-366 912

Fristedt R Willig A Granath P Cregravevecoeur M Rochaix J-D and Vener AV (2009) 913

Phosphorylation of photosystem II controls functional macroscopic folding of 914

photosynthetic membranes in Arabidopsis Plant Cell 21 3950-3964 915

Gallop JL and McMahon HT (2005) BAR domains and membrane curvature bringing 916

your curves to the BAR Biochem Soc Symp 72 223-231 917

Gibson DG (2011) Chapter fifteen - Enzymatic Assembly of Overlapping DNA Fragments 918

In Methods in Enzymology V Christopher ed (Academic Press) pp 349-361 919

Goedhart J von Stetten D Noirclerc-Savoye M Lelimousin M Joosen L Hink MA 920

van Weeren L Gadella TWJ and Royant A (2012) Structure-guided evolution of 921

cyan fluorescent proteins towards a quantum yield of 93 Nat Commun 3 751 922

Heinz S Liauw P Nickelsen J and Nowaczyk M (2016) Analysis of photosystem II 923

biogenesis in cyanobacteria Biochim Biophys Acta 1857 274-287 924

Hernaacutendez-Prieto M and Futschik M (2012) CyanoEXpress A web database for 925

exploration and visualisation of the integrated transcriptome of cyanobacterium 926

Synechocystis sp PCC6803 Bioinformation 8 634-638 927

Hernaacutendez-Prieto MA Semeniuk TA Giner-Lamia J and Futschik ME (2016) The 928

Transcriptional Landscape of the Photosynthetic Model Cyanobacterium 929

Synechocystis sp PCC6803 Sci Rep 6 22168 930

29

Huang F Fulda S Hagemann M and Norling B (2006) Proteomic screening of salt-931

stress-induced changes in plasma membranes of Synechocystis sp strain PCC 6803 932

Proteomics 6 910-920 933

Kirchhoff H (2013) Architectural switches in plant thylakoid membranes Photosynth Res 934

116 481-487 935

Klinkert B Elles I and Nickelsen J (2006) Translation of chloroplast psbD mRNA in 936

Chlamydomonas is controlled by a secondary RNA structure blocking the AUG start 937

codon Nucleic Acids Res 34 386-394 938

Klinkert B Ossenbuumlhl F Sikorski M Berry S Eichacker L and Nickelsen J (2004) 939

PratA a periplasmic tetratricopeptide repeat protein involved in biogenesis of 940

photosystem II in Synechocystis sp PCC 6803 J Biol Chem 279 44639-44644 941

Komenda J Nickelsen J Tichyacute M Praacutešil O Eichacker LA and Nixon PJ (2008) The 942

cyanobacterial homologue of HCF136YCF48 is a component of an early photosystem 943

II assembly complex and is important for both the efficient assembly and repair of 944

photosystem II in Synechocystis sp PCC 6803 J Biol Chem 283 22390-22399 945

Kopf M Klaumlhn S Scholz I Matthiessen JKF Hess WR and Voszlig B (2014) 946

Comparative analysis of the primary transcriptome of Synechocystis sp PCC 6803 947

DNA Res 21 527-539 948

Kunkel DD (1982) Thylakoid centers Structures associated with the cyanobacterial 949

photosynthetic membrane system Arch Microbiol 133 97-99 950

Liberton M Howard Berg R Heuser J Roth R and Pakrasi BH (2006) Ultrastructure 951

of the membrane systems in the unicellular cyanobacterium Synechocystis sp strain 952

PCC 6803 Protoplasma 227 129-138 953

Liberton M Saha R Jacobs JM Nguyen AY Gritsenko MA Smith RD 954

Koppenaal DW and Pakrasi HB (2016) Global Proteomic Analysis Reveals an 955

Exclusive Role of Thylakoid Membranes in Bioenergetics of a Model 956

Cyanobacterium Mol Cell Proteomics 15 2021-2032 957

Luque I and Ochoa de Alda JAG (2014) CURT1CAAD-containing aaRSs thylakoid 958

curvature and gene translation Trends Plant Sci 19 63-66 959

Marin K Stirnberg M Eisenhut M Kraumlmer R and Hagemann M (2006) Osmotic stress 960

in Synechocystis sp PCC 6803 low tolerance towards nonionic osmotic stress results 961

from lacking activation of glucosylglycerol accumulation Microbiology 152 2023-962

2030 963

Mullineaux CW (2005) Function and evolution of grana Trends Plant Sci 10 521-525 964

30

Mullineaux CW (2008) Biogenesis and dynamics of thylakoid membranes and the 965

photosynthetic apparatus In The Cyanobacteria A Herrero and E Flores eds 966

(Norfolk UK Caister Academic Press) pp 289ndash304 967

Nevo R Charuvi D Tsabari O and Reich Z (2012) Composition architecture and 968

dynamics of the photosynthetic apparatus in higher plants Plant J 70 157-176 969

Nickelsen J and Rengstl B (2013) Photosystem II assembly From cyanobacteria to plants 970

Annu Rev Plant Biol 64 609-635 971

Nickelsen J and Zerges W (2013) Thylakoid biogenesis has joined the new era of bacterial 972

cell biology Front Plant Sci 4 458 973

Nilsson F Simpson DJ Jansson C and Andersson B (1992) Ultrastructural and 974

biochemical characterization of a Synechocystis 6803 mutant with inactivated psbA 975

genes Arch Biochem Biophys 295 340-347 976

Odom WR Hodges R Chitnis PR and Guikema JA (1993) Characterization of 977

Synechocystis sp PCC 6803 in iron-supplied and iron-deficient media Plant Mol 978

Biol 23 1255-1264 979

Ossenbuumlhl F Inaba-Sulpice M Meurer J Soll J and Eichacker LA (2006) The 980

Synechocystis sp PCC 6803 Oxa1 homolog is essential for membrane integration of 981

reaction center precursor protein pD1 Plant Cell 18 2236-2246 982

Pisareva T Kwon J Oh J Kim S Ge C Wieslander Aring Choi J-S and Norling B 983

(2011) Model for Membrane Organization and Protein Sorting in the Cyanobacterium 984

Synechocystis sp PCC 6803 Inferred from Proteomics and Multivariate Sequence 985

Analyses J Proteome Res 10 3617-3631 986

Pribil M Labs M and Leister D (2014) Structure and dynamics of thylakoids in land 987

plants J Exp Bot 65 1955-1972 988

Rast A Heinz S and Nickelsen J (2015) Biogenesis of thylakoid membranes Biochim 989

Biophys Acta 1847 821-830 990

Rast A Rengstl B Heinz S Klingl A and Nickelsen J (2016) The role of Slr0151 a 991

tetratricopeptide repeat protein from Synechocystis sp PCC 6803 during Photosystem 992

II assembly and repair Front Plant Sci 7 605 993

Rengstl B Oster U Stengel A and Nickelsen J (2011) An Intermediate Membrane 994

Subfraction in Cyanobacteria Is Involved in an Assembly Network for Photosystem II 995

Biogenesis J Biol Chem 286 21944-21951 996

31

Rengstl B Knoppovaacute J Komenda J and Nickelsen J (2013) Characterization of a 997

Synechocystis double mutant lacking the photosystem II assembly factors YCF48 and 998

Sll0933 Planta 237 471-480 999

Rexroth S Mullineaux CW Ellinger D Sendtko E Roumlgner M and Koenig F (2011) 1000

The Plasma Membrane of the Cyanobacterium Gloeobacter violaceus Contains 1001

Segregated Bioenergetic Domains Plant Cell 23 2379-2390 1002

Rippka R Deruelles J Waterbury JB Herdman M and Stanier RY (1979) Generic 1003

Assignments Strain Histories and Properties of Pure Cultures of Cyanobacteria 1004

Microbiology 111 1-61 1005

Ruumltgers M and Schroda M (2013) A role of VIPP1 as a dynamic structure within 1006

thylakoid centers as sites of photosystem biogenesis Plant Signal Behav 8 e27037 1007

Sacharz J Bryan SJ Yu J Burroughs NJ Spence EM Nixon PJ and Mullineaux 1008

CW (2015) Sub-cellular location of FtsH proteases in the cyanobacterium1009

Synechocystis sp PCC 6803 suggests localised PSII repair zones in the thylakoid1010

membranes Mol Microbiol 96 448-4621011

Sandstroumlm S Park Y-I Oumlquist G and Gustafsson P (2001) CP43prime the isiA Gene 1012

Product Functions as an Excitation Energy Dissipator in the Cyanobacterium 1013

Synechococcus sp PCC 7942 Photochem Photobiol 74 431-437 1014

Schindelin J Arganda-Carreras I Frise E Kaynig V Longair M Pietzsch T 1015

Preibisch S Rueden C Saalfeld S Schmid B Tinevez J-Y White DJ 1016

Hartenstein V Eliceiri K Tomancak P and Cardona A (2012) Fiji an open-1017

source platform for biological-image analysis Nat Methods 9 676-682 1018

Schottkowski M Ratke J Oster U Nowaczyk M and Nickelsen J (2009a) Pitt a novel 1019

tetratricopeptide repeat protein involved in light-dependent chlorophyll biosynthesis 1020

and thylakoid membrane biogenesis in Synechocystis sp PCC 6803 Mol Plant 2 1021

1289-1297 1022

Schottkowski M Gkalympoudis S Tzekova N Stelljes C Schuumlnemann D Ankele E 1023

and Nickelsen J (2009b) Interaction of the periplasmic PratA factor and the PsbA 1024

(D1) protein during biogenesis of photosystem II in Synechocystis sp PCC 6803 J 1025

Biol Chem 284 1813-1819 1026

Selatildeo TT Zhang L Knoppovaaacute J Komenda J and Norling B (2016) Photosystem II 1027

Assembly Steps Take Place in the Thylakoid Membrane of the Cyanobacterium 1028

Synechocystis sp PCC6803 Plant Cell Physiol 57 878 1029

32

Spaumlt P Maček B and Forchhammer K (2015) Phosphoproteome of the cyanobacterium 1030

Synechocystis sp PCC 6803 and its dynamics during nitrogen starvation Front 1031

Microbiol 6 248 1032

Stengel A Guumlgel IL Hilger D Rengstl B Jung H and Nickelsen J (2012) Initial 1033

steps of photosystem II de novo assembly and preloading with manganese take place 1034

in biogenesis centers in Synechocystis Plant Cell 24 660-675 1035

Uniacke J and Zerges W (2007) Photosystem II assembly and repair are differentially 1036

localized in Chlamydomonas Plant Cell 19 3640-3654 1037

Uniacke J and Zerges W (2009) Chloroplast protein targeting involves localized 1038

translation in Chlamydomonas Proc Natl Acad Sci USA 106 1439-1444 1039

van de Meene AL Hohmann-Marriott M Vermaas WJ and Roberson R (2006) The 1040

three-dimensional structure of the cyanobacterium Synechocystis sp PCC 6803 Arch 1041

Microbiol 184 259-270 1042

van de Meene AML Sharp WP McDaniel JH Friedrich H Vermaas WFJ and 1043

Roberson RW (2012) Gross morphological changes in thylakoid membrane 1044

structure are associated with photosystem I deletion in Synechocystis sp PCC 6803 1045

Biochim Biophys Acta 1818 1427-1434 1046

Watanabe M and Ikeuchi M (2013) Phycobilisome architecture of a light-harvesting 1047

supercomplex Photosynth Res 116 265-276 1048

Wellburn AR and Lichtenthaler H (1984) Formulae and Program to Determine Total 1049

Carotenoids and Chlorophylls A and B of Leaf Extracts in Different Solvents In 1050

Advances in Photosynthesis Research Proceedings of the VIth International Congress 1051

on Photosynthesis Brussels Belgium August 1ndash6 1983 C Sybesma ed (Dordrecht 1052

Springer Netherlands) pp 9-12 1053

Wilde A Lunser K Ossenbuumlhl F Nickelsen J and Borner T (2001) Characterization of 1054

the cyanobacterial ycf37 mutation decreases the photosystem I content Biochem J 1055

357 211-216 1056

Wilson A Boulay C Wilde A Kerfeld CA and Kirilovsky D (2007) Light-Induced 1057

Energy Dissipation in Iron-Starved Cyanobacteria Roles of OCP and IsiA Proteins 1058

Plant Cell 19 656-672 1059

Xu M Bernaacutet G Singh A Mi H Roumlgner M Pakrasi HB and Ogawa T (2008) 1060

Properties of Mutants of Synechocystis sp Strain PCC 6803 Lacking Inorganic Carbon 1061

Sequestration Systems Plant Cell Physiol 49 1672-1677 1062

33

Yamamoto T Burke J Autz G and Jagendorf AT (1981) Bound ribosomes of Pea 1063

chloroplast thylakoid membranes location and release in vitro by high salt 1064

puromycin and RNase Plant Physiol 67 940-949 1065

Yang H Liao L Bo T Zhao L Sun X Lu X Norling B and Huang F (2014) 1066

Slr0151 in Synechocystis sp PCC 6803 is required for efficient repair of photosystem 1067

II under high-light condition J Integr Plant Biol 56 1136-1150 1068

Yeremenko N Kouřil R Ihalainen JA DHaene S van Oosterwijk N 1069

Andrizhiyevskaya EG Keegstra W Dekker HL Hagemann M Boekema EJ 1070

Matthijs HCP and Dekker JP (2004) Supramolecular Organization and Dual 1071

Function of the IsiA Chlorophyll-Binding Protein in Cyanobacteria Biochemistry 43 1072

10308-10313 1073

Zak E Norling B Maitra R Huang F Andersson B and Pakrasi HB (2001) The 1074

initial steps of biogenesis of cyanobacterial photosystems occur in plasma membranes 1075

Proc Natl Acad Sci USA 98 13443-13448 1076

Zang X Liu B Liu S Arunakumara KKIU and Zhang X (2007) Optimum 1077

Conditions for Transformation of Synechocystis sp PCC 6803 J Microbiol 45 241-1078

245 1079

Zhang L and Sakamoto W (2015) Possible function of VIPP1 in maintaining chloroplast 1080

membranes Biochim Biophys Acta 1847 831-837 1081

Zimmerberg J and Kozlov MM (2006) How proteins produce cellular membrane 1082

curvature Nat Rev Mol Cell Biol 7 9-19 1083

Zoumlfel P (1988) Statistik in der Praxis (Stuttgart Germany Gustav Fischer Verlag) 1084

1085

34

Figure Legends 1086

Figure 1 General characteristics of CurT A) Sequence alignment of CurT and CURT1A-D 1087

from A thaliana Predicted chloroplast transit-peptide sequences of CURT1A-D are omitted 1088

(Armbruster et al 2013) Positions of predicted C-terminal transmembrane domains (TDM) 1089

are marked (black bar) as is the position of the predicted amphipathic N-terminal helix in 1090

CurT (red bar) The green bar denotes the peptide sequence used for antibody production 1091

Identical and related amino acids that are conserved in 100 80 and 60 of the sequences 1092

are highlighted in black dark grey and light grey respectively B) Helical-wheel 1093

representation of the N-terminal amphipathic helix of CurT (red bar in A) The color code 1094

reflects the physicochemical properties of amino-acid side-chains green polar and 1095

uncharged blue polar and positively charged red polar and negatively charged yellow 1096

hydrophobic C) Solubility of CurT Membrane-associated proteins (50 microg) from wild-type 1097

cells were extracted with 5 mM HEPES (pH 76) containing either 1 M NaCl 01 M Na2CO3 1098

4 M urea 01 Triton X-100 or no additional solute After separation of membrane-bound 1099

(M) and solubilized (S) proteins by centrifugation proteins were fractionated by SDS-PAGE1100

and CurT was immunodetected on immunoblots As a control the integral membrane protein 1101

CP47 from PSII was analyzed in parallel D) Transmission electron micrographs of negatively 1102

stained liposomes Cell-free expression (CFE) of CurT and A thaliana CURT1A was 1103

performed in the presence of liposomes similar in composition to the lipids of the thylakoid 1104

membrane Liposomes before and after cell-free protein expression in the absence of DNA 1105

served as negative controls Black arrowheads indicate tubular connections between 1106

liposomes Scale bars 250 nm 1107

1108

Figure 2 Ultrastructural analysis of curT- cells Transmission electron micrographs of typical 1109

wild-type (A) and curT- (B-D) Synechocystis 6803 cells taken at 44000times (A B) and 28000times 1110

(C D) magnification respectively Ultrathin sections (35 to 45 nm) of cryofixed samples 1111

were stained with osmium tetroxide and post-stained using lead citrate Arrowheads indicate 1112

biogenesis centers Scale bars 200 nm (A B) and 500 nm (C D) respectively 1113

1114

Figure 3 Accumulation of components of photosynthetic complexes in the curT- mutant A) 1115

Whole cell extracts (30 microg protein) from wild-type and curT- strains were fractionated by 1116

SDS-PAGE and analyzed on immunoblots using the indicated antibodies B) The histogram 1117

shows levels of the indicated proteins in curT- extracts relative to wild-type samples (dashed 1118

red line) Data are means plusmn SD of three independent experiments Significant differences from 1119

35

wild-type protein levels according to Studentrsquos t-test with error probabilities of 5 and 1 1120

are indicated by and respectively 1121

1122

Figure 4 P700+ reduction kinetics and high-light effects in curT- cells A) Averaged traces 1123

(10 single measurements) of P700+ decay after complete oxidation by a 50-ms multiple 1124

turnover pulse (10000 micromol photons m-2 s-1) in the absence and presence of 10 microM DCMU 1125

B) Rate constants for P700+ reduction were obtained by fitting of the data with single1126

exponential functions Error bars indicate the SD of three independent measurements C) 1127

Impact of light intensity on the (relative) electron transport rate (rETR) Cells were exposed to 1128

gradually increasing light intensities which resulted in increasing electron transport until the 1129

capacity limit was reached PAR light intensity (micromol photons m-2 s-1) Error bars indicate the 1130

SD of three independent measurements D) D1 protein level in wild-type and curT- after high-1131

light treatment (800 micromol photons m-2s-1) in the presence and absence of lincomycin Samples 1132

were taken every 30 min and processed as in Figure 3 to determine the level of D1 present 1133

100 refers to wild-type D1 level at the beginning of the experiment 1134

1135

Figure 5 PSII assembly in curT- cells A) BNSDS-PAGE of membrane proteins Membrane 1136

fractions from wild-type and curT- cells were solubilized with 13 n-dodecyl-β-maltoside 1137

and proteins were fractionated by two-dimensional BNSDS-PAGE blotted and probed with 1138

antibodies against the PSII subunits D1 D2 CP47 and CP43 Wild-type blots were also 1139

probed with the αCurT antibody The sizes of marker proteins and the positions of PSII 1140

assembly intermediates (RCCII RCCI RC47) are shown above and below each image B) In 1141

vivo pulse labeling of membrane proteins with 35S Pulse-labeled PSII core proteins were 1142

separated via BNSDS-PAGE and visualized by autoradiography 1143

1144

Figure 6 Loss of CurT induces stress A) Low-temperature (77 K) fluorescence emission of 1145

Synechocystis 6803 wild-type (blue) and curT- (red) cells excited at 440 nm The spectra were 1146

normalized to the added fluorescein standard B) Low-temperature (77 K) fluorescence 1147

emission of Synechocystis 6803 wild-type (blue) and curT- (red) excited at 580 nm The 1148

spectra were normalized to 780 nm C) Level of IsiA in the curT- mutant relative to the wild-1149

type A mean value of 368 plusmn 96 (SD) was determined from three independent experiments 1150

1151

Figure 7 Membrane sublocalization of PSII-related factors Cell extracts from wild-type and 1152

curT- cells were fractionated by two consecutive rounds of sucrose-density gradient 1153

36

centrifugation (Schottkowski et al 2009b) The second linear gradient (20-60 sucrose) was 1154

apportioned into 14 fractions which were analyzed by immunoblotting using the indicated 1155

antibodies Fractions 1ndash6 represent PDMs and fractions 7ndash14 thylakoid membranes (TMs) 1156

To facilitate comparison between gradients sample volumes were normalized to the volume 1157

of fraction 7 that contained 40 microg of protein 1158

1159

Figure 8 Live-cell imaging of the curT-CFP strain by fluorescence microscopy In the curT-1160

CFP strain the native curT gene has been replaced by a CFP-tagged version resulting in the 1161

expression of the CurT-CFP fusion protein under the control of the native promotor A) 1162

Close-up views of the mid-cell plane in the CFP and far-red autofluorescence channels shown 1163

in slice 7 in panel B B) Synechocystis 6803 cells expressing CurT C-terminally fused to the 1164

mTurquoise2 variant of CFP from its native chromosomal promoter The two imaging 1165

channels are displayed as Z-axis montages (auto-scaled contrast step size 250 nm) in 1166

grayscale and color composite configuration The thylakoid autofluorescent channel as 1167

imaged in far-red fluorescence is depicted in magenta and CurT signal as imaged in cyan 1168

fluorescence is depicted in cyan C) Fluorescence intensity profiles of the two channels along 1169

the autofluorescent peripheral cell ldquoringrdquo are shown for slice 7 The maximum projection of 1170

the entire Z montage is also shown Scale bars (light grey) 2 microm 1171

1172

Figure 9 Immunofluorescence detection of CurT A) Close-ups of slice 5 in panel B B) 1173

Wild-type Synechocystis 6803 cells labeled with αCurT antibodies and detected with Oregon 1174

Green-conjugated secondary antibodies The Z-axis montages are shown as in Figure 8B 1175

except that the step size is 280 nm (1 to 10) C) Intensity profiles of the two channels along 1176

the autofluorescent peripheral cell ldquoringrdquo are shown for slice 5 The maximum projection of 1177

the entire Z montage is also shown Scale bars (light grey) 2 microm 1178

1179

Figure 10 Subcellular localization of CurT Ultrathin sections of wild-type Synechocystis 1180

6803 cells were incubated with rabbit αCurT prior to incubation with gold-conjugated goat 1181

anti-rabbit IgG A) Negative control (wild-type processed without addition of primary 1182

antibody) B C) Immunogold-labeled sections showing CurT localization at the cytoplasmic 1183

side of the thylakoid membrane D) Cluster formation of CurT signals at a putative biogenesis 1184

center from C E) Biogenesis center from the same cell (C) without any obvious CurT 1185

clustering of gold particles F) Schematic depiction of a wild-type cell (from Figure 2A) with 1186

color-coded curved membranes green = thylakoids that follow the curvature of the cell red = 1187

37

thylakoids that bend away from the plasma membrane yellow = thylakoids that bend toward 1188

the plasma membrane to converge on sites of biogenesis centers G) Relative distribution of 1189

gold signals between convex (dark color) and concave (light color) sides of membranes (n = 1190

1584 signals from a total of 95 cells) The undifferentiated overall signal distribution is given 1191

in blue Bars = 200 nm (overview) and 100 nm (details) 1192

1193

Figure 11 Differentially modified forms of CurT are found in different complexes in PDMs 1194

and thylakoid membranes Samples were isolated by fractionation of wild-type membranes 1195

via two consecutive sucrose density gradients according to Schottkowski et al (2009b) After 1196

density centrifugation samples were applied to BNSDS-PAGE analysis (A) or isoelectric 1197

focusing (B) Numbers on the right indicate the respective fraction from the second gradient 1198

(see Figure 7) Fraction 5 represents the PDMs and fraction 9 the thylakoid membrane 1199

1200

Figure 12 Loss of CurT increases sensitivity to abiotic stress A B) Doubling times of wild-1201

type and curT- under salt stress (A) or osmotic stress (B) Doubling times are means plusmn SD of 1202

three independent cultures C) Localization of CurT-CFP under salt and osmotic stress 1203

Samples were examined as described in Figure 8 Scale bars 1 microm D) Protein levels of wild-1204

type cells after growth in BG11 medium containing 500 mM NaCl Samples were analyzed on 1205

the same gel but unrelated samples between the presented signals were omitted E) 1206

Membrane preparations obtained from wild-type cells wild-type cells grown in the presence 1207

of 500 mM NaCl and curT- cells were subjected to the first gradient step in the membrane 1208

fractionation scheme The gradient was divided into five fractions and 10 of fractions I-IV 1209

and 02 of fraction V were analyzed by SDS-PAGE Fraction II includes the plasma 1210

membrane and fraction V consists of PratA-defined membrane and thylakoid membrane 1211

1212

Figure 13 Model of CurT distribution at convergence zones in Synechocystis 6803 The 1213

distribution of CurT in thylakoid (green) and plasma membranes (brown) is shown The 1214

pattern of localization of CurT in the thylakoid membrane is derived from membrane 1215

fractionation via sucrose density centrifugation fluorescence-based detection of the CurT-1216

CFP fusion and endogenous CurT and immunogold labeling experiments (Figures 7-10) The 1217

different CurT variants a b c and d identified in the IEF experiments (Figure 11) are depicted 1218

in yellow pink blue and black respectively CurT present in the plasma membrane is 1219

highlighted in gray as its precise nature and role remain to be defined (Figure 12) 1220

Membranes are represented as lipid bilayers Convex and concave faces of bent thylakoid 1221

38

sheets are indicated by black arrows The PDM which is dedicated to PSII assembly and 1222

repair is depicted in blue The dotted blue line emphasizes that the ultrastructure in this region 1223

has not yet been fully resolved PP periplasm PM plasma membrane TM thylakoid 1224

membrane L lumen PDM PratA-defined membrane 1225

1226

Tables 1227

Table 1 Physiological characteristics of the curT- mutant 1228

Strain Doubling time [h]

Oxygen Evolution[nmol h-1 OD750

-1]c

Chlorophyll content

[microg OD750-1]

d

Cell size [microm]e

Cell number [ml-1 OD750

-1]f

Wild type 817plusmn017a 1600plusmn042

b 1933plusmn187 251plusmn014 264plusmn020 390plusmn006 x 107

curT- 1259plusmn020a 3226plusmn056

b 1074plusmn20 195plusmn029 274plusmn044 367plusmn016 x 107

1229 abDoubling times in the presence (a) or absence (b) of 5 mM glucose measured under 1230

continuous illumination at 30 micromol photons m-2 s-1 and CO2-limiting conditions cOxygen 1231

evolution is expressed in nmol O2 produced per hour per OD750 unit dChlorophyll content is 1232

expressed in microg OD750-1 eThe diameter of non-dividing cells is presented in microm fCell number 1233

was determined per ml per OD750 Data are means plusmn SD of at least three independent 1234

experiments 1235

1236

Parsed CitationsAllen JF de Paula WBM Puthiyaveetil S and Nield J (2011) A structural phylogenetic map for chloroplast photosynthesisTrends Plant Sci 16 645-655

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Anderson JM Horton P Kim E-H and Chow WS (2012) Towards elucidation of dynamic structural changes of plant thylakoidarchitecture Philos Trans R Soc Lond B Biol Sci 367 3515-3524

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Armbruster U Zuumlhlke J Rengstl B Kreller R Makarenko E Ruumlhle T Schuumlnemann D Jahns P Weisshaar B NickelsenJ and Leister D (2010) The Arabidopsis thylakoid protein PAM68 is required for efficient D1 biogenesis and photosystem IIassembly Plant Cell 22 3439-3460

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Armbruster U Labs M Pribil M Viola S Xu W Scharfenberg M Hertle AP Rojahn U Jensen PE Rappaport F JoliotP Doumlrmann P Wanner G and Leister D (2013) Arabidopsis CURVATURE THYLAKOID1 proteins modify thylakoid architectureby inducing membrane curvature Plant Cell 25 2661-2678

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Aseeva E Ossenbuumlhl F Sippel C Cho WK Stein B Eichacker LA Meurer J Wanner G Westhoff P Soll J andVothknecht UC (2007) Vipp1 is required for basic thylakoid membrane formation but not for the assembly of thylakoid proteincomplexes Plant Physiol Biochem 45 119-128

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Bartsevich VV and Pakrasi HB (1995) Molecular identification of an ABC transporter complex for manganese analysis of acyanobacterial mutant strain impaired in the photosynthetic oxygen evolution process EMBO J 14 1845-1853

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Bartsevich VV and Pakrasi HB (1996) Manganese transport in the cyanobacterium Synechocystis sp PCC 6803 J Biol Chem271 26057-26061

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Bernaacutet G Waschewski N and Roumlgner M (2009) Towards efficient hydrogen production the impact of antenna size andexternal factors on electron transport dynamics in Synechocystis PCC 6803 Photosynth Res 99 205-216

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Boehm M Yu J Krynicka V Barker M Tichy M Komenda J Nixon PJ and Nield J (2012) Subunit Organization of aSynechocystis Hetero-Oligomeric Thylakoid FtsH Complex Involved in Photosystem II Repair Plant Cell 24 3669-3683

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Bradford MM (1976) A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle ofprotein-dye binding Anal Biochem 72 248-254

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Chang L Liu X Li Y Liu C-C Yang F Zhao J and Sui S-F (2015) Structural organization of an intact phycobilisome and itsassociation with photosystem II Cell Res 25 726-737

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Danielsson R Suorsa M Paakkarinen V Albertsson P-Aring Styring S Aro E-M and Mamedov F (2006) Dimeric andmonomeric organization of photosystem II Distribution of five distinct complexes in the different domains of the thylakoidmembrane J Biol Chem 281 14241-14249

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Daum B Nicastro D Austin J McIntosh JR and Kuumlhlbrandt W (2010) Arrangement of photosystem II and ATP synthase in

26

(Le126529) by the Deutsche Forschungsgemeinschaft in the context of Research Unit 850

FOR2092 and the Cluster of Excellence RESOLV (EXC 1069) AG is a Howard Hughes 851

Medical Institute postdoctoral fellow in the laboratory of Erin OrsquoShea at Harvard University 852

LS was supported by a PhD fellowship from the Chinese Scholarship Council 853

854

Author Contributions 855

SH AR LS MMN DL and JN designed the research SH AR LS AG ILG EH ML BR 856

SV performed the research all authors contributed to data analysis SH AR and JN wrote the 857

paper 858

859

Competing Financial Interest statement 860

The authors declare no competing financial interests 861

862

We wish to dedicate this paper to Fabrice Rappaport an outstanding colleague and friend who 863

passed away so early 864

865

27

References 866

Allen JF de Paula WBM Puthiyaveetil S and Nield J (2011) A structural 867

phylogenetic map for chloroplast photosynthesis Trends Plant Sci 16 645-655 868

Anderson JM Horton P Kim E-H and Chow WS (2012) Towards elucidation of 869

dynamic structural changes of plant thylakoid architecture Philos Trans R Soc 870

Lond B Biol Sci 367 3515-3524 871

Armbruster U Zuumlhlke J Rengstl B Kreller R Makarenko E Ruumlhle T Schuumlnemann 872

D Jahns P Weisshaar B Nickelsen J and Leister D (2010) The Arabidopsis 873

thylakoid protein PAM68 is required for efficient D1 biogenesis and photosystem II 874

assembly Plant Cell 22 3439-3460 875

Armbruster U Labs M Pribil M Viola S Xu W Scharfenberg M Hertle AP 876

Rojahn U Jensen PE Rappaport F Joliot P Doumlrmann P Wanner G and 877

Leister D (2013) Arabidopsis CURVATURE THYLAKOID1 proteins modify 878

thylakoid architecture by inducing membrane curvature Plant Cell 25 2661-2678 879

Aseeva E Ossenbuumlhl F Sippel C Cho WK Stein B Eichacker LA Meurer J 880

Wanner G Westhoff P Soll J and Vothknecht UC (2007) Vipp1 is required for 881

basic thylakoid membrane formation but not for the assembly of thylakoid protein 882

complexes Plant Physiol Biochem 45 119-128 883

Bartsevich VV and Pakrasi HB (1995) Molecular identification of an ABC transporter 884

complex for manganese analysis of a cyanobacterial mutant strain impaired in the 885

photosynthetic oxygen evolution process EMBO J 14 1845-1853 886

Bartsevich VV and Pakrasi HB (1996) Manganese transport in the cyanobacterium 887

Synechocystis sp PCC 6803 J Biol Chem 271 26057-26061 888

Bernaacutet G Waschewski N and Roumlgner M (2009) Towards efficient hydrogen production 889

the impact of antenna size and external factors on electron transport dynamics in 890

Synechocystis PCC 6803 Photosynth Res 99 205-216 891

Boehm M Yu J Krynicka V Barker M Tichy M Komenda J Nixon PJ and Nield 892

J (2012) Subunit Organization of a Synechocystis Hetero-Oligomeric Thylakoid FtsH893

Complex Involved in Photosystem II Repair Plant Cell 24 3669-3683894

Bradford MM (1976) A rapid and sensitive method for the quantitation of microgram 895

quantities of protein utilizing the principle of protein-dye binding Anal Biochem 72 896

248-254897

28

Chang L Liu X Li Y Liu C-C Yang F Zhao J and Sui S-F (2015) Structural 898

organization of an intact phycobilisome and its association with photosystem II Cell 899

Res 25 726-737 900

Danielsson R Suorsa M Paakkarinen V Albertsson P-Aring Styring S Aro E-M and 901

Mamedov F (2006) Dimeric and monomeric organization of photosystem II 902

Distribution of five distinct complexes in the different domains of the thylakoid 903

membrane J Biol Chem 281 14241-14249 904

Daum B Nicastro D Austin J McIntosh JR and Kuumlhlbrandt W (2010) Arrangement 905

of photosystem II and ATP synthase in chloroplast membranes of Spinach and Pea 906

Plant Cell 22 1299-1312 907

Engel BD Schaffer M Kuhn Cuellar L Villa E Plitzko JM and Baumeister W 908

(2015) Native architecture of the Chlamydomonas chloroplast revealed by in situ 909

cryo-electron tomography eLife 4 e04889 910

Ford MGJ Mills IG Peter BJ Vallis Y Praefcke GJK Evans PR and McMahon 911

HT (2002) Curvature of clathrin-coated pits driven by epsin Nature 419 361-366 912

Fristedt R Willig A Granath P Cregravevecoeur M Rochaix J-D and Vener AV (2009) 913

Phosphorylation of photosystem II controls functional macroscopic folding of 914

photosynthetic membranes in Arabidopsis Plant Cell 21 3950-3964 915

Gallop JL and McMahon HT (2005) BAR domains and membrane curvature bringing 916

your curves to the BAR Biochem Soc Symp 72 223-231 917

Gibson DG (2011) Chapter fifteen - Enzymatic Assembly of Overlapping DNA Fragments 918

In Methods in Enzymology V Christopher ed (Academic Press) pp 349-361 919

Goedhart J von Stetten D Noirclerc-Savoye M Lelimousin M Joosen L Hink MA 920

van Weeren L Gadella TWJ and Royant A (2012) Structure-guided evolution of 921

cyan fluorescent proteins towards a quantum yield of 93 Nat Commun 3 751 922

Heinz S Liauw P Nickelsen J and Nowaczyk M (2016) Analysis of photosystem II 923

biogenesis in cyanobacteria Biochim Biophys Acta 1857 274-287 924

Hernaacutendez-Prieto M and Futschik M (2012) CyanoEXpress A web database for 925

exploration and visualisation of the integrated transcriptome of cyanobacterium 926

Synechocystis sp PCC6803 Bioinformation 8 634-638 927

Hernaacutendez-Prieto MA Semeniuk TA Giner-Lamia J and Futschik ME (2016) The 928

Transcriptional Landscape of the Photosynthetic Model Cyanobacterium 929

Synechocystis sp PCC6803 Sci Rep 6 22168 930

29

Huang F Fulda S Hagemann M and Norling B (2006) Proteomic screening of salt-931

stress-induced changes in plasma membranes of Synechocystis sp strain PCC 6803 932

Proteomics 6 910-920 933

Kirchhoff H (2013) Architectural switches in plant thylakoid membranes Photosynth Res 934

116 481-487 935

Klinkert B Elles I and Nickelsen J (2006) Translation of chloroplast psbD mRNA in 936

Chlamydomonas is controlled by a secondary RNA structure blocking the AUG start 937

codon Nucleic Acids Res 34 386-394 938

Klinkert B Ossenbuumlhl F Sikorski M Berry S Eichacker L and Nickelsen J (2004) 939

PratA a periplasmic tetratricopeptide repeat protein involved in biogenesis of 940

photosystem II in Synechocystis sp PCC 6803 J Biol Chem 279 44639-44644 941

Komenda J Nickelsen J Tichyacute M Praacutešil O Eichacker LA and Nixon PJ (2008) The 942

cyanobacterial homologue of HCF136YCF48 is a component of an early photosystem 943

II assembly complex and is important for both the efficient assembly and repair of 944

photosystem II in Synechocystis sp PCC 6803 J Biol Chem 283 22390-22399 945

Kopf M Klaumlhn S Scholz I Matthiessen JKF Hess WR and Voszlig B (2014) 946

Comparative analysis of the primary transcriptome of Synechocystis sp PCC 6803 947

DNA Res 21 527-539 948

Kunkel DD (1982) Thylakoid centers Structures associated with the cyanobacterial 949

photosynthetic membrane system Arch Microbiol 133 97-99 950

Liberton M Howard Berg R Heuser J Roth R and Pakrasi BH (2006) Ultrastructure 951

of the membrane systems in the unicellular cyanobacterium Synechocystis sp strain 952

PCC 6803 Protoplasma 227 129-138 953

Liberton M Saha R Jacobs JM Nguyen AY Gritsenko MA Smith RD 954

Koppenaal DW and Pakrasi HB (2016) Global Proteomic Analysis Reveals an 955

Exclusive Role of Thylakoid Membranes in Bioenergetics of a Model 956

Cyanobacterium Mol Cell Proteomics 15 2021-2032 957

Luque I and Ochoa de Alda JAG (2014) CURT1CAAD-containing aaRSs thylakoid 958

curvature and gene translation Trends Plant Sci 19 63-66 959

Marin K Stirnberg M Eisenhut M Kraumlmer R and Hagemann M (2006) Osmotic stress 960

in Synechocystis sp PCC 6803 low tolerance towards nonionic osmotic stress results 961

from lacking activation of glucosylglycerol accumulation Microbiology 152 2023-962

2030 963

Mullineaux CW (2005) Function and evolution of grana Trends Plant Sci 10 521-525 964

