Aus dem Institut für Tierzucht und Tierhaltung
der Agrar- und Ernährungswissenschaftlichen Fakultät
der Christian-Albrechts-Universität zu Kiel
GENETIC VARIABILITY OF EQUINE MILK
PROTEIN GENES
Dissertation
zur Erlangung des Doktorgrades
der Agrar- und Ernährungswissenschaftlichen Fakultät
der Christian-Albrechts-Universität zu Kiel
Vorgelegt von
M. Sc. agr.
JULIA ELENA MARGOT ELISABETH BRINKMANN
aus Kiel.
Kiel, 2015
Dekan: Prof. Dr. Eberhard Hartung
1. Berichterstatter: Prof. Dr. Georg Thaller
2. Berichterstatter: Prof. Dr. Siegfried Wolffram
Tag der mündlichen Prüfung: 04. 11. 2015
Diese Dissertation wurde mit dankenswerter finanzieller Unterstützung des BMBF im
Rahmen des Kompetenznetzwerkes Food Chain Plus (FoCus) angefertigt
TABLE OF CONTENTS
GENERAL INTRODUCTION .................................................................................................. 1
CHAPTER I:
PRODUCTION, COMPOSITION AND UTILIZATION OF MARE MILK ........................... 3
1. Production ........................................................................................................................... 4
1.2. Milking ......................................................................................................................... 5
1.3 Hygiene standards ......................................................................................................... 6
1.4 Equine breeds for dairy production in Germany ........................................................... 6
2. Composition of mare milk .................................................................................................. 7
2.1 Gross composition of mare milk ................................................................................... 8
2.2 Lipid components .......................................................................................................... 8
2.3 Milk proteins ................................................................................................................. 8
2.3.1 Caseins ................................................................................................................. 10
2.3.1.1 αs1-casein ....................................................................................................... 12
2.3.1.2 ß-casein .......................................................................................................... 12
2.3.1.3 αs2-casein ....................................................................................................... 13
2.3.1.4 κ-casein .......................................................................................................... 13
2.3.2 Whey Proteins ...................................................................................................... 14
2.3.2.1 α-Lactalbumin ................................................................................................ 14
2.3.2.2 ß-Lactoglobulin ............................................................................................. 15
3. Utilization of mare milk ................................................................................................... 16
3.1 Disposal ....................................................................................................................... 16
3.2 Mare milk products ..................................................................................................... 16
3.3. Digestibility of mare milk proteins ............................................................................ 17
3.4 Health benefits ............................................................................................................ 18
3.5 Mare milk as a substitute in case of cow milk protein allergy .................................... 18
CHAPTER II:
DNA-BASED ANALYSIS OF PROTEIN VARIANTS REVEALS DIFFERENT GENETIC
VARIABILITY OF THE PARALOGOUS EQUINE ß-LACTOGLOBULIN GENES LGB1
AND LGB2 ............................................................................................................................... 31
CHAPTER III:
GENETIC VARIABILITY OF THE EQUINE CASEIN GENES .......................................... 49
CHAPTER IV:
CHARACTERIZATION OF AN EQUINE αs2-CASEIN VARIANT DUE A 1.3 KB
DELETION SPANNING TWO CODING EXONS ................................................................ 73
GENERAL DISCUSSION ....................................................................................................... 91
GENERAL SUMMARY ........................................................................................................ 107
ALLGEMEINE ZUSAMMENFASSUNG ............................................................................ 111
SUPPLEMENTAL TABLES ................................................................................................. 115
SUPPLEMENTAL FIGURES ............................................................................................... 119
1
GENERAL INTRODUCTION
The use of mare milk in human nutrition has a long tradition, as mare milk was already
mentioned by Homer in the Illiad (8th century BC). Especially nomadic tribes like the
Mongolians practiced the consumption of mare milk since ancient times. As there are several
positive effects of mare milk on human health described, the interest in mare milk arose in
Europe as well. Mare milk is used in naturopathy to cure several diseases; scientific evidence
was found for positive effects of mare milk consumption on cardiovascular diseases, atopic
dermatitis and chronic inflammatory bowel diseases. Nowadays, the mechanism of action of
mare milk was not elucidated.
The health beneficial effects made mare milk attractive for research within the scope of the
competence network Food Chain Plus (FoCus). The FoCus project is a joint research project
with scientists from the fields of agricultural and nutritional sciences, nutritional medicine, as
well as of the dairy and animal feed industry. One of the major goals of the projects is to identify
health promoting milk ingredients.
The composition of mare milk and especially the milk protein fraction is very different from
the composition of bovine milk. Mare milk is lower in fat and protein, but has a high lactose
content, similar to human milk. In ruminants, the protein fraction consists for the main part of
about 90 % of six milk proteins. In horses, these six milk proteins account for more than 70%
of the milk protein fraction. The six main milk proteins are divided into caseins and whey
proteins. The casein fraction can be subdivided into αs1-, ß-, αs2- and κ-casein whereas the main
equine whey proteins are ß-lactoglobulin I, ß-lactoglobulin II and α-lactalbumin, besides these
there are serum albumin, immunoglobulins, lysozyme, lactoferrin and other lesser proteins.
Different genetic variants of these milk proteins have been described in literature, especially in
cattle, sheep and goat several variants are known. Milk protein variants are mostly caused by
nucleotide exchanges within the milk protein encoding genes (CSN1S1, CSN2, CSN1S2, CSN3,
LGB1, LGB2, LALBA), which alter the amino acid sequence of the protein. Likewise, larger
structural variations within the gene (e.g. deletions or duplications) can lead to different milk
proteins. These variants may influence the nutritional value of the milk, as well as milk yield
and processing properties. Due to the altered amino acid sequence of the milk proteins, the
release of bioactive peptides during digestion can be influenced, as well as the allergenic
potential of the milk. As the milk proteins are hence assumed to contribute to the health effects
of mare milk, an extended knowledge about structure and variability of equine milk protein
2
genes is eligible. For this approach, all exons contributing to the open reading frames of the
equine milk protein genes and adjacent intronic regions were resequenced in 198 horses
belonging to 8 breeds. Furthermore, individual whole genome sequence calling data of 55
horses of 10 different breeds were incorporated in the study. For CSN1S2, the gene coding for
equine αs2-casein, part of the DNA-sequencing results were confirmed on RNA and protein
level as well. With this approach, most of the known variants, as well as several new variants
of the equine milk proteins were identified.
Chapter I of the present study gives an overview about the available literature. The production
of mare milk with regard to milking and processing of mare milk is shown as well as a short
overview of the history of the horse as a dairy animal. Furthermore, the composition of mare
milk with special regard to the milk proteins is described. Finally, the utilization of mare milk
as human nutrition is explained. Especially the effects of human health are mentioned
In Chapter II the results of the sequencing of equine LGB1 and LGB2 are illustrated. It was
possible to detect the known variants of the two paralogous genes as well as previously
unknown variants. A provisional nomenclature was established for the variants. The two genes
showed considerably differences in genetic variability, which may indicate different properties
of the two gene products.
Chapter III presents the results of the analysis of the four equine casein genes. Besides known
casein gene variants, several new variants were identified. For these variants a provisional
nomenclature was created. Furthermore, possible evolutionary pathways of these variants are
depicted.
In Chapter IV equine CSN1S2, the gene coding for αs2-casein, was subject to comprehensive
studies. A 1335 bp deletion, involving two coding exons, was substantiated not only on DNA
level, but on RNA and protein level as well. By comparing the obtained sequences with
published sequences, it was possible to show, that the deletion probably occurred before asses
and zebras diverged from the horse lineage.
4
1. Production
1.1 History of the horse as a dairy animal
Mare milk in human nutrition and especially in traditional naturopathic medicine has been
known since ancient times. Over the years, several positive effects of mare milk on human
health are empirically described. The oldest reference in literature for the utilization of the horse
as dairy animal can be found in Homer`s Iliad (8th century B.C.). The mare milking Scythians
in the steppes of South Russia are described by Hesiod in his didactic poem “Works and Days”,
as well as by other antique authors like Herodot (5th century B.C.). In the 13th century Marco
Polo refers to the use of mare milk at the Mongolians in his journey reports. Mare milk
production in Europe was established only slowly and sporadically. In the late 19th century there
was one mare milk farm in Austria, specialized on production of kumyß, an alcoholic fermented
beverage with claimed health benefits (Neuhaus, 1959). In 1858 the first mare milk sanatorium
was founded in Samara, Russia (URL 1). With the beginning of the 20th century, mare milk,
and especially kumyß production, became the focus of interest. Several large mare milk farms
were founded on the territory of the former USSR (Neuhaus, 1959). Dr. Rudolf Storch, war
prisoner in Second World War in Russia, brought the mare milk to Germany. During his
captivity, the veterinarian got committed about the quality and claimed health benefits of mare
milk. After his return home he founded the first mare milk farm in 1959 in Germany (URL 1).
Throughout the years, this mare milk farm evolved into the largest mare milk farm in Germany,
managed by descendants of Dr. Storch (URL 2). Today the most dairy herds are still found in
great quantities in the former USSR and in Mongolia, especially in Kazakhstan, Kirghizia
Tadzhikistan, Uzbekistan, in some parts of Russia near Kazakhstan: Kalmukia, Bachkiria, in
Mongolia and its periphery: Buryatia in Sibiria, Inner Mongolia in North China. Furthermore,
equine dairy production is found in Tibet and Xinjiang. In lower quantity, mare milk production
takes place in eastern Europe, particular in Belarus and Ukraine, and in central Europe in
Hungary, Austria, France, Belgium, The Netherlands and Germany (Doreau and Martin-Rosset,
2002; Uniacke-Lowe and Fox, 2012). The extend of mare milk production in Europe is roughly
one million kilogram per year (Fox and Uniacke, 2010).
5
1.2. Milking
Milking of the dairy mare can start between 20 to 45 days postpartum, when the foal is able to
be partly fed on concentrate and forage and to get along with a lesser amount of milk without
negative consequences in growth. Milking lasts 4-6 months (Doreau and Martin-Rosset, 2002).
The mare is separated from her foal for the milking procedure and milked roughly 5 times at
intervals of about 2.5 hours and produces up to 1 – 1.5 litres of milk at each milking (Uniacke-
Lowe, 2011). This procedure varies depending on the farm structure. A complete separation of
the foal, as done in dairy cattle, is not possible, because the mare requires permanent suckling
or milking to sustain lactation (Sixt, 2011). Additionally, the mare has a low udder capacity
(less than 2 litres with 75 – 86% alveolar milk) and the udder needs to be frequently emptied to
avoid a decrease in total milk yield, which can already occur when milking intervals extend 3
hours (Doreau and Martin-Rosset, 2002).
The high proportion of alveolar milk requires a good conditioning of the mares to the milking
procedure, so that milk ejection allows the maximal recovery of secreted milk (Doreau and
Martin-Rosset, 2002). To get the mares accustomed to milking, the transition from suckling to
milking can be improved by milking the mare with the foal in front of her, or milking one teat
while the foal suckles the other. When the mares got used to the milking, oat is offered while
milking (Caroprese et al., 2007). The mare can be milked by hand or by machine (Figure 1),
difficulties in milking can be caused by the two very short teats (Sixt, 2011) and the success of
milking essentially depends on manageability of mares, which shows the stockman`s ability of
a calm handling of the mares and the affinity of the mares to humans (Lansade et al., 2004). It
has been shown, that machine milking is
more efficient than hand milking
(Caroprese et al., 2007).
In Germany, mare milk is produced in
about 40 dairy farms (URL 1), most of
them producing ecologically. The
number of dairy mares varies from under
10 to over 100. In the German mare milk
farms usually a specific bucket milking
machine is used for milking. Only a small
number of farmers practice hand milking,
some farms have a heightened milking
shed, one farm has a tandem milking
Figure 1. Machine milking of a dairy mare
6
parlour for four horses. Which milking technology gets selected by the farm is certainly
dependent on the extent of the particular equine dairy production.
1.3 Hygiene standards
Mare Milk is filtrated after milking, then packaged mostly into 250 ml portions and quick-
frozen at -18 to -30°C (Sixt, 2011). Most equine dairy farms produce the mare milk as attested
milk (Vorzugsmilch, Tierische Lebensmittelhygiene Verordnung Anlage 9, URL 3). The milk
is subject to strict hygienic standards, is very low in germs and not pasteurized to preserve the
immunoglobulins in the milk (URL 1). Attested mare milk has to conform to additional
hygienic standards as compared to raw milk. The mares have to be clinically examined monthly
by veterinarians; furthermore, there must be monthly cytological tests of the milking of the
individual horses. If the somatic cell content exceeds 10.000 cells per millilitres, a
bacteriological test of the milk of each half of the udder is required. The standards for the
processing of the milk are very high as well (Sixt, 2011). Udder health is important for a
successful production of attested milk. Mastitis is very rare among mares and is only observed
if the udder or the teat is injured (Uniacke-Lowe, 2011).