30

Mullineaux CW (2008) Biogenesis and dynamics of thylakoid membranes and the 965

photosynthetic apparatus In The Cyanobacteria A Herrero and E Flores eds 966

(Norfolk UK Caister Academic Press) pp 289ndash304 967

Nevo R Charuvi D Tsabari O and Reich Z (2012) Composition architecture and 968

dynamics of the photosynthetic apparatus in higher plants Plant J 70 157-176 969

Nickelsen J and Rengstl B (2013) Photosystem II assembly From cyanobacteria to plants 970

Annu Rev Plant Biol 64 609-635 971

Nickelsen J and Zerges W (2013) Thylakoid biogenesis has joined the new era of bacterial 972

cell biology Front Plant Sci 4 458 973

Nilsson F Simpson DJ Jansson C and Andersson B (1992) Ultrastructural and 974

biochemical characterization of a Synechocystis 6803 mutant with inactivated psbA 975

genes Arch Biochem Biophys 295 340-347 976

Odom WR Hodges R Chitnis PR and Guikema JA (1993) Characterization of 977

Synechocystis sp PCC 6803 in iron-supplied and iron-deficient media Plant Mol 978

Biol 23 1255-1264 979

Ossenbuumlhl F Inaba-Sulpice M Meurer J Soll J and Eichacker LA (2006) The 980

Synechocystis sp PCC 6803 Oxa1 homolog is essential for membrane integration of 981

reaction center precursor protein pD1 Plant Cell 18 2236-2246 982

Pisareva T Kwon J Oh J Kim S Ge C Wieslander Aring Choi J-S and Norling B 983

(2011) Model for Membrane Organization and Protein Sorting in the Cyanobacterium 984

Synechocystis sp PCC 6803 Inferred from Proteomics and Multivariate Sequence 985

Analyses J Proteome Res 10 3617-3631 986

Pribil M Labs M and Leister D (2014) Structure and dynamics of thylakoids in land 987

plants J Exp Bot 65 1955-1972 988

Rast A Heinz S and Nickelsen J (2015) Biogenesis of thylakoid membranes Biochim 989

Biophys Acta 1847 821-830 990

Rast A Rengstl B Heinz S Klingl A and Nickelsen J (2016) The role of Slr0151 a 991

tetratricopeptide repeat protein from Synechocystis sp PCC 6803 during Photosystem 992

II assembly and repair Front Plant Sci 7 605 993

Rengstl B Oster U Stengel A and Nickelsen J (2011) An Intermediate Membrane 994

Subfraction in Cyanobacteria Is Involved in an Assembly Network for Photosystem II 995

Biogenesis J Biol Chem 286 21944-21951 996

31

Rengstl B Knoppovaacute J Komenda J and Nickelsen J (2013) Characterization of a 997

Synechocystis double mutant lacking the photosystem II assembly factors YCF48 and 998

Sll0933 Planta 237 471-480 999

Rexroth S Mullineaux CW Ellinger D Sendtko E Roumlgner M and Koenig F (2011) 1000

The Plasma Membrane of the Cyanobacterium Gloeobacter violaceus Contains 1001

Segregated Bioenergetic Domains Plant Cell 23 2379-2390 1002

Rippka R Deruelles J Waterbury JB Herdman M and Stanier RY (1979) Generic 1003

Assignments Strain Histories and Properties of Pure Cultures of Cyanobacteria 1004

Microbiology 111 1-61 1005

Ruumltgers M and Schroda M (2013) A role of VIPP1 as a dynamic structure within 1006

thylakoid centers as sites of photosystem biogenesis Plant Signal Behav 8 e27037 1007

Sacharz J Bryan SJ Yu J Burroughs NJ Spence EM Nixon PJ and Mullineaux 1008

CW (2015) Sub-cellular location of FtsH proteases in the cyanobacterium1009

Synechocystis sp PCC 6803 suggests localised PSII repair zones in the thylakoid1010

membranes Mol Microbiol 96 448-4621011

Sandstroumlm S Park Y-I Oumlquist G and Gustafsson P (2001) CP43prime the isiA Gene 1012

Product Functions as an Excitation Energy Dissipator in the Cyanobacterium 1013

Synechococcus sp PCC 7942 Photochem Photobiol 74 431-437 1014

Schindelin J Arganda-Carreras I Frise E Kaynig V Longair M Pietzsch T 1015

Preibisch S Rueden C Saalfeld S Schmid B Tinevez J-Y White DJ 1016

Hartenstein V Eliceiri K Tomancak P and Cardona A (2012) Fiji an open-1017

source platform for biological-image analysis Nat Methods 9 676-682 1018

Schottkowski M Ratke J Oster U Nowaczyk M and Nickelsen J (2009a) Pitt a novel 1019

tetratricopeptide repeat protein involved in light-dependent chlorophyll biosynthesis 1020

and thylakoid membrane biogenesis in Synechocystis sp PCC 6803 Mol Plant 2 1021

1289-1297 1022

Schottkowski M Gkalympoudis S Tzekova N Stelljes C Schuumlnemann D Ankele E 1023

and Nickelsen J (2009b) Interaction of the periplasmic PratA factor and the PsbA 1024

(D1) protein during biogenesis of photosystem II in Synechocystis sp PCC 6803 J 1025

Biol Chem 284 1813-1819 1026

Selatildeo TT Zhang L Knoppovaaacute J Komenda J and Norling B (2016) Photosystem II 1027

Assembly Steps Take Place in the Thylakoid Membrane of the Cyanobacterium 1028

Synechocystis sp PCC6803 Plant Cell Physiol 57 878 1029

32

Spaumlt P Maček B and Forchhammer K (2015) Phosphoproteome of the cyanobacterium 1030

Synechocystis sp PCC 6803 and its dynamics during nitrogen starvation Front 1031

Microbiol 6 248 1032

Stengel A Guumlgel IL Hilger D Rengstl B Jung H and Nickelsen J (2012) Initial 1033

steps of photosystem II de novo assembly and preloading with manganese take place 1034

in biogenesis centers in Synechocystis Plant Cell 24 660-675 1035

Uniacke J and Zerges W (2007) Photosystem II assembly and repair are differentially 1036

localized in Chlamydomonas Plant Cell 19 3640-3654 1037

Uniacke J and Zerges W (2009) Chloroplast protein targeting involves localized 1038

translation in Chlamydomonas Proc Natl Acad Sci USA 106 1439-1444 1039

van de Meene AL Hohmann-Marriott M Vermaas WJ and Roberson R (2006) The 1040

three-dimensional structure of the cyanobacterium Synechocystis sp PCC 6803 Arch 1041

Microbiol 184 259-270 1042

van de Meene AML Sharp WP McDaniel JH Friedrich H Vermaas WFJ and 1043

Roberson RW (2012) Gross morphological changes in thylakoid membrane 1044

structure are associated with photosystem I deletion in Synechocystis sp PCC 6803 1045

Biochim Biophys Acta 1818 1427-1434 1046

Watanabe M and Ikeuchi M (2013) Phycobilisome architecture of a light-harvesting 1047

supercomplex Photosynth Res 116 265-276 1048

Wellburn AR and Lichtenthaler H (1984) Formulae and Program to Determine Total 1049

Carotenoids and Chlorophylls A and B of Leaf Extracts in Different Solvents In 1050

Advances in Photosynthesis Research Proceedings of the VIth International Congress 1051

on Photosynthesis Brussels Belgium August 1ndash6 1983 C Sybesma ed (Dordrecht 1052

Springer Netherlands) pp 9-12 1053

Wilde A Lunser K Ossenbuumlhl F Nickelsen J and Borner T (2001) Characterization of 1054

the cyanobacterial ycf37 mutation decreases the photosystem I content Biochem J 1055

357 211-216 1056

Wilson A Boulay C Wilde A Kerfeld CA and Kirilovsky D (2007) Light-Induced 1057

Energy Dissipation in Iron-Starved Cyanobacteria Roles of OCP and IsiA Proteins 1058

Plant Cell 19 656-672 1059

Xu M Bernaacutet G Singh A Mi H Roumlgner M Pakrasi HB and Ogawa T (2008) 1060

Properties of Mutants of Synechocystis sp Strain PCC 6803 Lacking Inorganic Carbon 1061

Sequestration Systems Plant Cell Physiol 49 1672-1677 1062

33

Yamamoto T Burke J Autz G and Jagendorf AT (1981) Bound ribosomes of Pea 1063

chloroplast thylakoid membranes location and release in vitro by high salt 1064

puromycin and RNase Plant Physiol 67 940-949 1065

Yang H Liao L Bo T Zhao L Sun X Lu X Norling B and Huang F (2014) 1066

Slr0151 in Synechocystis sp PCC 6803 is required for efficient repair of photosystem 1067

II under high-light condition J Integr Plant Biol 56 1136-1150 1068

Yeremenko N Kouřil R Ihalainen JA DHaene S van Oosterwijk N 1069

Andrizhiyevskaya EG Keegstra W Dekker HL Hagemann M Boekema EJ 1070

Matthijs HCP and Dekker JP (2004) Supramolecular Organization and Dual 1071

Function of the IsiA Chlorophyll-Binding Protein in Cyanobacteria Biochemistry 43 1072

10308-10313 1073

Zak E Norling B Maitra R Huang F Andersson B and Pakrasi HB (2001) The 1074

initial steps of biogenesis of cyanobacterial photosystems occur in plasma membranes 1075

Proc Natl Acad Sci USA 98 13443-13448 1076

Zang X Liu B Liu S Arunakumara KKIU and Zhang X (2007) Optimum 1077

Conditions for Transformation of Synechocystis sp PCC 6803 J Microbiol 45 241-1078

245 1079

Zhang L and Sakamoto W (2015) Possible function of VIPP1 in maintaining chloroplast 1080

membranes Biochim Biophys Acta 1847 831-837 1081

Zimmerberg J and Kozlov MM (2006) How proteins produce cellular membrane 1082

curvature Nat Rev Mol Cell Biol 7 9-19 1083

Zoumlfel P (1988) Statistik in der Praxis (Stuttgart Germany Gustav Fischer Verlag) 1084

1085

34

Figure Legends 1086

Figure 1 General characteristics of CurT A) Sequence alignment of CurT and CURT1A-D 1087

from A thaliana Predicted chloroplast transit-peptide sequences of CURT1A-D are omitted 1088

(Armbruster et al 2013) Positions of predicted C-terminal transmembrane domains (TDM) 1089

are marked (black bar) as is the position of the predicted amphipathic N-terminal helix in 1090

CurT (red bar) The green bar denotes the peptide sequence used for antibody production 1091

Identical and related amino acids that are conserved in 100 80 and 60 of the sequences 1092

are highlighted in black dark grey and light grey respectively B) Helical-wheel 1093

representation of the N-terminal amphipathic helix of CurT (red bar in A) The color code 1094

reflects the physicochemical properties of amino-acid side-chains green polar and 1095

uncharged blue polar and positively charged red polar and negatively charged yellow 1096

hydrophobic C) Solubility of CurT Membrane-associated proteins (50 microg) from wild-type 1097

cells were extracted with 5 mM HEPES (pH 76) containing either 1 M NaCl 01 M Na2CO3 1098

4 M urea 01 Triton X-100 or no additional solute After separation of membrane-bound 1099

(M) and solubilized (S) proteins by centrifugation proteins were fractionated by SDS-PAGE1100

and CurT was immunodetected on immunoblots As a control the integral membrane protein 1101

CP47 from PSII was analyzed in parallel D) Transmission electron micrographs of negatively 1102

stained liposomes Cell-free expression (CFE) of CurT and A thaliana CURT1A was 1103

performed in the presence of liposomes similar in composition to the lipids of the thylakoid 1104

membrane Liposomes before and after cell-free protein expression in the absence of DNA 1105

served as negative controls Black arrowheads indicate tubular connections between 1106

liposomes Scale bars 250 nm 1107

1108

Figure 2 Ultrastructural analysis of curT- cells Transmission electron micrographs of typical 1109

wild-type (A) and curT- (B-D) Synechocystis 6803 cells taken at 44000times (A B) and 28000times 1110

(C D) magnification respectively Ultrathin sections (35 to 45 nm) of cryofixed samples 1111

were stained with osmium tetroxide and post-stained using lead citrate Arrowheads indicate 1112

biogenesis centers Scale bars 200 nm (A B) and 500 nm (C D) respectively 1113

1114

Figure 3 Accumulation of components of photosynthetic complexes in the curT- mutant A) 1115

Whole cell extracts (30 microg protein) from wild-type and curT- strains were fractionated by 1116

SDS-PAGE and analyzed on immunoblots using the indicated antibodies B) The histogram 1117

shows levels of the indicated proteins in curT- extracts relative to wild-type samples (dashed 1118

red line) Data are means plusmn SD of three independent experiments Significant differences from 1119

35

wild-type protein levels according to Studentrsquos t-test with error probabilities of 5 and 1 1120

are indicated by and respectively 1121

1122

Figure 4 P700+ reduction kinetics and high-light effects in curT- cells A) Averaged traces 1123

(10 single measurements) of P700+ decay after complete oxidation by a 50-ms multiple 1124

turnover pulse (10000 micromol photons m-2 s-1) in the absence and presence of 10 microM DCMU 1125

B) Rate constants for P700+ reduction were obtained by fitting of the data with single1126

exponential functions Error bars indicate the SD of three independent measurements C) 1127

Impact of light intensity on the (relative) electron transport rate (rETR) Cells were exposed to 1128

gradually increasing light intensities which resulted in increasing electron transport until the 1129

capacity limit was reached PAR light intensity (micromol photons m-2 s-1) Error bars indicate the 1130

SD of three independent measurements D) D1 protein level in wild-type and curT- after high-1131

light treatment (800 micromol photons m-2s-1) in the presence and absence of lincomycin Samples 1132

were taken every 30 min and processed as in Figure 3 to determine the level of D1 present 1133

100 refers to wild-type D1 level at the beginning of the experiment 1134

1135

Figure 5 PSII assembly in curT- cells A) BNSDS-PAGE of membrane proteins Membrane 1136

fractions from wild-type and curT- cells were solubilized with 13 n-dodecyl-β-maltoside 1137

and proteins were fractionated by two-dimensional BNSDS-PAGE blotted and probed with 1138

antibodies against the PSII subunits D1 D2 CP47 and CP43 Wild-type blots were also 1139

probed with the αCurT antibody The sizes of marker proteins and the positions of PSII 1140

assembly intermediates (RCCII RCCI RC47) are shown above and below each image B) In 1141

vivo pulse labeling of membrane proteins with 35S Pulse-labeled PSII core proteins were 1142

separated via BNSDS-PAGE and visualized by autoradiography 1143

1144

Figure 6 Loss of CurT induces stress A) Low-temperature (77 K) fluorescence emission of 1145

Synechocystis 6803 wild-type (blue) and curT- (red) cells excited at 440 nm The spectra were 1146

normalized to the added fluorescein standard B) Low-temperature (77 K) fluorescence 1147

emission of Synechocystis 6803 wild-type (blue) and curT- (red) excited at 580 nm The 1148

spectra were normalized to 780 nm C) Level of IsiA in the curT- mutant relative to the wild-1149

type A mean value of 368 plusmn 96 (SD) was determined from three independent experiments 1150

1151

Figure 7 Membrane sublocalization of PSII-related factors Cell extracts from wild-type and 1152

curT- cells were fractionated by two consecutive rounds of sucrose-density gradient 1153

36

centrifugation (Schottkowski et al 2009b) The second linear gradient (20-60 sucrose) was 1154

apportioned into 14 fractions which were analyzed by immunoblotting using the indicated 1155

antibodies Fractions 1ndash6 represent PDMs and fractions 7ndash14 thylakoid membranes (TMs) 1156

To facilitate comparison between gradients sample volumes were normalized to the volume 1157

of fraction 7 that contained 40 microg of protein 1158

1159

Figure 8 Live-cell imaging of the curT-CFP strain by fluorescence microscopy In the curT-1160

CFP strain the native curT gene has been replaced by a CFP-tagged version resulting in the 1161

expression of the CurT-CFP fusion protein under the control of the native promotor A) 1162

Close-up views of the mid-cell plane in the CFP and far-red autofluorescence channels shown 1163

in slice 7 in panel B B) Synechocystis 6803 cells expressing CurT C-terminally fused to the 1164

mTurquoise2 variant of CFP from its native chromosomal promoter The two imaging 1165

channels are displayed as Z-axis montages (auto-scaled contrast step size 250 nm) in 1166

grayscale and color composite configuration The thylakoid autofluorescent channel as 1167

imaged in far-red fluorescence is depicted in magenta and CurT signal as imaged in cyan 1168

fluorescence is depicted in cyan C) Fluorescence intensity profiles of the two channels along 1169

the autofluorescent peripheral cell ldquoringrdquo are shown for slice 7 The maximum projection of 1170

the entire Z montage is also shown Scale bars (light grey) 2 microm 1171

1172

Figure 9 Immunofluorescence detection of CurT A) Close-ups of slice 5 in panel B B) 1173

Wild-type Synechocystis 6803 cells labeled with αCurT antibodies and detected with Oregon 1174

Green-conjugated secondary antibodies The Z-axis montages are shown as in Figure 8B 1175

except that the step size is 280 nm (1 to 10) C) Intensity profiles of the two channels along 1176

the autofluorescent peripheral cell ldquoringrdquo are shown for slice 5 The maximum projection of 1177

the entire Z montage is also shown Scale bars (light grey) 2 microm 1178

1179

Figure 10 Subcellular localization of CurT Ultrathin sections of wild-type Synechocystis 1180

6803 cells were incubated with rabbit αCurT prior to incubation with gold-conjugated goat 1181

anti-rabbit IgG A) Negative control (wild-type processed without addition of primary 1182

antibody) B C) Immunogold-labeled sections showing CurT localization at the cytoplasmic 1183

side of the thylakoid membrane D) Cluster formation of CurT signals at a putative biogenesis 1184

center from C E) Biogenesis center from the same cell (C) without any obvious CurT 1185

clustering of gold particles F) Schematic depiction of a wild-type cell (from Figure 2A) with 1186

color-coded curved membranes green = thylakoids that follow the curvature of the cell red = 1187

37

thylakoids that bend away from the plasma membrane yellow = thylakoids that bend toward 1188

the plasma membrane to converge on sites of biogenesis centers G) Relative distribution of 1189

gold signals between convex (dark color) and concave (light color) sides of membranes (n = 1190

1584 signals from a total of 95 cells) The undifferentiated overall signal distribution is given 1191

in blue Bars = 200 nm (overview) and 100 nm (details) 1192

1193

Figure 11 Differentially modified forms of CurT are found in different complexes in PDMs 1194

and thylakoid membranes Samples were isolated by fractionation of wild-type membranes 1195

via two consecutive sucrose density gradients according to Schottkowski et al (2009b) After 1196

density centrifugation samples were applied to BNSDS-PAGE analysis (A) or isoelectric 1197

focusing (B) Numbers on the right indicate the respective fraction from the second gradient 1198

(see Figure 7) Fraction 5 represents the PDMs and fraction 9 the thylakoid membrane 1199

1200

Figure 12 Loss of CurT increases sensitivity to abiotic stress A B) Doubling times of wild-1201

type and curT- under salt stress (A) or osmotic stress (B) Doubling times are means plusmn SD of 1202

three independent cultures C) Localization of CurT-CFP under salt and osmotic stress 1203

Samples were examined as described in Figure 8 Scale bars 1 microm D) Protein levels of wild-1204

type cells after growth in BG11 medium containing 500 mM NaCl Samples were analyzed on 1205

the same gel but unrelated samples between the presented signals were omitted E) 1206

Membrane preparations obtained from wild-type cells wild-type cells grown in the presence 1207

of 500 mM NaCl and curT- cells were subjected to the first gradient step in the membrane 1208

fractionation scheme The gradient was divided into five fractions and 10 of fractions I-IV 1209

and 02 of fraction V were analyzed by SDS-PAGE Fraction II includes the plasma 1210

membrane and fraction V consists of PratA-defined membrane and thylakoid membrane 1211

1212

Figure 13 Model of CurT distribution at convergence zones in Synechocystis 6803 The 1213

distribution of CurT in thylakoid (green) and plasma membranes (brown) is shown The 1214

pattern of localization of CurT in the thylakoid membrane is derived from membrane 1215

fractionation via sucrose density centrifugation fluorescence-based detection of the CurT-1216

CFP fusion and endogenous CurT and immunogold labeling experiments (Figures 7-10) The 1217

different CurT variants a b c and d identified in the IEF experiments (Figure 11) are depicted 1218

in yellow pink blue and black respectively CurT present in the plasma membrane is 1219

highlighted in gray as its precise nature and role remain to be defined (Figure 12) 1220

Membranes are represented as lipid bilayers Convex and concave faces of bent thylakoid 1221

38

sheets are indicated by black arrows The PDM which is dedicated to PSII assembly and 1222

repair is depicted in blue The dotted blue line emphasizes that the ultrastructure in this region 1223

has not yet been fully resolved PP periplasm PM plasma membrane TM thylakoid 1224

membrane L lumen PDM PratA-defined membrane 1225

1226

Tables 1227

Table 1 Physiological characteristics of the curT- mutant 1228

Strain Doubling time [h]

Oxygen Evolution[nmol h-1 OD750

-1]c

Chlorophyll content

[microg OD750-1]

d

Cell size [microm]e

Cell number [ml-1 OD750

-1]f

Wild type 817plusmn017a 1600plusmn042

b 1933plusmn187 251plusmn014 264plusmn020 390plusmn006 x 107

curT- 1259plusmn020a 3226plusmn056

b 1074plusmn20 195plusmn029 274plusmn044 367plusmn016 x 107

1229 abDoubling times in the presence (a) or absence (b) of 5 mM glucose measured under 1230

continuous illumination at 30 micromol photons m-2 s-1 and CO2-limiting conditions cOxygen 1231

evolution is expressed in nmol O2 produced per hour per OD750 unit dChlorophyll content is 1232

expressed in microg OD750-1 eThe diameter of non-dividing cells is presented in microm fCell number 1233

was determined per ml per OD750 Data are means plusmn SD of at least three independent 1234

experiments 1235

1236

Parsed CitationsAllen JF de Paula WBM Puthiyaveetil S and Nield J (2011) A structural phylogenetic map for chloroplast photosynthesisTrends Plant Sci 16 645-655

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Anderson JM Horton P Kim E-H and Chow WS (2012) Towards elucidation of dynamic structural changes of plant thylakoidarchitecture Philos Trans R Soc Lond B Biol Sci 367 3515-3524

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Armbruster U Zuumlhlke J Rengstl B Kreller R Makarenko E Ruumlhle T Schuumlnemann D Jahns P Weisshaar B NickelsenJ and Leister D (2010) The Arabidopsis thylakoid protein PAM68 is required for efficient D1 biogenesis and photosystem IIassembly Plant Cell 22 3439-3460

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Armbruster U Labs M Pribil M Viola S Xu W Scharfenberg M Hertle AP Rojahn U Jensen PE Rappaport F JoliotP Doumlrmann P Wanner G and Leister D (2013) Arabidopsis CURVATURE THYLAKOID1 proteins modify thylakoid architectureby inducing membrane curvature Plant Cell 25 2661-2678

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Aseeva E Ossenbuumlhl F Sippel C Cho WK Stein B Eichacker LA Meurer J Wanner G Westhoff P Soll J andVothknecht UC (2007) Vipp1 is required for basic thylakoid membrane formation but not for the assembly of thylakoid proteincomplexes Plant Physiol Biochem 45 119-128

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Bartsevich VV and Pakrasi HB (1995) Molecular identification of an ABC transporter complex for manganese analysis of acyanobacterial mutant strain impaired in the photosynthetic oxygen evolution process EMBO J 14 1845-1853

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Bartsevich VV and Pakrasi HB (1996) Manganese transport in the cyanobacterium Synechocystis sp PCC 6803 J Biol Chem271 26057-26061

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Bernaacutet G Waschewski N and Roumlgner M (2009) Towards efficient hydrogen production the impact of antenna size andexternal factors on electron transport dynamics in Synechocystis PCC 6803 Photosynth Res 99 205-216

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Boehm M Yu J Krynicka V Barker M Tichy M Komenda J Nixon PJ and Nield J (2012) Subunit Organization of aSynechocystis Hetero-Oligomeric Thylakoid FtsH Complex Involved in Photosystem II Repair Plant Cell 24 3669-3683

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Bradford MM (1976) A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle ofprotein-dye binding Anal Biochem 72 248-254

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Chang L Liu X Li Y Liu C-C Yang F Zhao J and Sui S-F (2015) Structural organization of an intact phycobilisome and itsassociation with photosystem II Cell Res 25 726-737

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Danielsson R Suorsa M Paakkarinen V Albertsson P-Aring Styring S Aro E-M and Mamedov F (2006) Dimeric andmonomeric organization of photosystem II Distribution of five distinct complexes in the different domains of the thylakoidmembrane J Biol Chem 281 14241-14249

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Daum B Nicastro D Austin J McIntosh JR and Kuumlhlbrandt W (2010) Arrangement of photosystem II and ATP synthase in

27

References 866

Allen JF de Paula WBM Puthiyaveetil S and Nield J (2011) A structural 867

phylogenetic map for chloroplast photosynthesis Trends Plant Sci 16 645-655 868

Anderson JM Horton P Kim E-H and Chow WS (2012) Towards elucidation of 869

dynamic structural changes of plant thylakoid architecture Philos Trans R Soc 870

Lond B Biol Sci 367 3515-3524 871

Armbruster U Zuumlhlke J Rengstl B Kreller R Makarenko E Ruumlhle T Schuumlnemann 872

D Jahns P Weisshaar B Nickelsen J and Leister D (2010) The Arabidopsis 873

thylakoid protein PAM68 is required for efficient D1 biogenesis and photosystem II 874

assembly Plant Cell 22 3439-3460 875

Armbruster U Labs M Pribil M Viola S Xu W Scharfenberg M Hertle AP 876

Rojahn U Jensen PE Rappaport F Joliot P Doumlrmann P Wanner G and 877

Leister D (2013) Arabidopsis CURVATURE THYLAKOID1 proteins modify 878

thylakoid architecture by inducing membrane curvature Plant Cell 25 2661-2678 879

Aseeva E Ossenbuumlhl F Sippel C Cho WK Stein B Eichacker LA Meurer J 880

Wanner G Westhoff P Soll J and Vothknecht UC (2007) Vipp1 is required for 881

basic thylakoid membrane formation but not for the assembly of thylakoid protein 882

complexes Plant Physiol Biochem 45 119-128 883

Bartsevich VV and Pakrasi HB (1995) Molecular identification of an ABC transporter 884

complex for manganese analysis of a cyanobacterial mutant strain impaired in the 885

photosynthetic oxygen evolution process EMBO J 14 1845-1853 886

Bartsevich VV and Pakrasi HB (1996) Manganese transport in the cyanobacterium 887

Synechocystis sp PCC 6803 J Biol Chem 271 26057-26061 888

Bernaacutet G Waschewski N and Roumlgner M (2009) Towards efficient hydrogen production 889

the impact of antenna size and external factors on electron transport dynamics in 890

Synechocystis PCC 6803 Photosynth Res 99 205-216 891

Boehm M Yu J Krynicka V Barker M Tichy M Komenda J Nixon PJ and Nield 892

J (2012) Subunit Organization of a Synechocystis Hetero-Oligomeric Thylakoid FtsH893

Complex Involved in Photosystem II Repair Plant Cell 24 3669-3683894

Bradford MM (1976) A rapid and sensitive method for the quantitation of microgram 895

quantities of protein utilizing the principle of protein-dye binding Anal Biochem 72 896

248-254897

28

Chang L Liu X Li Y Liu C-C Yang F Zhao J and Sui S-F (2015) Structural 898

organization of an intact phycobilisome and its association with photosystem II Cell 899

Res 25 726-737 900

Danielsson R Suorsa M Paakkarinen V Albertsson P-Aring Styring S Aro E-M and 901

Mamedov F (2006) Dimeric and monomeric organization of photosystem II 902

Distribution of five distinct complexes in the different domains of the thylakoid 903

membrane J Biol Chem 281 14241-14249 904

Daum B Nicastro D Austin J McIntosh JR and Kuumlhlbrandt W (2010) Arrangement 905

of photosystem II and ATP synthase in chloroplast membranes of Spinach and Pea 906

Plant Cell 22 1299-1312 907

Engel BD Schaffer M Kuhn Cuellar L Villa E Plitzko JM and Baumeister W 908

(2015) Native architecture of the Chlamydomonas chloroplast revealed by in situ 909

cryo-electron tomography eLife 4 e04889 910

Ford MGJ Mills IG Peter BJ Vallis Y Praefcke GJK Evans PR and McMahon 911

HT (2002) Curvature of clathrin-coated pits driven by epsin Nature 419 361-366 912

Fristedt R Willig A Granath P Cregravevecoeur M Rochaix J-D and Vener AV (2009) 913

Phosphorylation of photosystem II controls functional macroscopic folding of 914

photosynthetic membranes in Arabidopsis Plant Cell 21 3950-3964 915

Gallop JL and McMahon HT (2005) BAR domains and membrane curvature bringing 916

your curves to the BAR Biochem Soc Symp 72 223-231 917

Gibson DG (2011) Chapter fifteen - Enzymatic Assembly of Overlapping DNA Fragments 918

In Methods in Enzymology V Christopher ed (Academic Press) pp 349-361 919

Goedhart J von Stetten D Noirclerc-Savoye M Lelimousin M Joosen L Hink MA 920

van Weeren L Gadella TWJ and Royant A (2012) Structure-guided evolution of 921

cyan fluorescent proteins towards a quantum yield of 93 Nat Commun 3 751 922

Heinz S Liauw P Nickelsen J and Nowaczyk M (2016) Analysis of photosystem II 923

biogenesis in cyanobacteria Biochim Biophys Acta 1857 274-287 924

Hernaacutendez-Prieto M and Futschik M (2012) CyanoEXpress A web database for 925

exploration and visualisation of the integrated transcriptome of cyanobacterium 926

Synechocystis sp PCC6803 Bioinformation 8 634-638 927

Hernaacutendez-Prieto MA Semeniuk TA Giner-Lamia J and Futschik ME (2016) The 928

Transcriptional Landscape of the Photosynthetic Model Cyanobacterium 929

Synechocystis sp PCC6803 Sci Rep 6 22168 930

29

Huang F Fulda S Hagemann M and Norling B (2006) Proteomic screening of salt-931

stress-induced changes in plasma membranes of Synechocystis sp strain PCC 6803 932

Proteomics 6 910-920 933

Kirchhoff H (2013) Architectural switches in plant thylakoid membranes Photosynth Res 934

116 481-487 935

Klinkert B Elles I and Nickelsen J (2006) Translation of chloroplast psbD mRNA in 936

Chlamydomonas is controlled by a secondary RNA structure blocking the AUG start 937

codon Nucleic Acids Res 34 386-394 938

Klinkert B Ossenbuumlhl F Sikorski M Berry S Eichacker L and Nickelsen J (2004) 939

PratA a periplasmic tetratricopeptide repeat protein involved in biogenesis of 940

photosystem II in Synechocystis sp PCC 6803 J Biol Chem 279 44639-44644 941

Komenda J Nickelsen J Tichyacute M Praacutešil O Eichacker LA and Nixon PJ (2008) The 942

cyanobacterial homologue of HCF136YCF48 is a component of an early photosystem 943

II assembly complex and is important for both the efficient assembly and repair of 944

photosystem II in Synechocystis sp PCC 6803 J Biol Chem 283 22390-22399 945

Kopf M Klaumlhn S Scholz I Matthiessen JKF Hess WR and Voszlig B (2014) 946

Comparative analysis of the primary transcriptome of Synechocystis sp PCC 6803 947

DNA Res 21 527-539 948

Kunkel DD (1982) Thylakoid centers Structures associated with the cyanobacterial 949

photosynthetic membrane system Arch Microbiol 133 97-99 950

Liberton M Howard Berg R Heuser J Roth R and Pakrasi BH (2006) Ultrastructure 951

of the membrane systems in the unicellular cyanobacterium Synechocystis sp strain 952

PCC 6803 Protoplasma 227 129-138 953

Liberton M Saha R Jacobs JM Nguyen AY Gritsenko MA Smith RD 954

Koppenaal DW and Pakrasi HB (2016) Global Proteomic Analysis Reveals an 955

Exclusive Role of Thylakoid Membranes in Bioenergetics of a Model 956

Cyanobacterium Mol Cell Proteomics 15 2021-2032 957

Luque I and Ochoa de Alda JAG (2014) CURT1CAAD-containing aaRSs thylakoid 958

curvature and gene translation Trends Plant Sci 19 63-66 959

Marin K Stirnberg M Eisenhut M Kraumlmer R and Hagemann M (2006) Osmotic stress 960

in Synechocystis sp PCC 6803 low tolerance towards nonionic osmotic stress results 961

from lacking activation of glucosylglycerol accumulation Microbiology 152 2023-962

2030 963

Mullineaux CW (2005) Function and evolution of grana Trends Plant Sci 10 521-525 964

30

Mullineaux CW (2008) Biogenesis and dynamics of thylakoid membranes and the 965

photosynthetic apparatus In The Cyanobacteria A Herrero and E Flores eds 966

(Norfolk UK Caister Academic Press) pp 289ndash304 967

Nevo R Charuvi D Tsabari O and Reich Z (2012) Composition architecture and 968

dynamics of the photosynthetic apparatus in higher plants Plant J 70 157-176 969

Nickelsen J and Rengstl B (2013) Photosystem II assembly From cyanobacteria to plants 970

Annu Rev Plant Biol 64 609-635 971

Nickelsen J and Zerges W (2013) Thylakoid biogenesis has joined the new era of bacterial 972

cell biology Front Plant Sci 4 458 973

Nilsson F Simpson DJ Jansson C and Andersson B (1992) Ultrastructural and 974

biochemical characterization of a Synechocystis 6803 mutant with inactivated psbA 975

genes Arch Biochem Biophys 295 340-347 976

Odom WR Hodges R Chitnis PR and Guikema JA (1993) Characterization of 977

Synechocystis sp PCC 6803 in iron-supplied and iron-deficient media Plant Mol 978

Biol 23 1255-1264 979

Ossenbuumlhl F Inaba-Sulpice M Meurer J Soll J and Eichacker LA (2006) The 980

Synechocystis sp PCC 6803 Oxa1 homolog is essential for membrane integration of 981

reaction center precursor protein pD1 Plant Cell 18 2236-2246 982

Pisareva T Kwon J Oh J Kim S Ge C Wieslander Aring Choi J-S and Norling B 983

(2011) Model for Membrane Organization and Protein Sorting in the Cyanobacterium 984

Synechocystis sp PCC 6803 Inferred from Proteomics and Multivariate Sequence 985

Analyses J Proteome Res 10 3617-3631 986

Pribil M Labs M and Leister D (2014) Structure and dynamics of thylakoids in land 987

plants J Exp Bot 65 1955-1972 988

Rast A Heinz S and Nickelsen J (2015) Biogenesis of thylakoid membranes Biochim 989

Biophys Acta 1847 821-830 990

Rast A Rengstl B Heinz S Klingl A and Nickelsen J (2016) The role of Slr0151 a 991

tetratricopeptide repeat protein from Synechocystis sp PCC 6803 during Photosystem 992

II assembly and repair Front Plant Sci 7 605 993

Rengstl B Oster U Stengel A and Nickelsen J (2011) An Intermediate Membrane 994

Subfraction in Cyanobacteria Is Involved in an Assembly Network for Photosystem II 995

Biogenesis J Biol Chem 286 21944-21951 996

31

Rengstl B Knoppovaacute J Komenda J and Nickelsen J (2013) Characterization of a 997

Synechocystis double mutant lacking the photosystem II assembly factors YCF48 and 998

Sll0933 Planta 237 471-480 999

Rexroth S Mullineaux CW Ellinger D Sendtko E Roumlgner M and Koenig F (2011) 1000

The Plasma Membrane of the Cyanobacterium Gloeobacter violaceus Contains 1001

Segregated Bioenergetic Domains Plant Cell 23 2379-2390 1002

Rippka R Deruelles J Waterbury JB Herdman M and Stanier RY (1979) Generic 1003

Assignments Strain Histories and Properties of Pure Cultures of Cyanobacteria 1004

Microbiology 111 1-61 1005

Ruumltgers M and Schroda M (2013) A role of VIPP1 as a dynamic structure within 1006

thylakoid centers as sites of photosystem biogenesis Plant Signal Behav 8 e27037 1007

Sacharz J Bryan SJ Yu J Burroughs NJ Spence EM Nixon PJ and Mullineaux 1008

CW (2015) Sub-cellular location of FtsH proteases in the cyanobacterium1009

Synechocystis sp PCC 6803 suggests localised PSII repair zones in the thylakoid1010

membranes Mol Microbiol 96 448-4621011

Sandstroumlm S Park Y-I Oumlquist G and Gustafsson P (2001) CP43prime the isiA Gene 1012

Product Functions as an Excitation Energy Dissipator in the Cyanobacterium 1013

Synechococcus sp PCC 7942 Photochem Photobiol 74 431-437 1014

Schindelin J Arganda-Carreras I Frise E Kaynig V Longair M Pietzsch T 1015

Preibisch S Rueden C Saalfeld S Schmid B Tinevez J-Y White DJ 1016

Hartenstein V Eliceiri K Tomancak P and Cardona A (2012) Fiji an open-1017

source platform for biological-image analysis Nat Methods 9 676-682 1018

Schottkowski M Ratke J Oster U Nowaczyk M and Nickelsen J (2009a) Pitt a novel 1019

tetratricopeptide repeat protein involved in light-dependent chlorophyll biosynthesis 1020

and thylakoid membrane biogenesis in Synechocystis sp PCC 6803 Mol Plant 2 1021

1289-1297 1022

Schottkowski M Gkalympoudis S Tzekova N Stelljes C Schuumlnemann D Ankele E 1023

and Nickelsen J (2009b) Interaction of the periplasmic PratA factor and the PsbA 1024

(D1) protein during biogenesis of photosystem II in Synechocystis sp PCC 6803 J 1025

Biol Chem 284 1813-1819 1026

Selatildeo TT Zhang L Knoppovaaacute J Komenda J and Norling B (2016) Photosystem II 1027

Assembly Steps Take Place in the Thylakoid Membrane of the Cyanobacterium 1028

Synechocystis sp PCC6803 Plant Cell Physiol 57 878 1029

32

Spaumlt P Maček B and Forchhammer K (2015) Phosphoproteome of the cyanobacterium 1030

Synechocystis sp PCC 6803 and its dynamics during nitrogen starvation Front 1031

Microbiol 6 248 1032

Stengel A Guumlgel IL Hilger D Rengstl B Jung H and Nickelsen J (2012) Initial 1033

steps of photosystem II de novo assembly and preloading with manganese take place 1034

in biogenesis centers in Synechocystis Plant Cell 24 660-675 1035

Uniacke J and Zerges W (2007) Photosystem II assembly and repair are differentially 1036

localized in Chlamydomonas Plant Cell 19 3640-3654 1037

Uniacke J and Zerges W (2009) Chloroplast protein targeting involves localized 1038

translation in Chlamydomonas Proc Natl Acad Sci USA 106 1439-1444 1039

van de Meene AL Hohmann-Marriott M Vermaas WJ and Roberson R (2006) The 1040

three-dimensional structure of the cyanobacterium Synechocystis sp PCC 6803 Arch 1041

Microbiol 184 259-270 1042

van de Meene AML Sharp WP McDaniel JH Friedrich H Vermaas WFJ and 1043

Roberson RW (2012) Gross morphological changes in thylakoid membrane 1044

structure are associated with photosystem I deletion in Synechocystis sp PCC 6803 1045

Biochim Biophys Acta 1818 1427-1434 1046

Watanabe M and Ikeuchi M (2013) Phycobilisome architecture of a light-harvesting 1047

supercomplex Photosynth Res 116 265-276 1048

Wellburn AR and Lichtenthaler H (1984) Formulae and Program to Determine Total 1049

Carotenoids and Chlorophylls A and B of Leaf Extracts in Different Solvents In 1050

Advances in Photosynthesis Research Proceedings of the VIth International Congress 1051

on Photosynthesis Brussels Belgium August 1ndash6 1983 C Sybesma ed (Dordrecht 1052

Springer Netherlands) pp 9-12 1053

Wilde A Lunser K Ossenbuumlhl F Nickelsen J and Borner T (2001) Characterization of 1054

the cyanobacterial ycf37 mutation decreases the photosystem I content Biochem J 1055

357 211-216 1056

Wilson A Boulay C Wilde A Kerfeld CA and Kirilovsky D (2007) Light-Induced 1057

Energy Dissipation in Iron-Starved Cyanobacteria Roles of OCP and IsiA Proteins 1058

Plant Cell 19 656-672 1059

Xu M Bernaacutet G Singh A Mi H Roumlgner M Pakrasi HB and Ogawa T (2008) 1060

Properties of Mutants of Synechocystis sp Strain PCC 6803 Lacking Inorganic Carbon 1061

Sequestration Systems Plant Cell Physiol 49 1672-1677 1062

33

Yamamoto T Burke J Autz G and Jagendorf AT (1981) Bound ribosomes of Pea 1063

chloroplast thylakoid membranes location and release in vitro by high salt 1064

puromycin and RNase Plant Physiol 67 940-949 1065

Yang H Liao L Bo T Zhao L Sun X Lu X Norling B and Huang F (2014) 1066

Slr0151 in Synechocystis sp PCC 6803 is required for efficient repair of photosystem 1067

II under high-light condition J Integr Plant Biol 56 1136-1150 1068

Yeremenko N Kouřil R Ihalainen JA DHaene S van Oosterwijk N 1069

Andrizhiyevskaya EG Keegstra W Dekker HL Hagemann M Boekema EJ 1070

Matthijs HCP and Dekker JP (2004) Supramolecular Organization and Dual 1071

Function of the IsiA Chlorophyll-Binding Protein in Cyanobacteria Biochemistry 43 1072

10308-10313 1073

Zak E Norling B Maitra R Huang F Andersson B and Pakrasi HB (2001) The 1074

initial steps of biogenesis of cyanobacterial photosystems occur in plasma membranes 1075

Proc Natl Acad Sci USA 98 13443-13448 1076

Zang X Liu B Liu S Arunakumara KKIU and Zhang X (2007) Optimum 1077

Conditions for Transformation of Synechocystis sp PCC 6803 J Microbiol 45 241-1078

245 1079

Zhang L and Sakamoto W (2015) Possible function of VIPP1 in maintaining chloroplast 1080

membranes Biochim Biophys Acta 1847 831-837 1081

Zimmerberg J and Kozlov MM (2006) How proteins produce cellular membrane 1082

curvature Nat Rev Mol Cell Biol 7 9-19 1083

Zoumlfel P (1988) Statistik in der Praxis (Stuttgart Germany Gustav Fischer Verlag) 1084

1085

34

Figure Legends 1086

Figure 1 General characteristics of CurT A) Sequence alignment of CurT and CURT1A-D 1087

from A thaliana Predicted chloroplast transit-peptide sequences of CURT1A-D are omitted 1088

(Armbruster et al 2013) Positions of predicted C-terminal transmembrane domains (TDM) 1089

are marked (black bar) as is the position of the predicted amphipathic N-terminal helix in 1090

CurT (red bar) The green bar denotes the peptide sequence used for antibody production 1091

Identical and related amino acids that are conserved in 100 80 and 60 of the sequences 1092

are highlighted in black dark grey and light grey respectively B) Helical-wheel 1093

representation of the N-terminal amphipathic helix of CurT (red bar in A) The color code 1094

reflects the physicochemical properties of amino-acid side-chains green polar and 1095

uncharged blue polar and positively charged red polar and negatively charged yellow 1096

hydrophobic C) Solubility of CurT Membrane-associated proteins (50 microg) from wild-type 1097

cells were extracted with 5 mM HEPES (pH 76) containing either 1 M NaCl 01 M Na2CO3 1098

4 M urea 01 Triton X-100 or no additional solute After separation of membrane-bound 1099

(M) and solubilized (S) proteins by centrifugation proteins were fractionated by SDS-PAGE1100

and CurT was immunodetected on immunoblots As a control the integral membrane protein 1101

CP47 from PSII was analyzed in parallel D) Transmission electron micrographs of negatively 1102

stained liposomes Cell-free expression (CFE) of CurT and A thaliana CURT1A was 1103

performed in the presence of liposomes similar in composition to the lipids of the thylakoid 1104

membrane Liposomes before and after cell-free protein expression in the absence of DNA 1105

served as negative controls Black arrowheads indicate tubular connections between 1106

liposomes Scale bars 250 nm 1107

1108

Figure 2 Ultrastructural analysis of curT- cells Transmission electron micrographs of typical 1109

wild-type (A) and curT- (B-D) Synechocystis 6803 cells taken at 44000times (A B) and 28000times 1110

(C D) magnification respectively Ultrathin sections (35 to 45 nm) of cryofixed samples 1111

were stained with osmium tetroxide and post-stained using lead citrate Arrowheads indicate 1112

biogenesis centers Scale bars 200 nm (A B) and 500 nm (C D) respectively 1113

1114

Figure 3 Accumulation of components of photosynthetic complexes in the curT- mutant A) 1115

Whole cell extracts (30 microg protein) from wild-type and curT- strains were fractionated by 1116

SDS-PAGE and analyzed on immunoblots using the indicated antibodies B) The histogram 1117

shows levels of the indicated proteins in curT- extracts relative to wild-type samples (dashed 1118

red line) Data are means plusmn SD of three independent experiments Significant differences from 1119

35

wild-type protein levels according to Studentrsquos t-test with error probabilities of 5 and 1 1120

are indicated by and respectively 1121

1122

Figure 4 P700+ reduction kinetics and high-light effects in curT- cells A) Averaged traces 1123

(10 single measurements) of P700+ decay after complete oxidation by a 50-ms multiple 1124

turnover pulse (10000 micromol photons m-2 s-1) in the absence and presence of 10 microM DCMU 1125

B) Rate constants for P700+ reduction were obtained by fitting of the data with single1126

exponential functions Error bars indicate the SD of three independent measurements C) 1127

Impact of light intensity on the (relative) electron transport rate (rETR) Cells were exposed to 1128

gradually increasing light intensities which resulted in increasing electron transport until the 1129

capacity limit was reached PAR light intensity (micromol photons m-2 s-1) Error bars indicate the 1130

SD of three independent measurements D) D1 protein level in wild-type and curT- after high-1131

light treatment (800 micromol photons m-2s-1) in the presence and absence of lincomycin Samples 1132

were taken every 30 min and processed as in Figure 3 to determine the level of D1 present 1133

100 refers to wild-type D1 level at the beginning of the experiment 1134

1135

Figure 5 PSII assembly in curT- cells A) BNSDS-PAGE of membrane proteins Membrane 1136

fractions from wild-type and curT- cells were solubilized with 13 n-dodecyl-β-maltoside 1137

and proteins were fractionated by two-dimensional BNSDS-PAGE blotted and probed with 1138

antibodies against the PSII subunits D1 D2 CP47 and CP43 Wild-type blots were also 1139

probed with the αCurT antibody The sizes of marker proteins and the positions of PSII 1140

assembly intermediates (RCCII RCCI RC47) are shown above and below each image B) In 1141

vivo pulse labeling of membrane proteins with 35S Pulse-labeled PSII core proteins were 1142

separated via BNSDS-PAGE and visualized by autoradiography 1143

1144

Figure 6 Loss of CurT induces stress A) Low-temperature (77 K) fluorescence emission of 1145

Synechocystis 6803 wild-type (blue) and curT- (red) cells excited at 440 nm The spectra were 1146

normalized to the added fluorescein standard B) Low-temperature (77 K) fluorescence 1147

emission of Synechocystis 6803 wild-type (blue) and curT- (red) excited at 580 nm The 1148

spectra were normalized to 780 nm C) Level of IsiA in the curT- mutant relative to the wild-1149

type A mean value of 368 plusmn 96 (SD) was determined from three independent experiments 1150

1151

Figure 7 Membrane sublocalization of PSII-related factors Cell extracts from wild-type and 1152

curT- cells were fractionated by two consecutive rounds of sucrose-density gradient 1153

36

centrifugation (Schottkowski et al 2009b) The second linear gradient (20-60 sucrose) was 1154

apportioned into 14 fractions which were analyzed by immunoblotting using the indicated 1155

antibodies Fractions 1ndash6 represent PDMs and fractions 7ndash14 thylakoid membranes (TMs) 1156

To facilitate comparison between gradients sample volumes were normalized to the volume 1157

of fraction 7 that contained 40 microg of protein 1158

1159

Figure 8 Live-cell imaging of the curT-CFP strain by fluorescence microscopy In the curT-1160

CFP strain the native curT gene has been replaced by a CFP-tagged version resulting in the 1161

expression of the CurT-CFP fusion protein under the control of the native promotor A) 1162

Close-up views of the mid-cell plane in the CFP and far-red autofluorescence channels shown 1163

in slice 7 in panel B B) Synechocystis 6803 cells expressing CurT C-terminally fused to the 1164

mTurquoise2 variant of CFP from its native chromosomal promoter The two imaging 1165

channels are displayed as Z-axis montages (auto-scaled contrast step size 250 nm) in 1166

grayscale and color composite configuration The thylakoid autofluorescent channel as 1167

imaged in far-red fluorescence is depicted in magenta and CurT signal as imaged in cyan 1168

fluorescence is depicted in cyan C) Fluorescence intensity profiles of the two channels along 1169

the autofluorescent peripheral cell ldquoringrdquo are shown for slice 7 The maximum projection of 1170

the entire Z montage is also shown Scale bars (light grey) 2 microm 1171

1172

Figure 9 Immunofluorescence detection of CurT A) Close-ups of slice 5 in panel B B) 1173

Wild-type Synechocystis 6803 cells labeled with αCurT antibodies and detected with Oregon 1174

Green-conjugated secondary antibodies The Z-axis montages are shown as in Figure 8B 1175

except that the step size is 280 nm (1 to 10) C) Intensity profiles of the two channels along 1176

the autofluorescent peripheral cell ldquoringrdquo are shown for slice 5 The maximum projection of 1177

the entire Z montage is also shown Scale bars (light grey) 2 microm 1178

1179

Figure 10 Subcellular localization of CurT Ultrathin sections of wild-type Synechocystis 1180

6803 cells were incubated with rabbit αCurT prior to incubation with gold-conjugated goat 1181

anti-rabbit IgG A) Negative control (wild-type processed without addition of primary 1182

antibody) B C) Immunogold-labeled sections showing CurT localization at the cytoplasmic 1183

side of the thylakoid membrane D) Cluster formation of CurT signals at a putative biogenesis 1184

center from C E) Biogenesis center from the same cell (C) without any obvious CurT 1185

clustering of gold particles F) Schematic depiction of a wild-type cell (from Figure 2A) with 1186

color-coded curved membranes green = thylakoids that follow the curvature of the cell red = 1187

37

thylakoids that bend away from the plasma membrane yellow = thylakoids that bend toward 1188

the plasma membrane to converge on sites of biogenesis centers G) Relative distribution of 1189

gold signals between convex (dark color) and concave (light color) sides of membranes (n = 1190

1584 signals from a total of 95 cells) The undifferentiated overall signal distribution is given 1191

in blue Bars = 200 nm (overview) and 100 nm (details) 1192

1193

Figure 11 Differentially modified forms of CurT are found in different complexes in PDMs 1194

and thylakoid membranes Samples were isolated by fractionation of wild-type membranes 1195

via two consecutive sucrose density gradients according to Schottkowski et al (2009b) After 1196

density centrifugation samples were applied to BNSDS-PAGE analysis (A) or isoelectric 1197

focusing (B) Numbers on the right indicate the respective fraction from the second gradient 1198

(see Figure 7) Fraction 5 represents the PDMs and fraction 9 the thylakoid membrane 1199

1200

Figure 12 Loss of CurT increases sensitivity to abiotic stress A B) Doubling times of wild-1201

type and curT- under salt stress (A) or osmotic stress (B) Doubling times are means plusmn SD of 1202

three independent cultures C) Localization of CurT-CFP under salt and osmotic stress 1203

Samples were examined as described in Figure 8 Scale bars 1 microm D) Protein levels of wild-1204

type cells after growth in BG11 medium containing 500 mM NaCl Samples were analyzed on 1205

the same gel but unrelated samples between the presented signals were omitted E) 1206

Membrane preparations obtained from wild-type cells wild-type cells grown in the presence 1207

of 500 mM NaCl and curT- cells were subjected to the first gradient step in the membrane 1208

fractionation scheme The gradient was divided into five fractions and 10 of fractions I-IV 1209

and 02 of fraction V were analyzed by SDS-PAGE Fraction II includes the plasma 1210

membrane and fraction V consists of PratA-defined membrane and thylakoid membrane 1211

1212

Figure 13 Model of CurT distribution at convergence zones in Synechocystis 6803 The 1213

distribution of CurT in thylakoid (green) and plasma membranes (brown) is shown The 1214

pattern of localization of CurT in the thylakoid membrane is derived from membrane 1215

fractionation via sucrose density centrifugation fluorescence-based detection of the CurT-1216

CFP fusion and endogenous CurT and immunogold labeling experiments (Figures 7-10) The 1217

different CurT variants a b c and d identified in the IEF experiments (Figure 11) are depicted 1218

in yellow pink blue and black respectively CurT present in the plasma membrane is 1219

highlighted in gray as its precise nature and role remain to be defined (Figure 12) 1220

Membranes are represented as lipid bilayers Convex and concave faces of bent thylakoid 1221

38

sheets are indicated by black arrows The PDM which is dedicated to PSII assembly and 1222

repair is depicted in blue The dotted blue line emphasizes that the ultrastructure in this region 1223

has not yet been fully resolved PP periplasm PM plasma membrane TM thylakoid 1224

membrane L lumen PDM PratA-defined membrane 1225

1226

Tables 1227

Table 1 Physiological characteristics of the curT- mutant 1228

Strain Doubling time [h]

Oxygen Evolution[nmol h-1 OD750

-1]c

Chlorophyll content

[microg OD750-1]

d

Cell size [microm]e

Cell number [ml-1 OD750

-1]f

Wild type 817plusmn017a 1600plusmn042

b 1933plusmn187 251plusmn014 264plusmn020 390plusmn006 x 107

curT- 1259plusmn020a 3226plusmn056

b 1074plusmn20 195plusmn029 274plusmn044 367plusmn016 x 107

1229 abDoubling times in the presence (a) or absence (b) of 5 mM glucose measured under 1230

continuous illumination at 30 micromol photons m-2 s-1 and CO2-limiting conditions cOxygen 1231

evolution is expressed in nmol O2 produced per hour per OD750 unit dChlorophyll content is 1232

expressed in microg OD750-1 eThe diameter of non-dividing cells is presented in microm fCell number 1233

was determined per ml per OD750 Data are means plusmn SD of at least three independent 1234

experiments 1235

1236

Parsed CitationsAllen JF de Paula WBM Puthiyaveetil S and Nield J (2011) A structural phylogenetic map for chloroplast photosynthesisTrends Plant Sci 16 645-655

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Anderson JM Horton P Kim E-H and Chow WS (2012) Towards elucidation of dynamic structural changes of plant thylakoidarchitecture Philos Trans R Soc Lond B Biol Sci 367 3515-3524

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Armbruster U Zuumlhlke J Rengstl B Kreller R Makarenko E Ruumlhle T Schuumlnemann D Jahns P Weisshaar B NickelsenJ and Leister D (2010) The Arabidopsis thylakoid protein PAM68 is required for efficient D1 biogenesis and photosystem IIassembly Plant Cell 22 3439-3460

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Armbruster U Labs M Pribil M Viola S Xu W Scharfenberg M Hertle AP Rojahn U Jensen PE Rappaport F JoliotP Doumlrmann P Wanner G and Leister D (2013) Arabidopsis CURVATURE THYLAKOID1 proteins modify thylakoid architectureby inducing membrane curvature Plant Cell 25 2661-2678

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Aseeva E Ossenbuumlhl F Sippel C Cho WK Stein B Eichacker LA Meurer J Wanner G Westhoff P Soll J andVothknecht UC (2007) Vipp1 is required for basic thylakoid membrane formation but not for the assembly of thylakoid proteincomplexes Plant Physiol Biochem 45 119-128

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Bartsevich VV and Pakrasi HB (1995) Molecular identification of an ABC transporter complex for manganese analysis of acyanobacterial mutant strain impaired in the photosynthetic oxygen evolution process EMBO J 14 1845-1853

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Bartsevich VV and Pakrasi HB (1996) Manganese transport in the cyanobacterium Synechocystis sp PCC 6803 J Biol Chem271 26057-26061

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Bernaacutet G Waschewski N and Roumlgner M (2009) Towards efficient hydrogen production the impact of antenna size andexternal factors on electron transport dynamics in Synechocystis PCC 6803 Photosynth Res 99 205-216

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Boehm M Yu J Krynicka V Barker M Tichy M Komenda J Nixon PJ and Nield J (2012) Subunit Organization of aSynechocystis Hetero-Oligomeric Thylakoid FtsH Complex Involved in Photosystem II Repair Plant Cell 24 3669-3683

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Bradford MM (1976) A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle ofprotein-dye binding Anal Biochem 72 248-254

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Chang L Liu X Li Y Liu C-C Yang F Zhao J and Sui S-F (2015) Structural organization of an intact phycobilisome and itsassociation with photosystem II Cell Res 25 726-737

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Danielsson R Suorsa M Paakkarinen V Albertsson P-Aring Styring S Aro E-M and Mamedov F (2006) Dimeric andmonomeric organization of photosystem II Distribution of five distinct complexes in the different domains of the thylakoidmembrane J Biol Chem 281 14241-14249

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Daum B Nicastro D Austin J McIntosh JR and Kuumlhlbrandt W (2010) Arrangement of photosystem II and ATP synthase in

28

Chang L Liu X Li Y Liu C-C Yang F Zhao J and Sui S-F (2015) Structural 898

organization of an intact phycobilisome and its association with photosystem II Cell 899

Res 25 726-737 900

Danielsson R Suorsa M Paakkarinen V Albertsson P-Aring Styring S Aro E-M and 901

Mamedov F (2006) Dimeric and monomeric organization of photosystem II 902

Distribution of five distinct complexes in the different domains of the thylakoid 903

membrane J Biol Chem 281 14241-14249 904

Daum B Nicastro D Austin J McIntosh JR and Kuumlhlbrandt W (2010) Arrangement 905

of photosystem II and ATP synthase in chloroplast membranes of Spinach and Pea 906

Plant Cell 22 1299-1312 907

Engel BD Schaffer M Kuhn Cuellar L Villa E Plitzko JM and Baumeister W 908

(2015) Native architecture of the Chlamydomonas chloroplast revealed by in situ 909

cryo-electron tomography eLife 4 e04889 910

Ford MGJ Mills IG Peter BJ Vallis Y Praefcke GJK Evans PR and McMahon 911

HT (2002) Curvature of clathrin-coated pits driven by epsin Nature 419 361-366 912

Fristedt R Willig A Granath P Cregravevecoeur M Rochaix J-D and Vener AV (2009) 913

Phosphorylation of photosystem II controls functional macroscopic folding of 914

photosynthetic membranes in Arabidopsis Plant Cell 21 3950-3964 915

Gallop JL and McMahon HT (2005) BAR domains and membrane curvature bringing 916

your curves to the BAR Biochem Soc Symp 72 223-231 917

Gibson DG (2011) Chapter fifteen - Enzymatic Assembly of Overlapping DNA Fragments 918

In Methods in Enzymology V Christopher ed (Academic Press) pp 349-361 919

Goedhart J von Stetten D Noirclerc-Savoye M Lelimousin M Joosen L Hink MA 920

van Weeren L Gadella TWJ and Royant A (2012) Structure-guided evolution of 921

cyan fluorescent proteins towards a quantum yield of 93 Nat Commun 3 751 922

Heinz S Liauw P Nickelsen J and Nowaczyk M (2016) Analysis of photosystem II 923

biogenesis in cyanobacteria Biochim Biophys Acta 1857 274-287 924

Hernaacutendez-Prieto M and Futschik M (2012) CyanoEXpress A web database for 925

exploration and visualisation of the integrated transcriptome of cyanobacterium 926

Synechocystis sp PCC6803 Bioinformation 8 634-638 927

Hernaacutendez-Prieto MA Semeniuk TA Giner-Lamia J and Futschik ME (2016) The 928

Transcriptional Landscape of the Photosynthetic Model Cyanobacterium 929

Synechocystis sp PCC6803 Sci Rep 6 22168 930

29

Huang F Fulda S Hagemann M and Norling B (2006) Proteomic screening of salt-931

stress-induced changes in plasma membranes of Synechocystis sp strain PCC 6803 932

Proteomics 6 910-920 933

Kirchhoff H (2013) Architectural switches in plant thylakoid membranes Photosynth Res 934

116 481-487 935

Klinkert B Elles I and Nickelsen J (2006) Translation of chloroplast psbD mRNA in 936

Chlamydomonas is controlled by a secondary RNA structure blocking the AUG start 937

codon Nucleic Acids Res 34 386-394 938

Klinkert B Ossenbuumlhl F Sikorski M Berry S Eichacker L and Nickelsen J (2004) 939

PratA a periplasmic tetratricopeptide repeat protein involved in biogenesis of 940

photosystem II in Synechocystis sp PCC 6803 J Biol Chem 279 44639-44644 941

Komenda J Nickelsen J Tichyacute M Praacutešil O Eichacker LA and Nixon PJ (2008) The 942

cyanobacterial homologue of HCF136YCF48 is a component of an early photosystem 943

II assembly complex and is important for both the efficient assembly and repair of 944

photosystem II in Synechocystis sp PCC 6803 J Biol Chem 283 22390-22399 945

Kopf M Klaumlhn S Scholz I Matthiessen JKF Hess WR and Voszlig B (2014) 946

Comparative analysis of the primary transcriptome of Synechocystis sp PCC 6803 947

DNA Res 21 527-539 948

Kunkel DD (1982) Thylakoid centers Structures associated with the cyanobacterial 949

photosynthetic membrane system Arch Microbiol 133 97-99 950

Liberton M Howard Berg R Heuser J Roth R and Pakrasi BH (2006) Ultrastructure 951

of the membrane systems in the unicellular cyanobacterium Synechocystis sp strain 952

PCC 6803 Protoplasma 227 129-138 953

Liberton M Saha R Jacobs JM Nguyen AY Gritsenko MA Smith RD 954

Koppenaal DW and Pakrasi HB (2016) Global Proteomic Analysis Reveals an 955

Exclusive Role of Thylakoid Membranes in Bioenergetics of a Model 956

Cyanobacterium Mol Cell Proteomics 15 2021-2032 957

Luque I and Ochoa de Alda JAG (2014) CURT1CAAD-containing aaRSs thylakoid 958

curvature and gene translation Trends Plant Sci 19 63-66 959

Marin K Stirnberg M Eisenhut M Kraumlmer R and Hagemann M (2006) Osmotic stress 960

in Synechocystis sp PCC 6803 low tolerance towards nonionic osmotic stress results 961

from lacking activation of glucosylglycerol accumulation Microbiology 152 2023-962

2030 963

Mullineaux CW (2005) Function and evolution of grana Trends Plant Sci 10 521-525 964

30

Mullineaux CW (2008) Biogenesis and dynamics of thylakoid membranes and the 965

photosynthetic apparatus In The Cyanobacteria A Herrero and E Flores eds 966

(Norfolk UK Caister Academic Press) pp 289ndash304 967

Nevo R Charuvi D Tsabari O and Reich Z (2012) Composition architecture and 968

dynamics of the photosynthetic apparatus in higher plants Plant J 70 157-176 969

Nickelsen J and Rengstl B (2013) Photosystem II assembly From cyanobacteria to plants 970

Annu Rev Plant Biol 64 609-635 971

Nickelsen J and Zerges W (2013) Thylakoid biogenesis has joined the new era of bacterial 972

cell biology Front Plant Sci 4 458 973

Nilsson F Simpson DJ Jansson C and Andersson B (1992) Ultrastructural and 974

biochemical characterization of a Synechocystis 6803 mutant with inactivated psbA 975

genes Arch Biochem Biophys 295 340-347 976

Odom WR Hodges R Chitnis PR and Guikema JA (1993) Characterization of 977

Synechocystis sp PCC 6803 in iron-supplied and iron-deficient media Plant Mol 978

Biol 23 1255-1264 979

Ossenbuumlhl F Inaba-Sulpice M Meurer J Soll J and Eichacker LA (2006) The 980

Synechocystis sp PCC 6803 Oxa1 homolog is essential for membrane integration of 981

reaction center precursor protein pD1 Plant Cell 18 2236-2246 982

Pisareva T Kwon J Oh J Kim S Ge C Wieslander Aring Choi J-S and Norling B 983

(2011) Model for Membrane Organization and Protein Sorting in the Cyanobacterium 984

Synechocystis sp PCC 6803 Inferred from Proteomics and Multivariate Sequence 985

Analyses J Proteome Res 10 3617-3631 986

Pribil M Labs M and Leister D (2014) Structure and dynamics of thylakoids in land 987

plants J Exp Bot 65 1955-1972 988

Rast A Heinz S and Nickelsen J (2015) Biogenesis of thylakoid membranes Biochim 989

Biophys Acta 1847 821-830 990

Rast A Rengstl B Heinz S Klingl A and Nickelsen J (2016) The role of Slr0151 a 991

tetratricopeptide repeat protein from Synechocystis sp PCC 6803 during Photosystem 992

II assembly and repair Front Plant Sci 7 605 993

Rengstl B Oster U Stengel A and Nickelsen J (2011) An Intermediate Membrane 994

Subfraction in Cyanobacteria Is Involved in an Assembly Network for Photosystem II 995

Biogenesis J Biol Chem 286 21944-21951 996

31

Rengstl B Knoppovaacute J Komenda J and Nickelsen J (2013) Characterization of a 997

Synechocystis double mutant lacking the photosystem II assembly factors YCF48 and 998

Sll0933 Planta 237 471-480 999

Rexroth S Mullineaux CW Ellinger D Sendtko E Roumlgner M and Koenig F (2011) 1000

The Plasma Membrane of the Cyanobacterium Gloeobacter violaceus Contains 1001

Segregated Bioenergetic Domains Plant Cell 23 2379-2390 1002

Rippka R Deruelles J Waterbury JB Herdman M and Stanier RY (1979) Generic 1003

Assignments Strain Histories and Properties of Pure Cultures of Cyanobacteria 1004

Microbiology 111 1-61 1005

Ruumltgers M and Schroda M (2013) A role of VIPP1 as a dynamic structure within 1006

thylakoid centers as sites of photosystem biogenesis Plant Signal Behav 8 e27037 1007

Sacharz J Bryan SJ Yu J Burroughs NJ Spence EM Nixon PJ and Mullineaux 1008

CW (2015) Sub-cellular location of FtsH proteases in the cyanobacterium1009

Synechocystis sp PCC 6803 suggests localised PSII repair zones in the thylakoid1010

membranes Mol Microbiol 96 448-4621011

Sandstroumlm S Park Y-I Oumlquist G and Gustafsson P (2001) CP43prime the isiA Gene 1012

Product Functions as an Excitation Energy Dissipator in the Cyanobacterium 1013

Synechococcus sp PCC 7942 Photochem Photobiol 74 431-437 1014

Schindelin J Arganda-Carreras I Frise E Kaynig V Longair M Pietzsch T 1015

Preibisch S Rueden C Saalfeld S Schmid B Tinevez J-Y White DJ 1016

Hartenstein V Eliceiri K Tomancak P and Cardona A (2012) Fiji an open-1017

source platform for biological-image analysis Nat Methods 9 676-682 1018

Schottkowski M Ratke J Oster U Nowaczyk M and Nickelsen J (2009a) Pitt a novel 1019

tetratricopeptide repeat protein involved in light-dependent chlorophyll biosynthesis 1020

and thylakoid membrane biogenesis in Synechocystis sp PCC 6803 Mol Plant 2 1021

1289-1297 1022

Schottkowski M Gkalympoudis S Tzekova N Stelljes C Schuumlnemann D Ankele E 1023

and Nickelsen J (2009b) Interaction of the periplasmic PratA factor and the PsbA 1024

(D1) protein during biogenesis of photosystem II in Synechocystis sp PCC 6803 J 1025

Biol Chem 284 1813-1819 1026

Selatildeo TT Zhang L Knoppovaaacute J Komenda J and Norling B (2016) Photosystem II 1027

Assembly Steps Take Place in the Thylakoid Membrane of the Cyanobacterium 1028

Synechocystis sp PCC6803 Plant Cell Physiol 57 878 1029

32

Spaumlt P Maček B and Forchhammer K (2015) Phosphoproteome of the cyanobacterium 1030

Synechocystis sp PCC 6803 and its dynamics during nitrogen starvation Front 1031

Microbiol 6 248 1032

Stengel A Guumlgel IL Hilger D Rengstl B Jung H and Nickelsen J (2012) Initial 1033

steps of photosystem II de novo assembly and preloading with manganese take place 1034

in biogenesis centers in Synechocystis Plant Cell 24 660-675 1035

Uniacke J and Zerges W (2007) Photosystem II assembly and repair are differentially 1036

localized in Chlamydomonas Plant Cell 19 3640-3654 1037

Uniacke J and Zerges W (2009) Chloroplast protein targeting involves localized 1038

translation in Chlamydomonas Proc Natl Acad Sci USA 106 1439-1444 1039

van de Meene AL Hohmann-Marriott M Vermaas WJ and Roberson R (2006) The 1040

three-dimensional structure of the cyanobacterium Synechocystis sp PCC 6803 Arch 1041

Microbiol 184 259-270 1042

van de Meene AML Sharp WP McDaniel JH Friedrich H Vermaas WFJ and 1043

Roberson RW (2012) Gross morphological changes in thylakoid membrane 1044

structure are associated with photosystem I deletion in Synechocystis sp PCC 6803 1045

Biochim Biophys Acta 1818 1427-1434 1046

Watanabe M and Ikeuchi M (2013) Phycobilisome architecture of a light-harvesting 1047

supercomplex Photosynth Res 116 265-276 1048

Wellburn AR and Lichtenthaler H (1984) Formulae and Program to Determine Total 1049

Carotenoids and Chlorophylls A and B of Leaf Extracts in Different Solvents In 1050

Advances in Photosynthesis Research Proceedings of the VIth International Congress 1051

on Photosynthesis Brussels Belgium August 1ndash6 1983 C Sybesma ed (Dordrecht 1052

Springer Netherlands) pp 9-12 1053

Wilde A Lunser K Ossenbuumlhl F Nickelsen J and Borner T (2001) Characterization of 1054

the cyanobacterial ycf37 mutation decreases the photosystem I content Biochem J 1055

357 211-216 1056

Wilson A Boulay C Wilde A Kerfeld CA and Kirilovsky D (2007) Light-Induced 1057

Energy Dissipation in Iron-Starved Cyanobacteria Roles of OCP and IsiA Proteins 1058

Plant Cell 19 656-672 1059

Xu M Bernaacutet G Singh A Mi H Roumlgner M Pakrasi HB and Ogawa T (2008) 1060

Properties of Mutants of Synechocystis sp Strain PCC 6803 Lacking Inorganic Carbon 1061

Sequestration Systems Plant Cell Physiol 49 1672-1677 1062

33

Yamamoto T Burke J Autz G and Jagendorf AT (1981) Bound ribosomes of Pea 1063

chloroplast thylakoid membranes location and release in vitro by high salt 1064

puromycin and RNase Plant Physiol 67 940-949 1065

Yang H Liao L Bo T Zhao L Sun X Lu X Norling B and Huang F (2014) 1066

Slr0151 in Synechocystis sp PCC 6803 is required for efficient repair of photosystem 1067

II under high-light condition J Integr Plant Biol 56 1136-1150 1068

Yeremenko N Kouřil R Ihalainen JA DHaene S van Oosterwijk N 1069

Andrizhiyevskaya EG Keegstra W Dekker HL Hagemann M Boekema EJ 1070

Matthijs HCP and Dekker JP (2004) Supramolecular Organization and Dual 1071

Function of the IsiA Chlorophyll-Binding Protein in Cyanobacteria Biochemistry 43 1072

10308-10313 1073

Zak E Norling B Maitra R Huang F Andersson B and Pakrasi HB (2001) The 1074

initial steps of biogenesis of cyanobacterial photosystems occur in plasma membranes 1075

Proc Natl Acad Sci USA 98 13443-13448 1076

Zang X Liu B Liu S Arunakumara KKIU and Zhang X (2007) Optimum 1077

Conditions for Transformation of Synechocystis sp PCC 6803 J Microbiol 45 241-1078

245 1079

Zhang L and Sakamoto W (2015) Possible function of VIPP1 in maintaining chloroplast 1080

membranes Biochim Biophys Acta 1847 831-837 1081

Zimmerberg J and Kozlov MM (2006) How proteins produce cellular membrane 1082

curvature Nat Rev Mol Cell Biol 7 9-19 1083

Zoumlfel P (1988) Statistik in der Praxis (Stuttgart Germany Gustav Fischer Verlag) 1084

1085

34

Figure Legends 1086

Figure 1 General characteristics of CurT A) Sequence alignment of CurT and CURT1A-D 1087

from A thaliana Predicted chloroplast transit-peptide sequences of CURT1A-D are omitted 1088

(Armbruster et al 2013) Positions of predicted C-terminal transmembrane domains (TDM) 1089

are marked (black bar) as is the position of the predicted amphipathic N-terminal helix in 1090

CurT (red bar) The green bar denotes the peptide sequence used for antibody production 1091

Identical and related amino acids that are conserved in 100 80 and 60 of the sequences 1092

are highlighted in black dark grey and light grey respectively B) Helical-wheel 1093

representation of the N-terminal amphipathic helix of CurT (red bar in A) The color code 1094

reflects the physicochemical properties of amino-acid side-chains green polar and 1095

uncharged blue polar and positively charged red polar and negatively charged yellow 1096

hydrophobic C) Solubility of CurT Membrane-associated proteins (50 microg) from wild-type 1097

cells were extracted with 5 mM HEPES (pH 76) containing either 1 M NaCl 01 M Na2CO3 1098

4 M urea 01 Triton X-100 or no additional solute After separation of membrane-bound 1099

(M) and solubilized (S) proteins by centrifugation proteins were fractionated by SDS-PAGE1100

and CurT was immunodetected on immunoblots As a control the integral membrane protein 1101

CP47 from PSII was analyzed in parallel D) Transmission electron micrographs of negatively 1102

stained liposomes Cell-free expression (CFE) of CurT and A thaliana CURT1A was 1103

performed in the presence of liposomes similar in composition to the lipids of the thylakoid 1104

membrane Liposomes before and after cell-free protein expression in the absence of DNA 1105

served as negative controls Black arrowheads indicate tubular connections between 1106

liposomes Scale bars 250 nm 1107

1108

Figure 2 Ultrastructural analysis of curT- cells Transmission electron micrographs of typical 1109

wild-type (A) and curT- (B-D) Synechocystis 6803 cells taken at 44000times (A B) and 28000times 1110

(C D) magnification respectively Ultrathin sections (35 to 45 nm) of cryofixed samples 1111

were stained with osmium tetroxide and post-stained using lead citrate Arrowheads indicate 1112

biogenesis centers Scale bars 200 nm (A B) and 500 nm (C D) respectively 1113

1114

Figure 3 Accumulation of components of photosynthetic complexes in the curT- mutant A) 1115

Whole cell extracts (30 microg protein) from wild-type and curT- strains were fractionated by 1116

SDS-PAGE and analyzed on immunoblots using the indicated antibodies B) The histogram 1117

shows levels of the indicated proteins in curT- extracts relative to wild-type samples (dashed 1118

red line) Data are means plusmn SD of three independent experiments Significant differences from 1119