1.4 Equine breeds for dairy production in Germany
Several breeds are used for the mare milk production. Differences between breeds in milk yield
are not clearly established and can often be explained by life weight variations when breeds
have very different adult weights (Doreau and Boulot, 1989). No specific breed is required for
dairy production; any breed can be milked. The crucial factor for selecting a breed as dairy
breed is the acceptance of milking by the mares (Doreau and Martin-Rosset, 2002).
The main dairy breed in Germany is the Haflinger. Also used for dairy production are Heavy
Breeds, Warmblood Horses and special breeds (URL 1). The Haflinger is a small sized breed
(heights at withers 150, life weight up to 500 kg) from Austria and it is known for its dairy
capacity. Also the calm character, good fertility and longevity make the Haflinger a suitable
dairy breed (Doreau and Martin-Rosset, 2002; Nissen, 1997).
A Heavy Breed used in Germany for dairy production is the Russian Heavy Draft Horse, a
breed which is common for dairy production in Russia. The Russian Heavy Draft is a
comparatively small Heavy Breed (~150 cm withers height, up to 700 kg life weight), which is
strong, easy to keep and economical in management and feeding. The horses of this breed
mature early; the foals reach 250 kilograms by weaning. The breed is famous for milk
7
production, can be used up to 25 years and has a good fertility and longevity, all this making
the Russian Heavy Draft an appropriate dairy breed (URL 4, URL 5).
Warmblood Horses are rather uncommon dairy animals, because of their sensitive character.
Nevertheless, mare milk can be a sideline for a Warmblood stud, while the sale of young horses
as sport or leisure horses is the main income. For the offspring of these horses, a potentially
higher market prize in comparison to previously mentioned breeds can be realized.
The expected higher market prices are the main argument for the use of special breeds in the
dairy production. The Icelandic Horse is a small horse (withers height 128 – 143 cm) with a
good health condition, with uncomplicated feedings needs and best fertility. The Icelandic
Horse has two additional gaits, tölt and pace, and is the favoured breed for gait riding in
Germany (Nissen, 1997).
Also used for mare milk production in Germany is the American Quarter Horse. This horse
(withers height 145 – 165 cm) was bred for farm work and is a popular show horse in disciplines
like reining and cutting and a favoured leisure horse and is known to be strong-nerved with
pleasant temperament (URL 7).
Another special breed in the German dairy production is the Argentine Criollo Horse (withers
height 138 – 150 cm). The Criollo is a tough and frugal horse, bred for cow work, today a
popular breed for leisure, trail riding, endurance, as well as show horse in reining and cutting
(URL 7).
2. Composition of mare milk
Milk is an important nutritional source which contains all nutrients for an optimal supply of the
infant. The milks of different species have different compositions, perfectly balanced for the
needs of the own offspring.
The composition of mare milk varies in course of lactation to support the foal best possible.
The colostral phase is comparatively short in horses, 24 -36 h after foaling the composition of
the milk is close to mature milk. As in other species, the colostrum contains more proteins,
immunoglobulins and enzymes especially important for the newborn´s immunity (Uniacke-
Lowe et al., 2010; Salimei and Fantuz, 2012). After the colostral phase, the protein content as
well as the mineral content decreases (Martuzzi and Doreau, 2006).
Further factors which may have an influence on the composition of mare milk are the mare`s
diet, the mineral supplementation of the mare and differences between breeds, although large
8
individual variability makes it difficult to determine a breed effect (Martuzzi and Doreau,
2006).
2.1 Gross composition of mare milk
Mare milk is known to have a composition close to that of human milk. Especially lactose
content as well as protein content and composition are close to that of human milk while bovine
milk is lower in lactose and higher in protein. Mare milk has less fat than human and bovine
milk and milk fatty acid composition differs (Doreau and Martin-Rosset, 2002). The average
energy content in mare milk is lower compared to human milk or bovine milk (Salimei and
Fantuz, 2012) (Table 1).
Table 1. Gross composition of mare milk in comparison to human and bovine milk
Mare Human Bovine
Fat (g kg-1) 12.1 (5 -20) 36.4 (35 – 40) 36.1 (35 -39)
Crude protein (g kg-1) 21.4 (15 – 28) 14.2 (9 – 17) 32.5 (31 – 38)
Lactose (g kg-1) 63.7 (58 – 70) 67.0 (63 – 70) 48.8 (44 – 49)
Ash (g kg-1) 4.2 (3 - 5) 2.2 (2 - 3) 7.6 (7 – 8)
Gross energy (kcal kg-1) 480 (390 – 550) 677 (650 – 700) 674 (650 – 712)
Data from Malacarne et al., 2002; Uniacke-Lowe et al., 2010
Mean values, between brackets minimum - maximum values reported in literature
2.2 Lipid components
Mare milk has a low fat content compared to human or cow`s milk (Tab.1). The fat globules
have a diameter of 2-3 mm (cow 3-5 mm, human ~4 mm). Mare milk fat contains less than 80%
triacylglycerols, while the milk fat of humans or cows is almost totally made of triacylglycerols.
The remaining part of mare milk fat is mainly composed of free fatty acids (~10 %), sterols
(~5%) and phospholipids (~5 %). Mare milk is poorer in stearic and oleic acids and richer in
palmitoleic, linoleic and linolenic acids compared to human and cow`s milk (Doreau and
Martin-Rosset, 2002; Malacarne et al., 2002).
2.3 Milk proteins
The two main fractions of equine milk protein are the caseins, divided into αs1-casein, ß-casein,
αs2-casein and κ-casein, and the whey proteins α-lactalbumin and ß-lactoglobulin. These
9
fractions account for more than 70% of the total protein in equine milk. The remaining part
consists mainly of serum albumin, lactoferrin, and lysozyme.
The composition of equine milk protein is considered to be very similar to that of human milk
regarding casein, whey and NPN content, even though human milk contains no αs2-casein and
no ß-lactoglobulin. Bovine milk has higher casein content compared to equine and human milk,
the whey protein fraction is almost 40% in equine milk, more than 50% in human and less than
20% in bovine milk. The protein fractions of equine milk in comparison to human and bovine
milk are summarized in Table 2.
The high whey protein content of equine milk makes the milk more favourable for human
nutrition than cow`s milk, because of the relatively higher supply of essential amino acids
(Hambræus, 1994; Malacarne et al., 2002).
Table 2. Protein fractions of equine milk
Protein Equine Human Bovine
Casein (g kg-1) 10.7 3.7 25.1
Fractions (%)
αs1-casein 17 13 42
ß-casein 79 66 34
αs2-casein 1.5 - 11
κ-casein 1.5 21 13
Micelles size (nm) 255 64 182
Whey (g kg-1) 8.3 7.6 5.7
Fractions (%)
ß-lactoglobulin 31 - 20
α-lactalbumin 29 42 54
Immunoglobulins 19 18 12
Serum albumin 4 8 6
Lactoferrin 7 30 8
Lysozyme 10 2 Traces
Data are mean values, taken from Salimei and Fantuz, 2012; Inglingstad et al., 2010; Uniacke-Lowe et al., 2010;
Malacarne et al., 2002
10
2.3.1 Caseins
The equine casein fraction is divided in the so called “calcium-sensitive” caseins αs1-casein
(17%), -casein (79%), αs2-casein (1.5%) and the physically and functional linked -casein
(1.5%) (Inglingstad et al., 2010; Malacarne et al., 2002; Miranda et al., 2004; Rijnkels, 2002)
(Table 2). The biological function of caseins is their ability to form macromolecular structures,
the casein micelles (Uniacke-Lowe et al., 2010). The casein micelle keeps the caseins soluble
and allows the transport of calcium and phosphate to the neonate (Alexander et al., 1988).
Especially ß-casein and κ-casein are important for micelle formation and determine micelle size
and curd firmness. Furthermore, κ-casein is important for milk coagulation. These functions are
of high physiology importance for the supply of the suckling infant, so there is a permanent
selection pressure conserving the structure of ß-casein and κ-casein. αs1-casein and αs2-casein
are important for the binding of calcium with phosphorylated amino acid residues. The structure
of these regions is highly conserved, the other regions of these caseins are much less conserved
(Stewart et al., 1987; Lenasi et al., 2003). The micelles in the milk of horses, cows and humans
show considerable differences in size. Equine casein micelles have an average diameter of 255
nm, bovine casein micelles are 182 nm on average. Human casein micelles are much smaller
with an average diameter of 64 nm. The low κ-casein content in equine milk is discussed as
reason for the large micelles (Martuzzi and Doreau, 2006).
The four caseins (αs1-, αs2-, β- and κ-casein) are encoded by four genes mapped to chromosome
3 (ECA 3) in a 290-kb cluster, gene order is CSN1S1 (αs1-CN-encoding gene), CSN2 (β-CN-
encoding gene), CSN1S2 (αs2-CN encoding gene), and CSN3 (κ-CN encoding gene)
(Milenkovic et al., 2002; Egito et al., 2002; Lenasi et al., 2003; Miranda et al., 2004; Girardet
et al., 2006; Miclo et al., 2007; Martin et al., 2009; Selvaggi et al., 2010) (Figure 2). The tight
linkage of casein genes is also observed in bovine species, where the casein cluster is localized
on chromosome 6 (BTA 6) (Threadgill and Womack, 1990), as well as in ovine species
(Leveziel et al., 1991), where the casein locus is found on chromosome 6 (OAR 6) (Phua et al.,
1992).
11
Figure 2. Genomic organization of the equine casein locus.
Caseins: αs1-CN (CSN1S1), β-CN (CSN2), αs2-CN (CSN1S2), κ-CN (CSN3).
A) Genomic organization of the equine casein locus
B) Structural organization of the four casein transcription units (full length). Open bars represent introns,
exons are depicted by grey (5`and 3` untranslated regions), green (part of exon encoding the signal
peptide) and light blue (exons and part of exon encoding for the matured proteins) boxes. Numbers of
exons are listed on top; size of exons is given under each exon in base pairs.
(Modified from Martin et al., 2002; Caroli et al., 2009)
12
2.3.1.1 αs1-casein
The sequence of a fragment of equine αs1-casein cDNA was reported by Milenkovic et al. in
2002. In 2003, Lenasi et al. determined the whole cDNA sequence of equine CSN1S1, from
which the amino acid sequence of equine αs1-casein was deduced. The mature protein contains
205 amino acids and the signaling peptide, a short N-terminal part of the protein, contains 15
amino acids, leading to a pre-form of αs1-casein of 220 amino acids. When the signal peptide
has delivered the protein to its associated location, it is cleaved and provided for digestion
(Williams et al., 2000). Due to its important function, the signal peptide is expected to be highly
conserved. The whole protein results from the reference sequence NM_001081883.1, plus exon
7 (24 bp), which is missing in this sequence. The gene CSN1S1 is divided into 20 exons
spanning over 16.5 kb, with 18 exons contributing to the open reading frame (Figure 2) (Lenasi
et al., 2003).
Beside the full length mRNA sequence of CSN1S1 (Lenasi et al., 2003), 3 kinds of mRNA
sequences probably due to exon skipping are noted for equine CSN1S1. Lenasi et al. (2003)
showed a lack of exon 7 in the mRNA sequence (αs1-casein∆7, GenBank AY040862), and
Milenkovic et al. (2002) isolated equine αs1-casein∆14 (GenBank AY049939). Miranda et al.
(2004) strongly suspected the existence of equine αs1-casein∆7,14. The existence of the four
known isoforms of equine αs1-casein was confirmed by Matéos et al. (2009), even though αs1-
CN∆7 and αs1-CN∆7,14 were observed to be the major isoforms of equine αs1-casein, leading to
the suggestion that exon 7 is mainly involved in the mechanism of alternative splicing.
2.3.1.2 ß-casein
The amino acid sequence of equine ß-casein was discovered by Lenasi et al. (2003), derived
from the cDNA sequence. Miranda et al. (2004) and Girardet et al. (2006) showed the existence
of an additional exon, leading to the insertion of eight amino acids (Glu27 to Lys34). The pre-
form of the protein is 241 amino acids, the cleavage of the 15 amino acids signal peptide leads
to a 226 bp mature protein. This protein results from the reference sequence NM_001081852.1,
plus exon 5 (24 bp), which is missing in this sequence. The gene is divided into 9 exons
spanning over 8.5 kb, with 7 exons belonging to the open reading frame (Figure 2).
Three isoforms of equine ß-casein were described in literature. Isoform 1 is corresponding to
the full length mRNA transcript (Girardet et al., 2006), isoform 2 (ß-CN∆5) is characterized by
the absence of exon 5 (Lenasi et al., 2003) and is the result of exon skipping (Miranda et al.,
2004). Due to the usage of a cryptic splice site, the region Val50 to Gln181, corresponding to the
main part of exon 7, is removed, leading to isoform 3 (Lenasi et al., 2006; Miclo et al., 2007).
13
A further isoform of equine ß-casein was accentuated by Lenasi et al. (2006), which is
characterized by alternative splicing of exon 5 and exon 8. The splicing of exon 8 would result
in a stop codon loss, but a corresponding protein to this splicing variant was not yet identified
in equine milk (Matéos et al., 2009).
2.3.1.3 αs2-casein
Probably due to its low amount, less is known about the equine αs2-casein. Ochirkhuyag et al.