35

wild-type protein levels according to Studentrsquos t-test with error probabilities of 5 and 1 1120

are indicated by and respectively 1121

1122

Figure 4 P700+ reduction kinetics and high-light effects in curT- cells A) Averaged traces 1123

(10 single measurements) of P700+ decay after complete oxidation by a 50-ms multiple 1124

turnover pulse (10000 micromol photons m-2 s-1) in the absence and presence of 10 microM DCMU 1125

B) Rate constants for P700+ reduction were obtained by fitting of the data with single1126

exponential functions Error bars indicate the SD of three independent measurements C) 1127

Impact of light intensity on the (relative) electron transport rate (rETR) Cells were exposed to 1128

gradually increasing light intensities which resulted in increasing electron transport until the 1129

capacity limit was reached PAR light intensity (micromol photons m-2 s-1) Error bars indicate the 1130

SD of three independent measurements D) D1 protein level in wild-type and curT- after high-1131

light treatment (800 micromol photons m-2s-1) in the presence and absence of lincomycin Samples 1132

were taken every 30 min and processed as in Figure 3 to determine the level of D1 present 1133

100 refers to wild-type D1 level at the beginning of the experiment 1134

1135

Figure 5 PSII assembly in curT- cells A) BNSDS-PAGE of membrane proteins Membrane 1136

fractions from wild-type and curT- cells were solubilized with 13 n-dodecyl-β-maltoside 1137

and proteins were fractionated by two-dimensional BNSDS-PAGE blotted and probed with 1138

antibodies against the PSII subunits D1 D2 CP47 and CP43 Wild-type blots were also 1139

probed with the αCurT antibody The sizes of marker proteins and the positions of PSII 1140

assembly intermediates (RCCII RCCI RC47) are shown above and below each image B) In 1141

vivo pulse labeling of membrane proteins with 35S Pulse-labeled PSII core proteins were 1142

separated via BNSDS-PAGE and visualized by autoradiography 1143

1144

Figure 6 Loss of CurT induces stress A) Low-temperature (77 K) fluorescence emission of 1145

Synechocystis 6803 wild-type (blue) and curT- (red) cells excited at 440 nm The spectra were 1146

normalized to the added fluorescein standard B) Low-temperature (77 K) fluorescence 1147

emission of Synechocystis 6803 wild-type (blue) and curT- (red) excited at 580 nm The 1148

spectra were normalized to 780 nm C) Level of IsiA in the curT- mutant relative to the wild-1149

type A mean value of 368 plusmn 96 (SD) was determined from three independent experiments 1150

1151

Figure 7 Membrane sublocalization of PSII-related factors Cell extracts from wild-type and 1152

curT- cells were fractionated by two consecutive rounds of sucrose-density gradient 1153

36

centrifugation (Schottkowski et al 2009b) The second linear gradient (20-60 sucrose) was 1154

apportioned into 14 fractions which were analyzed by immunoblotting using the indicated 1155

antibodies Fractions 1ndash6 represent PDMs and fractions 7ndash14 thylakoid membranes (TMs) 1156

To facilitate comparison between gradients sample volumes were normalized to the volume 1157

of fraction 7 that contained 40 microg of protein 1158

1159

Figure 8 Live-cell imaging of the curT-CFP strain by fluorescence microscopy In the curT-1160

CFP strain the native curT gene has been replaced by a CFP-tagged version resulting in the 1161

expression of the CurT-CFP fusion protein under the control of the native promotor A) 1162

Close-up views of the mid-cell plane in the CFP and far-red autofluorescence channels shown 1163

in slice 7 in panel B B) Synechocystis 6803 cells expressing CurT C-terminally fused to the 1164

mTurquoise2 variant of CFP from its native chromosomal promoter The two imaging 1165

channels are displayed as Z-axis montages (auto-scaled contrast step size 250 nm) in 1166

grayscale and color composite configuration The thylakoid autofluorescent channel as 1167

imaged in far-red fluorescence is depicted in magenta and CurT signal as imaged in cyan 1168

fluorescence is depicted in cyan C) Fluorescence intensity profiles of the two channels along 1169

the autofluorescent peripheral cell ldquoringrdquo are shown for slice 7 The maximum projection of 1170

the entire Z montage is also shown Scale bars (light grey) 2 microm 1171

1172

Figure 9 Immunofluorescence detection of CurT A) Close-ups of slice 5 in panel B B) 1173

Wild-type Synechocystis 6803 cells labeled with αCurT antibodies and detected with Oregon 1174

Green-conjugated secondary antibodies The Z-axis montages are shown as in Figure 8B 1175

except that the step size is 280 nm (1 to 10) C) Intensity profiles of the two channels along 1176

the autofluorescent peripheral cell ldquoringrdquo are shown for slice 5 The maximum projection of 1177

the entire Z montage is also shown Scale bars (light grey) 2 microm 1178

1179

Figure 10 Subcellular localization of CurT Ultrathin sections of wild-type Synechocystis 1180

6803 cells were incubated with rabbit αCurT prior to incubation with gold-conjugated goat 1181

anti-rabbit IgG A) Negative control (wild-type processed without addition of primary 1182

antibody) B C) Immunogold-labeled sections showing CurT localization at the cytoplasmic 1183

side of the thylakoid membrane D) Cluster formation of CurT signals at a putative biogenesis 1184

center from C E) Biogenesis center from the same cell (C) without any obvious CurT 1185

clustering of gold particles F) Schematic depiction of a wild-type cell (from Figure 2A) with 1186

color-coded curved membranes green = thylakoids that follow the curvature of the cell red = 1187

37

thylakoids that bend away from the plasma membrane yellow = thylakoids that bend toward 1188

the plasma membrane to converge on sites of biogenesis centers G) Relative distribution of 1189

gold signals between convex (dark color) and concave (light color) sides of membranes (n = 1190

1584 signals from a total of 95 cells) The undifferentiated overall signal distribution is given 1191

in blue Bars = 200 nm (overview) and 100 nm (details) 1192

1193

Figure 11 Differentially modified forms of CurT are found in different complexes in PDMs 1194

and thylakoid membranes Samples were isolated by fractionation of wild-type membranes 1195

via two consecutive sucrose density gradients according to Schottkowski et al (2009b) After 1196

density centrifugation samples were applied to BNSDS-PAGE analysis (A) or isoelectric 1197

focusing (B) Numbers on the right indicate the respective fraction from the second gradient 1198

(see Figure 7) Fraction 5 represents the PDMs and fraction 9 the thylakoid membrane 1199

1200

Figure 12 Loss of CurT increases sensitivity to abiotic stress A B) Doubling times of wild-1201

type and curT- under salt stress (A) or osmotic stress (B) Doubling times are means plusmn SD of 1202

three independent cultures C) Localization of CurT-CFP under salt and osmotic stress 1203

Samples were examined as described in Figure 8 Scale bars 1 microm D) Protein levels of wild-1204

type cells after growth in BG11 medium containing 500 mM NaCl Samples were analyzed on 1205

the same gel but unrelated samples between the presented signals were omitted E) 1206

Membrane preparations obtained from wild-type cells wild-type cells grown in the presence 1207

of 500 mM NaCl and curT- cells were subjected to the first gradient step in the membrane 1208

fractionation scheme The gradient was divided into five fractions and 10 of fractions I-IV 1209

and 02 of fraction V were analyzed by SDS-PAGE Fraction II includes the plasma 1210

membrane and fraction V consists of PratA-defined membrane and thylakoid membrane 1211

1212

Figure 13 Model of CurT distribution at convergence zones in Synechocystis 6803 The 1213

distribution of CurT in thylakoid (green) and plasma membranes (brown) is shown The 1214

pattern of localization of CurT in the thylakoid membrane is derived from membrane 1215

fractionation via sucrose density centrifugation fluorescence-based detection of the CurT-1216

CFP fusion and endogenous CurT and immunogold labeling experiments (Figures 7-10) The 1217

different CurT variants a b c and d identified in the IEF experiments (Figure 11) are depicted 1218

in yellow pink blue and black respectively CurT present in the plasma membrane is 1219

highlighted in gray as its precise nature and role remain to be defined (Figure 12) 1220

Membranes are represented as lipid bilayers Convex and concave faces of bent thylakoid 1221

38

sheets are indicated by black arrows The PDM which is dedicated to PSII assembly and 1222

repair is depicted in blue The dotted blue line emphasizes that the ultrastructure in this region 1223

has not yet been fully resolved PP periplasm PM plasma membrane TM thylakoid 1224

membrane L lumen PDM PratA-defined membrane 1225

1226

Tables 1227

Table 1 Physiological characteristics of the curT- mutant 1228

Strain Doubling time [h]

Oxygen Evolution[nmol h-1 OD750

-1]c

Chlorophyll content

[microg OD750-1]

d

Cell size [microm]e

Cell number [ml-1 OD750

-1]f

Wild type 817plusmn017a 1600plusmn042

b 1933plusmn187 251plusmn014 264plusmn020 390plusmn006 x 107

curT- 1259plusmn020a 3226plusmn056

b 1074plusmn20 195plusmn029 274plusmn044 367plusmn016 x 107

1229 abDoubling times in the presence (a) or absence (b) of 5 mM glucose measured under 1230

continuous illumination at 30 micromol photons m-2 s-1 and CO2-limiting conditions cOxygen 1231

evolution is expressed in nmol O2 produced per hour per OD750 unit dChlorophyll content is 1232

expressed in microg OD750-1 eThe diameter of non-dividing cells is presented in microm fCell number 1233

was determined per ml per OD750 Data are means plusmn SD of at least three independent 1234

experiments 1235

1236

Parsed CitationsAllen JF de Paula WBM Puthiyaveetil S and Nield J (2011) A structural phylogenetic map for chloroplast photosynthesisTrends Plant Sci 16 645-655

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Anderson JM Horton P Kim E-H and Chow WS (2012) Towards elucidation of dynamic structural changes of plant thylakoidarchitecture Philos Trans R Soc Lond B Biol Sci 367 3515-3524

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Armbruster U Zuumlhlke J Rengstl B Kreller R Makarenko E Ruumlhle T Schuumlnemann D Jahns P Weisshaar B NickelsenJ and Leister D (2010) The Arabidopsis thylakoid protein PAM68 is required for efficient D1 biogenesis and photosystem IIassembly Plant Cell 22 3439-3460

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Armbruster U Labs M Pribil M Viola S Xu W Scharfenberg M Hertle AP Rojahn U Jensen PE Rappaport F JoliotP Doumlrmann P Wanner G and Leister D (2013) Arabidopsis CURVATURE THYLAKOID1 proteins modify thylakoid architectureby inducing membrane curvature Plant Cell 25 2661-2678

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Aseeva E Ossenbuumlhl F Sippel C Cho WK Stein B Eichacker LA Meurer J Wanner G Westhoff P Soll J andVothknecht UC (2007) Vipp1 is required for basic thylakoid membrane formation but not for the assembly of thylakoid proteincomplexes Plant Physiol Biochem 45 119-128

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Bartsevich VV and Pakrasi HB (1995) Molecular identification of an ABC transporter complex for manganese analysis of acyanobacterial mutant strain impaired in the photosynthetic oxygen evolution process EMBO J 14 1845-1853

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Bartsevich VV and Pakrasi HB (1996) Manganese transport in the cyanobacterium Synechocystis sp PCC 6803 J Biol Chem271 26057-26061

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Bernaacutet G Waschewski N and Roumlgner M (2009) Towards efficient hydrogen production the impact of antenna size andexternal factors on electron transport dynamics in Synechocystis PCC 6803 Photosynth Res 99 205-216

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Boehm M Yu J Krynicka V Barker M Tichy M Komenda J Nixon PJ and Nield J (2012) Subunit Organization of aSynechocystis Hetero-Oligomeric Thylakoid FtsH Complex Involved in Photosystem II Repair Plant Cell 24 3669-3683

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Bradford MM (1976) A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle ofprotein-dye binding Anal Biochem 72 248-254

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Chang L Liu X Li Y Liu C-C Yang F Zhao J and Sui S-F (2015) Structural organization of an intact phycobilisome and itsassociation with photosystem II Cell Res 25 726-737

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Danielsson R Suorsa M Paakkarinen V Albertsson P-Aring Styring S Aro E-M and Mamedov F (2006) Dimeric andmonomeric organization of photosystem II Distribution of five distinct complexes in the different domains of the thylakoidmembrane J Biol Chem 281 14241-14249

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Daum B Nicastro D Austin J McIntosh JR and Kuumlhlbrandt W (2010) Arrangement of photosystem II and ATP synthase in

29

Huang F Fulda S Hagemann M and Norling B (2006) Proteomic screening of salt-931

stress-induced changes in plasma membranes of Synechocystis sp strain PCC 6803 932

Proteomics 6 910-920 933

Kirchhoff H (2013) Architectural switches in plant thylakoid membranes Photosynth Res 934

116 481-487 935

Klinkert B Elles I and Nickelsen J (2006) Translation of chloroplast psbD mRNA in 936

Chlamydomonas is controlled by a secondary RNA structure blocking the AUG start 937

codon Nucleic Acids Res 34 386-394 938

Klinkert B Ossenbuumlhl F Sikorski M Berry S Eichacker L and Nickelsen J (2004) 939

PratA a periplasmic tetratricopeptide repeat protein involved in biogenesis of 940

photosystem II in Synechocystis sp PCC 6803 J Biol Chem 279 44639-44644 941

Komenda J Nickelsen J Tichyacute M Praacutešil O Eichacker LA and Nixon PJ (2008) The 942

cyanobacterial homologue of HCF136YCF48 is a component of an early photosystem 943

II assembly complex and is important for both the efficient assembly and repair of 944

photosystem II in Synechocystis sp PCC 6803 J Biol Chem 283 22390-22399 945

Kopf M Klaumlhn S Scholz I Matthiessen JKF Hess WR and Voszlig B (2014) 946

Comparative analysis of the primary transcriptome of Synechocystis sp PCC 6803 947

DNA Res 21 527-539 948

Kunkel DD (1982) Thylakoid centers Structures associated with the cyanobacterial 949

photosynthetic membrane system Arch Microbiol 133 97-99 950

Liberton M Howard Berg R Heuser J Roth R and Pakrasi BH (2006) Ultrastructure 951

of the membrane systems in the unicellular cyanobacterium Synechocystis sp strain 952

PCC 6803 Protoplasma 227 129-138 953

Liberton M Saha R Jacobs JM Nguyen AY Gritsenko MA Smith RD 954

Koppenaal DW and Pakrasi HB (2016) Global Proteomic Analysis Reveals an 955

Exclusive Role of Thylakoid Membranes in Bioenergetics of a Model 956

Cyanobacterium Mol Cell Proteomics 15 2021-2032 957

Luque I and Ochoa de Alda JAG (2014) CURT1CAAD-containing aaRSs thylakoid 958

curvature and gene translation Trends Plant Sci 19 63-66 959

Marin K Stirnberg M Eisenhut M Kraumlmer R and Hagemann M (2006) Osmotic stress 960

in Synechocystis sp PCC 6803 low tolerance towards nonionic osmotic stress results 961

from lacking activation of glucosylglycerol accumulation Microbiology 152 2023-962

2030 963

Mullineaux CW (2005) Function and evolution of grana Trends Plant Sci 10 521-525 964

30

Mullineaux CW (2008) Biogenesis and dynamics of thylakoid membranes and the 965

photosynthetic apparatus In The Cyanobacteria A Herrero and E Flores eds 966

(Norfolk UK Caister Academic Press) pp 289ndash304 967

Nevo R Charuvi D Tsabari O and Reich Z (2012) Composition architecture and 968

dynamics of the photosynthetic apparatus in higher plants Plant J 70 157-176 969

Nickelsen J and Rengstl B (2013) Photosystem II assembly From cyanobacteria to plants 970

Annu Rev Plant Biol 64 609-635 971

Nickelsen J and Zerges W (2013) Thylakoid biogenesis has joined the new era of bacterial 972

cell biology Front Plant Sci 4 458 973

Nilsson F Simpson DJ Jansson C and Andersson B (1992) Ultrastructural and 974

biochemical characterization of a Synechocystis 6803 mutant with inactivated psbA 975

genes Arch Biochem Biophys 295 340-347 976

Odom WR Hodges R Chitnis PR and Guikema JA (1993) Characterization of 977

Synechocystis sp PCC 6803 in iron-supplied and iron-deficient media Plant Mol 978

Biol 23 1255-1264 979

Ossenbuumlhl F Inaba-Sulpice M Meurer J Soll J and Eichacker LA (2006) The 980

Synechocystis sp PCC 6803 Oxa1 homolog is essential for membrane integration of 981

reaction center precursor protein pD1 Plant Cell 18 2236-2246 982

Pisareva T Kwon J Oh J Kim S Ge C Wieslander Aring Choi J-S and Norling B 983

(2011) Model for Membrane Organization and Protein Sorting in the Cyanobacterium 984

Synechocystis sp PCC 6803 Inferred from Proteomics and Multivariate Sequence 985

Analyses J Proteome Res 10 3617-3631 986

Pribil M Labs M and Leister D (2014) Structure and dynamics of thylakoids in land 987

plants J Exp Bot 65 1955-1972 988

Rast A Heinz S and Nickelsen J (2015) Biogenesis of thylakoid membranes Biochim 989

Biophys Acta 1847 821-830 990

Rast A Rengstl B Heinz S Klingl A and Nickelsen J (2016) The role of Slr0151 a 991

tetratricopeptide repeat protein from Synechocystis sp PCC 6803 during Photosystem 992

II assembly and repair Front Plant Sci 7 605 993

Rengstl B Oster U Stengel A and Nickelsen J (2011) An Intermediate Membrane 994

Subfraction in Cyanobacteria Is Involved in an Assembly Network for Photosystem II 995

Biogenesis J Biol Chem 286 21944-21951 996

31

Rengstl B Knoppovaacute J Komenda J and Nickelsen J (2013) Characterization of a 997

Synechocystis double mutant lacking the photosystem II assembly factors YCF48 and 998

Sll0933 Planta 237 471-480 999

Rexroth S Mullineaux CW Ellinger D Sendtko E Roumlgner M and Koenig F (2011) 1000

The Plasma Membrane of the Cyanobacterium Gloeobacter violaceus Contains 1001

Segregated Bioenergetic Domains Plant Cell 23 2379-2390 1002

Rippka R Deruelles J Waterbury JB Herdman M and Stanier RY (1979) Generic 1003

Assignments Strain Histories and Properties of Pure Cultures of Cyanobacteria 1004

Microbiology 111 1-61 1005

Ruumltgers M and Schroda M (2013) A role of VIPP1 as a dynamic structure within 1006

thylakoid centers as sites of photosystem biogenesis Plant Signal Behav 8 e27037 1007

Sacharz J Bryan SJ Yu J Burroughs NJ Spence EM Nixon PJ and Mullineaux 1008

CW (2015) Sub-cellular location of FtsH proteases in the cyanobacterium1009

Synechocystis sp PCC 6803 suggests localised PSII repair zones in the thylakoid1010

membranes Mol Microbiol 96 448-4621011

Sandstroumlm S Park Y-I Oumlquist G and Gustafsson P (2001) CP43prime the isiA Gene 1012

Product Functions as an Excitation Energy Dissipator in the Cyanobacterium 1013

Synechococcus sp PCC 7942 Photochem Photobiol 74 431-437 1014

Schindelin J Arganda-Carreras I Frise E Kaynig V Longair M Pietzsch T 1015

Preibisch S Rueden C Saalfeld S Schmid B Tinevez J-Y White DJ 1016

Hartenstein V Eliceiri K Tomancak P and Cardona A (2012) Fiji an open-1017

source platform for biological-image analysis Nat Methods 9 676-682 1018

Schottkowski M Ratke J Oster U Nowaczyk M and Nickelsen J (2009a) Pitt a novel 1019

tetratricopeptide repeat protein involved in light-dependent chlorophyll biosynthesis 1020

and thylakoid membrane biogenesis in Synechocystis sp PCC 6803 Mol Plant 2 1021

1289-1297 1022

Schottkowski M Gkalympoudis S Tzekova N Stelljes C Schuumlnemann D Ankele E 1023

and Nickelsen J (2009b) Interaction of the periplasmic PratA factor and the PsbA 1024

(D1) protein during biogenesis of photosystem II in Synechocystis sp PCC 6803 J 1025

Biol Chem 284 1813-1819 1026

Selatildeo TT Zhang L Knoppovaaacute J Komenda J and Norling B (2016) Photosystem II 1027

Assembly Steps Take Place in the Thylakoid Membrane of the Cyanobacterium 1028

Synechocystis sp PCC6803 Plant Cell Physiol 57 878 1029

32

Spaumlt P Maček B and Forchhammer K (2015) Phosphoproteome of the cyanobacterium 1030

Synechocystis sp PCC 6803 and its dynamics during nitrogen starvation Front 1031

Microbiol 6 248 1032

Stengel A Guumlgel IL Hilger D Rengstl B Jung H and Nickelsen J (2012) Initial 1033

steps of photosystem II de novo assembly and preloading with manganese take place 1034

in biogenesis centers in Synechocystis Plant Cell 24 660-675 1035

Uniacke J and Zerges W (2007) Photosystem II assembly and repair are differentially 1036

localized in Chlamydomonas Plant Cell 19 3640-3654 1037

Uniacke J and Zerges W (2009) Chloroplast protein targeting involves localized 1038

translation in Chlamydomonas Proc Natl Acad Sci USA 106 1439-1444 1039

van de Meene AL Hohmann-Marriott M Vermaas WJ and Roberson R (2006) The 1040

three-dimensional structure of the cyanobacterium Synechocystis sp PCC 6803 Arch 1041

Microbiol 184 259-270 1042

van de Meene AML Sharp WP McDaniel JH Friedrich H Vermaas WFJ and 1043

Roberson RW (2012) Gross morphological changes in thylakoid membrane 1044

structure are associated with photosystem I deletion in Synechocystis sp PCC 6803 1045

Biochim Biophys Acta 1818 1427-1434 1046

Watanabe M and Ikeuchi M (2013) Phycobilisome architecture of a light-harvesting 1047

supercomplex Photosynth Res 116 265-276 1048

Wellburn AR and Lichtenthaler H (1984) Formulae and Program to Determine Total 1049

Carotenoids and Chlorophylls A and B of Leaf Extracts in Different Solvents In 1050

Advances in Photosynthesis Research Proceedings of the VIth International Congress 1051

on Photosynthesis Brussels Belgium August 1ndash6 1983 C Sybesma ed (Dordrecht 1052

Springer Netherlands) pp 9-12 1053

Wilde A Lunser K Ossenbuumlhl F Nickelsen J and Borner T (2001) Characterization of 1054

the cyanobacterial ycf37 mutation decreases the photosystem I content Biochem J 1055

357 211-216 1056

Wilson A Boulay C Wilde A Kerfeld CA and Kirilovsky D (2007) Light-Induced 1057

Energy Dissipation in Iron-Starved Cyanobacteria Roles of OCP and IsiA Proteins 1058

Plant Cell 19 656-672 1059

Xu M Bernaacutet G Singh A Mi H Roumlgner M Pakrasi HB and Ogawa T (2008) 1060

Properties of Mutants of Synechocystis sp Strain PCC 6803 Lacking Inorganic Carbon 1061

Sequestration Systems Plant Cell Physiol 49 1672-1677 1062

33

Yamamoto T Burke J Autz G and Jagendorf AT (1981) Bound ribosomes of Pea 1063

chloroplast thylakoid membranes location and release in vitro by high salt 1064

puromycin and RNase Plant Physiol 67 940-949 1065

Yang H Liao L Bo T Zhao L Sun X Lu X Norling B and Huang F (2014) 1066

Slr0151 in Synechocystis sp PCC 6803 is required for efficient repair of photosystem 1067

II under high-light condition J Integr Plant Biol 56 1136-1150 1068

Yeremenko N Kouřil R Ihalainen JA DHaene S van Oosterwijk N 1069

Andrizhiyevskaya EG Keegstra W Dekker HL Hagemann M Boekema EJ 1070

Matthijs HCP and Dekker JP (2004) Supramolecular Organization and Dual 1071

Function of the IsiA Chlorophyll-Binding Protein in Cyanobacteria Biochemistry 43 1072

10308-10313 1073

Zak E Norling B Maitra R Huang F Andersson B and Pakrasi HB (2001) The 1074

initial steps of biogenesis of cyanobacterial photosystems occur in plasma membranes 1075

Proc Natl Acad Sci USA 98 13443-13448 1076

Zang X Liu B Liu S Arunakumara KKIU and Zhang X (2007) Optimum 1077

Conditions for Transformation of Synechocystis sp PCC 6803 J Microbiol 45 241-1078

245 1079

Zhang L and Sakamoto W (2015) Possible function of VIPP1 in maintaining chloroplast 1080

membranes Biochim Biophys Acta 1847 831-837 1081

Zimmerberg J and Kozlov MM (2006) How proteins produce cellular membrane 1082

curvature Nat Rev Mol Cell Biol 7 9-19 1083

Zoumlfel P (1988) Statistik in der Praxis (Stuttgart Germany Gustav Fischer Verlag) 1084

1085

34

Figure Legends 1086

Figure 1 General characteristics of CurT A) Sequence alignment of CurT and CURT1A-D 1087

from A thaliana Predicted chloroplast transit-peptide sequences of CURT1A-D are omitted 1088

(Armbruster et al 2013) Positions of predicted C-terminal transmembrane domains (TDM) 1089

are marked (black bar) as is the position of the predicted amphipathic N-terminal helix in 1090

CurT (red bar) The green bar denotes the peptide sequence used for antibody production 1091

Identical and related amino acids that are conserved in 100 80 and 60 of the sequences 1092

are highlighted in black dark grey and light grey respectively B) Helical-wheel 1093

representation of the N-terminal amphipathic helix of CurT (red bar in A) The color code 1094

reflects the physicochemical properties of amino-acid side-chains green polar and 1095

uncharged blue polar and positively charged red polar and negatively charged yellow 1096

hydrophobic C) Solubility of CurT Membrane-associated proteins (50 microg) from wild-type 1097

cells were extracted with 5 mM HEPES (pH 76) containing either 1 M NaCl 01 M Na2CO3 1098

4 M urea 01 Triton X-100 or no additional solute After separation of membrane-bound 1099

(M) and solubilized (S) proteins by centrifugation proteins were fractionated by SDS-PAGE1100

and CurT was immunodetected on immunoblots As a control the integral membrane protein 1101

CP47 from PSII was analyzed in parallel D) Transmission electron micrographs of negatively 1102

stained liposomes Cell-free expression (CFE) of CurT and A thaliana CURT1A was 1103

performed in the presence of liposomes similar in composition to the lipids of the thylakoid 1104

membrane Liposomes before and after cell-free protein expression in the absence of DNA 1105

served as negative controls Black arrowheads indicate tubular connections between 1106

liposomes Scale bars 250 nm 1107

1108

Figure 2 Ultrastructural analysis of curT- cells Transmission electron micrographs of typical 1109

wild-type (A) and curT- (B-D) Synechocystis 6803 cells taken at 44000times (A B) and 28000times 1110

(C D) magnification respectively Ultrathin sections (35 to 45 nm) of cryofixed samples 1111

were stained with osmium tetroxide and post-stained using lead citrate Arrowheads indicate 1112

biogenesis centers Scale bars 200 nm (A B) and 500 nm (C D) respectively 1113

1114

Figure 3 Accumulation of components of photosynthetic complexes in the curT- mutant A) 1115

Whole cell extracts (30 microg protein) from wild-type and curT- strains were fractionated by 1116

SDS-PAGE and analyzed on immunoblots using the indicated antibodies B) The histogram 1117

shows levels of the indicated proteins in curT- extracts relative to wild-type samples (dashed 1118

red line) Data are means plusmn SD of three independent experiments Significant differences from 1119

35

wild-type protein levels according to Studentrsquos t-test with error probabilities of 5 and 1 1120

are indicated by and respectively 1121

1122

Figure 4 P700+ reduction kinetics and high-light effects in curT- cells A) Averaged traces 1123

(10 single measurements) of P700+ decay after complete oxidation by a 50-ms multiple 1124

turnover pulse (10000 micromol photons m-2 s-1) in the absence and presence of 10 microM DCMU 1125

B) Rate constants for P700+ reduction were obtained by fitting of the data with single1126

exponential functions Error bars indicate the SD of three independent measurements C) 1127

Impact of light intensity on the (relative) electron transport rate (rETR) Cells were exposed to 1128

gradually increasing light intensities which resulted in increasing electron transport until the 1129

capacity limit was reached PAR light intensity (micromol photons m-2 s-1) Error bars indicate the 1130

SD of three independent measurements D) D1 protein level in wild-type and curT- after high-1131

light treatment (800 micromol photons m-2s-1) in the presence and absence of lincomycin Samples 1132

were taken every 30 min and processed as in Figure 3 to determine the level of D1 present 1133

100 refers to wild-type D1 level at the beginning of the experiment 1134

1135

Figure 5 PSII assembly in curT- cells A) BNSDS-PAGE of membrane proteins Membrane 1136

fractions from wild-type and curT- cells were solubilized with 13 n-dodecyl-β-maltoside 1137

and proteins were fractionated by two-dimensional BNSDS-PAGE blotted and probed with 1138

antibodies against the PSII subunits D1 D2 CP47 and CP43 Wild-type blots were also 1139

probed with the αCurT antibody The sizes of marker proteins and the positions of PSII 1140

assembly intermediates (RCCII RCCI RC47) are shown above and below each image B) In 1141

vivo pulse labeling of membrane proteins with 35S Pulse-labeled PSII core proteins were 1142

separated via BNSDS-PAGE and visualized by autoradiography 1143

1144

Figure 6 Loss of CurT induces stress A) Low-temperature (77 K) fluorescence emission of 1145

Synechocystis 6803 wild-type (blue) and curT- (red) cells excited at 440 nm The spectra were 1146

normalized to the added fluorescein standard B) Low-temperature (77 K) fluorescence 1147

emission of Synechocystis 6803 wild-type (blue) and curT- (red) excited at 580 nm The 1148

spectra were normalized to 780 nm C) Level of IsiA in the curT- mutant relative to the wild-1149

type A mean value of 368 plusmn 96 (SD) was determined from three independent experiments 1150

1151

Figure 7 Membrane sublocalization of PSII-related factors Cell extracts from wild-type and 1152

curT- cells were fractionated by two consecutive rounds of sucrose-density gradient 1153

36

centrifugation (Schottkowski et al 2009b) The second linear gradient (20-60 sucrose) was 1154

apportioned into 14 fractions which were analyzed by immunoblotting using the indicated 1155

antibodies Fractions 1ndash6 represent PDMs and fractions 7ndash14 thylakoid membranes (TMs) 1156

To facilitate comparison between gradients sample volumes were normalized to the volume 1157

of fraction 7 that contained 40 microg of protein 1158

1159

Figure 8 Live-cell imaging of the curT-CFP strain by fluorescence microscopy In the curT-1160

CFP strain the native curT gene has been replaced by a CFP-tagged version resulting in the 1161

expression of the CurT-CFP fusion protein under the control of the native promotor A) 1162

Close-up views of the mid-cell plane in the CFP and far-red autofluorescence channels shown 1163

in slice 7 in panel B B) Synechocystis 6803 cells expressing CurT C-terminally fused to the 1164

mTurquoise2 variant of CFP from its native chromosomal promoter The two imaging 1165

channels are displayed as Z-axis montages (auto-scaled contrast step size 250 nm) in 1166

grayscale and color composite configuration The thylakoid autofluorescent channel as 1167

imaged in far-red fluorescence is depicted in magenta and CurT signal as imaged in cyan 1168

fluorescence is depicted in cyan C) Fluorescence intensity profiles of the two channels along 1169

the autofluorescent peripheral cell ldquoringrdquo are shown for slice 7 The maximum projection of 1170

the entire Z montage is also shown Scale bars (light grey) 2 microm 1171

1172

Figure 9 Immunofluorescence detection of CurT A) Close-ups of slice 5 in panel B B) 1173

Wild-type Synechocystis 6803 cells labeled with αCurT antibodies and detected with Oregon 1174

Green-conjugated secondary antibodies The Z-axis montages are shown as in Figure 8B 1175

except that the step size is 280 nm (1 to 10) C) Intensity profiles of the two channels along 1176

the autofluorescent peripheral cell ldquoringrdquo are shown for slice 5 The maximum projection of 1177

the entire Z montage is also shown Scale bars (light grey) 2 microm 1178

1179

Figure 10 Subcellular localization of CurT Ultrathin sections of wild-type Synechocystis 1180

6803 cells were incubated with rabbit αCurT prior to incubation with gold-conjugated goat 1181

anti-rabbit IgG A) Negative control (wild-type processed without addition of primary 1182

antibody) B C) Immunogold-labeled sections showing CurT localization at the cytoplasmic 1183

side of the thylakoid membrane D) Cluster formation of CurT signals at a putative biogenesis 1184

center from C E) Biogenesis center from the same cell (C) without any obvious CurT 1185

clustering of gold particles F) Schematic depiction of a wild-type cell (from Figure 2A) with 1186

color-coded curved membranes green = thylakoids that follow the curvature of the cell red = 1187

37

thylakoids that bend away from the plasma membrane yellow = thylakoids that bend toward 1188

the plasma membrane to converge on sites of biogenesis centers G) Relative distribution of 1189

gold signals between convex (dark color) and concave (light color) sides of membranes (n = 1190

1584 signals from a total of 95 cells) The undifferentiated overall signal distribution is given 1191

in blue Bars = 200 nm (overview) and 100 nm (details) 1192

1193

Figure 11 Differentially modified forms of CurT are found in different complexes in PDMs 1194

and thylakoid membranes Samples were isolated by fractionation of wild-type membranes 1195

via two consecutive sucrose density gradients according to Schottkowski et al (2009b) After 1196

density centrifugation samples were applied to BNSDS-PAGE analysis (A) or isoelectric 1197

focusing (B) Numbers on the right indicate the respective fraction from the second gradient 1198

(see Figure 7) Fraction 5 represents the PDMs and fraction 9 the thylakoid membrane 1199

1200

Figure 12 Loss of CurT increases sensitivity to abiotic stress A B) Doubling times of wild-1201

type and curT- under salt stress (A) or osmotic stress (B) Doubling times are means plusmn SD of 1202

three independent cultures C) Localization of CurT-CFP under salt and osmotic stress 1203

Samples were examined as described in Figure 8 Scale bars 1 microm D) Protein levels of wild-1204

type cells after growth in BG11 medium containing 500 mM NaCl Samples were analyzed on 1205

the same gel but unrelated samples between the presented signals were omitted E) 1206

Membrane preparations obtained from wild-type cells wild-type cells grown in the presence 1207

of 500 mM NaCl and curT- cells were subjected to the first gradient step in the membrane 1208

fractionation scheme The gradient was divided into five fractions and 10 of fractions I-IV 1209

and 02 of fraction V were analyzed by SDS-PAGE Fraction II includes the plasma 1210

membrane and fraction V consists of PratA-defined membrane and thylakoid membrane 1211

1212

Figure 13 Model of CurT distribution at convergence zones in Synechocystis 6803 The 1213

distribution of CurT in thylakoid (green) and plasma membranes (brown) is shown The 1214

pattern of localization of CurT in the thylakoid membrane is derived from membrane 1215

fractionation via sucrose density centrifugation fluorescence-based detection of the CurT-1216

CFP fusion and endogenous CurT and immunogold labeling experiments (Figures 7-10) The 1217

different CurT variants a b c and d identified in the IEF experiments (Figure 11) are depicted 1218

in yellow pink blue and black respectively CurT present in the plasma membrane is 1219

highlighted in gray as its precise nature and role remain to be defined (Figure 12) 1220

Membranes are represented as lipid bilayers Convex and concave faces of bent thylakoid 1221

38

sheets are indicated by black arrows The PDM which is dedicated to PSII assembly and 1222

repair is depicted in blue The dotted blue line emphasizes that the ultrastructure in this region 1223

has not yet been fully resolved PP periplasm PM plasma membrane TM thylakoid 1224

membrane L lumen PDM PratA-defined membrane 1225

1226

Tables 1227

Table 1 Physiological characteristics of the curT- mutant 1228

Strain Doubling time [h]

Oxygen Evolution[nmol h-1 OD750

-1]c

Chlorophyll content

[microg OD750-1]

d

Cell size [microm]e

Cell number [ml-1 OD750

-1]f

Wild type 817plusmn017a 1600plusmn042

b 1933plusmn187 251plusmn014 264plusmn020 390plusmn006 x 107

curT- 1259plusmn020a 3226plusmn056

b 1074plusmn20 195plusmn029 274plusmn044 367plusmn016 x 107

1229 abDoubling times in the presence (a) or absence (b) of 5 mM glucose measured under 1230

continuous illumination at 30 micromol photons m-2 s-1 and CO2-limiting conditions cOxygen 1231

evolution is expressed in nmol O2 produced per hour per OD750 unit dChlorophyll content is 1232

expressed in microg OD750-1 eThe diameter of non-dividing cells is presented in microm fCell number 1233

was determined per ml per OD750 Data are means plusmn SD of at least three independent 1234

experiments 1235

1236

Parsed CitationsAllen JF de Paula WBM Puthiyaveetil S and Nield J (2011) A structural phylogenetic map for chloroplast photosynthesisTrends Plant Sci 16 645-655

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Anderson JM Horton P Kim E-H and Chow WS (2012) Towards elucidation of dynamic structural changes of plant thylakoidarchitecture Philos Trans R Soc Lond B Biol Sci 367 3515-3524

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Armbruster U Zuumlhlke J Rengstl B Kreller R Makarenko E Ruumlhle T Schuumlnemann D Jahns P Weisshaar B NickelsenJ and Leister D (2010) The Arabidopsis thylakoid protein PAM68 is required for efficient D1 biogenesis and photosystem IIassembly Plant Cell 22 3439-3460