(2000) and Egito et al. (2002; 2001) descried the existence of αs2-casein in mare milk first, this
was confirmed by Miranda et al. (2004).
Recently it was possible to show that there are two different DNA sequences of equine CSN1S2.
The two sequences of equine CSN1S2 are the result of ancient duplication and deletion events
in the equine CSN1S2 gene (Brinkmann et al., 2015). The long variant of the equine CSN1S2
gene has two more coding exons and leads to a 231 amino acids protein including the 15 amino
acids signal peptide, making the mature protein 216 amino acids in length. The short variant
results from 1.3 kb deletion along the CSN1S2 gene. The mRNA sequence encoding for this
variant of equine αs2-casein was directly submitted in 2009 by Martin et al. (GU196267.1).
Including the 15 amino acids signal peptide the pre-form of this protein is 214 amino acids in
length. After the cleavage of the signal peptide a 199 amino acids protein remains. The exon-
intron structure of the full length variant of CSN1S2 is presented in Figure 2.
2.3.1.4 κ-casein
The -casein content of equine milk is very low as well and was subject to discussion for years.
After Ochirkhuyag et al. (2000) did not detect -casein in equine milk, Iametti et al. (2001) and
Miranda et al. (2004) succeeded in providing the evidence of -casein in equine milk. Lenasi
et al. (2003) determined the cDNA sequence of equine κ-casein, from which the amino acid
sequence was deducted. The signal peptide of equine κ-casein is 20 amino acids in length and
the mature protein consists of 165 amino acids. This protein is derived from a 836 bp mRNA
(NM_001081884.1), the gene CSN3 is divided into 5 exons spanning 10.5 kb, 3 exons are part
of the open reading frame (Figure 2).
Hobor et al. (2006; 2008) found two SNPs with predicted effect on the amino acid sequence,
an A to T exchange (c. 383) leads to an isoleucine to lysine exchange (p 128) in the protein, an
A to G exchange (c. 517) leads to an threonine to alanine exchange (p 173).
14
2.3.2 Whey Proteins
Alpha-lactalbumin and β-lactoglobulin represent the major whey proteins in equine milk, each
accounting for roughly 30% of the whey protein fraction, further whey proteins are serum
albumin, immunoglobulins, lysozyme, lactoferrin and other lesser proteins (Table 2). Whereas
serum albumin and immunoglobulins are of hematic origin, α-lactalbumin and β-lactoglobulin
are both of mammary origin (Martuzzi and Doreau, 2006).
2.3.2.1 α-Lactalbumin
Alpha-lactalbumin is present in the milk of all mammals and is besides galactosyltransferase
responsible for the catalysis of the final step in lactose synthesis in the lactating mammary
gland. Furthermore, it has a strong Ca2+-binding site and thus can interact with proteins,
peptides, membranes and low molecular weight organic compounds (Brew, 2013; Permyakov
and Berliner, 2000; Brew et al., 1968). Probably due to its physiological importance, the gene
sequence of α-lactalbumin is highly conserved across species (Simpson and Nicholas, 2002).
The amino acid sequence of equine α-lactalbumin consists of 123 amino acids (Kaminogawa
et al., 1984), the signal peptide is 19 amino acids in length. The mRNA coding for this protein
(XM_001915789.2) is to the current state of knowledge 567 bp in length, divided into four
exons. Part of exon 1 and part of exon 4 are not part of the open reading frame. LALBA, the
gene coding for α-lactalbumin, was assigned to chromosome 6 (ECA 6, NCBI Gene ID
100146585) (Figure 2). Based on protein information, three different variants (A, B and C) of
the equine α-lactalbumin are known, which differ by a few amino acid exchanges (Table 3)
(Kaminogawa et al., 1984; Godovac-Zimmermann et al., 1987).
Table 3. Protein variants of equine Alpha-lactalbumin
Alpha-lactalbumin variant
Position within
protein Ref.Seq.1 A2 B3 C3
26 Glu Glu Gln Gln
52 Ser Ser Asn Asn
97 Asn Asp Asn Asn
114 Ile Ile Asp Ile
1 GenBank accession number NC_009149.2 2 Kaminogawa et al., 1984 3 Godovac-Zimmermann et al., 1987
15
2.3.2.2 ß-Lactoglobulin
Beta-lactoglobulin is absent in the milk of humans, camels, lagomorphs and rodents and
belongs to protein family of the lipocalins (Flower et al., 2000), which have a diverse series of
functions; particularly ligand-binding functions are established. Various functions of ß-
lactoglobulin have been discussed, but no definite physiological function was determined until
today. Beta-lactoglobulin of all species binds retinol, and ß-lactoglobulin of many species, but
not equine or porcine, binds fatty acids (Pérez and Calvo, 1995). Further functions like a
signaling or activity-modulator role are discussed (Kontopidis et al., 2004).
For equine ß-lactoglobulin, two isoforms named ß-lactoglobulin I and ß-lactoglobulin II have
been identified, which are due to the presence of two paralogous genes in horses, as well as in
several other species like the donkey, dog and the dolphin (Pervaiz and Brew, 1986; Halliday
et al., 1993; Godovac-Zimmermann et al., 1990). Three forms of ß-lactoglobulin have been
described in cats (Halliday et al., 1993; Pena et al., 1999). Equine ß-lactoglobulin II comprises
163 amino acids, one more than equine ß-lactoglobulin I, a glycine residue inserted after
position 116 (Halliday et al., 1991). Sequence homology between the two proteins is 70%, the
amino acid sequence differs in 52 positions (Conti et al., 1984; Godovac-Zimmermann et al.,
1985; Uniacke-Lowe et al., 2010). The signal peptide of both proteins consists of 18 amino
acids. LGB1 and LGB2, the genes coding for ß-lactoglobulin I and ß-lactoglobulin II,
respectively, show strong structural similarities and are divided into 7 exons, exons 1 to 6
contribute to the open reading frame. The two genes are located in the same direction in a 20
kb distance on chromosome 25 (NCBI Gene ID100034193 and 100034194) (Conti et al., 1984;
Godovac-Zimmermann et al., 1985; Halliday et al., 1991) (Figure 3).
16
Figure 3. Genomic organization of the whey proteins LGB1, LGB2 and LALBA.
Open bars represent introns, exons are depicted by grey (5`and 3` untranslated regions), green (part of exon
encoding the signal peptide) and light blue (exons and part of exon encoding for the matured proteins) boxes.
Numbers of exons are listed on the top; size of exons is given under each exon in base pairs.
3. Utilization of mare milk
3.1 Disposal
The main part of the in Germany produced mare milk is packaged into 250 ml portions, quick-
frozen and sold by direct marketing via farm shops or internet to the consumer. One litre mare
milk costs about 10 Euro. A smaller part of the produced mare milk is processed to mare milk
products, which are mainly sold by direct marketing as well; the prices depend on the products
and the producers (Sixt, 2011).
3.2 Mare milk products
The primary use of horse milk was mainly the processing to kumyß. This fermented horse milk
drink is of particular importance in Russia and West Asia, such as Kazakhstan and also
Mongolia, where it is also called airag and is the national drink. Kumyß is widely consumed in
17
these countries; the production of kumyß has long tradition. Several health benefits of kumyß
are known, based on empirical knowledge (Doreau and Martin-Rosset, 2002). A Mongolian
adage says “Kumyß cures 40 diseases” (Levine, 1998). Kumyß production is a traditional craft
and lasts 4-6 hours, the end product of fermentation includes lactate and ethanol, due to the
bacteria and yeast which seed the milk. Bacteria mainly belong to Lactobacillus and
Streptococcus species, yeast species are Saccharomyces, Torula, Torulopsis, and Candida. The
flora of kumyß varies depending on the production site. Kumyß contains about 2% alcohol and
it is slightly gaseous. Due to the not standardized processing of kumyß, an unpleasant taste of
the drink, caused by either the proliferation of the yeast or an excess of acidification, may be
problematic (Doreau and Martin-Rosset, 2002). Also in Germany kumyß is produced by a mare
milk farm and sold in 250 ml bottles by direct marketing as well as in pharmacies. Further mare
milk products sold in Germany are mare milk capsules, which contain lyophilized mare milk,
lyophilized mare milk powder, and mare milk drinks on the basis of lyophilized or fermented
horse milk.
Several mare milk cosmetics are also sold. Nowadays, no scientific evidence for the cosmetic
properties of mare milk in comparison to other milks is available, but mare milk has a good
image (Doreau and Martin-Rosset, 2002). A potential reason for the positive effects in
dermatology, which are observed for mare milk, is the lysozyme content. Lysozyme is
efficacious in soothing skin and scalp inflammations (Chiofalo et al., 2006). Products of mare
milk farms in Germany are for example creams, lotions, body washes and soaps.
Cheese making on the basis of mare milk is not possible because mare milk does not coagulate
from chymosin. Mare milk is able to coagulate under acidic conditions, so that not only the low
part of casein in comparison to bovine milk is the limiting factor. Also the low concentration
of κ-casein as well as the low interaction between calcium and caseins and a pH-value up to 7.0
may limit the activity of chymosin (Doreau and Martin-Rosset, 2002).
3.3. Digestibility of mare milk proteins
Equine milk protein is very valuable in human nutrition due to its high digestibility of about
95% and superior amino acid composition (Bos et al., 1999; Inglingstad et al., 2010). The high
digestibility can mainly be ascribed to a high susceptibility of the caseins for hydrolysis by
gastric enzymes. Due to the low content of -casein and the large size of equine casein micelles
a soft and readily digestible coagulum is formed in the stomach. Furthermore, equine milk
showed in vitro rapid duodenal degradation of β-lactoglobulin after 30 min leaving only 25%
18
of the protein intact. In contrast, bovine β-lactoglobulin was significantly less digested, and
more than 60% of the protein remained intact. No explanation for the high digestibility of
equine ß-lactoglobulin was discussed so far. Alpha-lactalbumin is in all species the most
resistant protein to human digestion (Inglingstad et al., 2010).
3.4 Health benefits
Several health beneficial effects of mare milk are empirically known. Various indications for
mare milk consumption in naturopathic medicine are common, from cardiovascular diseases up
to the improvement of general physical health. The knowledge about the effects of mare milk
is mainly based on long experience of Russian sanatoria. Various literature from the former
USSR is available, summarized by Lozovich (1995). Positive effects of mare milk on
gastrointestinal ulcers, digestive and cardiovascular diseases are described. Also diarrhea and
gastritis were treated with mare milk or kumyß, which seem to be more effective than raw milk.
Furthermore, mare milk was used to improve the health of patients suffering from tuberculosis,
chronic hepatitis, anaemia and nephritis. Several reasons for the effectiveness were suggested,
like the fatty acid pattern of mare milk or the high content of lysozyme and lactoferrin. Also
peptides from the hydrolysis of ß-casein may be responsible for health effects of mare milk.
Mare milk and kumyß contain peptides with hypotensive activity, but specific research on
bioactive peptides from mare milk is scarce (Doreau and Martin-Rosset, 2002).
A current study of Chen et al. (2010) describes the isolation of 4 peptides from kumyß, which
have angiotensin I-converting enzyme (ACE) inhibitor activities. ACE inhibitors have been
shown to reduce peripheral blood pressure and exert an antihypertensive effect in vivo. One of
the peptides was identified as part of equine ß-casein. Evidence for the health beneficial effects
of mare milk in case of chronic inflammatory bowel diseases were found in other studies
(Schubert et al., 2009). Also in case of atopic dermatitis mare milk seems to have a positive
effect on human health, especially the pruritus decreased in part of the probands after oral intake
of mare milk (Foekel et al., 2009). The health effects of mare milk are certainly a promising
study subject for the future.
3.5 Mare milk as a substitute in case of cow milk protein allergy
Cow milk allergy (CMA) is an IgE mediated allergenic reaction causing a broad range of
symptoms affecting skin, digestive system or lungs. Possible symptoms are skin rash, eczema,
constipation and infantile colic, as well as wheezing. Further symptoms are possible. This
condition affects approximately 2% of infants when nourished with milk replacements on cow
19
milk basis (Heine et al., 2002). The mechanism of an IgE-mediated CMA consists of 2
subsequent phases. Initially, sensitization leads to the development of allergen-specific memory
T cells and of IgE+ memory B cells, which produce high levels of allergen-specific IgE
antibodies after repeated contact with the allergen. If it comes to a contact with the allergen
again, the specific IgE antibodies on mast cells and basophiles bind via the immunoreactive
structures (epitopes) to the allergen (Valenta, 2002; Lisson, 2014).
Among the Caseins, αs1-casein has been identified as the protein with the highest allergenic
potential and many individuals affected by CMA show a high titre of IgE specific for this
protein (Shek et al., 2005; Ruiter et al., 2006; Gaudin et al., 2008; Schulmeister et al., 2009;
Lisson, 2014). Alpha-lactalbumin and ß-lactoglobulin are the main allergens among the whey
proteins. Even though the amino acid sequence of bovine and human α-lactalbumin shows
sequence homology of about 76%, several studies showed the allergenicity of this protein
(Baldo, 1984; Adams et al., 1991). Beta-lactoglobulin is a major allergen provoking CMA. The
genetic variability and the allergenicity of this protein are described in Chapter II. Beta-
lactoglobulin belongs to the ligand-binding protein family of lipocalins, which are known to be
food and airborne allergens (Mantyjarvi et al., 2000). The fact that ß-lactoglobulin is absent in
human milk is thought to play a role in allergenicity. Furthermore, it is resistant to acid digestion
and thus passes through stomach more or less intact, possibly enhancing its allergenic potential
(Heine et al., 2002). In case of an IgE mediated CMA, mare`s milk may be a possible substitute.