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Armbruster U Labs M Pribil M Viola S Xu W Scharfenberg M Hertle AP Rojahn U Jensen PE Rappaport F JoliotP Doumlrmann P Wanner G and Leister D (2013) Arabidopsis CURVATURE THYLAKOID1 proteins modify thylakoid architectureby inducing membrane curvature Plant Cell 25 2661-2678

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Aseeva E Ossenbuumlhl F Sippel C Cho WK Stein B Eichacker LA Meurer J Wanner G Westhoff P Soll J andVothknecht UC (2007) Vipp1 is required for basic thylakoid membrane formation but not for the assembly of thylakoid proteincomplexes Plant Physiol Biochem 45 119-128

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Bartsevich VV and Pakrasi HB (1995) Molecular identification of an ABC transporter complex for manganese analysis of acyanobacterial mutant strain impaired in the photosynthetic oxygen evolution process EMBO J 14 1845-1853

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Bartsevich VV and Pakrasi HB (1996) Manganese transport in the cyanobacterium Synechocystis sp PCC 6803 J Biol Chem271 26057-26061

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Bernaacutet G Waschewski N and Roumlgner M (2009) Towards efficient hydrogen production the impact of antenna size andexternal factors on electron transport dynamics in Synechocystis PCC 6803 Photosynth Res 99 205-216

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Boehm M Yu J Krynicka V Barker M Tichy M Komenda J Nixon PJ and Nield J (2012) Subunit Organization of aSynechocystis Hetero-Oligomeric Thylakoid FtsH Complex Involved in Photosystem II Repair Plant Cell 24 3669-3683

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Bradford MM (1976) A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle ofprotein-dye binding Anal Biochem 72 248-254

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Chang L Liu X Li Y Liu C-C Yang F Zhao J and Sui S-F (2015) Structural organization of an intact phycobilisome and itsassociation with photosystem II Cell Res 25 726-737

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Danielsson R Suorsa M Paakkarinen V Albertsson P-Aring Styring S Aro E-M and Mamedov F (2006) Dimeric andmonomeric organization of photosystem II Distribution of five distinct complexes in the different domains of the thylakoidmembrane J Biol Chem 281 14241-14249

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Daum B Nicastro D Austin J McIntosh JR and Kuumlhlbrandt W (2010) Arrangement of photosystem II and ATP synthase in

30

Mullineaux CW (2008) Biogenesis and dynamics of thylakoid membranes and the 965

photosynthetic apparatus In The Cyanobacteria A Herrero and E Flores eds 966

(Norfolk UK Caister Academic Press) pp 289ndash304 967

Nevo R Charuvi D Tsabari O and Reich Z (2012) Composition architecture and 968

dynamics of the photosynthetic apparatus in higher plants Plant J 70 157-176 969

Nickelsen J and Rengstl B (2013) Photosystem II assembly From cyanobacteria to plants 970

Annu Rev Plant Biol 64 609-635 971

Nickelsen J and Zerges W (2013) Thylakoid biogenesis has joined the new era of bacterial 972

cell biology Front Plant Sci 4 458 973

Nilsson F Simpson DJ Jansson C and Andersson B (1992) Ultrastructural and 974

biochemical characterization of a Synechocystis 6803 mutant with inactivated psbA 975

genes Arch Biochem Biophys 295 340-347 976

Odom WR Hodges R Chitnis PR and Guikema JA (1993) Characterization of 977

Synechocystis sp PCC 6803 in iron-supplied and iron-deficient media Plant Mol 978

Biol 23 1255-1264 979

Ossenbuumlhl F Inaba-Sulpice M Meurer J Soll J and Eichacker LA (2006) The 980

Synechocystis sp PCC 6803 Oxa1 homolog is essential for membrane integration of 981

reaction center precursor protein pD1 Plant Cell 18 2236-2246 982

Pisareva T Kwon J Oh J Kim S Ge C Wieslander Aring Choi J-S and Norling B 983

(2011) Model for Membrane Organization and Protein Sorting in the Cyanobacterium 984

Synechocystis sp PCC 6803 Inferred from Proteomics and Multivariate Sequence 985

Analyses J Proteome Res 10 3617-3631 986

Pribil M Labs M and Leister D (2014) Structure and dynamics of thylakoids in land 987

plants J Exp Bot 65 1955-1972 988

Rast A Heinz S and Nickelsen J (2015) Biogenesis of thylakoid membranes Biochim 989

Biophys Acta 1847 821-830 990

Rast A Rengstl B Heinz S Klingl A and Nickelsen J (2016) The role of Slr0151 a 991

tetratricopeptide repeat protein from Synechocystis sp PCC 6803 during Photosystem 992

II assembly and repair Front Plant Sci 7 605 993

Rengstl B Oster U Stengel A and Nickelsen J (2011) An Intermediate Membrane 994

Subfraction in Cyanobacteria Is Involved in an Assembly Network for Photosystem II 995

Biogenesis J Biol Chem 286 21944-21951 996

31

Rengstl B Knoppovaacute J Komenda J and Nickelsen J (2013) Characterization of a 997

Synechocystis double mutant lacking the photosystem II assembly factors YCF48 and 998

Sll0933 Planta 237 471-480 999

Rexroth S Mullineaux CW Ellinger D Sendtko E Roumlgner M and Koenig F (2011) 1000

The Plasma Membrane of the Cyanobacterium Gloeobacter violaceus Contains 1001

Segregated Bioenergetic Domains Plant Cell 23 2379-2390 1002

Rippka R Deruelles J Waterbury JB Herdman M and Stanier RY (1979) Generic 1003

Assignments Strain Histories and Properties of Pure Cultures of Cyanobacteria 1004

Microbiology 111 1-61 1005

Ruumltgers M and Schroda M (2013) A role of VIPP1 as a dynamic structure within 1006

thylakoid centers as sites of photosystem biogenesis Plant Signal Behav 8 e27037 1007

Sacharz J Bryan SJ Yu J Burroughs NJ Spence EM Nixon PJ and Mullineaux 1008

CW (2015) Sub-cellular location of FtsH proteases in the cyanobacterium1009

Synechocystis sp PCC 6803 suggests localised PSII repair zones in the thylakoid1010

membranes Mol Microbiol 96 448-4621011

Sandstroumlm S Park Y-I Oumlquist G and Gustafsson P (2001) CP43prime the isiA Gene 1012

Product Functions as an Excitation Energy Dissipator in the Cyanobacterium 1013

Synechococcus sp PCC 7942 Photochem Photobiol 74 431-437 1014

Schindelin J Arganda-Carreras I Frise E Kaynig V Longair M Pietzsch T 1015

Preibisch S Rueden C Saalfeld S Schmid B Tinevez J-Y White DJ 1016

Hartenstein V Eliceiri K Tomancak P and Cardona A (2012) Fiji an open-1017

source platform for biological-image analysis Nat Methods 9 676-682 1018

Schottkowski M Ratke J Oster U Nowaczyk M and Nickelsen J (2009a) Pitt a novel 1019

tetratricopeptide repeat protein involved in light-dependent chlorophyll biosynthesis 1020

and thylakoid membrane biogenesis in Synechocystis sp PCC 6803 Mol Plant 2 1021

1289-1297 1022

Schottkowski M Gkalympoudis S Tzekova N Stelljes C Schuumlnemann D Ankele E 1023

and Nickelsen J (2009b) Interaction of the periplasmic PratA factor and the PsbA 1024

(D1) protein during biogenesis of photosystem II in Synechocystis sp PCC 6803 J 1025

Biol Chem 284 1813-1819 1026

Selatildeo TT Zhang L Knoppovaaacute J Komenda J and Norling B (2016) Photosystem II 1027

Assembly Steps Take Place in the Thylakoid Membrane of the Cyanobacterium 1028

Synechocystis sp PCC6803 Plant Cell Physiol 57 878 1029

32

Spaumlt P Maček B and Forchhammer K (2015) Phosphoproteome of the cyanobacterium 1030

Synechocystis sp PCC 6803 and its dynamics during nitrogen starvation Front 1031

Microbiol 6 248 1032

Stengel A Guumlgel IL Hilger D Rengstl B Jung H and Nickelsen J (2012) Initial 1033

steps of photosystem II de novo assembly and preloading with manganese take place 1034

in biogenesis centers in Synechocystis Plant Cell 24 660-675 1035

Uniacke J and Zerges W (2007) Photosystem II assembly and repair are differentially 1036

localized in Chlamydomonas Plant Cell 19 3640-3654 1037

Uniacke J and Zerges W (2009) Chloroplast protein targeting involves localized 1038

translation in Chlamydomonas Proc Natl Acad Sci USA 106 1439-1444 1039

van de Meene AL Hohmann-Marriott M Vermaas WJ and Roberson R (2006) The 1040

three-dimensional structure of the cyanobacterium Synechocystis sp PCC 6803 Arch 1041

Microbiol 184 259-270 1042

van de Meene AML Sharp WP McDaniel JH Friedrich H Vermaas WFJ and 1043

Roberson RW (2012) Gross morphological changes in thylakoid membrane 1044

structure are associated with photosystem I deletion in Synechocystis sp PCC 6803 1045

Biochim Biophys Acta 1818 1427-1434 1046

Watanabe M and Ikeuchi M (2013) Phycobilisome architecture of a light-harvesting 1047

supercomplex Photosynth Res 116 265-276 1048

Wellburn AR and Lichtenthaler H (1984) Formulae and Program to Determine Total 1049

Carotenoids and Chlorophylls A and B of Leaf Extracts in Different Solvents In 1050

Advances in Photosynthesis Research Proceedings of the VIth International Congress 1051

on Photosynthesis Brussels Belgium August 1ndash6 1983 C Sybesma ed (Dordrecht 1052

Springer Netherlands) pp 9-12 1053

Wilde A Lunser K Ossenbuumlhl F Nickelsen J and Borner T (2001) Characterization of 1054

the cyanobacterial ycf37 mutation decreases the photosystem I content Biochem J 1055

357 211-216 1056

Wilson A Boulay C Wilde A Kerfeld CA and Kirilovsky D (2007) Light-Induced 1057

Energy Dissipation in Iron-Starved Cyanobacteria Roles of OCP and IsiA Proteins 1058

Plant Cell 19 656-672 1059

Xu M Bernaacutet G Singh A Mi H Roumlgner M Pakrasi HB and Ogawa T (2008) 1060

Properties of Mutants of Synechocystis sp Strain PCC 6803 Lacking Inorganic Carbon 1061

Sequestration Systems Plant Cell Physiol 49 1672-1677 1062

33

Yamamoto T Burke J Autz G and Jagendorf AT (1981) Bound ribosomes of Pea 1063

chloroplast thylakoid membranes location and release in vitro by high salt 1064

puromycin and RNase Plant Physiol 67 940-949 1065

Yang H Liao L Bo T Zhao L Sun X Lu X Norling B and Huang F (2014) 1066

Slr0151 in Synechocystis sp PCC 6803 is required for efficient repair of photosystem 1067

II under high-light condition J Integr Plant Biol 56 1136-1150 1068

Yeremenko N Kouřil R Ihalainen JA DHaene S van Oosterwijk N 1069

Andrizhiyevskaya EG Keegstra W Dekker HL Hagemann M Boekema EJ 1070

Matthijs HCP and Dekker JP (2004) Supramolecular Organization and Dual 1071

Function of the IsiA Chlorophyll-Binding Protein in Cyanobacteria Biochemistry 43 1072

10308-10313 1073

Zak E Norling B Maitra R Huang F Andersson B and Pakrasi HB (2001) The 1074

initial steps of biogenesis of cyanobacterial photosystems occur in plasma membranes 1075

Proc Natl Acad Sci USA 98 13443-13448 1076

Zang X Liu B Liu S Arunakumara KKIU and Zhang X (2007) Optimum 1077

Conditions for Transformation of Synechocystis sp PCC 6803 J Microbiol 45 241-1078

245 1079

Zhang L and Sakamoto W (2015) Possible function of VIPP1 in maintaining chloroplast 1080

membranes Biochim Biophys Acta 1847 831-837 1081

Zimmerberg J and Kozlov MM (2006) How proteins produce cellular membrane 1082

curvature Nat Rev Mol Cell Biol 7 9-19 1083

Zoumlfel P (1988) Statistik in der Praxis (Stuttgart Germany Gustav Fischer Verlag) 1084

1085

34

Figure Legends 1086

Figure 1 General characteristics of CurT A) Sequence alignment of CurT and CURT1A-D 1087

from A thaliana Predicted chloroplast transit-peptide sequences of CURT1A-D are omitted 1088

(Armbruster et al 2013) Positions of predicted C-terminal transmembrane domains (TDM) 1089

are marked (black bar) as is the position of the predicted amphipathic N-terminal helix in 1090

CurT (red bar) The green bar denotes the peptide sequence used for antibody production 1091

Identical and related amino acids that are conserved in 100 80 and 60 of the sequences 1092

are highlighted in black dark grey and light grey respectively B) Helical-wheel 1093

representation of the N-terminal amphipathic helix of CurT (red bar in A) The color code 1094

reflects the physicochemical properties of amino-acid side-chains green polar and 1095

uncharged blue polar and positively charged red polar and negatively charged yellow 1096

hydrophobic C) Solubility of CurT Membrane-associated proteins (50 microg) from wild-type 1097

cells were extracted with 5 mM HEPES (pH 76) containing either 1 M NaCl 01 M Na2CO3 1098

4 M urea 01 Triton X-100 or no additional solute After separation of membrane-bound 1099

(M) and solubilized (S) proteins by centrifugation proteins were fractionated by SDS-PAGE1100

and CurT was immunodetected on immunoblots As a control the integral membrane protein 1101

CP47 from PSII was analyzed in parallel D) Transmission electron micrographs of negatively 1102

stained liposomes Cell-free expression (CFE) of CurT and A thaliana CURT1A was 1103

performed in the presence of liposomes similar in composition to the lipids of the thylakoid 1104

membrane Liposomes before and after cell-free protein expression in the absence of DNA 1105

served as negative controls Black arrowheads indicate tubular connections between 1106

liposomes Scale bars 250 nm 1107

1108

Figure 2 Ultrastructural analysis of curT- cells Transmission electron micrographs of typical 1109

wild-type (A) and curT- (B-D) Synechocystis 6803 cells taken at 44000times (A B) and 28000times 1110

(C D) magnification respectively Ultrathin sections (35 to 45 nm) of cryofixed samples 1111

were stained with osmium tetroxide and post-stained using lead citrate Arrowheads indicate 1112

biogenesis centers Scale bars 200 nm (A B) and 500 nm (C D) respectively 1113

1114

Figure 3 Accumulation of components of photosynthetic complexes in the curT- mutant A) 1115

Whole cell extracts (30 microg protein) from wild-type and curT- strains were fractionated by 1116

SDS-PAGE and analyzed on immunoblots using the indicated antibodies B) The histogram 1117

shows levels of the indicated proteins in curT- extracts relative to wild-type samples (dashed 1118

red line) Data are means plusmn SD of three independent experiments Significant differences from 1119

35

wild-type protein levels according to Studentrsquos t-test with error probabilities of 5 and 1 1120

are indicated by and respectively 1121

1122

Figure 4 P700+ reduction kinetics and high-light effects in curT- cells A) Averaged traces 1123

(10 single measurements) of P700+ decay after complete oxidation by a 50-ms multiple 1124

turnover pulse (10000 micromol photons m-2 s-1) in the absence and presence of 10 microM DCMU 1125

B) Rate constants for P700+ reduction were obtained by fitting of the data with single1126

exponential functions Error bars indicate the SD of three independent measurements C) 1127

Impact of light intensity on the (relative) electron transport rate (rETR) Cells were exposed to 1128

gradually increasing light intensities which resulted in increasing electron transport until the 1129

capacity limit was reached PAR light intensity (micromol photons m-2 s-1) Error bars indicate the 1130

SD of three independent measurements D) D1 protein level in wild-type and curT- after high-1131

light treatment (800 micromol photons m-2s-1) in the presence and absence of lincomycin Samples 1132

were taken every 30 min and processed as in Figure 3 to determine the level of D1 present 1133

100 refers to wild-type D1 level at the beginning of the experiment 1134

1135

Figure 5 PSII assembly in curT- cells A) BNSDS-PAGE of membrane proteins Membrane 1136

fractions from wild-type and curT- cells were solubilized with 13 n-dodecyl-β-maltoside 1137

and proteins were fractionated by two-dimensional BNSDS-PAGE blotted and probed with 1138

antibodies against the PSII subunits D1 D2 CP47 and CP43 Wild-type blots were also 1139

probed with the αCurT antibody The sizes of marker proteins and the positions of PSII 1140

assembly intermediates (RCCII RCCI RC47) are shown above and below each image B) In 1141

vivo pulse labeling of membrane proteins with 35S Pulse-labeled PSII core proteins were 1142

separated via BNSDS-PAGE and visualized by autoradiography 1143

1144

Figure 6 Loss of CurT induces stress A) Low-temperature (77 K) fluorescence emission of 1145

Synechocystis 6803 wild-type (blue) and curT- (red) cells excited at 440 nm The spectra were 1146

normalized to the added fluorescein standard B) Low-temperature (77 K) fluorescence 1147

emission of Synechocystis 6803 wild-type (blue) and curT- (red) excited at 580 nm The 1148

spectra were normalized to 780 nm C) Level of IsiA in the curT- mutant relative to the wild-1149

type A mean value of 368 plusmn 96 (SD) was determined from three independent experiments 1150

1151

Figure 7 Membrane sublocalization of PSII-related factors Cell extracts from wild-type and 1152

curT- cells were fractionated by two consecutive rounds of sucrose-density gradient 1153

36

centrifugation (Schottkowski et al 2009b) The second linear gradient (20-60 sucrose) was 1154

apportioned into 14 fractions which were analyzed by immunoblotting using the indicated 1155

antibodies Fractions 1ndash6 represent PDMs and fractions 7ndash14 thylakoid membranes (TMs) 1156

To facilitate comparison between gradients sample volumes were normalized to the volume 1157

of fraction 7 that contained 40 microg of protein 1158

1159

Figure 8 Live-cell imaging of the curT-CFP strain by fluorescence microscopy In the curT-1160

CFP strain the native curT gene has been replaced by a CFP-tagged version resulting in the 1161

expression of the CurT-CFP fusion protein under the control of the native promotor A) 1162

Close-up views of the mid-cell plane in the CFP and far-red autofluorescence channels shown 1163

in slice 7 in panel B B) Synechocystis 6803 cells expressing CurT C-terminally fused to the 1164

mTurquoise2 variant of CFP from its native chromosomal promoter The two imaging 1165

channels are displayed as Z-axis montages (auto-scaled contrast step size 250 nm) in 1166

grayscale and color composite configuration The thylakoid autofluorescent channel as 1167

imaged in far-red fluorescence is depicted in magenta and CurT signal as imaged in cyan 1168

fluorescence is depicted in cyan C) Fluorescence intensity profiles of the two channels along 1169

the autofluorescent peripheral cell ldquoringrdquo are shown for slice 7 The maximum projection of 1170

the entire Z montage is also shown Scale bars (light grey) 2 microm 1171

1172

Figure 9 Immunofluorescence detection of CurT A) Close-ups of slice 5 in panel B B) 1173

Wild-type Synechocystis 6803 cells labeled with αCurT antibodies and detected with Oregon 1174

Green-conjugated secondary antibodies The Z-axis montages are shown as in Figure 8B 1175

except that the step size is 280 nm (1 to 10) C) Intensity profiles of the two channels along 1176

the autofluorescent peripheral cell ldquoringrdquo are shown for slice 5 The maximum projection of 1177

the entire Z montage is also shown Scale bars (light grey) 2 microm 1178

1179

Figure 10 Subcellular localization of CurT Ultrathin sections of wild-type Synechocystis 1180

6803 cells were incubated with rabbit αCurT prior to incubation with gold-conjugated goat 1181

anti-rabbit IgG A) Negative control (wild-type processed without addition of primary 1182

antibody) B C) Immunogold-labeled sections showing CurT localization at the cytoplasmic 1183

side of the thylakoid membrane D) Cluster formation of CurT signals at a putative biogenesis 1184

center from C E) Biogenesis center from the same cell (C) without any obvious CurT 1185

clustering of gold particles F) Schematic depiction of a wild-type cell (from Figure 2A) with 1186

color-coded curved membranes green = thylakoids that follow the curvature of the cell red = 1187

37

thylakoids that bend away from the plasma membrane yellow = thylakoids that bend toward 1188

the plasma membrane to converge on sites of biogenesis centers G) Relative distribution of 1189

gold signals between convex (dark color) and concave (light color) sides of membranes (n = 1190

1584 signals from a total of 95 cells) The undifferentiated overall signal distribution is given 1191

in blue Bars = 200 nm (overview) and 100 nm (details) 1192

1193

Figure 11 Differentially modified forms of CurT are found in different complexes in PDMs 1194

and thylakoid membranes Samples were isolated by fractionation of wild-type membranes 1195

via two consecutive sucrose density gradients according to Schottkowski et al (2009b) After 1196

density centrifugation samples were applied to BNSDS-PAGE analysis (A) or isoelectric 1197

focusing (B) Numbers on the right indicate the respective fraction from the second gradient 1198

(see Figure 7) Fraction 5 represents the PDMs and fraction 9 the thylakoid membrane 1199

1200

Figure 12 Loss of CurT increases sensitivity to abiotic stress A B) Doubling times of wild-1201

type and curT- under salt stress (A) or osmotic stress (B) Doubling times are means plusmn SD of 1202

three independent cultures C) Localization of CurT-CFP under salt and osmotic stress 1203

Samples were examined as described in Figure 8 Scale bars 1 microm D) Protein levels of wild-1204

type cells after growth in BG11 medium containing 500 mM NaCl Samples were analyzed on 1205

the same gel but unrelated samples between the presented signals were omitted E) 1206

Membrane preparations obtained from wild-type cells wild-type cells grown in the presence 1207

of 500 mM NaCl and curT- cells were subjected to the first gradient step in the membrane 1208

fractionation scheme The gradient was divided into five fractions and 10 of fractions I-IV 1209

and 02 of fraction V were analyzed by SDS-PAGE Fraction II includes the plasma 1210

membrane and fraction V consists of PratA-defined membrane and thylakoid membrane 1211

1212

Figure 13 Model of CurT distribution at convergence zones in Synechocystis 6803 The 1213

distribution of CurT in thylakoid (green) and plasma membranes (brown) is shown The 1214

pattern of localization of CurT in the thylakoid membrane is derived from membrane 1215

fractionation via sucrose density centrifugation fluorescence-based detection of the CurT-1216

CFP fusion and endogenous CurT and immunogold labeling experiments (Figures 7-10) The 1217

different CurT variants a b c and d identified in the IEF experiments (Figure 11) are depicted 1218

in yellow pink blue and black respectively CurT present in the plasma membrane is 1219

highlighted in gray as its precise nature and role remain to be defined (Figure 12) 1220

Membranes are represented as lipid bilayers Convex and concave faces of bent thylakoid 1221

38

sheets are indicated by black arrows The PDM which is dedicated to PSII assembly and 1222

repair is depicted in blue The dotted blue line emphasizes that the ultrastructure in this region 1223

has not yet been fully resolved PP periplasm PM plasma membrane TM thylakoid 1224

membrane L lumen PDM PratA-defined membrane 1225

1226

Tables 1227

Table 1 Physiological characteristics of the curT- mutant 1228

Strain Doubling time [h]

Oxygen Evolution[nmol h-1 OD750

-1]c

Chlorophyll content

[microg OD750-1]

d

Cell size [microm]e

Cell number [ml-1 OD750

-1]f

Wild type 817plusmn017a 1600plusmn042

b 1933plusmn187 251plusmn014 264plusmn020 390plusmn006 x 107

curT- 1259plusmn020a 3226plusmn056

b 1074plusmn20 195plusmn029 274plusmn044 367plusmn016 x 107

1229 abDoubling times in the presence (a) or absence (b) of 5 mM glucose measured under 1230

continuous illumination at 30 micromol photons m-2 s-1 and CO2-limiting conditions cOxygen 1231

evolution is expressed in nmol O2 produced per hour per OD750 unit dChlorophyll content is 1232

expressed in microg OD750-1 eThe diameter of non-dividing cells is presented in microm fCell number 1233

was determined per ml per OD750 Data are means plusmn SD of at least three independent 1234

experiments 1235

1236

Parsed CitationsAllen JF de Paula WBM Puthiyaveetil S and Nield J (2011) A structural phylogenetic map for chloroplast photosynthesisTrends Plant Sci 16 645-655

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Anderson JM Horton P Kim E-H and Chow WS (2012) Towards elucidation of dynamic structural changes of plant thylakoidarchitecture Philos Trans R Soc Lond B Biol Sci 367 3515-3524

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Armbruster U Zuumlhlke J Rengstl B Kreller R Makarenko E Ruumlhle T Schuumlnemann D Jahns P Weisshaar B NickelsenJ and Leister D (2010) The Arabidopsis thylakoid protein PAM68 is required for efficient D1 biogenesis and photosystem IIassembly Plant Cell 22 3439-3460

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Armbruster U Labs M Pribil M Viola S Xu W Scharfenberg M Hertle AP Rojahn U Jensen PE Rappaport F JoliotP Doumlrmann P Wanner G and Leister D (2013) Arabidopsis CURVATURE THYLAKOID1 proteins modify thylakoid architectureby inducing membrane curvature Plant Cell 25 2661-2678

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Aseeva E Ossenbuumlhl F Sippel C Cho WK Stein B Eichacker LA Meurer J Wanner G Westhoff P Soll J andVothknecht UC (2007) Vipp1 is required for basic thylakoid membrane formation but not for the assembly of thylakoid proteincomplexes Plant Physiol Biochem 45 119-128

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Bartsevich VV and Pakrasi HB (1995) Molecular identification of an ABC transporter complex for manganese analysis of acyanobacterial mutant strain impaired in the photosynthetic oxygen evolution process EMBO J 14 1845-1853

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Bartsevich VV and Pakrasi HB (1996) Manganese transport in the cyanobacterium Synechocystis sp PCC 6803 J Biol Chem271 26057-26061

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Bernaacutet G Waschewski N and Roumlgner M (2009) Towards efficient hydrogen production the impact of antenna size andexternal factors on electron transport dynamics in Synechocystis PCC 6803 Photosynth Res 99 205-216

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Boehm M Yu J Krynicka V Barker M Tichy M Komenda J Nixon PJ and Nield J (2012) Subunit Organization of aSynechocystis Hetero-Oligomeric Thylakoid FtsH Complex Involved in Photosystem II Repair Plant Cell 24 3669-3683

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Bradford MM (1976) A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle ofprotein-dye binding Anal Biochem 72 248-254

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Chang L Liu X Li Y Liu C-C Yang F Zhao J and Sui S-F (2015) Structural organization of an intact phycobilisome and itsassociation with photosystem II Cell Res 25 726-737

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Danielsson R Suorsa M Paakkarinen V Albertsson P-Aring Styring S Aro E-M and Mamedov F (2006) Dimeric andmonomeric organization of photosystem II Distribution of five distinct complexes in the different domains of the thylakoidmembrane J Biol Chem 281 14241-14249

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Daum B Nicastro D Austin J McIntosh JR and Kuumlhlbrandt W (2010) Arrangement of photosystem II and ATP synthase in

31

Rengstl B Knoppovaacute J Komenda J and Nickelsen J (2013) Characterization of a 997

Synechocystis double mutant lacking the photosystem II assembly factors YCF48 and 998

Sll0933 Planta 237 471-480 999

Rexroth S Mullineaux CW Ellinger D Sendtko E Roumlgner M and Koenig F (2011) 1000

The Plasma Membrane of the Cyanobacterium Gloeobacter violaceus Contains 1001

Segregated Bioenergetic Domains Plant Cell 23 2379-2390 1002

Rippka R Deruelles J Waterbury JB Herdman M and Stanier RY (1979) Generic 1003

Assignments Strain Histories and Properties of Pure Cultures of Cyanobacteria 1004

Microbiology 111 1-61 1005

Ruumltgers M and Schroda M (2013) A role of VIPP1 as a dynamic structure within 1006

thylakoid centers as sites of photosystem biogenesis Plant Signal Behav 8 e27037 1007

Sacharz J Bryan SJ Yu J Burroughs NJ Spence EM Nixon PJ and Mullineaux 1008

CW (2015) Sub-cellular location of FtsH proteases in the cyanobacterium1009

Synechocystis sp PCC 6803 suggests localised PSII repair zones in the thylakoid1010

membranes Mol Microbiol 96 448-4621011

Sandstroumlm S Park Y-I Oumlquist G and Gustafsson P (2001) CP43prime the isiA Gene 1012

Product Functions as an Excitation Energy Dissipator in the Cyanobacterium 1013

Synechococcus sp PCC 7942 Photochem Photobiol 74 431-437 1014

Schindelin J Arganda-Carreras I Frise E Kaynig V Longair M Pietzsch T 1015

Preibisch S Rueden C Saalfeld S Schmid B Tinevez J-Y White DJ 1016

Hartenstein V Eliceiri K Tomancak P and Cardona A (2012) Fiji an open-1017

source platform for biological-image analysis Nat Methods 9 676-682 1018

Schottkowski M Ratke J Oster U Nowaczyk M and Nickelsen J (2009a) Pitt a novel 1019

tetratricopeptide repeat protein involved in light-dependent chlorophyll biosynthesis 1020

and thylakoid membrane biogenesis in Synechocystis sp PCC 6803 Mol Plant 2 1021

1289-1297 1022

Schottkowski M Gkalympoudis S Tzekova N Stelljes C Schuumlnemann D Ankele E 1023

and Nickelsen J (2009b) Interaction of the periplasmic PratA factor and the PsbA 1024

(D1) protein during biogenesis of photosystem II in Synechocystis sp PCC 6803 J 1025

Biol Chem 284 1813-1819 1026

Selatildeo TT Zhang L Knoppovaaacute J Komenda J and Norling B (2016) Photosystem II 1027

Assembly Steps Take Place in the Thylakoid Membrane of the Cyanobacterium 1028

Synechocystis sp PCC6803 Plant Cell Physiol 57 878 1029

32

Spaumlt P Maček B and Forchhammer K (2015) Phosphoproteome of the cyanobacterium 1030

Synechocystis sp PCC 6803 and its dynamics during nitrogen starvation Front 1031

Microbiol 6 248 1032

Stengel A Guumlgel IL Hilger D Rengstl B Jung H and Nickelsen J (2012) Initial 1033

steps of photosystem II de novo assembly and preloading with manganese take place 1034

in biogenesis centers in Synechocystis Plant Cell 24 660-675 1035

Uniacke J and Zerges W (2007) Photosystem II assembly and repair are differentially 1036

localized in Chlamydomonas Plant Cell 19 3640-3654 1037

Uniacke J and Zerges W (2009) Chloroplast protein targeting involves localized 1038

translation in Chlamydomonas Proc Natl Acad Sci USA 106 1439-1444 1039

van de Meene AL Hohmann-Marriott M Vermaas WJ and Roberson R (2006) The 1040

three-dimensional structure of the cyanobacterium Synechocystis sp PCC 6803 Arch 1041

Microbiol 184 259-270 1042

van de Meene AML Sharp WP McDaniel JH Friedrich H Vermaas WFJ and 1043

Roberson RW (2012) Gross morphological changes in thylakoid membrane 1044

structure are associated with photosystem I deletion in Synechocystis sp PCC 6803 1045

Biochim Biophys Acta 1818 1427-1434 1046

Watanabe M and Ikeuchi M (2013) Phycobilisome architecture of a light-harvesting 1047

supercomplex Photosynth Res 116 265-276 1048

Wellburn AR and Lichtenthaler H (1984) Formulae and Program to Determine Total 1049

Carotenoids and Chlorophylls A and B of Leaf Extracts in Different Solvents In 1050

Advances in Photosynthesis Research Proceedings of the VIth International Congress 1051

on Photosynthesis Brussels Belgium August 1ndash6 1983 C Sybesma ed (Dordrecht 1052

Springer Netherlands) pp 9-12 1053

Wilde A Lunser K Ossenbuumlhl F Nickelsen J and Borner T (2001) Characterization of 1054

the cyanobacterial ycf37 mutation decreases the photosystem I content Biochem J 1055

357 211-216 1056

Wilson A Boulay C Wilde A Kerfeld CA and Kirilovsky D (2007) Light-Induced 1057

Energy Dissipation in Iron-Starved Cyanobacteria Roles of OCP and IsiA Proteins 1058

Plant Cell 19 656-672 1059

Xu M Bernaacutet G Singh A Mi H Roumlgner M Pakrasi HB and Ogawa T (2008) 1060

Properties of Mutants of Synechocystis sp Strain PCC 6803 Lacking Inorganic Carbon 1061

Sequestration Systems Plant Cell Physiol 49 1672-1677 1062

33

Yamamoto T Burke J Autz G and Jagendorf AT (1981) Bound ribosomes of Pea 1063

chloroplast thylakoid membranes location and release in vitro by high salt 1064

puromycin and RNase Plant Physiol 67 940-949 1065

Yang H Liao L Bo T Zhao L Sun X Lu X Norling B and Huang F (2014) 1066

Slr0151 in Synechocystis sp PCC 6803 is required for efficient repair of photosystem 1067

II under high-light condition J Integr Plant Biol 56 1136-1150 1068

Yeremenko N Kouřil R Ihalainen JA DHaene S van Oosterwijk N 1069

Andrizhiyevskaya EG Keegstra W Dekker HL Hagemann M Boekema EJ 1070

Matthijs HCP and Dekker JP (2004) Supramolecular Organization and Dual 1071

Function of the IsiA Chlorophyll-Binding Protein in Cyanobacteria Biochemistry 43 1072

10308-10313 1073

Zak E Norling B Maitra R Huang F Andersson B and Pakrasi HB (2001) The 1074

initial steps of biogenesis of cyanobacterial photosystems occur in plasma membranes 1075

Proc Natl Acad Sci USA 98 13443-13448 1076

Zang X Liu B Liu S Arunakumara KKIU and Zhang X (2007) Optimum 1077

Conditions for Transformation of Synechocystis sp PCC 6803 J Microbiol 45 241-1078

245 1079

Zhang L and Sakamoto W (2015) Possible function of VIPP1 in maintaining chloroplast 1080

membranes Biochim Biophys Acta 1847 831-837 1081

Zimmerberg J and Kozlov MM (2006) How proteins produce cellular membrane 1082

curvature Nat Rev Mol Cell Biol 7 9-19 1083

Zoumlfel P (1988) Statistik in der Praxis (Stuttgart Germany Gustav Fischer Verlag) 1084

1085

34

Figure Legends 1086

Figure 1 General characteristics of CurT A) Sequence alignment of CurT and CURT1A-D 1087

from A thaliana Predicted chloroplast transit-peptide sequences of CURT1A-D are omitted 1088

(Armbruster et al 2013) Positions of predicted C-terminal transmembrane domains (TDM) 1089

are marked (black bar) as is the position of the predicted amphipathic N-terminal helix in 1090

CurT (red bar) The green bar denotes the peptide sequence used for antibody production 1091

Identical and related amino acids that are conserved in 100 80 and 60 of the sequences 1092

are highlighted in black dark grey and light grey respectively B) Helical-wheel 1093

representation of the N-terminal amphipathic helix of CurT (red bar in A) The color code 1094

reflects the physicochemical properties of amino-acid side-chains green polar and 1095

uncharged blue polar and positively charged red polar and negatively charged yellow 1096

hydrophobic C) Solubility of CurT Membrane-associated proteins (50 microg) from wild-type 1097

cells were extracted with 5 mM HEPES (pH 76) containing either 1 M NaCl 01 M Na2CO3 1098

4 M urea 01 Triton X-100 or no additional solute After separation of membrane-bound 1099

(M) and solubilized (S) proteins by centrifugation proteins were fractionated by SDS-PAGE1100

and CurT was immunodetected on immunoblots As a control the integral membrane protein 1101

CP47 from PSII was analyzed in parallel D) Transmission electron micrographs of negatively 1102

stained liposomes Cell-free expression (CFE) of CurT and A thaliana CURT1A was 1103

performed in the presence of liposomes similar in composition to the lipids of the thylakoid 1104

membrane Liposomes before and after cell-free protein expression in the absence of DNA 1105

served as negative controls Black arrowheads indicate tubular connections between 1106

liposomes Scale bars 250 nm 1107

1108

Figure 2 Ultrastructural analysis of curT- cells Transmission electron micrographs of typical 1109

wild-type (A) and curT- (B-D) Synechocystis 6803 cells taken at 44000times (A B) and 28000times 1110

(C D) magnification respectively Ultrathin sections (35 to 45 nm) of cryofixed samples 1111

were stained with osmium tetroxide and post-stained using lead citrate Arrowheads indicate 1112

biogenesis centers Scale bars 200 nm (A B) and 500 nm (C D) respectively 1113

1114

Figure 3 Accumulation of components of photosynthetic complexes in the curT- mutant A) 1115

Whole cell extracts (30 microg protein) from wild-type and curT- strains were fractionated by 1116

SDS-PAGE and analyzed on immunoblots using the indicated antibodies B) The histogram 1117

shows levels of the indicated proteins in curT- extracts relative to wild-type samples (dashed 1118

red line) Data are means plusmn SD of three independent experiments Significant differences from 1119

35

wild-type protein levels according to Studentrsquos t-test with error probabilities of 5 and 1 1120

are indicated by and respectively 1121

1122

Figure 4 P700+ reduction kinetics and high-light effects in curT- cells A) Averaged traces 1123

(10 single measurements) of P700+ decay after complete oxidation by a 50-ms multiple 1124

turnover pulse (10000 micromol photons m-2 s-1) in the absence and presence of 10 microM DCMU 1125

B) Rate constants for P700+ reduction were obtained by fitting of the data with single1126

exponential functions Error bars indicate the SD of three independent measurements C) 1127

Impact of light intensity on the (relative) electron transport rate (rETR) Cells were exposed to 1128

gradually increasing light intensities which resulted in increasing electron transport until the 1129

capacity limit was reached PAR light intensity (micromol photons m-2 s-1) Error bars indicate the 1130