In vitro and in vivo studies have shown mare milk to be tolerated by 96% of the children with
CMA. The absence of relevant IgE binding epitopes in equine milk proteins, probably caused
by differences in the amino acid sequence, has been discussed as possible explanation (Businco
et al., 2000; Curadi et al., 2001). Another reason discussed for the better acceptance of mare
milk in case of CMA is the ratio of whey proteins to caseins, which is close to that in human
milk. It has been shown, that the balance between caseins and whey proteins can be an important
factor in determining the allergenicity of bovine milk proteins (Lara-Villoslada et al., 2005).
Furthermore, the high digestibility of equine ß-lactoglobulin, which is in contrast to bovine and
ovine ß-lactoglobulin highly degraded by gastrointestinal enzymes (Inglingstad et al., 2010),
may reduce its allergenic potential.
Although mare milk seems to be a good substitute in case of CMA, it has to be taken into
account that mare milk protein allergy is possible as well. One case of an IgE mediated allergy
to the proteins in mare milk as a consequence to sensitization to horse dander is reported in
literature (Fanta and Ebner, 1998).
20
References
Adams, S. L., Barnett, D., Walsh, B. J., Pearce, R. J., Hill, D. J., Howden, M. E. 1991. Human
IgE-binding synthetic peptides of bovine beta-lactoglobulin and alpha-lactalbumin. In vitro
cross-reactivity of the allergens. Immunol. Cell Biol. 69 (Pt 3):191–197.
Alexander, L. J., Stewart, A. F., Mackinlay, A. G., Kapelinskaya, T. V., Tkach, T. M.,
Gorodetsky, S. I. 1988. Isolation and characterization of the bovine kappa-casein gene. Eur. J.
Biochem. 178(2):395–401.
Baldo, B. A. 1984. Milk allergies. Aust. J. Dairy Technol.(39):120–128.
Bos, C., Mahé, S., Gaudichon, C., Benamouzig, R., Gausserès, N., Luengo, C., Ferrière, F.,
Rautureau, J., Tomé, D. 1999. Assessment of net postprandial protein utilization of 15N-
labelled milk nitrogen in human subjects. Br. J. Nutr. 81(3):221–226.
Brew, K. 2013. α-Lactalbumin. p. 261–273. In P. L. H. McSweeney, and P. F. Fox (eds.).
Advanced Dairy Chemistry. Springer US.
Brew, K., Vanaman, T. C., Hill, R. L. 1968. The role of alpha-lactalbumin and the A protein
in lactose synthetase: a unique mechanism for the control of a biological reaction. Proc Natl
Acad Sci U S A 59(2):491–497.
Brinkmann, J., Koudelka, T., Keppler, J. K., Tholey, A., Schwarz, K., Thaller, G., Tetens, J.
2015. Characterization of an Equine α-S2-casein Variant due to a 1.3 kb Deletion Spanning
Two Coding Exons. DOI: 10.1371/journal.pone.0139700
Businco, L., Giampietro, P. G., Lucenti, P., Lucaroni, F., Pini, C., Di Felice, G., Iacovacci, P.,
Curadi, C., Orlandi, M. 2000. Allergenicity of mare's milk in children with cow's milk allergy.
J. Allergy Clin. Immunol. 105(5):1031–1034.
Caroli, A. M., Chessa, S., Erhardt, G. J. 2009. Invited review: milk protein polymorphisms in
cattle: effect on animal breeding and human nutrition. J. Dairy Sci. 92(11):5335–5352.
21
Caroprese, M., Albenzio, M., Marino, R., Muscio, A., Zezza, T., Sevi, A. 2007. Behavior,
milk yield, and milk composition of machine-and hand-milked Murgese mares. J. Dairy Sci.
90(6):2773–2777.
Chen, Y., Wang, Z., Chen, X., Liu, Y., Zhang, H., Sun, T. 2010. Identification of angiotensin
I-converting enzyme inhibitory peptides from koumiss, a traditional fermented mare's milk. J.
Dairy Sci. 93(3):884–892.
Chiofalo, B., Drogoul, C., Salimei, E. 2006. Other utilization of mare`s and ass`s milk. p.
133–147. In N. Miraglia, W. Martin-Rosset, and European Association for Animal Production
(eds.). Nutrition and Feeding of the Broodmare: EAAP publication No. 120, Campobasso,
Italy, 20. -22. June 2006. Wageningen Academic Publishers.
Conti, A., Godovac-Zimmermann, J., Liberatori, J., Braunitzer, G. 1984. The primary
structure of monomeric beta-lactoglobulin I from horse colostrum (Equus caballus,
Perissodactyla). Hoppe-Seyler's Z. Physiol. Chem. 365(12):1393–1401.
Curadi, M. C., P. G. Giampietro, P. Lucenti, and M. Orlandi. 2001. Use of mare milk in
pediatric allergology., Firenze, 12.-15.06.2001.
Doreau, M., Boulot, S. 1989. Recent knowledge on mare milk production: A review.
Livestock Production Science 22(3-4):213–235.
Doreau, M., Martin-Rosset, W. 2002. Dairy animals: horse. p. 630–637. In H. Roginski, J. A.
Fuquay, and P. F. Fox (eds.). Encyclopedia of dairy sciences. Academic Press, London, UK.
Egito, A. S., Girardet, J.-M., Miclo, L., Mollé, D., Humbert, G., Gaillard, J. 2001.
Susceptibility of equine κ- and β-caseins to hydrolysis by chymosin. International Dairy
Journal 11(11-12):885–893.
Egito, A. S., Miclo, L., López, C., Adam, A., Girardet, J.-M., Gaillard, J. 2002. Separation
and characterization of mares' milk alpha(s1)-, beta-, kappa-caseins, gamma-casein-like, and
proteose peptone component 5-like peptides. J. Dairy Sci. 85(4):697–706.
22
Fanta, C., Ebner, C. 1998. Allergy to mare's milk. Allergy 53(5):539–540.
Flower, D. R., North, A. C., Sansom, C. E. 2000. The lipocalin protein family: Structural and
sequence overview. Biochimica et Biophysica Acta (BBA) - Protein Structure and Molecular
Enzymology 1482(1-2):9–24.
Foekel, C., Schubert, R., Kaatz, M., Schmidt, I., Bauer, A., Hipler, U.-C., Vogelsang, H.,
Rabe, K., Jahreis, G. 2009. Dietetic effects of oral intervention with mare's milk on the
Severity Scoring of Atopic Dermatitis, on faecal microbiota and on immunological
parameters in patients with atopic dermatitis. Int J Food Sci Nutr 60 Suppl 7:41–52.
Fox, P. F., Uniacke, T. 2010. Chemical and physico-chemical properties of equid milk. p. 39.
In Wageningen Academic Publishers (ed.). Book of Abstracts of the 61st Annual Meeting of
the European Association for Animal Production, Heraklion - Crete Island, Greece, 23-27
August 2010.
Gaudin, J.-C., Rabesona, H., Choiset, Y., Yeretssian, G., Chobert, J.-M., Sakanyan, V.,
Drouet, M., Haertle, T. 2008. Assessment of the immunoglobulin E-mediated immune
response to milk-specific proteins in allergic patients using microarrays. Clin. Exp. Allergy
38(4):686–693.
Girardet, J.-M., Miclo, L., Florent, S., Mollé, D., Gaillard, J. 2006. Determination of the
phosphorylation level and deamidation susceptibility of equine β‐casein. Proteomics
6(12):3707–3717.
Godovac-Zimmermann, J., Conti, A., Liberatori, J., Braunitzer, G. 1985. The amino-acid
sequence of beta-lactoglobulin II from horse colostrum (Equus caballus, Perissodactyla): beta-
lactoglobulins are retinol-binding proteins. Biol. Chem. Hoppe-Seyler 366(6):601–608.
Godovac-Zimmermann, J., Conti, A., Sheil, M., Napolitano, L. 1990. Covalent structure of
the minor monomeric beta-lactoglobulin II component from donkey milk. Biol. Chem.
Hoppe-Seyler 371(9):871–879.
23
Godovac-Zimmermann, J., Shaw, D., Conti, A., McKenzie, H. 1987. Identification and the
primary structure of equine alpha-lactalbumin B and C (Equus caballus, Perissodactyla). Biol.
Chem. Hoppe-Seyler 368(4):427–433.
Halliday, J. A., Bell, K., McAndrew, K., Shaw, D. C. 1993. Feline ß-lactoglobulins I, II and
III, and canine ß-lactoglobulins I and II: amino acid sequences provide evidence for the
existence of more tham one gene for ß-lactoglobulin in the cat and the dog. Protein sequences
& data analysis Journal(5):201–205.
Halliday, J. A., Bell, K., Shaw, D. C. 1991. The complete amino acid sequence of feline β-
lactoglobulin II and a partial revision of the equine β-lactoglobulin II sequence. Biochimica et
Biophysica Acta (BBA) - Protein Structure and Molecular Enzymology 1077(1):25–30.
Hambræus, L. 1994. Milk composition in animals and humans. Nutritional aspects. p. 13–23.
In Proceedings of 1st world congress: Dairy products in human health and nutrition, Madrid,
7–10 June 1993, pp. 13–23.
Heine, R. G., Elsayed, S., Hosking, C. S., Hill, D. J. 2002. Cow's milk allergy in infancy. Curr
Opin Allergy Clin Immunol 2(3):217–225.
Hobor, S., Kunej, T., Dovč, P. 2008. Polymorphisms in the kappa casein (CSN3) gene in
horse and comparative analysis of its promoter and coding region. Anim. Genet. 39(5):520–
530.
Hobor, S., Kunej, T., Lenasi, T., Dovč, P. 2006. Kappa casein gen (CSN3) in horse: Kappa
Casein Gen (CSN3) in Horse: Genetic Variability in Exon 1 and 4. Acta agriculturae
Slovenica 88(2):83–89.
Iametti, B. S., Tedeschi, G., Oungre, E., Bonomi, F. 2001. Primary structure of kappa-casein
isolated from mares' milk. J. Dairy Res. 68(1):53–61.
Inglingstad, R. A., Devold, T. G., Eriksen, E. K., Holm, H., Jacobsen, M., Liland, K. H.,
Rukke, E. O., Vegarud, G. E. 2010. Comparison of the digestion of caseins and whey proteins
24
in equine, bovine, caprine and human milks by human gastrointestinal enzymes. Dairy Sci.
Technol. 90(5):549–563.
Kaminogawa, S., McKenzie, H. A., Shaw, D. C. 1984. The amino acid sequence of equine
alpha-lactalbumin. Biochem Int 9(5):539–546.
Kontopidis, G., Holt, C., Sawyer, L. 2004. Invited review: beta-lactoglobulin: binding
properties, structure, and function. J. Dairy Sci. 87(4):785–796.
Lansade, L., Bertrand, M., Boivin, X., Bouissou, M.-F. 2004. Effects of handling at weaning
on manageability and reactivity of foals. Applied Animal Behaviour Science 87(1-2):131–
149.
Lara-Villoslada, F., Olivares, M., Xaus, J. 2005. The balance between caseins and whey
proteins in cow's milk determines its allergenicity. J. Dairy Sci. 88(5):1654–1660.
Lenasi, T., Peterlin, B. M., Dovč, P. 2006. Distal regulation of alternative splicing by splicing
enhancer in equine beta-casein intron 1. RNA 12(3):498–507.
Lenasi, T., Rogelj, I., Dovč, P. 2003. Characterization of equine cDNA sequences for αS1-, β-
and κ-casein. J. Dairy Res. 70(1):29–36.
Leveziel, H., Metenier, L., Guerin, G., Cullen, P., Provot, C., Bertaud, M., Mercier, J. C.
1991. Restriction fragment length polymorphism of ovine casein genes: close linkage between
the alpha s1-, alpha s2-, beta- and kappa-casein loci. Anim. Genet. 22(1):1–10.
Levine, M. A. 1998. Eating horses: the evolutionary significance of hippophagy. Antiquity
72(275):90–100.
Lisson, M. 2014. Appearance of epitopes in bovine milk protein variants, their allergenicity
and potential use in human nutrition. Zugl.: Gießen, Univ., Diss., 2014. 1. Aufl. Édition
scientifique. VVB Laufersweiler, Gießen.
25
Lozovich, S. 1995. Medical uses of whole and fermented mare milk in Russia. Cultured Dairy
Products Journal(30):18–21.
Malacarne, M., Martuzzi, F., Summer, A., Mariani, P. 2002. Protein and fat composition of
mare's milk: some nutritional remarks with reference to human and cow's milk. International
Dairy Journal 12(11):869–877.
Mantyjarvi, R., Rautiainen, J., Virtanen, T. 2000. Lipocalins as allergens. Biochimica et
Biophysica Acta (BBA) - Protein Structure and Molecular Enzymology 1482(1-2):308–317.
Martin, P. D., Miclo, L., Rebours, E., Matéos, A., Miranda, G. 2009. Equus caballus mRNA
encoding CSN1S2 (alphaS2-casein) precursor (GenBank GU196267). Genetique Animale et
Biologie Integrative (GAI), INRA, Domaine de Vilvert, Jouy-En-Josas 78350, France.
unpublished.
Martin, P. D., Szymanowska, M., Zwierzchowski, L., Leroux, C. 2002. The impact of genetic
polymorphisms on the protein composition of ruminant milks. Reprod Nutr Dev 42(5):433–
459.
Martuzzi, F., Doreau, M. 2006. Mare milk composition:recent findings about protein fractions
and mineral content. p. 65–77. In N. Miraglia, W. Martin-Rosset, and European Association
for Animal Production (eds.). Nutrition and Feeding of the Broodmare: EAAP publication
No. 120, Campobasso, Italy, 20. -22. June 2006. Wageningen Academic Publishers.
Matéos, A., Miclo, L., Mollé, D., Dary, A., Girardet, J.-M., Gaillard, J. 2009. Equine alpha
S1-casein: characterization of alternative splicing isoforms and determination of
phosphorylation levels. J. Dairy Sci. 92(8):3604–3615.
Miclo, L., Girardet, J.-M., Egito, A. S., Mollé, D., Martin, P. D., Gaillard, J. 2007. The
primary structure of a low-Mr multiphosphorylated variant of beta-casein in equine milk.
Proteomics 7(8):1327–1335.
26
Milenkovic, D., Martin, P. D., Guérin, G., Leroux, C. 2002. A specific pattern of splicing for
the horse αS1-Casein mRNA and partial genomic characterization of the relevant locus. Genet
Sel Evol 34(4):509.
Miranda, G., Mahé, M.-F., Leroux, C., Martin, P. D. 2004. Proteomic tools to characterize the
protein fraction of Equidae milk. Proteomics 4(8):2496–2509.
Neuhaus, U. 1959. Milch und Milchgewinnung von Pferdestuten. Zeitschrift für Tierzüchtung
und Züchtungsbiologie 73(1‐4):370–392.
Nissen, J. 1997. Enzyklopädie der Pferderassen: Europa. Kosmos, Stuttgart.
Ochirkhuyag, B., Chobert, J.-M., Dalgalarrondo, M., Haertle, T. 2000. Characterization of
mare caseins. Identification of αS1- and αS2- caseins. Lait 80(2):223–235.
Pena, R. N., Sánchez, A., Coll, A., Folch, J. M. 1999. Isolation, sequencing and relative
quantitation by fluorescent-ratio PCR of feline beta-lactoglobulin I, II, and III cDNAs.
Mamm. Genome 10(6):560–564.
Pérez, M. D., Calvo, M. 1995. Interaction of beta-lactoglobulin with retinol and fatty acids
and its role as a possible biological function for this protein: a review. J. Dairy Sci.
78(5):978–988.
Permyakov, E. A., Berliner, L. J. 2000. α-Lactalbumin: Structure and function. FEBS Letters
473(3):269–274.
Pervaiz, S., Brew, K. 1986. Purification and characterization of the major whey proteins from
the milks of the bottlenose dolphin (Tursiops truncatus), the Florida manatee (Trichechus
manatus latirostris), and the beagle (Canis familiaris). Archives of Biochemistry and
Biophysics 246(2):846–854.
27
Phua, S. H., Collins, L., Wood, N., McNabb, L., Davidson, B., Broad, T., Lewis, P. 1992. An
Eco RI restriction fragment length polymorphism at the ovine locus for alpha 1 type III
collagen (COL3A1). Anim. Genet. 23(5):477.
Rijnkels, M. 2002. Multispecies comparison of the casein gene loci and evolution of casein
gene family. J Mammary Gland Biol Neoplasia 7(3):327–345.
Ruiter, B., Tregoat, V., M'rabet, L., Garssen, J., Bruijnzeel-Koomen, C A F M, Knol, E. F.,
Hoffen, E. 2006. Characterization of T cell epitopes in alphas1-casein in cow's milk allergic,
atopic and non-atopic children. Clin. Exp. Allergy 36(3):303–310.
Salimei, E., Fantuz, F. 2012. Equid milk for human consumption. International Dairy Journal
24(2):130–142.
Schubert, R., Kahle, C., Kauf, E., Hofmann, J., Hobert, I., Gruhn, B., Häfer, R., Vogelsang,
H., Jahreis, G. 2009. Dietetic efficacy of mare’s milk for patients with chronic inflammatory
bowel diseases – clinical study. Ernährung/Nutrition 33(7-8):314–321.
Schulmeister, U., Hochwallner, H., Swoboda, I., Focke-Tejkl, M., Geller, B., Nystrand, M.,
Härlin, A., Thalhamer, J., Scheiblhofer, S., Keller, W., Niggemann, B., Quirce, S., Ebner, C.,
Mari, A., Pauli, G., Herz, U., Valenta, R., Spitzauer, S. 2009. Cloning, expression, and
mapping of allergenic determinants of alphaS1-casein, a major cow's milk allergen. J.
Immunol. 182(11):7019–7029.
Selvaggi, M., Pesce Delfino, A. R., Dario, C. 2010. Exon 1 polymorphisms in the equine
CSN3 gene: SNPs distribution analysis in Murgese horse breed. Anim. Biotechnol.
21(4):252–256.
Shek, L. P. C., Bardina, L., Castro, R., Sampson, H. A., Beyer, K. 2005. Humoral and cellular
responses to cow milk proteins in patients with milk-induced IgE-mediated and non-IgE-
mediated disorders. Allergy 60(7):912–919.
Simpson, K., Nicholas, K. 2002. The Comparative Biology of Whey Proteins. J Mammary
Gland Biol Neoplasia 7(3):313–326.
28
Sixt, M. 2011. Untersuchungen zum Nachweis und zum Vorkommen von Mykotoxinen und
Hemmstoffen in Stutenmilch. Univ., Diss.-Gießen, 2011. 1. Aufl. VVB Laufersweiler Verl.,
Giessen.
Stewart, A. F., Bonsing, J., Beattie, C. W., Shah, F., Willis, I. M., Mackinlay, A. G. 1987.
Complete nucleotide sequences of bovine alpha S2- and beta-casein cDNAs: comparisons
with related sequences in other species. Molecular Biology and Evolution 4(3):231–241.
Threadgill, D. W., Womack, J. E. 1990. Genomic analysis of the major bovine milk protein
genes. Nucleic Acids Res 18(23):6935–6942.
Uniacke-Lowe, T. 2011. Studies on equine milk and comparative studies on equine and
bovine milk systems. PhD Thesis. University College Cork, Cork, Ireland.
Uniacke-Lowe, T., Fox, P. F. 2012. Equid Milk: Chemistry, Biochmistry and Processing. p.
491–530. In B. K. Simpson (ed.). Food Biochemistry and Food Processing. Wiley.
Uniacke-Lowe, T., Huppertz, T., Fox, P. F. 2010. Equine milk proteins: Chemistry, structure
and nutritional significance. International Dairy Journal 20(9):609–629.
Valenta, R. 2002. The future of antigen-specific immunotherapy of allergy. Nat Rev Immunol
2(6):446–453.
Williams, E. J., Pal, C., Hurst, L. D. 2000. The molecular evolution of signal peptides. Gene
253(2):313–322.
URL
(1) http://www.bvds.info (29.08.2015)
(2) http://www.stutenmilch.de/unternehmen/ueber-das-gestuet/chronik (29.08.2015)
(3) http://www.gesetze-im-internet.de/bundesrecht/tier-lmhv/gesamt.pdf (29.08.2015)
29
(4) Dmitriev, N. G.; Ernst, L. K. (Hg.) (1989): Animal genetic resources of the
USSR. FAO. Rome (FAO animal production and health paper, 65)
http://www.fao.org/docrep/009/ah759e/ah759e00.htm (29.08.2015)
(5) Breeds of Lifestock: Russian Heavy Draft. Oklahoma State University.
http://www.ansi.okstate.edu/breeds/horses/ (29.08.2015)
(6) http://www.dqha.de/zucht/zuchtziel/ (29.08.2015)
(7) http://www.criollo-crzvd.de/criollo/rassestandard/ (29.08.2015)
31
CHAPTER II:
DNA-BASED ANALYSIS OF PROTEIN VARIANTS REVEALS DIFFERENT
GENETIC VARIABILITY OF THE PARALOGOUS EQUINE ß-LACTOGLOBULIN
GENES LGB1 AND LGB2
J. Brinkmann 1, V. Jagannathan 2,3, C. Drögemüller 2, S. Rieder 3,4, T. Leeb 2, G. Thaller 1 and
J. Tetens 1
1 Institute of Animal Breeding and Husbandry, Christian-Albrechts-University Kiel, Kiel,
Germany
2 Institute of Genetics, University of Bern, Bern, Switzerland
3 Swiss Competence Center of Animal Breeding and Genetics, University of Bern, Bern
University of Applied Sciences HAFL and Agroscope, Bern, Switzerland
4 Agroscope, Swiss National Stud Farm, Avenches, Switzerland
Submitted for Publication in Livestock Science
32
Abstract
The genetic variability of milk protein genes may influence the nutritive value or processing
and functional properties of the milk. While numerous protein variants are known in ruminants,
knowledge about milk protein variability in horses is still limited. Mare’s milk is, however,
produced for human consumption in many countries. Beta-lactoglobulin belonging to the
protein family of lipocalins, which are known as common food- and airborne allergens, is a
major whey protein. It is absent from human milk and thus a key agent in provoking cow’s milk
protein allergy. Mare’s milk is, however, usually better tolerated by most affected people.
Several functions of -lactoglobulin have been discussed, but its ultimate physiological role
remains unclear. In the current study, the open reading frames of the two equine -lactoglobulin
paralogues LGB1 and LGB2 were resequenced in 249 horses belonging to 14 different breeds
in order to predict the existence of protein variants at the DNA-level. Thereby, only a single
signal peptide variant of LGB1, but 10 different putative protein variants of LGB2 were
identified. In horses, both genes are expressed and in such this is a striking previously unknown
difference in genetic variability between the two genes. It can be assumed that LGB1 is the
ancestral paralogue, which has an essential function causing a high selection pressure. As horses
have very low milk fat content this unknown function might well be related to vitamin-uptake.
Further studies are, however, needed, to elucidate the properties of the different gene products.
Keywords: horse, whey proteins, milk protein variants, -lactoglobulin
Implications
Scientific interest in mare milk arose since positive effects on human health were observed.
Furthermore, mare’s milk is discussed as a possible substitute for cow milk in case of a cow
milk protein allergy. An improved knowledge about the protein fraction of mare’s milk and
especially of the genetic structure and variability of the milk protein genes may lead to a better
understanding of these effects. The results of this study are a helpful tool for further research in
allergenicity of mare’s milk as well as well as its effects on human health.
Introduction
Whey proteins account for approximately 40% of total equine milk protein, which is
intermediate between human and bovine milk with shares of about 50% and 20%, respectively.
In most species, α-lactalbumin and β-lactoglobulin represent the major whey proteins, while
33
the latter is absent from the milk of humans, camels, lagomorphs and rodents. In horses, each
of the two proteins accounts for ~30% of the whey protein fraction (Uniacke-Lowe et al., 2010).
Beta-lactoblobulin belongs to the ligand-binding protein family of lipocalins, which are known
to be major food and airborne allergens (Mäntyjärvi et al., 2000). Beta-lactoglobulin generally
binds retinol and in many species also fatty acids, but not in horse or pig (Pérez and Calvo,
1995). Furthermore, roles as signalling molecule or activity-modulator have been discussed
(Kontopidis et al., 2004). However, no definite physiological function of the protein has been
determined until today.
Two fractions of equine ß-lactoglobulin, ß-lactoglobulin I and ß-lactoglobulin II, have been
identified arising from the presence of two paralogous genes. This is also the case in other
species such as donkey and dog, while in cats e.g. even three paralogues are present (Halliday
et al., 1993; Godovac-Zimmermann et al., 1990).
Beta-lactoglobulin is known to be a major allergen provoking cow milk protein allergy (CMA),
an IgE mediated allergenic reaction causing a broad range of symptoms, such as atopic
dermatitis, constipation and infantile colic. This condition affects approximately 2% of infants
when nourished with milk replacements on cow milk basis. In these cases, mare`s milk can be
regarded as a possible substitute, which is better tolerated by most of the affected children
(Businco et al., 2000; Curadi et al., 2001). Moreover, positive effects of mare’s milk
consumption on diseases like atopic dermatitis (Foekel et al., 2009), Morbus Crohn (Schubert
et al., 2009) or cardiovascular diseases (Chen et al., 2010) have been reported.