SD of three independent measurements D) D1 protein level in wild-type and curT- after high-1131

light treatment (800 micromol photons m-2s-1) in the presence and absence of lincomycin Samples 1132

were taken every 30 min and processed as in Figure 3 to determine the level of D1 present 1133

100 refers to wild-type D1 level at the beginning of the experiment 1134

1135

Figure 5 PSII assembly in curT- cells A) BNSDS-PAGE of membrane proteins Membrane 1136

fractions from wild-type and curT- cells were solubilized with 13 n-dodecyl-β-maltoside 1137

and proteins were fractionated by two-dimensional BNSDS-PAGE blotted and probed with 1138

antibodies against the PSII subunits D1 D2 CP47 and CP43 Wild-type blots were also 1139

probed with the αCurT antibody The sizes of marker proteins and the positions of PSII 1140

assembly intermediates (RCCII RCCI RC47) are shown above and below each image B) In 1141

vivo pulse labeling of membrane proteins with 35S Pulse-labeled PSII core proteins were 1142

separated via BNSDS-PAGE and visualized by autoradiography 1143

1144

Figure 6 Loss of CurT induces stress A) Low-temperature (77 K) fluorescence emission of 1145

Synechocystis 6803 wild-type (blue) and curT- (red) cells excited at 440 nm The spectra were 1146

normalized to the added fluorescein standard B) Low-temperature (77 K) fluorescence 1147

emission of Synechocystis 6803 wild-type (blue) and curT- (red) excited at 580 nm The 1148

spectra were normalized to 780 nm C) Level of IsiA in the curT- mutant relative to the wild-1149

type A mean value of 368 plusmn 96 (SD) was determined from three independent experiments 1150

1151

Figure 7 Membrane sublocalization of PSII-related factors Cell extracts from wild-type and 1152

curT- cells were fractionated by two consecutive rounds of sucrose-density gradient 1153

36

centrifugation (Schottkowski et al 2009b) The second linear gradient (20-60 sucrose) was 1154

apportioned into 14 fractions which were analyzed by immunoblotting using the indicated 1155

antibodies Fractions 1ndash6 represent PDMs and fractions 7ndash14 thylakoid membranes (TMs) 1156

To facilitate comparison between gradients sample volumes were normalized to the volume 1157

of fraction 7 that contained 40 microg of protein 1158

1159

Figure 8 Live-cell imaging of the curT-CFP strain by fluorescence microscopy In the curT-1160

CFP strain the native curT gene has been replaced by a CFP-tagged version resulting in the 1161

expression of the CurT-CFP fusion protein under the control of the native promotor A) 1162

Close-up views of the mid-cell plane in the CFP and far-red autofluorescence channels shown 1163

in slice 7 in panel B B) Synechocystis 6803 cells expressing CurT C-terminally fused to the 1164

mTurquoise2 variant of CFP from its native chromosomal promoter The two imaging 1165

channels are displayed as Z-axis montages (auto-scaled contrast step size 250 nm) in 1166

grayscale and color composite configuration The thylakoid autofluorescent channel as 1167

imaged in far-red fluorescence is depicted in magenta and CurT signal as imaged in cyan 1168

fluorescence is depicted in cyan C) Fluorescence intensity profiles of the two channels along 1169

the autofluorescent peripheral cell ldquoringrdquo are shown for slice 7 The maximum projection of 1170

the entire Z montage is also shown Scale bars (light grey) 2 microm 1171

1172

Figure 9 Immunofluorescence detection of CurT A) Close-ups of slice 5 in panel B B) 1173

Wild-type Synechocystis 6803 cells labeled with αCurT antibodies and detected with Oregon 1174

Green-conjugated secondary antibodies The Z-axis montages are shown as in Figure 8B 1175

except that the step size is 280 nm (1 to 10) C) Intensity profiles of the two channels along 1176

the autofluorescent peripheral cell ldquoringrdquo are shown for slice 5 The maximum projection of 1177

the entire Z montage is also shown Scale bars (light grey) 2 microm 1178

1179

Figure 10 Subcellular localization of CurT Ultrathin sections of wild-type Synechocystis 1180

6803 cells were incubated with rabbit αCurT prior to incubation with gold-conjugated goat 1181

anti-rabbit IgG A) Negative control (wild-type processed without addition of primary 1182

antibody) B C) Immunogold-labeled sections showing CurT localization at the cytoplasmic 1183

side of the thylakoid membrane D) Cluster formation of CurT signals at a putative biogenesis 1184

center from C E) Biogenesis center from the same cell (C) without any obvious CurT 1185

clustering of gold particles F) Schematic depiction of a wild-type cell (from Figure 2A) with 1186

color-coded curved membranes green = thylakoids that follow the curvature of the cell red = 1187

37

thylakoids that bend away from the plasma membrane yellow = thylakoids that bend toward 1188

the plasma membrane to converge on sites of biogenesis centers G) Relative distribution of 1189

gold signals between convex (dark color) and concave (light color) sides of membranes (n = 1190

1584 signals from a total of 95 cells) The undifferentiated overall signal distribution is given 1191

in blue Bars = 200 nm (overview) and 100 nm (details) 1192

1193

Figure 11 Differentially modified forms of CurT are found in different complexes in PDMs 1194

and thylakoid membranes Samples were isolated by fractionation of wild-type membranes 1195

via two consecutive sucrose density gradients according to Schottkowski et al (2009b) After 1196

density centrifugation samples were applied to BNSDS-PAGE analysis (A) or isoelectric 1197

focusing (B) Numbers on the right indicate the respective fraction from the second gradient 1198

(see Figure 7) Fraction 5 represents the PDMs and fraction 9 the thylakoid membrane 1199

1200

Figure 12 Loss of CurT increases sensitivity to abiotic stress A B) Doubling times of wild-1201

type and curT- under salt stress (A) or osmotic stress (B) Doubling times are means plusmn SD of 1202

three independent cultures C) Localization of CurT-CFP under salt and osmotic stress 1203

Samples were examined as described in Figure 8 Scale bars 1 microm D) Protein levels of wild-1204

type cells after growth in BG11 medium containing 500 mM NaCl Samples were analyzed on 1205

the same gel but unrelated samples between the presented signals were omitted E) 1206

Membrane preparations obtained from wild-type cells wild-type cells grown in the presence 1207

of 500 mM NaCl and curT- cells were subjected to the first gradient step in the membrane 1208

fractionation scheme The gradient was divided into five fractions and 10 of fractions I-IV 1209

and 02 of fraction V were analyzed by SDS-PAGE Fraction II includes the plasma 1210

membrane and fraction V consists of PratA-defined membrane and thylakoid membrane 1211

1212

Figure 13 Model of CurT distribution at convergence zones in Synechocystis 6803 The 1213

distribution of CurT in thylakoid (green) and plasma membranes (brown) is shown The 1214

pattern of localization of CurT in the thylakoid membrane is derived from membrane 1215

fractionation via sucrose density centrifugation fluorescence-based detection of the CurT-1216

CFP fusion and endogenous CurT and immunogold labeling experiments (Figures 7-10) The 1217

different CurT variants a b c and d identified in the IEF experiments (Figure 11) are depicted 1218

in yellow pink blue and black respectively CurT present in the plasma membrane is 1219

highlighted in gray as its precise nature and role remain to be defined (Figure 12) 1220

Membranes are represented as lipid bilayers Convex and concave faces of bent thylakoid 1221

38

sheets are indicated by black arrows The PDM which is dedicated to PSII assembly and 1222

repair is depicted in blue The dotted blue line emphasizes that the ultrastructure in this region 1223

has not yet been fully resolved PP periplasm PM plasma membrane TM thylakoid 1224

membrane L lumen PDM PratA-defined membrane 1225

1226

Tables 1227

Table 1 Physiological characteristics of the curT- mutant 1228

Strain Doubling time [h]

Oxygen Evolution[nmol h-1 OD750

-1]c

Chlorophyll content

[microg OD750-1]

d

Cell size [microm]e

Cell number [ml-1 OD750

-1]f

Wild type 817plusmn017a 1600plusmn042

b 1933plusmn187 251plusmn014 264plusmn020 390plusmn006 x 107

curT- 1259plusmn020a 3226plusmn056

b 1074plusmn20 195plusmn029 274plusmn044 367plusmn016 x 107

1229 abDoubling times in the presence (a) or absence (b) of 5 mM glucose measured under 1230

continuous illumination at 30 micromol photons m-2 s-1 and CO2-limiting conditions cOxygen 1231

evolution is expressed in nmol O2 produced per hour per OD750 unit dChlorophyll content is 1232

expressed in microg OD750-1 eThe diameter of non-dividing cells is presented in microm fCell number 1233

was determined per ml per OD750 Data are means plusmn SD of at least three independent 1234

experiments 1235

1236

Parsed CitationsAllen JF de Paula WBM Puthiyaveetil S and Nield J (2011) A structural phylogenetic map for chloroplast photosynthesisTrends Plant Sci 16 645-655

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Anderson JM Horton P Kim E-H and Chow WS (2012) Towards elucidation of dynamic structural changes of plant thylakoidarchitecture Philos Trans R Soc Lond B Biol Sci 367 3515-3524

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Armbruster U Zuumlhlke J Rengstl B Kreller R Makarenko E Ruumlhle T Schuumlnemann D Jahns P Weisshaar B NickelsenJ and Leister D (2010) The Arabidopsis thylakoid protein PAM68 is required for efficient D1 biogenesis and photosystem IIassembly Plant Cell 22 3439-3460

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Armbruster U Labs M Pribil M Viola S Xu W Scharfenberg M Hertle AP Rojahn U Jensen PE Rappaport F JoliotP Doumlrmann P Wanner G and Leister D (2013) Arabidopsis CURVATURE THYLAKOID1 proteins modify thylakoid architectureby inducing membrane curvature Plant Cell 25 2661-2678

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Aseeva E Ossenbuumlhl F Sippel C Cho WK Stein B Eichacker LA Meurer J Wanner G Westhoff P Soll J andVothknecht UC (2007) Vipp1 is required for basic thylakoid membrane formation but not for the assembly of thylakoid proteincomplexes Plant Physiol Biochem 45 119-128

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Bartsevich VV and Pakrasi HB (1995) Molecular identification of an ABC transporter complex for manganese analysis of acyanobacterial mutant strain impaired in the photosynthetic oxygen evolution process EMBO J 14 1845-1853

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Bartsevich VV and Pakrasi HB (1996) Manganese transport in the cyanobacterium Synechocystis sp PCC 6803 J Biol Chem271 26057-26061

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Bernaacutet G Waschewski N and Roumlgner M (2009) Towards efficient hydrogen production the impact of antenna size andexternal factors on electron transport dynamics in Synechocystis PCC 6803 Photosynth Res 99 205-216

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Boehm M Yu J Krynicka V Barker M Tichy M Komenda J Nixon PJ and Nield J (2012) Subunit Organization of aSynechocystis Hetero-Oligomeric Thylakoid FtsH Complex Involved in Photosystem II Repair Plant Cell 24 3669-3683

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Bradford MM (1976) A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle ofprotein-dye binding Anal Biochem 72 248-254

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Chang L Liu X Li Y Liu C-C Yang F Zhao J and Sui S-F (2015) Structural organization of an intact phycobilisome and itsassociation with photosystem II Cell Res 25 726-737

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Danielsson R Suorsa M Paakkarinen V Albertsson P-Aring Styring S Aro E-M and Mamedov F (2006) Dimeric andmonomeric organization of photosystem II Distribution of five distinct complexes in the different domains of the thylakoidmembrane J Biol Chem 281 14241-14249

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Daum B Nicastro D Austin J McIntosh JR and Kuumlhlbrandt W (2010) Arrangement of photosystem II and ATP synthase in

32

Spaumlt P Maček B and Forchhammer K (2015) Phosphoproteome of the cyanobacterium 1030

Synechocystis sp PCC 6803 and its dynamics during nitrogen starvation Front 1031

Microbiol 6 248 1032

Stengel A Guumlgel IL Hilger D Rengstl B Jung H and Nickelsen J (2012) Initial 1033

steps of photosystem II de novo assembly and preloading with manganese take place 1034

in biogenesis centers in Synechocystis Plant Cell 24 660-675 1035

Uniacke J and Zerges W (2007) Photosystem II assembly and repair are differentially 1036

localized in Chlamydomonas Plant Cell 19 3640-3654 1037

Uniacke J and Zerges W (2009) Chloroplast protein targeting involves localized 1038

translation in Chlamydomonas Proc Natl Acad Sci USA 106 1439-1444 1039

van de Meene AL Hohmann-Marriott M Vermaas WJ and Roberson R (2006) The 1040

three-dimensional structure of the cyanobacterium Synechocystis sp PCC 6803 Arch 1041

Microbiol 184 259-270 1042

van de Meene AML Sharp WP McDaniel JH Friedrich H Vermaas WFJ and 1043

Roberson RW (2012) Gross morphological changes in thylakoid membrane 1044

structure are associated with photosystem I deletion in Synechocystis sp PCC 6803 1045

Biochim Biophys Acta 1818 1427-1434 1046

Watanabe M and Ikeuchi M (2013) Phycobilisome architecture of a light-harvesting 1047

supercomplex Photosynth Res 116 265-276 1048

Wellburn AR and Lichtenthaler H (1984) Formulae and Program to Determine Total 1049

Carotenoids and Chlorophylls A and B of Leaf Extracts in Different Solvents In 1050

Advances in Photosynthesis Research Proceedings of the VIth International Congress 1051

on Photosynthesis Brussels Belgium August 1ndash6 1983 C Sybesma ed (Dordrecht 1052

Springer Netherlands) pp 9-12 1053

Wilde A Lunser K Ossenbuumlhl F Nickelsen J and Borner T (2001) Characterization of 1054

the cyanobacterial ycf37 mutation decreases the photosystem I content Biochem J 1055

357 211-216 1056

Wilson A Boulay C Wilde A Kerfeld CA and Kirilovsky D (2007) Light-Induced 1057

Energy Dissipation in Iron-Starved Cyanobacteria Roles of OCP and IsiA Proteins 1058

Plant Cell 19 656-672 1059

Xu M Bernaacutet G Singh A Mi H Roumlgner M Pakrasi HB and Ogawa T (2008) 1060

Properties of Mutants of Synechocystis sp Strain PCC 6803 Lacking Inorganic Carbon 1061

Sequestration Systems Plant Cell Physiol 49 1672-1677 1062

33

Yamamoto T Burke J Autz G and Jagendorf AT (1981) Bound ribosomes of Pea 1063

chloroplast thylakoid membranes location and release in vitro by high salt 1064

puromycin and RNase Plant Physiol 67 940-949 1065

Yang H Liao L Bo T Zhao L Sun X Lu X Norling B and Huang F (2014) 1066

Slr0151 in Synechocystis sp PCC 6803 is required for efficient repair of photosystem 1067

II under high-light condition J Integr Plant Biol 56 1136-1150 1068

Yeremenko N Kouřil R Ihalainen JA DHaene S van Oosterwijk N 1069

Andrizhiyevskaya EG Keegstra W Dekker HL Hagemann M Boekema EJ 1070

Matthijs HCP and Dekker JP (2004) Supramolecular Organization and Dual 1071

Function of the IsiA Chlorophyll-Binding Protein in Cyanobacteria Biochemistry 43 1072

10308-10313 1073

Zak E Norling B Maitra R Huang F Andersson B and Pakrasi HB (2001) The 1074

initial steps of biogenesis of cyanobacterial photosystems occur in plasma membranes 1075

Proc Natl Acad Sci USA 98 13443-13448 1076

Zang X Liu B Liu S Arunakumara KKIU and Zhang X (2007) Optimum 1077

Conditions for Transformation of Synechocystis sp PCC 6803 J Microbiol 45 241-1078

245 1079

Zhang L and Sakamoto W (2015) Possible function of VIPP1 in maintaining chloroplast 1080

membranes Biochim Biophys Acta 1847 831-837 1081

Zimmerberg J and Kozlov MM (2006) How proteins produce cellular membrane 1082

curvature Nat Rev Mol Cell Biol 7 9-19 1083

Zoumlfel P (1988) Statistik in der Praxis (Stuttgart Germany Gustav Fischer Verlag) 1084

1085

34

Figure Legends 1086

Figure 1 General characteristics of CurT A) Sequence alignment of CurT and CURT1A-D 1087

from A thaliana Predicted chloroplast transit-peptide sequences of CURT1A-D are omitted 1088

(Armbruster et al 2013) Positions of predicted C-terminal transmembrane domains (TDM) 1089

are marked (black bar) as is the position of the predicted amphipathic N-terminal helix in 1090

CurT (red bar) The green bar denotes the peptide sequence used for antibody production 1091

Identical and related amino acids that are conserved in 100 80 and 60 of the sequences 1092

are highlighted in black dark grey and light grey respectively B) Helical-wheel 1093

representation of the N-terminal amphipathic helix of CurT (red bar in A) The color code 1094

reflects the physicochemical properties of amino-acid side-chains green polar and 1095

uncharged blue polar and positively charged red polar and negatively charged yellow 1096

hydrophobic C) Solubility of CurT Membrane-associated proteins (50 microg) from wild-type 1097

cells were extracted with 5 mM HEPES (pH 76) containing either 1 M NaCl 01 M Na2CO3 1098

4 M urea 01 Triton X-100 or no additional solute After separation of membrane-bound 1099

(M) and solubilized (S) proteins by centrifugation proteins were fractionated by SDS-PAGE1100

and CurT was immunodetected on immunoblots As a control the integral membrane protein 1101

CP47 from PSII was analyzed in parallel D) Transmission electron micrographs of negatively 1102

stained liposomes Cell-free expression (CFE) of CurT and A thaliana CURT1A was 1103

performed in the presence of liposomes similar in composition to the lipids of the thylakoid 1104

membrane Liposomes before and after cell-free protein expression in the absence of DNA 1105

served as negative controls Black arrowheads indicate tubular connections between 1106

liposomes Scale bars 250 nm 1107

1108

Figure 2 Ultrastructural analysis of curT- cells Transmission electron micrographs of typical 1109

wild-type (A) and curT- (B-D) Synechocystis 6803 cells taken at 44000times (A B) and 28000times 1110

(C D) magnification respectively Ultrathin sections (35 to 45 nm) of cryofixed samples 1111

were stained with osmium tetroxide and post-stained using lead citrate Arrowheads indicate 1112

biogenesis centers Scale bars 200 nm (A B) and 500 nm (C D) respectively 1113

1114

Figure 3 Accumulation of components of photosynthetic complexes in the curT- mutant A) 1115

Whole cell extracts (30 microg protein) from wild-type and curT- strains were fractionated by 1116

SDS-PAGE and analyzed on immunoblots using the indicated antibodies B) The histogram 1117

shows levels of the indicated proteins in curT- extracts relative to wild-type samples (dashed 1118

red line) Data are means plusmn SD of three independent experiments Significant differences from 1119

35

wild-type protein levels according to Studentrsquos t-test with error probabilities of 5 and 1 1120

are indicated by and respectively 1121

1122

Figure 4 P700+ reduction kinetics and high-light effects in curT- cells A) Averaged traces 1123

(10 single measurements) of P700+ decay after complete oxidation by a 50-ms multiple 1124

turnover pulse (10000 micromol photons m-2 s-1) in the absence and presence of 10 microM DCMU 1125

B) Rate constants for P700+ reduction were obtained by fitting of the data with single1126

exponential functions Error bars indicate the SD of three independent measurements C) 1127

Impact of light intensity on the (relative) electron transport rate (rETR) Cells were exposed to 1128

gradually increasing light intensities which resulted in increasing electron transport until the 1129

capacity limit was reached PAR light intensity (micromol photons m-2 s-1) Error bars indicate the 1130

SD of three independent measurements D) D1 protein level in wild-type and curT- after high-1131

light treatment (800 micromol photons m-2s-1) in the presence and absence of lincomycin Samples 1132

were taken every 30 min and processed as in Figure 3 to determine the level of D1 present 1133

100 refers to wild-type D1 level at the beginning of the experiment 1134

1135

Figure 5 PSII assembly in curT- cells A) BNSDS-PAGE of membrane proteins Membrane 1136

fractions from wild-type and curT- cells were solubilized with 13 n-dodecyl-β-maltoside 1137

and proteins were fractionated by two-dimensional BNSDS-PAGE blotted and probed with 1138

antibodies against the PSII subunits D1 D2 CP47 and CP43 Wild-type blots were also 1139

probed with the αCurT antibody The sizes of marker proteins and the positions of PSII 1140

assembly intermediates (RCCII RCCI RC47) are shown above and below each image B) In 1141

vivo pulse labeling of membrane proteins with 35S Pulse-labeled PSII core proteins were 1142

separated via BNSDS-PAGE and visualized by autoradiography 1143

1144

Figure 6 Loss of CurT induces stress A) Low-temperature (77 K) fluorescence emission of 1145

Synechocystis 6803 wild-type (blue) and curT- (red) cells excited at 440 nm The spectra were 1146

normalized to the added fluorescein standard B) Low-temperature (77 K) fluorescence 1147

emission of Synechocystis 6803 wild-type (blue) and curT- (red) excited at 580 nm The 1148

spectra were normalized to 780 nm C) Level of IsiA in the curT- mutant relative to the wild-1149

type A mean value of 368 plusmn 96 (SD) was determined from three independent experiments 1150

1151

Figure 7 Membrane sublocalization of PSII-related factors Cell extracts from wild-type and 1152

curT- cells were fractionated by two consecutive rounds of sucrose-density gradient 1153

36

centrifugation (Schottkowski et al 2009b) The second linear gradient (20-60 sucrose) was 1154

apportioned into 14 fractions which were analyzed by immunoblotting using the indicated 1155

antibodies Fractions 1ndash6 represent PDMs and fractions 7ndash14 thylakoid membranes (TMs) 1156

To facilitate comparison between gradients sample volumes were normalized to the volume 1157

of fraction 7 that contained 40 microg of protein 1158

1159

Figure 8 Live-cell imaging of the curT-CFP strain by fluorescence microscopy In the curT-1160

CFP strain the native curT gene has been replaced by a CFP-tagged version resulting in the 1161

expression of the CurT-CFP fusion protein under the control of the native promotor A) 1162

Close-up views of the mid-cell plane in the CFP and far-red autofluorescence channels shown 1163

in slice 7 in panel B B) Synechocystis 6803 cells expressing CurT C-terminally fused to the 1164

mTurquoise2 variant of CFP from its native chromosomal promoter The two imaging 1165

channels are displayed as Z-axis montages (auto-scaled contrast step size 250 nm) in 1166

grayscale and color composite configuration The thylakoid autofluorescent channel as 1167

imaged in far-red fluorescence is depicted in magenta and CurT signal as imaged in cyan 1168

fluorescence is depicted in cyan C) Fluorescence intensity profiles of the two channels along 1169

the autofluorescent peripheral cell ldquoringrdquo are shown for slice 7 The maximum projection of 1170

the entire Z montage is also shown Scale bars (light grey) 2 microm 1171

1172

Figure 9 Immunofluorescence detection of CurT A) Close-ups of slice 5 in panel B B) 1173

Wild-type Synechocystis 6803 cells labeled with αCurT antibodies and detected with Oregon 1174

Green-conjugated secondary antibodies The Z-axis montages are shown as in Figure 8B 1175

except that the step size is 280 nm (1 to 10) C) Intensity profiles of the two channels along 1176

the autofluorescent peripheral cell ldquoringrdquo are shown for slice 5 The maximum projection of 1177

the entire Z montage is also shown Scale bars (light grey) 2 microm 1178

1179

Figure 10 Subcellular localization of CurT Ultrathin sections of wild-type Synechocystis 1180

6803 cells were incubated with rabbit αCurT prior to incubation with gold-conjugated goat 1181

anti-rabbit IgG A) Negative control (wild-type processed without addition of primary 1182

antibody) B C) Immunogold-labeled sections showing CurT localization at the cytoplasmic 1183

side of the thylakoid membrane D) Cluster formation of CurT signals at a putative biogenesis 1184

center from C E) Biogenesis center from the same cell (C) without any obvious CurT 1185

clustering of gold particles F) Schematic depiction of a wild-type cell (from Figure 2A) with 1186

color-coded curved membranes green = thylakoids that follow the curvature of the cell red = 1187

37

thylakoids that bend away from the plasma membrane yellow = thylakoids that bend toward 1188

the plasma membrane to converge on sites of biogenesis centers G) Relative distribution of 1189

gold signals between convex (dark color) and concave (light color) sides of membranes (n = 1190

1584 signals from a total of 95 cells) The undifferentiated overall signal distribution is given 1191

in blue Bars = 200 nm (overview) and 100 nm (details) 1192

1193

Figure 11 Differentially modified forms of CurT are found in different complexes in PDMs 1194

and thylakoid membranes Samples were isolated by fractionation of wild-type membranes 1195

via two consecutive sucrose density gradients according to Schottkowski et al (2009b) After 1196

density centrifugation samples were applied to BNSDS-PAGE analysis (A) or isoelectric 1197

focusing (B) Numbers on the right indicate the respective fraction from the second gradient 1198

(see Figure 7) Fraction 5 represents the PDMs and fraction 9 the thylakoid membrane 1199

1200

Figure 12 Loss of CurT increases sensitivity to abiotic stress A B) Doubling times of wild-1201

type and curT- under salt stress (A) or osmotic stress (B) Doubling times are means plusmn SD of 1202

three independent cultures C) Localization of CurT-CFP under salt and osmotic stress 1203

Samples were examined as described in Figure 8 Scale bars 1 microm D) Protein levels of wild-1204

type cells after growth in BG11 medium containing 500 mM NaCl Samples were analyzed on 1205

the same gel but unrelated samples between the presented signals were omitted E) 1206

Membrane preparations obtained from wild-type cells wild-type cells grown in the presence 1207

of 500 mM NaCl and curT- cells were subjected to the first gradient step in the membrane 1208

fractionation scheme The gradient was divided into five fractions and 10 of fractions I-IV 1209

and 02 of fraction V were analyzed by SDS-PAGE Fraction II includes the plasma 1210

membrane and fraction V consists of PratA-defined membrane and thylakoid membrane 1211

1212

Figure 13 Model of CurT distribution at convergence zones in Synechocystis 6803 The 1213

distribution of CurT in thylakoid (green) and plasma membranes (brown) is shown The 1214

pattern of localization of CurT in the thylakoid membrane is derived from membrane 1215

fractionation via sucrose density centrifugation fluorescence-based detection of the CurT-1216

CFP fusion and endogenous CurT and immunogold labeling experiments (Figures 7-10) The 1217

different CurT variants a b c and d identified in the IEF experiments (Figure 11) are depicted 1218

in yellow pink blue and black respectively CurT present in the plasma membrane is 1219

highlighted in gray as its precise nature and role remain to be defined (Figure 12) 1220

Membranes are represented as lipid bilayers Convex and concave faces of bent thylakoid 1221

38

sheets are indicated by black arrows The PDM which is dedicated to PSII assembly and 1222

repair is depicted in blue The dotted blue line emphasizes that the ultrastructure in this region 1223

has not yet been fully resolved PP periplasm PM plasma membrane TM thylakoid 1224

membrane L lumen PDM PratA-defined membrane 1225

1226

Tables 1227

Table 1 Physiological characteristics of the curT- mutant 1228

Strain Doubling time [h]

Oxygen Evolution[nmol h-1 OD750

-1]c

Chlorophyll content

[microg OD750-1]

d

Cell size [microm]e

Cell number [ml-1 OD750

-1]f

Wild type 817plusmn017a 1600plusmn042

b 1933plusmn187 251plusmn014 264plusmn020 390plusmn006 x 107

curT- 1259plusmn020a 3226plusmn056

b 1074plusmn20 195plusmn029 274plusmn044 367plusmn016 x 107

1229 abDoubling times in the presence (a) or absence (b) of 5 mM glucose measured under 1230

continuous illumination at 30 micromol photons m-2 s-1 and CO2-limiting conditions cOxygen 1231

evolution is expressed in nmol O2 produced per hour per OD750 unit dChlorophyll content is 1232

expressed in microg OD750-1 eThe diameter of non-dividing cells is presented in microm fCell number 1233

was determined per ml per OD750 Data are means plusmn SD of at least three independent 1234

experiments 1235

1236

Parsed CitationsAllen JF de Paula WBM Puthiyaveetil S and Nield J (2011) A structural phylogenetic map for chloroplast photosynthesisTrends Plant Sci 16 645-655

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Anderson JM Horton P Kim E-H and Chow WS (2012) Towards elucidation of dynamic structural changes of plant thylakoidarchitecture Philos Trans R Soc Lond B Biol Sci 367 3515-3524

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Armbruster U Zuumlhlke J Rengstl B Kreller R Makarenko E Ruumlhle T Schuumlnemann D Jahns P Weisshaar B NickelsenJ and Leister D (2010) The Arabidopsis thylakoid protein PAM68 is required for efficient D1 biogenesis and photosystem IIassembly Plant Cell 22 3439-3460

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Armbruster U Labs M Pribil M Viola S Xu W Scharfenberg M Hertle AP Rojahn U Jensen PE Rappaport F JoliotP Doumlrmann P Wanner G and Leister D (2013) Arabidopsis CURVATURE THYLAKOID1 proteins modify thylakoid architectureby inducing membrane curvature Plant Cell 25 2661-2678

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Aseeva E Ossenbuumlhl F Sippel C Cho WK Stein B Eichacker LA Meurer J Wanner G Westhoff P Soll J andVothknecht UC (2007) Vipp1 is required for basic thylakoid membrane formation but not for the assembly of thylakoid proteincomplexes Plant Physiol Biochem 45 119-128

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Bartsevich VV and Pakrasi HB (1995) Molecular identification of an ABC transporter complex for manganese analysis of acyanobacterial mutant strain impaired in the photosynthetic oxygen evolution process EMBO J 14 1845-1853

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Bartsevich VV and Pakrasi HB (1996) Manganese transport in the cyanobacterium Synechocystis sp PCC 6803 J Biol Chem271 26057-26061

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Bernaacutet G Waschewski N and Roumlgner M (2009) Towards efficient hydrogen production the impact of antenna size andexternal factors on electron transport dynamics in Synechocystis PCC 6803 Photosynth Res 99 205-216

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Boehm M Yu J Krynicka V Barker M Tichy M Komenda J Nixon PJ and Nield J (2012) Subunit Organization of aSynechocystis Hetero-Oligomeric Thylakoid FtsH Complex Involved in Photosystem II Repair Plant Cell 24 3669-3683

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Bradford MM (1976) A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle ofprotein-dye binding Anal Biochem 72 248-254

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Chang L Liu X Li Y Liu C-C Yang F Zhao J and Sui S-F (2015) Structural organization of an intact phycobilisome and itsassociation with photosystem II Cell Res 25 726-737

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Danielsson R Suorsa M Paakkarinen V Albertsson P-Aring Styring S Aro E-M and Mamedov F (2006) Dimeric andmonomeric organization of photosystem II Distribution of five distinct complexes in the different domains of the thylakoidmembrane J Biol Chem 281 14241-14249

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Daum B Nicastro D Austin J McIntosh JR and Kuumlhlbrandt W (2010) Arrangement of photosystem II and ATP synthase in

33

Yamamoto T Burke J Autz G and Jagendorf AT (1981) Bound ribosomes of Pea 1063

chloroplast thylakoid membranes location and release in vitro by high salt 1064

puromycin and RNase Plant Physiol 67 940-949 1065

Yang H Liao L Bo T Zhao L Sun X Lu X Norling B and Huang F (2014) 1066

Slr0151 in Synechocystis sp PCC 6803 is required for efficient repair of photosystem 1067

II under high-light condition J Integr Plant Biol 56 1136-1150 1068

Yeremenko N Kouřil R Ihalainen JA DHaene S van Oosterwijk N 1069

Andrizhiyevskaya EG Keegstra W Dekker HL Hagemann M Boekema EJ 1070

Matthijs HCP and Dekker JP (2004) Supramolecular Organization and Dual 1071

Function of the IsiA Chlorophyll-Binding Protein in Cyanobacteria Biochemistry 43 1072

10308-10313 1073

Zak E Norling B Maitra R Huang F Andersson B and Pakrasi HB (2001) The 1074

initial steps of biogenesis of cyanobacterial photosystems occur in plasma membranes 1075

Proc Natl Acad Sci USA 98 13443-13448 1076

Zang X Liu B Liu S Arunakumara KKIU and Zhang X (2007) Optimum 1077

Conditions for Transformation of Synechocystis sp PCC 6803 J Microbiol 45 241-1078

245 1079

Zhang L and Sakamoto W (2015) Possible function of VIPP1 in maintaining chloroplast 1080

membranes Biochim Biophys Acta 1847 831-837 1081

Zimmerberg J and Kozlov MM (2006) How proteins produce cellular membrane 1082

curvature Nat Rev Mol Cell Biol 7 9-19 1083

Zoumlfel P (1988) Statistik in der Praxis (Stuttgart Germany Gustav Fischer Verlag) 1084

1085

34

Figure Legends 1086

Figure 1 General characteristics of CurT A) Sequence alignment of CurT and CURT1A-D 1087

from A thaliana Predicted chloroplast transit-peptide sequences of CURT1A-D are omitted 1088

(Armbruster et al 2013) Positions of predicted C-terminal transmembrane domains (TDM) 1089

are marked (black bar) as is the position of the predicted amphipathic N-terminal helix in 1090

CurT (red bar) The green bar denotes the peptide sequence used for antibody production 1091

Identical and related amino acids that are conserved in 100 80 and 60 of the sequences 1092

are highlighted in black dark grey and light grey respectively B) Helical-wheel 1093

representation of the N-terminal amphipathic helix of CurT (red bar in A) The color code 1094

reflects the physicochemical properties of amino-acid side-chains green polar and 1095

uncharged blue polar and positively charged red polar and negatively charged yellow 1096

hydrophobic C) Solubility of CurT Membrane-associated proteins (50 microg) from wild-type 1097

cells were extracted with 5 mM HEPES (pH 76) containing either 1 M NaCl 01 M Na2CO3 1098

4 M urea 01 Triton X-100 or no additional solute After separation of membrane-bound 1099

(M) and solubilized (S) proteins by centrifugation proteins were fractionated by SDS-PAGE1100

and CurT was immunodetected on immunoblots As a control the integral membrane protein 1101

CP47 from PSII was analyzed in parallel D) Transmission electron micrographs of negatively 1102

stained liposomes Cell-free expression (CFE) of CurT and A thaliana CURT1A was 1103

performed in the presence of liposomes similar in composition to the lipids of the thylakoid 1104

membrane Liposomes before and after cell-free protein expression in the absence of DNA 1105

served as negative controls Black arrowheads indicate tubular connections between 1106

liposomes Scale bars 250 nm 1107

1108

Figure 2 Ultrastructural analysis of curT- cells Transmission electron micrographs of typical 1109

wild-type (A) and curT- (B-D) Synechocystis 6803 cells taken at 44000times (A B) and 28000times 1110

(C D) magnification respectively Ultrathin sections (35 to 45 nm) of cryofixed samples 1111

were stained with osmium tetroxide and post-stained using lead citrate Arrowheads indicate 1112

biogenesis centers Scale bars 200 nm (A B) and 500 nm (C D) respectively 1113

1114

Figure 3 Accumulation of components of photosynthetic complexes in the curT- mutant A) 1115

Whole cell extracts (30 microg protein) from wild-type and curT- strains were fractionated by 1116

SDS-PAGE and analyzed on immunoblots using the indicated antibodies B) The histogram 1117

shows levels of the indicated proteins in curT- extracts relative to wild-type samples (dashed 1118

red line) Data are means plusmn SD of three independent experiments Significant differences from 1119

35

wild-type protein levels according to Studentrsquos t-test with error probabilities of 5 and 1 1120

are indicated by and respectively 1121

1122

Figure 4 P700+ reduction kinetics and high-light effects in curT- cells A) Averaged traces 1123

(10 single measurements) of P700+ decay after complete oxidation by a 50-ms multiple 1124

turnover pulse (10000 micromol photons m-2 s-1) in the absence and presence of 10 microM DCMU 1125

B) Rate constants for P700+ reduction were obtained by fitting of the data with single1126

exponential functions Error bars indicate the SD of three independent measurements C) 1127

Impact of light intensity on the (relative) electron transport rate (rETR) Cells were exposed to 1128

gradually increasing light intensities which resulted in increasing electron transport until the 1129

capacity limit was reached PAR light intensity (micromol photons m-2 s-1) Error bars indicate the 1130

SD of three independent measurements D) D1 protein level in wild-type and curT- after high-1131

light treatment (800 micromol photons m-2s-1) in the presence and absence of lincomycin Samples 1132

were taken every 30 min and processed as in Figure 3 to determine the level of D1 present 1133

100 refers to wild-type D1 level at the beginning of the experiment 1134

1135

Figure 5 PSII assembly in curT- cells A) BNSDS-PAGE of membrane proteins Membrane 1136

fractions from wild-type and curT- cells were solubilized with 13 n-dodecyl-β-maltoside 1137

and proteins were fractionated by two-dimensional BNSDS-PAGE blotted and probed with 1138

antibodies against the PSII subunits D1 D2 CP47 and CP43 Wild-type blots were also 1139

probed with the αCurT antibody The sizes of marker proteins and the positions of PSII 1140

assembly intermediates (RCCII RCCI RC47) are shown above and below each image B) In 1141

vivo pulse labeling of membrane proteins with 35S Pulse-labeled PSII core proteins were 1142

separated via BNSDS-PAGE and visualized by autoradiography 1143

1144

Figure 6 Loss of CurT induces stress A) Low-temperature (77 K) fluorescence emission of 1145

Synechocystis 6803 wild-type (blue) and curT- (red) cells excited at 440 nm The spectra were 1146

normalized to the added fluorescein standard B) Low-temperature (77 K) fluorescence 1147

emission of Synechocystis 6803 wild-type (blue) and curT- (red) excited at 580 nm The 1148

spectra were normalized to 780 nm C) Level of IsiA in the curT- mutant relative to the wild-1149

type A mean value of 368 plusmn 96 (SD) was determined from three independent experiments 1150

1151

Figure 7 Membrane sublocalization of PSII-related factors Cell extracts from wild-type and 1152

curT- cells were fractionated by two consecutive rounds of sucrose-density gradient 1153

36

centrifugation (Schottkowski et al 2009b) The second linear gradient (20-60 sucrose) was 1154

apportioned into 14 fractions which were analyzed by immunoblotting using the indicated 1155

antibodies Fractions 1ndash6 represent PDMs and fractions 7ndash14 thylakoid membranes (TMs) 1156

To facilitate comparison between gradients sample volumes were normalized to the volume 1157

of fraction 7 that contained 40 microg of protein 1158

1159

Figure 8 Live-cell imaging of the curT-CFP strain by fluorescence microscopy In the curT-1160

CFP strain the native curT gene has been replaced by a CFP-tagged version resulting in the 1161

expression of the CurT-CFP fusion protein under the control of the native promotor A) 1162

Close-up views of the mid-cell plane in the CFP and far-red autofluorescence channels shown 1163

in slice 7 in panel B B) Synechocystis 6803 cells expressing CurT C-terminally fused to the 1164

mTurquoise2 variant of CFP from its native chromosomal promoter The two imaging 1165

channels are displayed as Z-axis montages (auto-scaled contrast step size 250 nm) in 1166

grayscale and color composite configuration The thylakoid autofluorescent channel as 1167

imaged in far-red fluorescence is depicted in magenta and CurT signal as imaged in cyan 1168

fluorescence is depicted in cyan C) Fluorescence intensity profiles of the two channels along 1169

the autofluorescent peripheral cell ldquoringrdquo are shown for slice 7 The maximum projection of 1170

the entire Z montage is also shown Scale bars (light grey) 2 microm 1171

1172

Figure 9 Immunofluorescence detection of CurT A) Close-ups of slice 5 in panel B B) 1173

Wild-type Synechocystis 6803 cells labeled with αCurT antibodies and detected with Oregon 1174

Green-conjugated secondary antibodies The Z-axis montages are shown as in Figure 8B 1175

except that the step size is 280 nm (1 to 10) C) Intensity profiles of the two channels along 1176

the autofluorescent peripheral cell ldquoringrdquo are shown for slice 5 The maximum projection of 1177

the entire Z montage is also shown Scale bars (light grey) 2 microm 1178

1179

Figure 10 Subcellular localization of CurT Ultrathin sections of wild-type Synechocystis 1180

6803 cells were incubated with rabbit αCurT prior to incubation with gold-conjugated goat 1181

anti-rabbit IgG A) Negative control (wild-type processed without addition of primary 1182

antibody) B C) Immunogold-labeled sections showing CurT localization at the cytoplasmic 1183

side of the thylakoid membrane D) Cluster formation of CurT signals at a putative biogenesis 1184

center from C E) Biogenesis center from the same cell (C) without any obvious CurT 1185

clustering of gold particles F) Schematic depiction of a wild-type cell (from Figure 2A) with 1186

color-coded curved membranes green = thylakoids that follow the curvature of the cell red = 1187

37

thylakoids that bend away from the plasma membrane yellow = thylakoids that bend toward 1188

the plasma membrane to converge on sites of biogenesis centers G) Relative distribution of 1189

gold signals between convex (dark color) and concave (light color) sides of membranes (n = 1190

1584 signals from a total of 95 cells) The undifferentiated overall signal distribution is given 1191

in blue Bars = 200 nm (overview) and 100 nm (details) 1192

1193

Figure 11 Differentially modified forms of CurT are found in different complexes in PDMs 1194

and thylakoid membranes Samples were isolated by fractionation of wild-type membranes 1195

via two consecutive sucrose density gradients according to Schottkowski et al (2009b) After 1196

density centrifugation samples were applied to BNSDS-PAGE analysis (A) or isoelectric 1197

focusing (B) Numbers on the right indicate the respective fraction from the second gradient 1198

(see Figure 7) Fraction 5 represents the PDMs and fraction 9 the thylakoid membrane 1199

1200

Figure 12 Loss of CurT increases sensitivity to abiotic stress A B) Doubling times of wild-1201

type and curT- under salt stress (A) or osmotic stress (B) Doubling times are means plusmn SD of 1202

three independent cultures C) Localization of CurT-CFP under salt and osmotic stress 1203

Samples were examined as described in Figure 8 Scale bars 1 microm D) Protein levels of wild-1204

type cells after growth in BG11 medium containing 500 mM NaCl Samples were analyzed on 1205

the same gel but unrelated samples between the presented signals were omitted E) 1206

Membrane preparations obtained from wild-type cells wild-type cells grown in the presence 1207

of 500 mM NaCl and curT- cells were subjected to the first gradient step in the membrane 1208

fractionation scheme The gradient was divided into five fractions and 10 of fractions I-IV 1209

and 02 of fraction V were analyzed by SDS-PAGE Fraction II includes the plasma 1210

membrane and fraction V consists of PratA-defined membrane and thylakoid membrane 1211

1212

Figure 13 Model of CurT distribution at convergence zones in Synechocystis 6803 The 1213

distribution of CurT in thylakoid (green) and plasma membranes (brown) is shown The 1214

pattern of localization of CurT in the thylakoid membrane is derived from membrane 1215

fractionation via sucrose density centrifugation fluorescence-based detection of the CurT-1216

CFP fusion and endogenous CurT and immunogold labeling experiments (Figures 7-10) The 1217

different CurT variants a b c and d identified in the IEF experiments (Figure 11) are depicted 1218

in yellow pink blue and black respectively CurT present in the plasma membrane is 1219

highlighted in gray as its precise nature and role remain to be defined (Figure 12) 1220

Membranes are represented as lipid bilayers Convex and concave faces of bent thylakoid 1221

38

sheets are indicated by black arrows The PDM which is dedicated to PSII assembly and 1222

repair is depicted in blue The dotted blue line emphasizes that the ultrastructure in this region 1223

has not yet been fully resolved PP periplasm PM plasma membrane TM thylakoid 1224

membrane L lumen PDM PratA-defined membrane 1225

1226

Tables 1227

Table 1 Physiological characteristics of the curT- mutant 1228

Strain Doubling time [h]

Oxygen Evolution[nmol h-1 OD750

-1]c

Chlorophyll content

[microg OD750-1]

d

Cell size [microm]e

Cell number [ml-1 OD750

-1]f

Wild type 817plusmn017a 1600plusmn042

b 1933plusmn187 251plusmn014 264plusmn020 390plusmn006 x 107

curT- 1259plusmn020a 3226plusmn056

b 1074plusmn20 195plusmn029 274plusmn044 367plusmn016 x 107

1229 abDoubling times in the presence (a) or absence (b) of 5 mM glucose measured under 1230

continuous illumination at 30 micromol photons m-2 s-1 and CO2-limiting conditions cOxygen 1231

evolution is expressed in nmol O2 produced per hour per OD750 unit dChlorophyll content is 1232

expressed in microg OD750-1 eThe diameter of non-dividing cells is presented in microm fCell number 1233

was determined per ml per OD750 Data are means plusmn SD of at least three independent 1234

experiments 1235

1236

Parsed CitationsAllen JF de Paula WBM Puthiyaveetil S and Nield J (2011) A structural phylogenetic map for chloroplast photosynthesisTrends Plant Sci 16 645-655

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Anderson JM Horton P Kim E-H and Chow WS (2012) Towards elucidation of dynamic structural changes of plant thylakoidarchitecture Philos Trans R Soc Lond B Biol Sci 367 3515-3524

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Armbruster U Zuumlhlke J Rengstl B Kreller R Makarenko E Ruumlhle T Schuumlnemann D Jahns P Weisshaar B NickelsenJ and Leister D (2010) The Arabidopsis thylakoid protein PAM68 is required for efficient D1 biogenesis and photosystem IIassembly Plant Cell 22 3439-3460

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Armbruster U Labs M Pribil M Viola S Xu W Scharfenberg M Hertle AP Rojahn U Jensen PE Rappaport F JoliotP Doumlrmann P Wanner G and Leister D (2013) Arabidopsis CURVATURE THYLAKOID1 proteins modify thylakoid architectureby inducing membrane curvature Plant Cell 25 2661-2678

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Aseeva E Ossenbuumlhl F Sippel C Cho WK Stein B Eichacker LA Meurer J Wanner G Westhoff P Soll J andVothknecht UC (2007) Vipp1 is required for basic thylakoid membrane formation but not for the assembly of thylakoid proteincomplexes Plant Physiol Biochem 45 119-128

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Bartsevich VV and Pakrasi HB (1995) Molecular identification of an ABC transporter complex for manganese analysis of acyanobacterial mutant strain impaired in the photosynthetic oxygen evolution process EMBO J 14 1845-1853

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Bartsevich VV and Pakrasi HB (1996) Manganese transport in the cyanobacterium Synechocystis sp PCC 6803 J Biol Chem271 26057-26061

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Bernaacutet G Waschewski N and Roumlgner M (2009) Towards efficient hydrogen production the impact of antenna size andexternal factors on electron transport dynamics in Synechocystis PCC 6803 Photosynth Res 99 205-216

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Boehm M Yu J Krynicka V Barker M Tichy M Komenda J Nixon PJ and Nield J (2012) Subunit Organization of aSynechocystis Hetero-Oligomeric Thylakoid FtsH Complex Involved in Photosystem II Repair Plant Cell 24 3669-3683

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Bradford MM (1976) A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle ofprotein-dye binding Anal Biochem 72 248-254

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Chang L Liu X Li Y Liu C-C Yang F Zhao J and Sui S-F (2015) Structural organization of an intact phycobilisome and itsassociation with photosystem II Cell Res 25 726-737

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Danielsson R Suorsa M Paakkarinen V Albertsson P-Aring Styring S Aro E-M and Mamedov F (2006) Dimeric andmonomeric organization of photosystem II Distribution of five distinct complexes in the different domains of the thylakoidmembrane J Biol Chem 281 14241-14249

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Daum B Nicastro D Austin J McIntosh JR and Kuumlhlbrandt W (2010) Arrangement of photosystem II and ATP synthase in

34

Figure Legends 1086

Figure 1 General characteristics of CurT A) Sequence alignment of CurT and CURT1A-D 1087

from A thaliana Predicted chloroplast transit-peptide sequences of CURT1A-D are omitted 1088

(Armbruster et al 2013) Positions of predicted C-terminal transmembrane domains (TDM) 1089

are marked (black bar) as is the position of the predicted amphipathic N-terminal helix in 1090

CurT (red bar) The green bar denotes the peptide sequence used for antibody production 1091

Identical and related amino acids that are conserved in 100 80 and 60 of the sequences 1092

are highlighted in black dark grey and light grey respectively B) Helical-wheel 1093

representation of the N-terminal amphipathic helix of CurT (red bar in A) The color code 1094

reflects the physicochemical properties of amino-acid side-chains green polar and 1095

uncharged blue polar and positively charged red polar and negatively charged yellow 1096

hydrophobic C) Solubility of CurT Membrane-associated proteins (50 microg) from wild-type 1097

cells were extracted with 5 mM HEPES (pH 76) containing either 1 M NaCl 01 M Na2CO3 1098

4 M urea 01 Triton X-100 or no additional solute After separation of membrane-bound 1099

(M) and solubilized (S) proteins by centrifugation proteins were fractionated by SDS-PAGE1100

and CurT was immunodetected on immunoblots As a control the integral membrane protein 1101

CP47 from PSII was analyzed in parallel D) Transmission electron micrographs of negatively 1102

stained liposomes Cell-free expression (CFE) of CurT and A thaliana CURT1A was 1103

performed in the presence of liposomes similar in composition to the lipids of the thylakoid 1104

membrane Liposomes before and after cell-free protein expression in the absence of DNA 1105

served as negative controls Black arrowheads indicate tubular connections between 1106

liposomes Scale bars 250 nm 1107

1108

Figure 2 Ultrastructural analysis of curT- cells Transmission electron micrographs of typical 1109

wild-type (A) and curT- (B-D) Synechocystis 6803 cells taken at 44000times (A B) and 28000times 1110

(C D) magnification respectively Ultrathin sections (35 to 45 nm) of cryofixed samples 1111

were stained with osmium tetroxide and post-stained using lead citrate Arrowheads indicate 1112

biogenesis centers Scale bars 200 nm (A B) and 500 nm (C D) respectively 1113

1114

Figure 3 Accumulation of components of photosynthetic complexes in the curT- mutant A) 1115

Whole cell extracts (30 microg protein) from wild-type and curT- strains were fractionated by 1116

SDS-PAGE and analyzed on immunoblots using the indicated antibodies B) The histogram 1117

shows levels of the indicated proteins in curT- extracts relative to wild-type samples (dashed 1118

red line) Data are means plusmn SD of three independent experiments Significant differences from 1119

35

wild-type protein levels according to Studentrsquos t-test with error probabilities of 5 and 1 1120

are indicated by and respectively 1121

1122

Figure 4 P700+ reduction kinetics and high-light effects in curT- cells A) Averaged traces 1123

(10 single measurements) of P700+ decay after complete oxidation by a 50-ms multiple 1124

turnover pulse (10000 micromol photons m-2 s-1) in the absence and presence of 10 microM DCMU 1125

B) Rate constants for P700+ reduction were obtained by fitting of the data with single1126

exponential functions Error bars indicate the SD of three independent measurements C) 1127

Impact of light intensity on the (relative) electron transport rate (rETR) Cells were exposed to 1128

gradually increasing light intensities which resulted in increasing electron transport until the 1129

capacity limit was reached PAR light intensity (micromol photons m-2 s-1) Error bars indicate the 1130

SD of three independent measurements D) D1 protein level in wild-type and curT- after high-1131

light treatment (800 micromol photons m-2s-1) in the presence and absence of lincomycin Samples 1132

were taken every 30 min and processed as in Figure 3 to determine the level of D1 present 1133

100 refers to wild-type D1 level at the beginning of the experiment 1134

1135

Figure 5 PSII assembly in curT- cells A) BNSDS-PAGE of membrane proteins Membrane 1136

fractions from wild-type and curT- cells were solubilized with 13 n-dodecyl-β-maltoside 1137

and proteins were fractionated by two-dimensional BNSDS-PAGE blotted and probed with 1138

antibodies against the PSII subunits D1 D2 CP47 and CP43 Wild-type blots were also 1139

probed with the αCurT antibody The sizes of marker proteins and the positions of PSII 1140

assembly intermediates (RCCII RCCI RC47) are shown above and below each image B) In 1141

vivo pulse labeling of membrane proteins with 35S Pulse-labeled PSII core proteins were 1142

separated via BNSDS-PAGE and visualized by autoradiography 1143

1144

Figure 6 Loss of CurT induces stress A) Low-temperature (77 K) fluorescence emission of 1145

Synechocystis 6803 wild-type (blue) and curT- (red) cells excited at 440 nm The spectra were 1146

normalized to the added fluorescein standard B) Low-temperature (77 K) fluorescence 1147

emission of Synechocystis 6803 wild-type (blue) and curT- (red) excited at 580 nm The 1148

spectra were normalized to 780 nm C) Level of IsiA in the curT- mutant relative to the wild-1149

type A mean value of 368 plusmn 96 (SD) was determined from three independent experiments 1150

1151

Figure 7 Membrane sublocalization of PSII-related factors Cell extracts from wild-type and 1152

curT- cells were fractionated by two consecutive rounds of sucrose-density gradient 1153

36

centrifugation (Schottkowski et al 2009b) The second linear gradient (20-60 sucrose) was 1154

apportioned into 14 fractions which were analyzed by immunoblotting using the indicated 1155

antibodies Fractions 1ndash6 represent PDMs and fractions 7ndash14 thylakoid membranes (TMs) 1156

To facilitate comparison between gradients sample volumes were normalized to the volume 1157

of fraction 7 that contained 40 microg of protein 1158

1159

Figure 8 Live-cell imaging of the curT-CFP strain by fluorescence microscopy In the curT-1160

CFP strain the native curT gene has been replaced by a CFP-tagged version resulting in the 1161

expression of the CurT-CFP fusion protein under the control of the native promotor A) 1162

Close-up views of the mid-cell plane in the CFP and far-red autofluorescence channels shown 1163

in slice 7 in panel B B) Synechocystis 6803 cells expressing CurT C-terminally fused to the 1164

mTurquoise2 variant of CFP from its native chromosomal promoter The two imaging 1165

channels are displayed as Z-axis montages (auto-scaled contrast step size 250 nm) in 1166

grayscale and color composite configuration The thylakoid autofluorescent channel as 1167

imaged in far-red fluorescence is depicted in magenta and CurT signal as imaged in cyan 1168

fluorescence is depicted in cyan C) Fluorescence intensity profiles of the two channels along 1169

the autofluorescent peripheral cell ldquoringrdquo are shown for slice 7 The maximum projection of 1170

the entire Z montage is also shown Scale bars (light grey) 2 microm 1171

1172

Figure 9 Immunofluorescence detection of CurT A) Close-ups of slice 5 in panel B B) 1173

Wild-type Synechocystis 6803 cells labeled with αCurT antibodies and detected with Oregon 1174

Green-conjugated secondary antibodies The Z-axis montages are shown as in Figure 8B 1175

except that the step size is 280 nm (1 to 10) C) Intensity profiles of the two channels along 1176

the autofluorescent peripheral cell ldquoringrdquo are shown for slice 5 The maximum projection of 1177

the entire Z montage is also shown Scale bars (light grey) 2 microm 1178

1179

Figure 10 Subcellular localization of CurT Ultrathin sections of wild-type Synechocystis 1180

6803 cells were incubated with rabbit αCurT prior to incubation with gold-conjugated goat 1181

anti-rabbit IgG A) Negative control (wild-type processed without addition of primary 1182

antibody) B C) Immunogold-labeled sections showing CurT localization at the cytoplasmic 1183

side of the thylakoid membrane D) Cluster formation of CurT signals at a putative biogenesis 1184

center from C E) Biogenesis center from the same cell (C) without any obvious CurT 1185

clustering of gold particles F) Schematic depiction of a wild-type cell (from Figure 2A) with 1186

color-coded curved membranes green = thylakoids that follow the curvature of the cell red = 1187

37

thylakoids that bend away from the plasma membrane yellow = thylakoids that bend toward 1188

the plasma membrane to converge on sites of biogenesis centers G) Relative distribution of 1189

gold signals between convex (dark color) and concave (light color) sides of membranes (n = 1190

1584 signals from a total of 95 cells) The undifferentiated overall signal distribution is given 1191

in blue Bars = 200 nm (overview) and 100 nm (details) 1192

1193

Figure 11 Differentially modified forms of CurT are found in different complexes in PDMs 1194

and thylakoid membranes Samples were isolated by fractionation of wild-type membranes 1195

via two consecutive sucrose density gradients according to Schottkowski et al (2009b) After 1196

density centrifugation samples were applied to BNSDS-PAGE analysis (A) or isoelectric 1197

focusing (B) Numbers on the right indicate the respective fraction from the second gradient 1198

(see Figure 7) Fraction 5 represents the PDMs and fraction 9 the thylakoid membrane 1199

1200

Figure 12 Loss of CurT increases sensitivity to abiotic stress A B) Doubling times of wild-1201

type and curT- under salt stress (A) or osmotic stress (B) Doubling times are means plusmn SD of 1202

three independent cultures C) Localization of CurT-CFP under salt and osmotic stress 1203

Samples were examined as described in Figure 8 Scale bars 1 microm D) Protein levels of wild-1204

type cells after growth in BG11 medium containing 500 mM NaCl Samples were analyzed on 1205

the same gel but unrelated samples between the presented signals were omitted E) 1206

Membrane preparations obtained from wild-type cells wild-type cells grown in the presence 1207

of 500 mM NaCl and curT- cells were subjected to the first gradient step in the membrane 1208

fractionation scheme The gradient was divided into five fractions and 10 of fractions I-IV 1209

and 02 of fraction V were analyzed by SDS-PAGE Fraction II includes the plasma 1210

membrane and fraction V consists of PratA-defined membrane and thylakoid membrane 1211

1212

Figure 13 Model of CurT distribution at convergence zones in Synechocystis 6803 The 1213

distribution of CurT in thylakoid (green) and plasma membranes (brown) is shown The 1214

pattern of localization of CurT in the thylakoid membrane is derived from membrane 1215

fractionation via sucrose density centrifugation fluorescence-based detection of the CurT-1216

CFP fusion and endogenous CurT and immunogold labeling experiments (Figures 7-10) The 1217

different CurT variants a b c and d identified in the IEF experiments (Figure 11) are depicted 1218

in yellow pink blue and black respectively CurT present in the plasma membrane is 1219

highlighted in gray as its precise nature and role remain to be defined (Figure 12) 1220

Membranes are represented as lipid bilayers Convex and concave faces of bent thylakoid 1221

38

sheets are indicated by black arrows The PDM which is dedicated to PSII assembly and 1222

repair is depicted in blue The dotted blue line emphasizes that the ultrastructure in this region 1223

has not yet been fully resolved PP periplasm PM plasma membrane TM thylakoid 1224

membrane L lumen PDM PratA-defined membrane 1225

1226

Tables 1227

Table 1 Physiological characteristics of the curT- mutant 1228

Strain Doubling time [h]

Oxygen Evolution[nmol h-1 OD750

-1]c

Chlorophyll content

[microg OD750-1]

d

Cell size [microm]e

Cell number [ml-1 OD750

-1]f

Wild type 817plusmn017a 1600plusmn042

b 1933plusmn187 251plusmn014 264plusmn020 390plusmn006 x 107

curT- 1259plusmn020a 3226plusmn056

b 1074plusmn20 195plusmn029 274plusmn044 367plusmn016 x 107

1229 abDoubling times in the presence (a) or absence (b) of 5 mM glucose measured under 1230

continuous illumination at 30 micromol photons m-2 s-1 and CO2-limiting conditions cOxygen 1231

evolution is expressed in nmol O2 produced per hour per OD750 unit dChlorophyll content is 1232

expressed in microg OD750-1 eThe diameter of non-dividing cells is presented in microm fCell number 1233

was determined per ml per OD750 Data are means plusmn SD of at least three independent 1234

experiments 1235

1236

Parsed CitationsAllen JF de Paula WBM Puthiyaveetil S and Nield J (2011) A structural phylogenetic map for chloroplast photosynthesisTrends Plant Sci 16 645-655

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Anderson JM Horton P Kim E-H and Chow WS (2012) Towards elucidation of dynamic structural changes of plant thylakoidarchitecture Philos Trans R Soc Lond B Biol Sci 367 3515-3524

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Armbruster U Zuumlhlke J Rengstl B Kreller R Makarenko E Ruumlhle T Schuumlnemann D Jahns P Weisshaar B NickelsenJ and Leister D (2010) The Arabidopsis thylakoid protein PAM68 is required for efficient D1 biogenesis and photosystem IIassembly Plant Cell 22 3439-3460

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Armbruster U Labs M Pribil M Viola S Xu W Scharfenberg M Hertle AP Rojahn U Jensen PE Rappaport F JoliotP Doumlrmann P Wanner G and Leister D (2013) Arabidopsis CURVATURE THYLAKOID1 proteins modify thylakoid architectureby inducing membrane curvature Plant Cell 25 2661-2678

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Aseeva E Ossenbuumlhl F Sippel C Cho WK Stein B Eichacker LA Meurer J Wanner G Westhoff P Soll J andVothknecht UC (2007) Vipp1 is required for basic thylakoid membrane formation but not for the assembly of thylakoid proteincomplexes Plant Physiol Biochem 45 119-128

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Bartsevich VV and Pakrasi HB (1995) Molecular identification of an ABC transporter complex for manganese analysis of acyanobacterial mutant strain impaired in the photosynthetic oxygen evolution process EMBO J 14 1845-1853

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Bartsevich VV and Pakrasi HB (1996) Manganese transport in the cyanobacterium Synechocystis sp PCC 6803 J Biol Chem271 26057-26061

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Bernaacutet G Waschewski N and Roumlgner M (2009) Towards efficient hydrogen production the impact of antenna size andexternal factors on electron transport dynamics in Synechocystis PCC 6803 Photosynth Res 99 205-216

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Boehm M Yu J Krynicka V Barker M Tichy M Komenda J Nixon PJ and Nield J (2012) Subunit Organization of aSynechocystis Hetero-Oligomeric Thylakoid FtsH Complex Involved in Photosystem II Repair Plant Cell 24 3669-3683

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Bradford MM (1976) A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle ofprotein-dye binding Anal Biochem 72 248-254

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Chang L Liu X Li Y Liu C-C Yang F Zhao J and Sui S-F (2015) Structural organization of an intact phycobilisome and itsassociation with photosystem II Cell Res 25 726-737

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Danielsson R Suorsa M Paakkarinen V Albertsson P-Aring Styring S Aro E-M and Mamedov F (2006) Dimeric andmonomeric organization of photosystem II Distribution of five distinct complexes in the different domains of the thylakoidmembrane J Biol Chem 281 14241-14249

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Daum B Nicastro D Austin J McIntosh JR and Kuumlhlbrandt W (2010) Arrangement of photosystem II and ATP synthase in

35

wild-type protein levels according to Studentrsquos t-test with error probabilities of 5 and 1 1120

are indicated by and respectively 1121

1122

Figure 4 P700+ reduction kinetics and high-light effects in curT- cells A) Averaged traces 1123

(10 single measurements) of P700+ decay after complete oxidation by a 50-ms multiple 1124

turnover pulse (10000 micromol photons m-2 s-1) in the absence and presence of 10 microM DCMU 1125

B) Rate constants for P700+ reduction were obtained by fitting of the data with single1126

exponential functions Error bars indicate the SD of three independent measurements C) 1127

Impact of light intensity on the (relative) electron transport rate (rETR) Cells were exposed to 1128

gradually increasing light intensities which resulted in increasing electron transport until the 1129

capacity limit was reached PAR light intensity (micromol photons m-2 s-1) Error bars indicate the 1130

SD of three independent measurements D) D1 protein level in wild-type and curT- after high-1131

light treatment (800 micromol photons m-2s-1) in the presence and absence of lincomycin Samples 1132

were taken every 30 min and processed as in Figure 3 to determine the level of D1 present 1133

100 refers to wild-type D1 level at the beginning of the experiment 1134

1135

Figure 5 PSII assembly in curT- cells A) BNSDS-PAGE of membrane proteins Membrane 1136

fractions from wild-type and curT- cells were solubilized with 13 n-dodecyl-β-maltoside 1137

and proteins were fractionated by two-dimensional BNSDS-PAGE blotted and probed with 1138

antibodies against the PSII subunits D1 D2 CP47 and CP43 Wild-type blots were also 1139

probed with the αCurT antibody The sizes of marker proteins and the positions of PSII 1140

assembly intermediates (RCCII RCCI RC47) are shown above and below each image B) In 1141

vivo pulse labeling of membrane proteins with 35S Pulse-labeled PSII core proteins were 1142

separated via BNSDS-PAGE and visualized by autoradiography 1143

1144

Figure 6 Loss of CurT induces stress A) Low-temperature (77 K) fluorescence emission of 1145

Synechocystis 6803 wild-type (blue) and curT- (red) cells excited at 440 nm The spectra were 1146

normalized to the added fluorescein standard B) Low-temperature (77 K) fluorescence 1147

emission of Synechocystis 6803 wild-type (blue) and curT- (red) excited at 580 nm The 1148

spectra were normalized to 780 nm C) Level of IsiA in the curT- mutant relative to the wild-1149

type A mean value of 368 plusmn 96 (SD) was determined from three independent experiments 1150

1151

Figure 7 Membrane sublocalization of PSII-related factors Cell extracts from wild-type and 1152

curT- cells were fractionated by two consecutive rounds of sucrose-density gradient 1153

36

centrifugation (Schottkowski et al 2009b) The second linear gradient (20-60 sucrose) was 1154

apportioned into 14 fractions which were analyzed by immunoblotting using the indicated 1155

antibodies Fractions 1ndash6 represent PDMs and fractions 7ndash14 thylakoid membranes (TMs) 1156

To facilitate comparison between gradients sample volumes were normalized to the volume 1157

of fraction 7 that contained 40 microg of protein 1158

1159

Figure 8 Live-cell imaging of the curT-CFP strain by fluorescence microscopy In the curT-1160

CFP strain the native curT gene has been replaced by a CFP-tagged version resulting in the 1161

expression of the CurT-CFP fusion protein under the control of the native promotor A) 1162

Close-up views of the mid-cell plane in the CFP and far-red autofluorescence channels shown 1163

in slice 7 in panel B B) Synechocystis 6803 cells expressing CurT C-terminally fused to the 1164

mTurquoise2 variant of CFP from its native chromosomal promoter The two imaging 1165

channels are displayed as Z-axis montages (auto-scaled contrast step size 250 nm) in 1166

grayscale and color composite configuration The thylakoid autofluorescent channel as 1167

imaged in far-red fluorescence is depicted in magenta and CurT signal as imaged in cyan 1168

fluorescence is depicted in cyan C) Fluorescence intensity profiles of the two channels along 1169

the autofluorescent peripheral cell ldquoringrdquo are shown for slice 7 The maximum projection of 1170

the entire Z montage is also shown Scale bars (light grey) 2 microm 1171

1172

Figure 9 Immunofluorescence detection of CurT A) Close-ups of slice 5 in panel B B) 1173

Wild-type Synechocystis 6803 cells labeled with αCurT antibodies and detected with Oregon 1174

Green-conjugated secondary antibodies The Z-axis montages are shown as in Figure 8B 1175

except that the step size is 280 nm (1 to 10) C) Intensity profiles of the two channels along 1176

the autofluorescent peripheral cell ldquoringrdquo are shown for slice 5 The maximum projection of 1177

the entire Z montage is also shown Scale bars (light grey) 2 microm 1178

1179

Figure 10 Subcellular localization of CurT Ultrathin sections of wild-type Synechocystis 1180

6803 cells were incubated with rabbit αCurT prior to incubation with gold-conjugated goat 1181

anti-rabbit IgG A) Negative control (wild-type processed without addition of primary 1182

antibody) B C) Immunogold-labeled sections showing CurT localization at the cytoplasmic 1183

side of the thylakoid membrane D) Cluster formation of CurT signals at a putative biogenesis 1184

center from C E) Biogenesis center from the same cell (C) without any obvious CurT 1185

clustering of gold particles F) Schematic depiction of a wild-type cell (from Figure 2A) with 1186

color-coded curved membranes green = thylakoids that follow the curvature of the cell red = 1187

37

thylakoids that bend away from the plasma membrane yellow = thylakoids that bend toward 1188

the plasma membrane to converge on sites of biogenesis centers G) Relative distribution of 1189

gold signals between convex (dark color) and concave (light color) sides of membranes (n = 1190

1584 signals from a total of 95 cells) The undifferentiated overall signal distribution is given 1191

in blue Bars = 200 nm (overview) and 100 nm (details) 1192

1193

Figure 11 Differentially modified forms of CurT are found in different complexes in PDMs 1194

and thylakoid membranes Samples were isolated by fractionation of wild-type membranes 1195

via two consecutive sucrose density gradients according to Schottkowski et al (2009b) After 1196

density centrifugation samples were applied to BNSDS-PAGE analysis (A) or isoelectric 1197

focusing (B) Numbers on the right indicate the respective fraction from the second gradient 1198

(see Figure 7) Fraction 5 represents the PDMs and fraction 9 the thylakoid membrane 1199

1200

Figure 12 Loss of CurT increases sensitivity to abiotic stress A B) Doubling times of wild-1201

type and curT- under salt stress (A) or osmotic stress (B) Doubling times are means plusmn SD of 1202

three independent cultures C) Localization of CurT-CFP under salt and osmotic stress 1203

Samples were examined as described in Figure 8 Scale bars 1 microm D) Protein levels of wild-1204

type cells after growth in BG11 medium containing 500 mM NaCl Samples were analyzed on 1205

the same gel but unrelated samples between the presented signals were omitted E) 1206

Membrane preparations obtained from wild-type cells wild-type cells grown in the presence 1207

of 500 mM NaCl and curT- cells were subjected to the first gradient step in the membrane 1208

fractionation scheme The gradient was divided into five fractions and 10 of fractions I-IV 1209

and 02 of fraction V were analyzed by SDS-PAGE Fraction II includes the plasma 1210

membrane and fraction V consists of PratA-defined membrane and thylakoid membrane 1211

1212

Figure 13 Model of CurT distribution at convergence zones in Synechocystis 6803 The 1213

distribution of CurT in thylakoid (green) and plasma membranes (brown) is shown The 1214

pattern of localization of CurT in the thylakoid membrane is derived from membrane 1215

fractionation via sucrose density centrifugation fluorescence-based detection of the CurT-1216

CFP fusion and endogenous CurT and immunogold labeling experiments (Figures 7-10) The 1217

different CurT variants a b c and d identified in the IEF experiments (Figure 11) are depicted 1218

in yellow pink blue and black respectively CurT present in the plasma membrane is 1219

highlighted in gray as its precise nature and role remain to be defined (Figure 12) 1220

Membranes are represented as lipid bilayers Convex and concave faces of bent thylakoid 1221

38

sheets are indicated by black arrows The PDM which is dedicated to PSII assembly and 1222

repair is depicted in blue The dotted blue line emphasizes that the ultrastructure in this region 1223

has not yet been fully resolved PP periplasm PM plasma membrane TM thylakoid 1224

membrane L lumen PDM PratA-defined membrane 1225

1226

Tables 1227

Table 1 Physiological characteristics of the curT- mutant 1228

Strain Doubling time [h]

Oxygen Evolution[nmol h-1 OD750

-1]c

Chlorophyll content

[microg OD750-1]

d

Cell size [microm]e

Cell number [ml-1 OD750

-1]f

Wild type 817plusmn017a 1600plusmn042

b 1933plusmn187 251plusmn014 264plusmn020 390plusmn006 x 107

curT- 1259plusmn020a 3226plusmn056

b 1074plusmn20 195plusmn029 274plusmn044 367plusmn016 x 107

1229 abDoubling times in the presence (a) or absence (b) of 5 mM glucose measured under 1230

continuous illumination at 30 micromol photons m-2 s-1 and CO2-limiting conditions cOxygen 1231

evolution is expressed in nmol O2 produced per hour per OD750 unit dChlorophyll content is 1232

expressed in microg OD750-1 eThe diameter of non-dividing cells is presented in microm fCell number 1233

was determined per ml per OD750 Data are means plusmn SD of at least three independent 1234

experiments 1235

1236

Parsed CitationsAllen JF de Paula WBM Puthiyaveetil S and Nield J (2011) A structural phylogenetic map for chloroplast photosynthesisTrends Plant Sci 16 645-655

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Anderson JM Horton P Kim E-H and Chow WS (2012) Towards elucidation of dynamic structural changes of plant thylakoidarchitecture Philos Trans R Soc Lond B Biol Sci 367 3515-3524

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Armbruster U Zuumlhlke J Rengstl B Kreller R Makarenko E Ruumlhle T Schuumlnemann D Jahns P Weisshaar B NickelsenJ and Leister D (2010) The Arabidopsis thylakoid protein PAM68 is required for efficient D1 biogenesis and photosystem IIassembly Plant Cell 22 3439-3460

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Armbruster U Labs M Pribil M Viola S Xu W Scharfenberg M Hertle AP Rojahn U Jensen PE Rappaport F JoliotP Doumlrmann P Wanner G and Leister D (2013) Arabidopsis CURVATURE THYLAKOID1 proteins modify thylakoid architectureby inducing membrane curvature Plant Cell 25 2661-2678

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Aseeva E Ossenbuumlhl F Sippel C Cho WK Stein B Eichacker LA Meurer J Wanner G Westhoff P Soll J andVothknecht UC (2007) Vipp1 is required for basic thylakoid membrane formation but not for the assembly of thylakoid proteincomplexes Plant Physiol Biochem 45 119-128

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Bartsevich VV and Pakrasi HB (1995) Molecular identification of an ABC transporter complex for manganese analysis of acyanobacterial mutant strain impaired in the photosynthetic oxygen evolution process EMBO J 14 1845-1853

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Bartsevich VV and Pakrasi HB (1996) Manganese transport in the cyanobacterium Synechocystis sp PCC 6803 J Biol Chem271 26057-26061

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Bernaacutet G Waschewski N and Roumlgner M (2009) Towards efficient hydrogen production the impact of antenna size andexternal factors on electron transport dynamics in Synechocystis PCC 6803 Photosynth Res 99 205-216

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Boehm M Yu J Krynicka V Barker M Tichy M Komenda J Nixon PJ and Nield J (2012) Subunit Organization of aSynechocystis Hetero-Oligomeric Thylakoid FtsH Complex Involved in Photosystem II Repair Plant Cell 24 3669-3683

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Bradford MM (1976) A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle ofprotein-dye binding Anal Biochem 72 248-254

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Chang L Liu X Li Y Liu C-C Yang F Zhao J and Sui S-F (2015) Structural organization of an intact phycobilisome and itsassociation with photosystem II Cell Res 25 726-737

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Danielsson R Suorsa M Paakkarinen V Albertsson P-Aring Styring S Aro E-M and Mamedov F (2006) Dimeric andmonomeric organization of photosystem II Distribution of five distinct complexes in the different domains of the thylakoidmembrane J Biol Chem 281 14241-14249

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Daum B Nicastro D Austin J McIntosh JR and Kuumlhlbrandt W (2010) Arrangement of photosystem II and ATP synthase in

36

centrifugation (Schottkowski et al 2009b) The second linear gradient (20-60 sucrose) was 1154

apportioned into 14 fractions which were analyzed by immunoblotting using the indicated 1155

antibodies Fractions 1ndash6 represent PDMs and fractions 7ndash14 thylakoid membranes (TMs) 1156

To facilitate comparison between gradients sample volumes were normalized to the volume 1157

of fraction 7 that contained 40 microg of protein 1158

1159

Figure 8 Live-cell imaging of the curT-CFP strain by fluorescence microscopy In the curT-1160

CFP strain the native curT gene has been replaced by a CFP-tagged version resulting in the 1161

expression of the CurT-CFP fusion protein under the control of the native promotor A) 1162