There are many studies about whey protein variability in cattle and other species (Caroli et al.,
2009; Selvaggi et al., 2014), and also in the donkey different genetic variants of whey proteins
have been reported (Herrouin et al., 2000; Cunsolo et al., 2007; Chianese et al., 2013), but the
knowledge about equine whey proteins genetic variability is limited. However, the presence of
different genetic variants might alter the allergenicity, but also other properties such as the
nutritive value of the milk. Furthermore, milk protein variants are valuable tools for breed
characterizations, biodiversity investigations, and evolutionary studies (Caroli et al., 2009). The
major aim of the current study was therefore to identify genetic -lactoglobulin variants in the
domestic horse. Furthermore, a hypothesis regarding the evolution of different variants was
established.
34
Material and methods
Animals and samples
Genomic DNA was extracted from full blood and hair samples of 198 horses from 8 different
breeds that are actually used for mare’s milk production in Germany applying a modified
protocol according to Miller et al. (1988). The animals were selected to be as unrelated as
possible. Additionally, individual whole genome sequence variant calling data of a total 51
horses of 10 different breeds available from other studies were incorporated in the analyses (for
details on individual coverage see Supplemental Table 1). Bioinformatic details were reported
before (Drögemüller et al., 2014; Frischknecht et al., 2014). In total, 249 horses belonging to
14 different breeds or populations were analyzed (Table 1).
Table 1 Animals used in the sequencing of equine LGB1 and LGB2 (n=249)
Breed Acronym Sanger1 [N] WGS2 [N] Total [N]
Akhal-Teke AK 1 1
Dairy Crossbreed3 CB 21 21
Argentine Criollo Horse CR 27 27
Fjord Horse FJ 3 3
Franches-Montagnes FM 26 26
Haflinger HF 39 1 40
Icelandic Horse IC 25 1 26
Dutch Warmblood (KWPN) WBNL 1 1
Quarter Horse QH 22 3 25
Russian Heavy Draft RU 24 24
Shetlandpony SP 2 2
Swiss Warmblood WBCH 2 2
UK Warmblood WBUK 2 2
German Warmblood WBD 37 12 47
Total 198 51 249
1 Sequencing data from individual Sanger resequencing of open reading frames 2 Sequencing data from Illumina HiSeq whole genome sequencing (WGS) 3 Crossbreed mainly composed of German Riding Pony, Haflinger Horse, Connemara Pony and New Forrest
Pony that has been intuitively bred for higher milk yield
DNA sequencing
A total of 12 Primer pairs (Supplemental Table 2) were designed to amplify all exons
contributing to the open reading frames of the genes and adjacent intronic regions using the
35
Primer 3 software (Rozen and Skaletsky, 2000) based on the genomic reference sequences of
both lactoglobulin genes (Acc. No NC_009168.2).
PCR amplification and DNA sequencing were done as described by Gallinat et al. (2013). The
obtained sequences were analyzed and compared with the genomic reference sequence (Acc.
No. NC_009168.2) using the software Sequencher 4.9 (Gene Codes Corp., Ann Arbor, MI).
Results
The open reading frames of equine LGB1 and LGB2 were successfully sequenced in 223 horses
each (Table 2). The analysis revealed a previously unknown signal peptide variant of the LGB1
gene as well as 10 non-synonymous variants of the LGB2 gene, 8 of which were considered
novel. A preliminary nomenclature was established for these variants. The counted allele
frequencies of the variants of LGB1 and LGB2 in samples of > 15 animals per breed are given
in Table 2.
36
Table 2 Number of successfully sequenced animals per breed and counted allele frequencies for LGB1 and LGB2 variants
LGB1 LGB2
Breed1 N A A* N A B1 B2 C1 C2 D1 D2 E F G
AK 1 +2 + 1 - + + - - - - - - -
CB 19 1 -3 18 0.39 - - 0.16 - - 0.14 0.28 - 0.03
CR 25 1 - 27 0.48 0.24 0.06 0.12 - 0.04 0.06 - - -
FJ 3 + - 2 - - - + - - - - - -
FM 26 1 - 26 0.5 0.04 - 0.27 - 0.11 0.07 - - -
HA 38 1 - 38 0.45 0.02 0.04 0.25 - - 0.2 0.04 - -
IC 23 1 - 25 0.58 - 0.02 0.26 0.02 0.06 0.02 0.04 - -
WBNL4 1 + - 1 + + - - - - - - - -
QH 22 0.98 0.02 19 0.45 0.18 0.06 0.15 - - 0.13 0.03 - -
RD 17 1 - 22 0.93 - - 0.02 - - 0.05 - - -
SP 2 + - 2 + - - + - - - - - -
WBCH4 2 + - 2 + + - + - - - - - -
WBUK4 2 + - 2 + - - + - + - - - -
WBD4 42 1 - 36 0.46 0.38 - 0.05 - - 0.08 - 0.03 -
WBTOTAL4 73 1 - 41 0.45 0.35 - 0.09 - 0.01 0.07 - 0.03 -
1 For an explanation of breed acronyms see Table 1 2 A plus sign indicates that the correspondent variant is present in, but the number of animals is too low to determine allele frequencies (N3) 3 A minus sign indicates that the correspondent variant is not present in that breed 4 Breeds belonging to the European Warmblood population (Dutch, Swiss, UK and German Warmblood) were also analysed jointly as WBTOTAL
37
LGB1
In most of the analyzed animals no differences to the genomic reference sequence
(NC_009168.2:38250776-38255515) were found. Only one Quarter Horse as well as the Akhal-
Teke were found to be heterozygous for a previously unknown A>G transition at position 37
of the open reading frame leading to a predicted amino acid exchange from methionine to valine
at position 13 of the signal peptide.
LGB2
Eight nonsynonymous mutations were identified within the LGB2 gene, 5 of which were
previously undescribed. Based on the observed genotypes, the presence of 10 distinct protein
variants was predicted. Preliminary designations (LGB2*A – LGB2*G) were assigned to these
variants, which will be used throughout the following sections; for details see Table 3 and
Figure 1.
The most common and probably ancestral (see below) LGB2 variant, which was thus designated
LGB*A did occur in all breeds except for Fjord Horses and the single Akhal-Teke. It differs
from the genomic GenBank reference sequence (NC_009168.2:38266531-38271345) in a
single position corresponding the 164th nucleotide of the open reading frame leading to the
presence of alanine in position 55 of the protein (Table 3 and Figure 1). In this position, the
reference sequence NC_009168.2 codes for valine; the variant was termed LGB*B1. It was
present in most of the examined breed samples except for the crossbred ponies, Fjord Horses,
Icelandic Horses, Russian Heavy Drafts, Shetlandponies and UK-Warmbloods. The presence
of an additional transversion (c.394 G>T; Ala132Ser) that was found in Akhal-Teke, Criollo
Horses, Haflinger Horses, Icelandic Horses and Quarter Horses leads to variant LGB2*B2. In
most breeds but Fjord Horses and Dutch Warmblood, a variant denoted as LGB2*C1 was
identified that differs from variant A by an additional nonsynonymous transition at position 230
of the coding sequence (p.Arg77His). A further nucleotide exchange leading to a predicted
replacement of alanine by threonine on position 83 of the protein, which was only found in the
Icelandic Horse, differentiates LGB*C2 from that variant. Only in Criollos, Franches-
Montagnes and Icelandic Horses, variant LGB2*D1 was found, which differs from variant A
by the presence of an additional mutation in position 157 of the open reading frame (c.157
G>A; p.Glu53Lys), also present in the mRNA reference sequence NM_001082494). A further
nonsynonymous exchange (c.515 G>C; p.Pro172Arg) leads to variant LGB2*D2, which
completely corresponds to the mRNA reference sequence (NM_001082494).This variant was
38
found at low frequencies in most of the breeds except for Akhal-Teke, Fjord Horses, Dutch
Warmblood, Shetlandponies, Swiss Warmblood, and UK-Warmblood. Particularly in the
crossbreed, but also in Haflinger, Icelandic Horses and Quarter Horses, variant LGB2*E was
found. This variant shows a nonsynonymous transversion in position 520 of the coding
sequence (c.520 G>C; p.Gly174Arg) as compared to variant A. The same mutation but in
conjunction with the mutation defining LGB2*B1 characterizes LGB2*G, which most likely
arose by recombination and was only detected in the crossbred ponies. Very rare and only found
in the German Warmblood Horse was variant LGB2*F, which differs from variant A by a
transversion from A to T in position 70 of the open reading frame leading to a predicted
exchange of threonin for serin in codon 24.
Table 3 Sequence variation and resulting amino acid substitutions for LGB2 variants
Position1
LGB2 variant
A B12 B2 C1 C2 D1 D23 E F G4
70
24
ACG
Thr
TCG
Ser
157
53
GAG
Glu
AAG
Lys
AAG
Lys
164
55
GCC
Ala
GTC
Val
GTC
Val
GTC
Val
230
77
CGC
Arg
CAC
His
CAC
His
247
83
GCA
Ala
ACA
Thr
394
132
GCT
Ala
TCT
Ser
515
172
CCG
Pro
CTG
Leu
520
174
GGG
Gly
CGG
Arg
CGG
Arg
1 The upper number denotes the position within the coding sequence and the lower number within the protein 2 Variant B1 corresponds to the genomic reference sequence (NC_009168.2:38266531-38271345) 3 Variant D2 corresponds to mRNA sequence NM_001082494 4 Variant G is probably a recombinant between variants B1 and E
39
Discussion
Methodology
In the current study, we resequenced the open reading frames of the equine LGB1, and LGB2
genes to identify putative protein variants at the DNA level. This is advantageous over protein
analyses, because DNA material such as hair samples can more easily be obtained than milk
samples. Furthermore, DNA sequencing directly identifies the mutations underlying the protein
variants and is also able to detect variation that only causes minor changes of the protein
properties, which can go undetected in standard protein analyses. However, nothing can be said
about the actual expression of the variants or mutations that affect splicing (Gallinat et al.,
2013). Thus, the designations assigned to the variants identified at the DNA level within this
study have to be regarded as preliminary and are subject to confirmation.
Although focussed on breeds that are actually kept for milk production, this study covers a
comparatively wide range of partly distantly related breeds, which increases the amount of
variation. The sample size per breed is, however, small so that the counted allele frequencies
have to be taken with care.
Breed specific variation
Only little variability was found in LGB1, while 10 different variants were found in LGB2. The
highest degree of variability was seen in the Icelandic Horses with 7 variants one of which was
private to the breed (LGB2*C2) This is notable as the breed originates from a small founder
population brought to Iceland approximately 1100 years ago and remained isolated since then
(Adalsteinsson, 1981). However, it has to be taken into account that samples were not collected
on Iceland, because Hreidarsdóttir et al. (2014) reported a higher diversity in terms of effective
founders for abroad as compared to the Icelandic population.
In each the Criollo, Haflinger and Quarter Horse breeds, 6 different variants of LGB2 were
detected. Notably, the variant LGB2*D1 occurs in Criollos and Icelandic Horses, but also in
Franches-Montagnes at a considerable frequency (Table 2). The lowest amount of variability
was found in the Russian Heavy Drafts, which almost uniformly carried variant LGB2*B with
an allele frequency of 0.93. This breed has been founded in the 1860s by grading up native
horses with Ardennes. The first world war, followed by the civil war, nearly wiped out the
breed, the stock of purebreds was reconstituted and isolated as an independent breed not before
1937 (Dmitriev and Ernst, 1989). Thus, the breed faced a serious bottleneck, which might be
an explanation for the low amount of variation.
40
The Warmblood samples from different countries (Germany, Switzerland, United Kingdom and
The Netherlands) can principally be considered belonging to the same horse breed or to be at
least very similar. Thus, these samples were also jointly analyzed revealing that the major
variants in this breed are LGB2*A and B1. This is different from Franches-Montagnes Horses,
which can also be considered as heavy Warmbloods, as variant B1 is rare in this breed, while
C1 is rather common.
Evolution of LGB2 variants
Due to the small sample size, conclusions about the evolution of the identified gene variants of
LGB2 are difficult, especially for rare variants. The determination of a variant is only
unequivocally possible on haplotypes with not more than one heterozygous position. On the
basis of the available information, we derived a simple model for the evolution of variants under
the constraint of as few mutations as possible (Figure 1).
The variant LGB2*A was also found by BLAST analysis in the LGB2 sequence of the donkey
(Equus asinus, lactoglobulin II variants B and C, GenBank accession number HM012799.1 and
HM012800.1). The domestic donkey represents a sister lineage of modern horses and shares a
most common recent ancestor with horses 4.0 – 4.5 Mya ago (Orlando et al., 2013) indicating
that LGB2*A is an ancestral variant.
Variant LGB2*B1 is also common in most of the examined breeds and was assumed to have
evolved from variant LGB2*A as a result of a single nucleotide exchange (c.164 C>T). From
this variant, LGB2*B2 evolved by means of an additional nonsynonymous mutation
(c.394G>T; p.Ala132Ser). The variants LGB2*C1, LGB2*D1, LGB2*E, and LGB2*F (c.164
T>G) each differ in a single amino acid position from variant A (Table 3 and Figure 1).