Close-up views of the mid-cell plane in the CFP and far-red autofluorescence channels shown 1163

in slice 7 in panel B B) Synechocystis 6803 cells expressing CurT C-terminally fused to the 1164

mTurquoise2 variant of CFP from its native chromosomal promoter The two imaging 1165

channels are displayed as Z-axis montages (auto-scaled contrast step size 250 nm) in 1166

grayscale and color composite configuration The thylakoid autofluorescent channel as 1167

imaged in far-red fluorescence is depicted in magenta and CurT signal as imaged in cyan 1168

fluorescence is depicted in cyan C) Fluorescence intensity profiles of the two channels along 1169

the autofluorescent peripheral cell ldquoringrdquo are shown for slice 7 The maximum projection of 1170

the entire Z montage is also shown Scale bars (light grey) 2 microm 1171

1172

Figure 9 Immunofluorescence detection of CurT A) Close-ups of slice 5 in panel B B) 1173

Wild-type Synechocystis 6803 cells labeled with αCurT antibodies and detected with Oregon 1174

Green-conjugated secondary antibodies The Z-axis montages are shown as in Figure 8B 1175

except that the step size is 280 nm (1 to 10) C) Intensity profiles of the two channels along 1176

the autofluorescent peripheral cell ldquoringrdquo are shown for slice 5 The maximum projection of 1177

the entire Z montage is also shown Scale bars (light grey) 2 microm 1178

1179

Figure 10 Subcellular localization of CurT Ultrathin sections of wild-type Synechocystis 1180

6803 cells were incubated with rabbit αCurT prior to incubation with gold-conjugated goat 1181

anti-rabbit IgG A) Negative control (wild-type processed without addition of primary 1182

antibody) B C) Immunogold-labeled sections showing CurT localization at the cytoplasmic 1183

side of the thylakoid membrane D) Cluster formation of CurT signals at a putative biogenesis 1184

center from C E) Biogenesis center from the same cell (C) without any obvious CurT 1185

clustering of gold particles F) Schematic depiction of a wild-type cell (from Figure 2A) with 1186

color-coded curved membranes green = thylakoids that follow the curvature of the cell red = 1187

37

thylakoids that bend away from the plasma membrane yellow = thylakoids that bend toward 1188

the plasma membrane to converge on sites of biogenesis centers G) Relative distribution of 1189

gold signals between convex (dark color) and concave (light color) sides of membranes (n = 1190

1584 signals from a total of 95 cells) The undifferentiated overall signal distribution is given 1191

in blue Bars = 200 nm (overview) and 100 nm (details) 1192

1193

Figure 11 Differentially modified forms of CurT are found in different complexes in PDMs 1194

and thylakoid membranes Samples were isolated by fractionation of wild-type membranes 1195

via two consecutive sucrose density gradients according to Schottkowski et al (2009b) After 1196

density centrifugation samples were applied to BNSDS-PAGE analysis (A) or isoelectric 1197

focusing (B) Numbers on the right indicate the respective fraction from the second gradient 1198

(see Figure 7) Fraction 5 represents the PDMs and fraction 9 the thylakoid membrane 1199

1200

Figure 12 Loss of CurT increases sensitivity to abiotic stress A B) Doubling times of wild-1201

type and curT- under salt stress (A) or osmotic stress (B) Doubling times are means plusmn SD of 1202

three independent cultures C) Localization of CurT-CFP under salt and osmotic stress 1203

Samples were examined as described in Figure 8 Scale bars 1 microm D) Protein levels of wild-1204

type cells after growth in BG11 medium containing 500 mM NaCl Samples were analyzed on 1205

the same gel but unrelated samples between the presented signals were omitted E) 1206

Membrane preparations obtained from wild-type cells wild-type cells grown in the presence 1207

of 500 mM NaCl and curT- cells were subjected to the first gradient step in the membrane 1208

fractionation scheme The gradient was divided into five fractions and 10 of fractions I-IV 1209

and 02 of fraction V were analyzed by SDS-PAGE Fraction II includes the plasma 1210

membrane and fraction V consists of PratA-defined membrane and thylakoid membrane 1211

1212

Figure 13 Model of CurT distribution at convergence zones in Synechocystis 6803 The 1213

distribution of CurT in thylakoid (green) and plasma membranes (brown) is shown The 1214

pattern of localization of CurT in the thylakoid membrane is derived from membrane 1215

fractionation via sucrose density centrifugation fluorescence-based detection of the CurT-1216

CFP fusion and endogenous CurT and immunogold labeling experiments (Figures 7-10) The 1217

different CurT variants a b c and d identified in the IEF experiments (Figure 11) are depicted 1218

in yellow pink blue and black respectively CurT present in the plasma membrane is 1219

highlighted in gray as its precise nature and role remain to be defined (Figure 12) 1220

Membranes are represented as lipid bilayers Convex and concave faces of bent thylakoid 1221

38

sheets are indicated by black arrows The PDM which is dedicated to PSII assembly and 1222

repair is depicted in blue The dotted blue line emphasizes that the ultrastructure in this region 1223

has not yet been fully resolved PP periplasm PM plasma membrane TM thylakoid 1224

membrane L lumen PDM PratA-defined membrane 1225

1226

Tables 1227

Table 1 Physiological characteristics of the curT- mutant 1228

Strain Doubling time [h]

Oxygen Evolution[nmol h-1 OD750

-1]c

Chlorophyll content

[microg OD750-1]

d

Cell size [microm]e

Cell number [ml-1 OD750

-1]f

Wild type 817plusmn017a 1600plusmn042

b 1933plusmn187 251plusmn014 264plusmn020 390plusmn006 x 107

curT- 1259plusmn020a 3226plusmn056

b 1074plusmn20 195plusmn029 274plusmn044 367plusmn016 x 107

1229 abDoubling times in the presence (a) or absence (b) of 5 mM glucose measured under 1230

continuous illumination at 30 micromol photons m-2 s-1 and CO2-limiting conditions cOxygen 1231

evolution is expressed in nmol O2 produced per hour per OD750 unit dChlorophyll content is 1232

expressed in microg OD750-1 eThe diameter of non-dividing cells is presented in microm fCell number 1233

was determined per ml per OD750 Data are means plusmn SD of at least three independent 1234

experiments 1235

1236

Parsed CitationsAllen JF de Paula WBM Puthiyaveetil S and Nield J (2011) A structural phylogenetic map for chloroplast photosynthesisTrends Plant Sci 16 645-655

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Anderson JM Horton P Kim E-H and Chow WS (2012) Towards elucidation of dynamic structural changes of plant thylakoidarchitecture Philos Trans R Soc Lond B Biol Sci 367 3515-3524

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Armbruster U Zuumlhlke J Rengstl B Kreller R Makarenko E Ruumlhle T Schuumlnemann D Jahns P Weisshaar B NickelsenJ and Leister D (2010) The Arabidopsis thylakoid protein PAM68 is required for efficient D1 biogenesis and photosystem IIassembly Plant Cell 22 3439-3460

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Armbruster U Labs M Pribil M Viola S Xu W Scharfenberg M Hertle AP Rojahn U Jensen PE Rappaport F JoliotP Doumlrmann P Wanner G and Leister D (2013) Arabidopsis CURVATURE THYLAKOID1 proteins modify thylakoid architectureby inducing membrane curvature Plant Cell 25 2661-2678

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Aseeva E Ossenbuumlhl F Sippel C Cho WK Stein B Eichacker LA Meurer J Wanner G Westhoff P Soll J andVothknecht UC (2007) Vipp1 is required for basic thylakoid membrane formation but not for the assembly of thylakoid proteincomplexes Plant Physiol Biochem 45 119-128

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Bartsevich VV and Pakrasi HB (1995) Molecular identification of an ABC transporter complex for manganese analysis of acyanobacterial mutant strain impaired in the photosynthetic oxygen evolution process EMBO J 14 1845-1853

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Bartsevich VV and Pakrasi HB (1996) Manganese transport in the cyanobacterium Synechocystis sp PCC 6803 J Biol Chem271 26057-26061

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Bernaacutet G Waschewski N and Roumlgner M (2009) Towards efficient hydrogen production the impact of antenna size andexternal factors on electron transport dynamics in Synechocystis PCC 6803 Photosynth Res 99 205-216

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Boehm M Yu J Krynicka V Barker M Tichy M Komenda J Nixon PJ and Nield J (2012) Subunit Organization of aSynechocystis Hetero-Oligomeric Thylakoid FtsH Complex Involved in Photosystem II Repair Plant Cell 24 3669-3683

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Bradford MM (1976) A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle ofprotein-dye binding Anal Biochem 72 248-254

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Chang L Liu X Li Y Liu C-C Yang F Zhao J and Sui S-F (2015) Structural organization of an intact phycobilisome and itsassociation with photosystem II Cell Res 25 726-737

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Danielsson R Suorsa M Paakkarinen V Albertsson P-Aring Styring S Aro E-M and Mamedov F (2006) Dimeric andmonomeric organization of photosystem II Distribution of five distinct complexes in the different domains of the thylakoidmembrane J Biol Chem 281 14241-14249

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Daum B Nicastro D Austin J McIntosh JR and Kuumlhlbrandt W (2010) Arrangement of photosystem II and ATP synthase in

37

thylakoids that bend away from the plasma membrane yellow = thylakoids that bend toward 1188

the plasma membrane to converge on sites of biogenesis centers G) Relative distribution of 1189

gold signals between convex (dark color) and concave (light color) sides of membranes (n = 1190

1584 signals from a total of 95 cells) The undifferentiated overall signal distribution is given 1191

in blue Bars = 200 nm (overview) and 100 nm (details) 1192

1193

Figure 11 Differentially modified forms of CurT are found in different complexes in PDMs 1194

and thylakoid membranes Samples were isolated by fractionation of wild-type membranes 1195

via two consecutive sucrose density gradients according to Schottkowski et al (2009b) After 1196

density centrifugation samples were applied to BNSDS-PAGE analysis (A) or isoelectric 1197

focusing (B) Numbers on the right indicate the respective fraction from the second gradient 1198

(see Figure 7) Fraction 5 represents the PDMs and fraction 9 the thylakoid membrane 1199

1200

Figure 12 Loss of CurT increases sensitivity to abiotic stress A B) Doubling times of wild-1201

type and curT- under salt stress (A) or osmotic stress (B) Doubling times are means plusmn SD of 1202

three independent cultures C) Localization of CurT-CFP under salt and osmotic stress 1203

Samples were examined as described in Figure 8 Scale bars 1 microm D) Protein levels of wild-1204

type cells after growth in BG11 medium containing 500 mM NaCl Samples were analyzed on 1205

the same gel but unrelated samples between the presented signals were omitted E) 1206

Membrane preparations obtained from wild-type cells wild-type cells grown in the presence 1207

of 500 mM NaCl and curT- cells were subjected to the first gradient step in the membrane 1208

fractionation scheme The gradient was divided into five fractions and 10 of fractions I-IV 1209

and 02 of fraction V were analyzed by SDS-PAGE Fraction II includes the plasma 1210

membrane and fraction V consists of PratA-defined membrane and thylakoid membrane 1211

1212

Figure 13 Model of CurT distribution at convergence zones in Synechocystis 6803 The 1213

distribution of CurT in thylakoid (green) and plasma membranes (brown) is shown The 1214

pattern of localization of CurT in the thylakoid membrane is derived from membrane 1215

fractionation via sucrose density centrifugation fluorescence-based detection of the CurT-1216

CFP fusion and endogenous CurT and immunogold labeling experiments (Figures 7-10) The 1217

different CurT variants a b c and d identified in the IEF experiments (Figure 11) are depicted 1218

in yellow pink blue and black respectively CurT present in the plasma membrane is 1219

highlighted in gray as its precise nature and role remain to be defined (Figure 12) 1220

Membranes are represented as lipid bilayers Convex and concave faces of bent thylakoid 1221

38

sheets are indicated by black arrows The PDM which is dedicated to PSII assembly and 1222

repair is depicted in blue The dotted blue line emphasizes that the ultrastructure in this region 1223

has not yet been fully resolved PP periplasm PM plasma membrane TM thylakoid 1224

membrane L lumen PDM PratA-defined membrane 1225

1226

Tables 1227

Table 1 Physiological characteristics of the curT- mutant 1228

Strain Doubling time [h]

Oxygen Evolution[nmol h-1 OD750

-1]c

Chlorophyll content

[microg OD750-1]

d

Cell size [microm]e

Cell number [ml-1 OD750

-1]f

Wild type 817plusmn017a 1600plusmn042

b 1933plusmn187 251plusmn014 264plusmn020 390plusmn006 x 107

curT- 1259plusmn020a 3226plusmn056

b 1074plusmn20 195plusmn029 274plusmn044 367plusmn016 x 107

1229 abDoubling times in the presence (a) or absence (b) of 5 mM glucose measured under 1230

continuous illumination at 30 micromol photons m-2 s-1 and CO2-limiting conditions cOxygen 1231

evolution is expressed in nmol O2 produced per hour per OD750 unit dChlorophyll content is 1232

expressed in microg OD750-1 eThe diameter of non-dividing cells is presented in microm fCell number 1233

was determined per ml per OD750 Data are means plusmn SD of at least three independent 1234

experiments 1235

1236

Parsed CitationsAllen JF de Paula WBM Puthiyaveetil S and Nield J (2011) A structural phylogenetic map for chloroplast photosynthesisTrends Plant Sci 16 645-655

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Anderson JM Horton P Kim E-H and Chow WS (2012) Towards elucidation of dynamic structural changes of plant thylakoidarchitecture Philos Trans R Soc Lond B Biol Sci 367 3515-3524

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Armbruster U Zuumlhlke J Rengstl B Kreller R Makarenko E Ruumlhle T Schuumlnemann D Jahns P Weisshaar B NickelsenJ and Leister D (2010) The Arabidopsis thylakoid protein PAM68 is required for efficient D1 biogenesis and photosystem IIassembly Plant Cell 22 3439-3460

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Armbruster U Labs M Pribil M Viola S Xu W Scharfenberg M Hertle AP Rojahn U Jensen PE Rappaport F JoliotP Doumlrmann P Wanner G and Leister D (2013) Arabidopsis CURVATURE THYLAKOID1 proteins modify thylakoid architectureby inducing membrane curvature Plant Cell 25 2661-2678

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Aseeva E Ossenbuumlhl F Sippel C Cho WK Stein B Eichacker LA Meurer J Wanner G Westhoff P Soll J andVothknecht UC (2007) Vipp1 is required for basic thylakoid membrane formation but not for the assembly of thylakoid proteincomplexes Plant Physiol Biochem 45 119-128

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Bartsevich VV and Pakrasi HB (1995) Molecular identification of an ABC transporter complex for manganese analysis of acyanobacterial mutant strain impaired in the photosynthetic oxygen evolution process EMBO J 14 1845-1853

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Bartsevich VV and Pakrasi HB (1996) Manganese transport in the cyanobacterium Synechocystis sp PCC 6803 J Biol Chem271 26057-26061

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Bernaacutet G Waschewski N and Roumlgner M (2009) Towards efficient hydrogen production the impact of antenna size andexternal factors on electron transport dynamics in Synechocystis PCC 6803 Photosynth Res 99 205-216

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Boehm M Yu J Krynicka V Barker M Tichy M Komenda J Nixon PJ and Nield J (2012) Subunit Organization of aSynechocystis Hetero-Oligomeric Thylakoid FtsH Complex Involved in Photosystem II Repair Plant Cell 24 3669-3683

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Bradford MM (1976) A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle ofprotein-dye binding Anal Biochem 72 248-254

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Chang L Liu X Li Y Liu C-C Yang F Zhao J and Sui S-F (2015) Structural organization of an intact phycobilisome and itsassociation with photosystem II Cell Res 25 726-737

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Danielsson R Suorsa M Paakkarinen V Albertsson P-Aring Styring S Aro E-M and Mamedov F (2006) Dimeric andmonomeric organization of photosystem II Distribution of five distinct complexes in the different domains of the thylakoidmembrane J Biol Chem 281 14241-14249

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Daum B Nicastro D Austin J McIntosh JR and Kuumlhlbrandt W (2010) Arrangement of photosystem II and ATP synthase in

38

sheets are indicated by black arrows The PDM which is dedicated to PSII assembly and 1222

repair is depicted in blue The dotted blue line emphasizes that the ultrastructure in this region 1223

has not yet been fully resolved PP periplasm PM plasma membrane TM thylakoid 1224

membrane L lumen PDM PratA-defined membrane 1225

1226

Tables 1227

Table 1 Physiological characteristics of the curT- mutant 1228

Strain Doubling time [h]

Oxygen Evolution[nmol h-1 OD750

-1]c

Chlorophyll content

[microg OD750-1]

d

Cell size [microm]e

Cell number [ml-1 OD750

-1]f

Wild type 817plusmn017a 1600plusmn042

b 1933plusmn187 251plusmn014 264plusmn020 390plusmn006 x 107

curT- 1259plusmn020a 3226plusmn056

b 1074plusmn20 195plusmn029 274plusmn044 367plusmn016 x 107

1229 abDoubling times in the presence (a) or absence (b) of 5 mM glucose measured under 1230

continuous illumination at 30 micromol photons m-2 s-1 and CO2-limiting conditions cOxygen 1231

evolution is expressed in nmol O2 produced per hour per OD750 unit dChlorophyll content is 1232

expressed in microg OD750-1 eThe diameter of non-dividing cells is presented in microm fCell number 1233

was determined per ml per OD750 Data are means plusmn SD of at least three independent 1234

experiments 1235

1236

Parsed CitationsAllen JF de Paula WBM Puthiyaveetil S and Nield J (2011) A structural phylogenetic map for chloroplast photosynthesisTrends Plant Sci 16 645-655

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Anderson JM Horton P Kim E-H and Chow WS (2012) Towards elucidation of dynamic structural changes of plant thylakoidarchitecture Philos Trans R Soc Lond B Biol Sci 367 3515-3524

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Armbruster U Zuumlhlke J Rengstl B Kreller R Makarenko E Ruumlhle T Schuumlnemann D Jahns P Weisshaar B NickelsenJ and Leister D (2010) The Arabidopsis thylakoid protein PAM68 is required for efficient D1 biogenesis and photosystem IIassembly Plant Cell 22 3439-3460

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Armbruster U Labs M Pribil M Viola S Xu W Scharfenberg M Hertle AP Rojahn U Jensen PE Rappaport F JoliotP Doumlrmann P Wanner G and Leister D (2013) Arabidopsis CURVATURE THYLAKOID1 proteins modify thylakoid architectureby inducing membrane curvature Plant Cell 25 2661-2678

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Aseeva E Ossenbuumlhl F Sippel C Cho WK Stein B Eichacker LA Meurer J Wanner G Westhoff P Soll J andVothknecht UC (2007) Vipp1 is required for basic thylakoid membrane formation but not for the assembly of thylakoid proteincomplexes Plant Physiol Biochem 45 119-128

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Bartsevich VV and Pakrasi HB (1995) Molecular identification of an ABC transporter complex for manganese analysis of acyanobacterial mutant strain impaired in the photosynthetic oxygen evolution process EMBO J 14 1845-1853

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Bartsevich VV and Pakrasi HB (1996) Manganese transport in the cyanobacterium Synechocystis sp PCC 6803 J Biol Chem271 26057-26061

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Bernaacutet G Waschewski N and Roumlgner M (2009) Towards efficient hydrogen production the impact of antenna size andexternal factors on electron transport dynamics in Synechocystis PCC 6803 Photosynth Res 99 205-216

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Boehm M Yu J Krynicka V Barker M Tichy M Komenda J Nixon PJ and Nield J (2012) Subunit Organization of aSynechocystis Hetero-Oligomeric Thylakoid FtsH Complex Involved in Photosystem II Repair Plant Cell 24 3669-3683

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Bradford MM (1976) A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle ofprotein-dye binding Anal Biochem 72 248-254

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Chang L Liu X Li Y Liu C-C Yang F Zhao J and Sui S-F (2015) Structural organization of an intact phycobilisome and itsassociation with photosystem II Cell Res 25 726-737

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Danielsson R Suorsa M Paakkarinen V Albertsson P-Aring Styring S Aro E-M and Mamedov F (2006) Dimeric andmonomeric organization of photosystem II Distribution of five distinct complexes in the different domains of the thylakoidmembrane J Biol Chem 281 14241-14249

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Daum B Nicastro D Austin J McIntosh JR and Kuumlhlbrandt W (2010) Arrangement of photosystem II and ATP synthase in

Parsed CitationsAllen JF de Paula WBM Puthiyaveetil S and Nield J (2011) A structural phylogenetic map for chloroplast photosynthesisTrends Plant Sci 16 645-655

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Anderson JM Horton P Kim E-H and Chow WS (2012) Towards elucidation of dynamic structural changes of plant thylakoidarchitecture Philos Trans R Soc Lond B Biol Sci 367 3515-3524

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Armbruster U Zuumlhlke J Rengstl B Kreller R Makarenko E Ruumlhle T Schuumlnemann D Jahns P Weisshaar B NickelsenJ and Leister D (2010) The Arabidopsis thylakoid protein PAM68 is required for efficient D1 biogenesis and photosystem IIassembly Plant Cell 22 3439-3460

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Armbruster U Labs M Pribil M Viola S Xu W Scharfenberg M Hertle AP Rojahn U Jensen PE Rappaport F JoliotP Doumlrmann P Wanner G and Leister D (2013) Arabidopsis CURVATURE THYLAKOID1 proteins modify thylakoid architectureby inducing membrane curvature Plant Cell 25 2661-2678

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Aseeva E Ossenbuumlhl F Sippel C Cho WK Stein B Eichacker LA Meurer J Wanner G Westhoff P Soll J andVothknecht UC (2007) Vipp1 is required for basic thylakoid membrane formation but not for the assembly of thylakoid proteincomplexes Plant Physiol Biochem 45 119-128

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Bartsevich VV and Pakrasi HB (1995) Molecular identification of an ABC transporter complex for manganese analysis of acyanobacterial mutant strain impaired in the photosynthetic oxygen evolution process EMBO J 14 1845-1853

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Bartsevich VV and Pakrasi HB (1996) Manganese transport in the cyanobacterium Synechocystis sp PCC 6803 J Biol Chem271 26057-26061

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Bernaacutet G Waschewski N and Roumlgner M (2009) Towards efficient hydrogen production the impact of antenna size andexternal factors on electron transport dynamics in Synechocystis PCC 6803 Photosynth Res 99 205-216

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Boehm M Yu J Krynicka V Barker M Tichy M Komenda J Nixon PJ and Nield J (2012) Subunit Organization of aSynechocystis Hetero-Oligomeric Thylakoid FtsH Complex Involved in Photosystem II Repair Plant Cell 24 3669-3683

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Bradford MM (1976) A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle ofprotein-dye binding Anal Biochem 72 248-254

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Chang L Liu X Li Y Liu C-C Yang F Zhao J and Sui S-F (2015) Structural organization of an intact phycobilisome and itsassociation with photosystem II Cell Res 25 726-737

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Danielsson R Suorsa M Paakkarinen V Albertsson P-Aring Styring S Aro E-M and Mamedov F (2006) Dimeric andmonomeric organization of photosystem II Distribution of five distinct complexes in the different domains of the thylakoidmembrane J Biol Chem 281 14241-14249

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Daum B Nicastro D Austin J McIntosh JR and Kuumlhlbrandt W (2010) Arrangement of photosystem II and ATP synthase in

chloroplast membranes of Spinach and Pea Plant Cell 22 1299-1312Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Engel BD Schaffer M Kuhn Cuellar L Villa E Plitzko JM and Baumeister W (2015) Native architecture of theChlamydomonas chloroplast revealed by in situ cryo-electron tomography eLife 4 e04889

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Ford MGJ Mills IG Peter BJ Vallis Y Praefcke GJK Evans PR and McMahon HT (2002) Curvature of clathrin-coatedpits driven by epsin Nature 419 361-366

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Fristedt R Willig A Granath P Cregravevecoeur M Rochaix J-D and Vener AV (2009) Phosphorylation of photosystem IIcontrols functional macroscopic folding of photosynthetic membranes in Arabidopsis Plant Cell 21 3950-3964

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Gallop JL and McMahon HT (2005) BAR domains and membrane curvature bringing your curves to the BAR Biochem SocSymp 72 223-231

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Gibson DG (2011) Chapter fifteen - Enzymatic Assembly of Overlapping DNA Fragments In Methods in Enzymology VChristopher ed (Academic Press) pp 349-361

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Goedhart J von Stetten D Noirclerc-Savoye M Lelimousin M Joosen L Hink MA van Weeren L Gadella TWJ andRoyant A (2012) Structure-guided evolution of cyan fluorescent proteins towards a quantum yield of 93 Nat Commun 3 751

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Heinz S Liauw P Nickelsen J and Nowaczyk M (2016) Analysis of photosystem II biogenesis in cyanobacteria BiochimBiophys Acta 1857 274-287

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Hernaacutendez-Prieto M and Futschik M (2012) CyanoEXpress A web database for exploration and visualisation of the integratedtranscriptome of cyanobacterium Synechocystis sp PCC6803 Bioinformation 8 634-638

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Hernaacutendez-Prieto MA Semeniuk TA Giner-Lamia J and Futschik ME (2016) The Transcriptional Landscape of thePhotosynthetic Model Cyanobacterium Synechocystis sp PCC6803 Sci Rep 6 22168

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Huang F Fulda S Hagemann M and Norling B (2006) Proteomic screening of salt-stress-induced changes in plasmamembranes of Synechocystis sp strain PCC 6803 Proteomics 6 910-920

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Kirchhoff H (2013) Architectural switches in plant thylakoid membranes Photosynth Res 116 481-487Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Klinkert B Elles I and Nickelsen J (2006) Translation of chloroplast psbD mRNA in Chlamydomonas is controlled by asecondary RNA structure blocking the AUG start codon Nucleic Acids Res 34 386-394

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Klinkert B Ossenbuumlhl F Sikorski M Berry S Eichacker L and Nickelsen J (2004) PratA a periplasmic tetratricopeptiderepeat protein involved in biogenesis of photosystem II in Synechocystis sp PCC 6803 J Biol Chem 279 44639-44644

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Komenda J Nickelsen J Tichyacute M Praacutešil O Eichacker LA and Nixon PJ (2008) The cyanobacterial homologue ofHCF136YCF48 is a component of an early photosystem II assembly complex and is important for both the efficient assembly andrepair of photosystem II in Synechocystis sp PCC 6803 J Biol Chem 283 22390-22399

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Kopf M Klaumlhn S Scholz I Matthiessen JKF Hess WR and Voszlig B (2014) Comparative analysis of the primarytranscriptome of Synechocystis sp PCC 6803 DNA Res 21 527-539

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Kunkel DD (1982) Thylakoid centers Structures associated with the cyanobacterial photosynthetic membrane system ArchMicrobiol 133 97-99

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Liberton M Howard Berg R Heuser J Roth R and Pakrasi BH (2006) Ultrastructure of the membrane systems in theunicellular cyanobacterium Synechocystis sp strain PCC 6803 Protoplasma 227 129-138

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Liberton M Saha R Jacobs JM Nguyen AY Gritsenko MA Smith RD Koppenaal DW and Pakrasi HB (2016) GlobalProteomic Analysis Reveals an Exclusive Role of Thylakoid Membranes in Bioenergetics of a Model Cyanobacterium Mol CellProteomics 15 2021-2032

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Luque I and Ochoa de Alda JAG (2014) CURT1CAAD-containing aaRSs thylakoid curvature and gene translation TrendsPlant Sci 19 63-66

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Marin K Stirnberg M Eisenhut M Kraumlmer R and Hagemann M (2006) Osmotic stress in Synechocystis sp PCC 6803 lowtolerance towards nonionic osmotic stress results from lacking activation of glucosylglycerol accumulation Microbiology 1522023-2030

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Mullineaux CW (2005) Function and evolution of grana Trends Plant Sci 10 521-525Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Mullineaux CW (2008) Biogenesis and dynamics of thylakoid membranes and the photosynthetic apparatus In TheCyanobacteria A Herrero and E Flores eds (Norfolk UK Caister Academic Press) pp 289-304

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Nevo R Charuvi D Tsabari O and Reich Z (2012) Composition architecture and dynamics of the photosynthetic apparatus inhigher plants Plant J 70 157-176

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Nickelsen J and Rengstl B (2013) Photosystem II assembly From cyanobacteria to plants Annu Rev Plant Biol 64 609-635Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Nickelsen J and Zerges W (2013) Thylakoid biogenesis has joined the new era of bacterial cell biology Front Plant Sci 4 458Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Nilsson F Simpson DJ Jansson C and Andersson B (1992) Ultrastructural and biochemical characterization of aSynechocystis 6803 mutant with inactivated psbA genes Arch Biochem Biophys 295 340-347

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Odom WR Hodges R Chitnis PR and Guikema JA (1993) Characterization of Synechocystis sp PCC 6803 in iron-supplied

and iron-deficient media Plant Mol Biol 23 1255-1264Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Ossenbuumlhl F Inaba-Sulpice M Meurer J Soll J and Eichacker LA (2006) The Synechocystis sp PCC 6803 Oxa1 homolog isessential for membrane integration of reaction center precursor protein pD1 Plant Cell 18 2236-2246

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Pisareva T Kwon J Oh J Kim S Ge C Wieslander Aring Choi J-S and Norling B (2011) Model for Membrane Organizationand Protein Sorting in the Cyanobacterium Synechocystis sp PCC 6803 Inferred from Proteomics and Multivariate SequenceAnalyses J Proteome Res 10 3617-3631

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Pribil M Labs M and Leister D (2014) Structure and dynamics of thylakoids in land plants J Exp Bot 65 1955-1972Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Rast A Heinz S and Nickelsen J (2015) Biogenesis of thylakoid membranes Biochim Biophys Acta 1847 821-830Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Rast A Rengstl B Heinz S Klingl A and Nickelsen J (2016) The role of Slr0151 a tetratricopeptide repeat protein fromSynechocystis sp PCC 6803 during Photosystem II assembly and repair Front Plant Sci 7 605

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Rengstl B Oster U Stengel A and Nickelsen J (2011) An Intermediate Membrane Subfraction in Cyanobacteria Is Involved inan Assembly Network for Photosystem II Biogenesis J Biol Chem 286 21944-21951

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Rengstl B Knoppovaacute J Komenda J and Nickelsen J (2013) Characterization of a Synechocystis double mutant lacking thephotosystem II assembly factors YCF48 and Sll0933 Planta 237 471-480

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Rexroth S Mullineaux CW Ellinger D Sendtko E Roumlgner M and Koenig F (2011) The Plasma Membrane of theCyanobacterium Gloeobacter violaceus Contains Segregated Bioenergetic Domains Plant Cell 23 2379-2390

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Rippka R Deruelles J Waterbury JB Herdman M and Stanier RY (1979) Generic Assignments Strain Histories andProperties of Pure Cultures of Cyanobacteria Microbiology 111 1-61

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Ruumltgers M and Schroda M (2013) A role of VIPP1 as a dynamic structure within thylakoid centers as sites of photosystembiogenesis Plant Signal Behav 8 e27037

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Sacharz J Bryan SJ Yu J Burroughs NJ Spence EM Nixon PJ and Mullineaux CW (2015) Sub-cellular location ofFtsH proteases in the cyanobacterium Synechocystis sp PCC 6803 suggests localised PSII repair zones in the thylakoidmembranes Mol Microbiol 96 448-462

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Sandstroumlm S Park Y-I Oumlquist G and Gustafsson P (2001) CP43 the isiA Gene Product Functions as an Excitation EnergyDissipator in the Cyanobacterium Synechococcus sp PCC 7942 Photochem Photobiol 74 431-437

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Schindelin J Arganda-Carreras I Frise E Kaynig V Longair M Pietzsch T Preibisch S Rueden C Saalfeld S SchmidB Tinevez J-Y White DJ Hartenstein V Eliceiri K Tomancak P and Cardona A (2012) Fiji an open-source platform forbiological-image analysis Nat Methods 9 676-682

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Schottkowski M Ratke J Oster U Nowaczyk M and Nickelsen J (2009a) Pitt a novel tetratricopeptide repeat proteininvolved in light-dependent chlorophyll biosynthesis and thylakoid membrane biogenesis in Synechocystis sp PCC 6803 MolPlant 2 1289-1297

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Schottkowski M Gkalympoudis S Tzekova N Stelljes C Schuumlnemann D Ankele E and Nickelsen J (2009b) Interaction ofthe periplasmic PratA factor and the PsbA (D1) protein during biogenesis of photosystem II in Synechocystis sp PCC 6803 J BiolChem 284 1813-1819

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Selatildeo TT Zhang L Knoppovaaacute J Komenda J and Norling B (2016) Photosystem II Assembly Steps Take Place in theThylakoid Membrane of the Cyanobacterium Synechocystis sp PCC6803 Plant Cell Physiol 57 878

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Spaumlt P Macek B and Forchhammer K (2015) Phosphoproteome of the cyanobacterium Synechocystis sp PCC 6803 and itsdynamics during nitrogen starvation Front Microbiol 6 248

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Stengel A Guumlgel IL Hilger D Rengstl B Jung H and Nickelsen J (2012) Initial steps of photosystem II de novo assemblyand preloading with manganese take place in biogenesis centers in Synechocystis Plant Cell 24 660-675

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Uniacke J and Zerges W (2007) Photosystem II assembly and repair are differentially localized in Chlamydomonas Plant Cell 193640-3654

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Uniacke J and Zerges W (2009) Chloroplast protein targeting involves localized translation in Chlamydomonas Proc Natl AcadSci USA 106 1439-1444

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

van de Meene AL Hohmann-Marriott M Vermaas WJ and Roberson R (2006) The three-dimensional structure of thecyanobacterium Synechocystis sp PCC 6803 Arch Microbiol 184 259-270

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

van de Meene AML Sharp WP McDaniel JH Friedrich H Vermaas WFJ and Roberson RW (2012) Gross morphologicalchanges in thylakoid membrane structure are associated with photosystem I deletion in Synechocystis sp PCC 6803 BiochimBiophys Acta 1818 1427-1434

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Watanabe M and Ikeuchi M (2013) Phycobilisome architecture of a light-harvesting supercomplex Photosynth Res 116 265-276

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Wellburn AR and Lichtenthaler H (1984) Formulae and Program to Determine Total Carotenoids and Chlorophylls A and B ofLeaf Extracts in Different Solvents In Advances in Photosynthesis Research Proceedings of the VIth International Congress onPhotosynthesis Brussels Belgium August 1-6 1983 C Sybesma ed (Dordrecht Springer Netherlands) pp 9-12

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Wilde A Lunser K Ossenbuumlhl F Nickelsen J and Borner T (2001) Characterization of the cyanobacterial ycf37 mutationdecreases the photosystem I content Biochem J 357 211-216

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Wilson A Boulay C Wilde A Kerfeld CA and Kirilovsky D (2007) Light-Induced Energy Dissipation in Iron-StarvedCyanobacteria Roles of OCP and IsiA Proteins Plant Cell 19 656-672

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Xu M Bernaacutet G Singh A Mi H Roumlgner M Pakrasi HB and Ogawa T (2008) Properties of Mutants of Synechocystis spStrain PCC 6803 Lacking Inorganic Carbon Sequestration Systems Plant Cell Physiol 49 1672-1677

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Yamamoto T Burke J Autz G and Jagendorf AT (1981) Bound ribosomes of Pea chloroplast thylakoid membranes locationand release in vitro by high salt puromycin and RNase Plant Physiol 67 940-949

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Yang H Liao L Bo T Zhao L Sun X Lu X Norling B and Huang F (2014) Slr0151 in Synechocystis sp PCC 6803 isrequired for efficient repair of photosystem II under high-light condition J Integr Plant Biol 56 1136-1150

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Yeremenko N Kouril R Ihalainen JA DHaene S van Oosterwijk N Andrizhiyevskaya EG Keegstra W Dekker HLHagemann M Boekema EJ Matthijs HCP and Dekker JP (2004) Supramolecular Organization and Dual Function of the IsiAChlorophyll-Binding Protein in Cyanobacteria Biochemistry 43 10308-10313

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Zak E Norling B Maitra R Huang F Andersson B and Pakrasi HB (2001) The initial steps of biogenesis of cyanobacterialphotosystems occur in plasma membranes Proc Natl Acad Sci USA 98 13443-13448

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Zang X Liu B Liu S Arunakumara KKIU and Zhang X (2007) Optimum Conditions for Transformation of Synechocystis spPCC 6803 J Microbiol 45 241-245

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Zhang L and Sakamoto W (2015) Possible function of VIPP1 in maintaining chloroplast membranes Biochim Biophys Acta 1847831-837

Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Zimmerberg J and Kozlov MM (2006) How proteins produce cellular membrane curvature Nat Rev Mol Cell Biol 7 9-19Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

Zoumlfel P (1988) Statistik in der Praxis (Stuttgart Germany Gustav Fischer Verlag)Pubmed Author and TitleCrossRef Author and TitleGoogle Scholar Author Only Title Only Author and Title

DOI 101105tpc1600491 originally published online August 19 2016Plant Cell

Rengstl Stefania Viola Marc M Nowaczyk Dario Leister and Joumlrg NickelsenSteffen Heinz Anna Rast Lin Shao Andrian Gutu Irene L Guumlgel Eiri Heyno Mathias Labs Birgit

CURVATURE THYLAKOID1 ProteinsThylakoid Membrane Architecture in Synechocystis Depends on CurT a Homolog of the Granal

This information is current as of May 25 2020

Supplemental Data contentsuppl20160819tpc1600491DC1html

Permissions httpswwwcopyrightcomcccopenurldosid=pd_hw1532298Xampissn=1532298XampWTmc_id=pd_hw1532298X

eTOCs httpwwwplantcellorgcgialertsctmain

Sign up for eTOCs at

CiteTrack Alerts httpwwwplantcellorgcgialertsctmain

Sign up for CiteTrack Alerts at

Subscription Information httpwwwaspborgpublicationssubscriptionscfm

is available atPlant Physiology and The Plant CellSubscription Information for

ADVANCING THE SCIENCE OF PLANT BIOLOGY copy American Society of Plant Biologists