Subsequent mutations of variants C1 and D1 could have given rise to the variants LGB2*C2
and LGB2*D2. Finally, we observed variant LGB2*G, which is only present in the crossbred
animals and is characterized by the presence of both the mutations defining variants B1 and E,
respectively. Thus, it probably represents a recombinant haplotype.
41
Figure 1 Most likely evolution of equine LGB2 gene variants
Variability and function
The two paralogous lactoglobulin genes LGB1 (Gene ID 100034193) and LGB2 (Gene ID
100034194) are located adjacently on equine chromosome 25 with a distance of ~10 kbp.
Equine ß-lactoglobulin II comprises 163 amino acids, one more than equine ß-lactoglobulin I
(Halliday et al., 1991). Sequence homology between the two proteins is 70%, the amino acid
sequence differs in 52 positions (Conti et al., 1984; Godovac-Zimmermann et al., 1985). In
contrast to ruminants, which have been shown to possess LGB pseudogenes (Passey and
Mackinlay, 1995; Folch et al., 1996), both genes are expressed. In the current study, LGB1 was
found to be strongly conserved across breeds, while LGB2 was highly variable. This indicates
a higher selective pressure on LGB1 and suggests that it is the ancestral paralogue, which has a
crucial function that has to be maintained. The actual function of -lactoglobulin has, however,
not been determined to date. It seems likely that it acts as a transporter, which is the case for
many lipocalins (Kontopidis et al., 2004). Beta-lactoblobulin has been shown to bind small
42
hydrophobic compounds such as retinol and other lipophilic vitamins (Kontopidis et al., 2004;
Mensi et al., 2013), isothiocyanate (Keppler et al., 2014), and various polyphenols (Riihimäki
et al., 2008; Wu et al., 2013) as well as fatty acids, which is, however, not the case for equine
-lactoglobulin (Pérez and Calvo, 1995). Especially the role as a transporter for retinol and
carotenoids has been discussed, but it has been argued that retinol is highly soluble in the fat
phase of milk and will probably be transported from mother to offspring by that route
(Kontopidis et al., 2004). Equine milk, however, has a low fat content making it possible that
this function is more essential in horses than in other species with a higher fat content such as
cattle or humans. In fact, bovine -lactoglobulin is much more variable than equine -
lactoglobulin (Caroli et al., 2009) and the protein is completely absent from human milk
(Uniacke-Lowe et al., 2010). It seems possible, that the definite function of ß-lactoglobulin
varies from species to species (Kontopidis et al., 2004).
Allergenic potential
Lipocalins are common food and airborne allergens (Mäntyjärvi et al., 2000). In case of a cow
milk protein allergy (CMA), ß-lactoglobulin appears to be the main allergen, especially because
it is absent from human milk and resistant to acid digestion, especially in cattle and goats (Heine
et al., 2002). Inglingstad et al. (2010) showed that equine ß-lactoglobulin on the other hand is
highly degraded by gastrointestinal enzymes. Furthermore, in vitro and in vivo studies have
shown that mare’s milk is tolerated by 96% of the children with CMA. The absence of relevant
IgE binding epitopes in equine milk proteins, probably caused by differences in the amino acid
sequence, has been discussed as possible explanation (Businco et al., 2000; Curadi et al., 2001).
Also donkey’s milk is better tolerated by CMA patients (Iacono et al., 1992; Monti et al., 2012),
which has been linked to quantitative LGB2 polymorphisms leading to a very low -
lactoglobulin content (Chianese et al., 2013).
For cattle, it has been shown that genetic milk protein variants are leading to modifications of
the relevant epitopes and thus do change the allergenic potential of milk (Lisson et al., 2013).
It would thus be worth investigating how the high degree of variability at the equine LGB2
locus affects allergenicity of mare’s milk.
Acknowledgements
This project was founded by the German Federal Ministry of Education and Research (Bonn,
Germany) within the competence network “Food Chain Plus” (FoCus, grant no. 0315539A).
43
The authors would like to thank all the mare’s milk producers for providing samples, Julia
Tetens for her help with sample collection and Gabriele Ottzen-Schirakow for expert technical
assistance.
References
Adalsteinsson, S. 1981. Origin and conservation of farm animal populations in Iceland.
Zeitschrift für Tierzüchtung und Züchtungsbiologie 98(1-4):258–264.
Businco, L., Giampietro, P. G., Lucenti, P., Lucaroni, F., Pini, C., Di Felice, G., Iacovacci, P.,
Curadi, C., Orlandi, M. 2000. Allergenicity of mare’s milk in children with cow’s milk
allergy. Journal of Allergy and Clinical Immunology 105(5):1031–1034.
Caroli, A. M., Chessa, S., Erhardt, G. J. 2009. Invited review: milk protein polymorphisms in
cattle: effect on animal breeding and human nutrition. J. Dairy Sci. 92(11):5335–5352.
Chen, Y., Wang, Z., Chen, X., Liu, Y., Zhang, H., Sun, T. 2010. Identification of angiotensin
I-converting enzyme inhibitory peptides from koumiss, a traditional fermented mare's milk. J.
Dairy Sci. 93(3):884–892.
Chianese, L., Simone, C. de, Ferranti, P., Mauriello, R., Costanzo, A., Quarto, M., Garro, G.,
Picariello, G., Mamone, G., Ramunno, L. 2013. Occurrence of qualitative and quantitative
polymorphism at donkey beta-Lactoglobulin II locus. Food. Res. Int. 54(1):1273–1279.
Conti, A., Godovac-Zimmermann, J., Liberatori, J., Braunitzer, G., MINORI, D. 1984. The
Primary Structure of Monomeric β-Lactoglobulin I from Horse Colostrum (Equus caballus,
Perissodactyla). Physiol. Chem. Hoppe-Seyler 365(2):1393–1402.
Cunsolo, V., Costa, A., Saletti, R., Muccilli, V., Foti, S. 2007. Detection and sequence
determination of a new variant beta-lactoglobulin II from donkey. Rapid Commun. Mass
Spectrom. 21(8):1438–1446.
Curadi, M. C., P. G. Giampetro, P. Lucenti, and M. Orlandi. 2001. Use of mare milk in
pediatric allergology., Firenze, 12.-15.06.2001.
44
Dmitriev, N. G., and L. K. Ernst. 1989. Animal genetic resources of the USSR. FAO animal
production and health paper 65, Rome.
Drögemüller, M., Jagannathan, V., Welle, M. M., Graubner, C., Straub, R., Gerber, V.,
Burger, D., Signer-Hasler, H., Poncet, P.-A., Klopfenstein, S., Niederhäusern, R. von, Tetens,
J., Thaller, G., Rieder, S., Drögemüller, C., Leeb, T. 2014. Congenital hepatic fibrosis in the
Franches-Montagnes horse is associated with the polycystic kidney and hepatic disease 1
(PKHD1) gene. PloS ONE 9(10):e110125.
Foekel, C., Schubert, R., Kaatz, M., Schmidt, I., Bauer, A., Hipler, U.-C., Vogelsang, H.,
Rabe, K., Jahreis, G. 2009. Dietetic effects of oral intervention with mare's milk on the
Severity Scoring of Atopic Dermatitis, on faecal microbiota and on immunological
parameters in patients with atopic dermatitis. Int J Food Sci Nutr 60 Suppl 7:41–52.
Folch, J. M., Coll, A., Hayes, H. C., Sànchez, A. 1996. Characterization of a caprine beta-
lactoglobulin pseudogene, identification and chromosomal localization by in situ
hybridization in goat, sheep and cow. Gene 177(1-2):87–91.
Frischknecht, M., Neuditschko, M., Jagannathan, V., Drögemüller, C., Tetens, J., Thaller, G.,
Leeb, T., Rieder, S. 2014. Imputation of sequence level genotypes in the Franches-Montagnes
horse breed. Genet. Sel. Evol. 46:63.
Gallinat, J. L., Qanbari, S., Drögemüller, C., Pimentel, E. C. G., Thaller, G., Tetens, J. 2013.
DNA-based identification of novel bovine casein gene variants. J. Dairy Sci. 96(1):699–709.
Godovac-Zimmermann, J., Conti, A., Liberatori, J., Braunitzer, G. 1985. The amino-acid
sequence of beta-lactoglobulin II from horse colostrum (Equus caballus, Perissodactyla):
beta-lactoglobulins are retinol-binding proteins. Biol. Chem. Hoppe-Seyler 366(6):601–608.
Godovac-Zimmermann, J., Conti, A., Sheil, M., Napolitano, L. 1990. Covalent structure of
the minor monomeric beta-lactoglobulin II component from donkey milk. Biol. Chem.
Hoppe-Seyler 371(9):871–879.
45
Halliday, J. A., Bell, K., McAndrew, K., Shaw, D. C. 1993. Feline ß-lactoglobulins I, II and
III, and canine ß-lactoglobulins I and II: amino acid sequences provide evidence for the
existence of more tham one gene for ß-lactoglobulin in the cat and the dog. Protein Sequences
& Data Analysis Journal(5):201–205.
Halliday, J. A., Bell, K., Shaw, D. C. 1991. The complete amino acid sequence of feline beta-
lactoglobulin II and a partial revision of the equine beta-lactoglobulin II sequence. Biochim.
Biophys. Acta 1077(1):25–30.
Heine, R. G., Elsayed, S., Hosking, C. S., Hill, D. J. 2002. Cow's milk allergy in infancy. Curr
Opin Allergy Clin Immunol 2(3):217–225.
Herrouin, M., Mollé, D., Fauquant, J., Ballestra, F., Maubois, J. L., Léonil, J. 2000. New
genetic variants identified in donkey's milk whey proteins. J. Protein Chem. 19(2):105–115.
Hreidarsdóttir, G., Árnason, T., Svansson, V., Hallson, J. 2014. Analysis of the history and
population structure of the Icelandic horse using pedigree data and DNA analyses. Icel. Agric.
Sci.(27):63–79.
Iacono, G., Carroccio, A., Cavataio, F., Montalto, G., Soresi, M., Balsamo, V. 1992. Use of
ass' milk in multiple food allergy. J. Pediatr. Gastroenterol. Nutr. 14(2):177–181.
Inglingstad, R. A., Devold, T. G., Eriksen, E. K., Holm, H., Jacobsen, M., Liland, K. H.,
Rukke, E. O., Vegarud, G. E. 2010. Comparison of the digestion of caseins and whey proteins
in equine, bovine, caprine and human milks by human gastrointestinal enzymes. Dairy
Science & Technol. 90(5):549–563.
Keppler, J. K., Koudelka, T., Palani, K., Stuhldreier, M. C., Temps, F., Tholey, A., Schwarz,
K. 2014. Characterization of the covalent binding of allyl isothiocyanate to β-lactoglobulin by
fluorescence quenching, equilibrium measurement, and mass spectrometry. J. Biomol. Struct.
Dyn. 32(7):1103–1117.
Kontopidis, G., Holt, C., Sawyer, L. 2004. Invited review: beta-lactoglobulin: binding
properties, structure, and function. J. Dairy Sci. 87(4):785–796.
46
Lisson, M., Lochnit, G., Erhardt, G. 2013. Genetic variants of bovine β- and κ-casein result in
different immunoglobulin E-binding epitopes after in vitro gastrointestinal digestion. J. Dairy
Sci. 96(9):5532–5543.
Mäntyjärvi, R., Rautiainen, J., Virtanen, T. 2000. Lipocalins as allergens. Biochim. Biophys.
Acta 1482(1-2):308–317.
Mensi, A., Choiset, Y., Rabesona, H., Haertlé, T., Borel, P., Chobert, J.-M. 2013. Interactions
of β-lactoglobulin variants A and B with Vitamin A. Competitive binding of retinoids and
carotenoids. J. Agric. Food Chem. 61(17):4114–4119.
Miller, S. A., Dykes, D. D., Polesky, H. F. 1988. A simple salting out procedure for extracting
DNA from human nucleated cells. Nucleic Acids Res. 16(3):1215.
Monti, G., Viola, S., Baro, C., Cresi, F., Tovo, P. A., Moro, G., Ferrero, M. P., Conti, A.,
Bertino, E. 2012. Tolerability of donkey's milk in 92 highly-problematic cow's milk allergic
children. J. Biol. Regul. Homeost. Agents 26(3 Suppl):75–82.
Orlando, L., Ginolhac, A., Zhang, G., Froese, D., Albrechtsen, A., Stiller, M., Schubert, M.,
Cappellini, E., Petersen, B., Moltke, I., Johnson, P. L. F., Fumagalli, M., Vilstrup, J. T.,
Raghavan, M., Korneliussen, T., Malaspinas, A.-S., Vogt, J., Szklarczyk, D., Kelstrup, C. D.,
Vinther, J., Dolocan, A., Stenderup, J., Velazquez, A. M. V., Cahill, J., Rasmussen, M.,
Wang, X., Min, J., Zazula, G. D., Seguin-Orlando, A., Mortensen, C., Magnussen, K.,
Thompson, J. F., Weinstock, J., Gregersen, K., Røed, K. H., Eisenmann, V., Rubin, C. J.,
Miller, D. C., Antczak, D. F., Bertelsen, M. F., Brunak, S., Al-Rasheid, K. A. S., Ryder, O.,
Andersson, L., Mundy, J., Krogh, A., Gilbert, M. T. P., Kjær, K., Sicheritz-Ponten, T., Jensen,
L. J., Olsen, J. V., Hofreiter, M., Nielsen, R., Shapiro, B., Wang, J., Willerslev, E. 2013.
Recalibrating Equus evolution using the genome sequence of an early Middle Pleistocene
horse. Nature 499(7456):74–78.
Passey, R. J., Mackinlay, A. G. 1995. Characterisation of a Second, Apparently Inactive,
Copy of the Bovine beta-lactoglobulin Gene. Eur J Biochem 233(3):736–743.
47
Pérez, M. D., Calvo, M. 1995. Interaction of beta-lactoglobulin with retinol and fatty acids
and its role as a possible biological function for this protein: a review. J. Dairy Sci.
78(5):978–988.
Riihimäki, L. H., Vainio, M. J., Heikura, J. M. S., Valkonen, K. H., Virtanen, V. T., Vuorela,
P. M. 2008. Binding of phenolic compounds and their derivatives to bovine and reindeer beta-
lactoglobulin. J. Agric. Food Chem. 56(17):7721–7729.
Rozen, S., Skaletsky, H. 2000. Primer3 on the WWW for general users and for biologist
programmers. Methods Mol. Biol. 132:365–386.
Schubert, R., Kahle, C., Kauf, E., Hofmann, J., Hobert, I., Gruhn, B., Häfer, R., Vogelsang,
H., Jahreis, G. 2009. Dietetic efficacy of mare’s milk for patients with chronic inflammatory
bowel diseases – clinical study. Ernährung/Nutrition 33(7-8):314–321.
Selvaggi, M., Laudadio, V., Dario, C., Tufarelli, V. 2014. Major proteins in goat milk: an
updated overview on genetic variability. Molecular biology reports 41(2):1035–1048.
Uniacke-Lowe, T., Huppertz, T., Fox, P. F. 2010. Equine milk proteins: Chemistry, structure
and nutritional significance. International Dairy Journal 20(9):609–629.
Wu, X., Dey, R., Wu, H. U., Liu, Z., He, Q., Zeng, X. 2013. Studies on the interaction of -
epigallocatechin-3-gallate from green tea with bovine β-lactoglobulin by spectroscopic
methods and docking. Int J Dairy Technol 66(1):7–13.
49
CHAPTER III:
GENETIC VARIABILITY OF THE EQUINE CASEIN GENES
J. Brinkmann 1, V. Jagannathan 2,3, C. Drögemüller 2,3, S. Rieder 3,4, T. Leeb 2,3, G. Thaller 1
and J. Tetens 1
1 Institute of Animal Breeding and Husbandry, Christian-Albrechts-University Kiel, Kiel,
Germany
2 Institute of Genetics, University of Bern, Bern, Switzerland
3 Swiss Competence Center of Animal Breeding and Genetics, University of Bern, Bern
University of Applied Sciences HAFL and Agroscope, Bern, Switzerland
4 Agroscope, Swiss National Stud Farm, Avenches, Switzerland
Submitted for Publication to Journal of Dairy Science
50
Interpretive Summary
Mare milk is known to exhibit several positive effects on human health. Furthermore, mare
milk can be used as hypoallergenic foodstuff in case of cow milk protein allergy. With this
study, the knowledge about the structure and genetic variability of the equine casein genes was
improved. A total of 31 putative casein gene isoforms were detected by re-sequencing of the
four casein genes CSN1S1, CSN2, CSN1S2 and CSN3, 26 of them were considered novel. The
results are a useful tool for further studies about effects of mare milk on human health.
Abstract
The casein genes are known to be highly variable in typical dairy species such as cattle and
goat, but the knowledge about equine casein genes is limited. Nevertheless, mare’s milk
production and consumption is gaining more and more importance because of its high nutritive
value, use in naturopathy and hypoallergenic properties with respect to cow milk protein
allergy. In the current study, the open reading frames of the four casein genes CSN1S1 (αs1-
casein), CSN2 (ß-casein), CSN1S2 (αs2-casein) and CSN3 (κ-casein) were resequenced in 253
horses of 14 breeds. The analysis revealed 21 non-synonymous nucleotide exchanges, as well
as 11 synonymous nucleotide exchanges, leading to a total of 31 putative protein isoforms, 26
of which considered novel, predicted at the DNA-level. Although the majority of the alleles
need to be confirmed at the transcript and protein level, a preliminary nomenclature was
established for the equine casein alleles.
Introduction
The genetic diversity of milk protein genes in typical dairy species such as cattle (Caroli et al.,
2009) and goat (Selvaggi et al., 2014) has been considered in numerous studies and distinct
genetic variants have been described at both the protein and the DNA level. Despite a
longstanding tradition of mare’s milk consumption in countries of the Central Asian Steppes
and a growing interest in horse milk in Central Europe, the knowledge about equine milk
proteins and especially their genetic variability is still very limited.
Due to their ability to form micelles, the caseins are important for the supply of the neonate
with calcium, phosphate, and amino acids. (Lenasi et al., 2003; Uniacke-Lowe et al., 2010).
Whereas the casein fraction in bovine milk is accounting for about 75% of the whole milk
protein (Martin and Grosclaude, 1993), caseins only make up half of the equine milk protein
fraction (Malacarne et al., 2002). The equine casein fraction is divided in αs1-casein (17%), -
51
casein (79%), αs2-casein (1.5%) and -casein (1.5%) (Inglingstad et al., 2010; Malacarne et al.,
2002; Miranda et al., 2004). The genes encoding these proteins are located on equine
chromosome (ECA) 3 in a tightly linked 290-kb gene cluster. The order is CSN1S1 (encoding
αs1-casein), CSN2 (encoding β- casein), CSN1S2 (encoding αs2- casein), and CSN3 (encoding
κ- casein) (Egito et al., 2002; Girardet et al., 2006; Lenasi et al., 2003; Lenasi et al., 2005;
Martin et al., 2009; Miclo et al., 2007; Milenkovic et al., 2002; Miranda et al., 2004; Selvaggi
et al., 2010). The recent knowledge about the individual caseins and their genetic variability is
summarized in Table 1.
The aim of this study was to provide extended knowledge about the genetic variability of equine
casein genes and to identify putative protein variants at the DNA level.
Table 1. Current knowledge about equine casein genes and their genetic variability.
Casein Gene
Symbol
Location
EquCab2.0
Chromosome 3
NC_009146.2
Remarks
αs1 CSN1S1 64,954,285…
64,970,471
Full length cDNA sequence: Lenasi et al. (2003).
Two variants due to exon skipping (Miranda et al., 2004).
Genomic (NC_009146.2) and mRNA (NM_ 001081883.1)
reference sequences differ (c.406 C>A).
ß CSN2 64,938,110…
64,946,489
Full length cDNA sequence: Lenasi et al. (2003) and Girardet
et al. (2006).
Two smaller variants reported (Miranda et al., 2004).
αs2 CSN1S2 64,795,317...
64,811,812
First described in 2000 (Egito et al., 2001; Egito et al., 2002;
Miranda et al., 2004; Ochirkhuyag et al., 2000).
Two major variants (CSN1S2*A, CSN1S2*B) due to a
genomic 1.3 kb deletion covering two coding exons
(Brinkmann et al., 2015).
CSN3 64,683,856…
64,694,148
First described in 2001 (Iametti et al., 2001; Miranda et al.,
2004).
Full lenghth cDNA sequence: Lenasi et al. (2003).
Two putative variants described at the DNA-level by Hobor
et al. (2006; 2008): Ile383Lys and Thr173Ala.
52
Material and Methods
Animals and Samples
Genomic DNA was extracted from hair samples of 198 horses from eight different breeds
actually used for mare milk production in Germany applying a modified protocol according to
Miller et al. (1988). The animals were selected to be as unrelated as possible. Additionally,
individual whole genome sequence variant calling data of a total 55 horses from 10 different
breeds available from other studies were incorporated in the analyses. The animals were
sequenced to a mean coverage of 15.8X; bioinformatic details were reported before
(Drögemüller et al., 2014; Frischknecht et al., 2014). In total, 253 horses belonging to 14
different breeds or populations were analyzed (Table 2).
Table 2. Animals used in the sequence analysis of the equine casein genes (n=253).
Breed Acronym SEQ1 WGS2 TOTAL
Akhal-Teke AK 1 1
Dairy Crossbreed3 CB 21 - 21
Argentine Criollo Horse CR 27 - 27
Fjord Horse FJ 3 - 3
Franches-Montagnes FM - 29 29
Haflinger HF 39 1 40
Icelandic Horse IC 25 1 26
Dutch Warmblood (KWPN) WBNL - 1 1
Quarter Horse QH 22 3 25
Russian Heavy Draft RU 24 - 24
Shetlandpony SP - 2 2
Swiss Warmblood WBCH - 3 3
UK Warmblood WBUK - 2 2
German Warmblood WBD 37 12 49
TOTAL 198 55 253
1 Data from DNA Sanger-sequencing. 2 Data from whole genome sequencing. 3 Breeds that are crossed include German Riding Pony, Haflinger Horse, Connemara Pony, New Forrest Pony and
further pony breeds to achieve a preferable high milk yield.
53
DNA Sequencing
A total of 37 primer pairs (Supplemental Table 1) were designed to amplify all exons
contributing to the open reading frames of the genes and adjacent intronic regions: The Primer
3 software (Rozen and Skaletsky, 2000) was used based on the genomic reference sequences
of the casein genes CSN1S1, CSN2, CSN1S2, and CSN3 (Acc. No NC_009146.2). The genomic
sequence of CSN1S1 was found to contain a gap spanning a coding exon. A flanking primer
pair was designed in order to close the gap by Sanger sequencing.
PCR amplification and DNA sequencing were done as described by Gallinat et al. (2013). The
obtained sequences were analyzed and compared with the genomic GenBank sequence
NC_009146.2 using the software Sequencher 4.9 (Gene Codes Corp., Ann Arbor, MI). The
discrimination of the known CSN1S2 variants A or B was done by fragment length analysis as
described by Brinkmann et al. (2015). Allele frequencies for all observed variants of CSN1S1,
CSN2, CSN1S2, and CSN3 were calculated by direct counting for the examined breeds.
Results
The open reading frames of the 4 casein genes were successfully sequenced in 244 horses
belonging to 8 breeds (numbers differ between genes; details are given in Table 3). Six, four,
eight and 13 variants were identified in CSN1S1, CSN2, CSN1S2, and CSN3, respectively. This
makes a total of 31 casein variants identified at the DNA level, two of which do represent signal
peptide variants and 26 of which can be regarded as novel. Moreover, 11 synonymous
nucleotide exchanges were identified. The counted allele frequencies of all variants are
summarized in Table 3, allele frequencies were only determined in breeds with at least 10
samples available.
Provisional names were assigned to the variants (CSN1S1*A - CSN1S1*D; CSN2*A - CSN2*C;
CSN1S2*A - CSN1S2*F; CSN3*A - CSN3*M). The numbering of positions on the gene refers
to the coding sequence for the full length proteins, including the signal peptide. For αs1-casein
this results in a 220 amino acid protein, resulting from the mRNA sequence NM_001081883.1
plus exon 7 (24 bp), which is missing in this sequence. The full length protein of -casein is
241 amino acids in length, resulting from the coding sequence NM_001081852.1 plus exon 5
(24 bp) which is missing in this sequence. Resulting from the reference sequence KP658381.1
the full length αs2- casein is 231 amino acids in length. The reference sequence
NM_001081884.1 codes for -casein, which is 185 amino acids in length.
54
Table 3. Number of examined animals per breed and counted allele frequencies at the 4 casein encoding genes CSN1S1, CSN2, CSN1S2 and CSN3.
Gene and variant
CSN1S1 CSN2 CSN1S2 CSN3
Breed1 n A A*2 B C D E n A A*2 B C n A B C D1 D2 E1 E2 F n A B C D E F G H I J K L M
AK 1 +3 -4 - - - - 1 + - - - 1 + - - - - - - - 1 + - - - - - - - - - - - -
CB 20 0.65 0.35 - - - - 21 0.88 0.12 - - 1
8 0.83 0.17 - - - - - - 21 0.88 - 0.12 - - - - - - - - - -
CR 18 0.47 0.50 0.30 - - - 27 0.98 0.02 - - 1
6 1.00 - - - - - - - 26 0.73 - 0.13 0.1 - 0.04 - - - - - - -
FJ 3 + + + - - - 3 + - - - 3 + + + - - + - - 3 + - - - - - + + + - - - -
FM 29 0.67 0.30 - - - 0.03 29 0.98 0.20 - - 2
9 1.00 - - - - - - - 29 0.74 - - - - - - - - 0.02 0.24 - -
HF 34 0.52 0.47 - - 0.01 - 37 0.82 0.18 - - 3
6 0.54 0.35 0.01 - - 0.05 0.04 - 38 0.68 - 0.28 - - - 0.01 0.02 - 0.01 - - -
IC 22 0.55 0.27 - 0.09 0.09 - 26 0.80 0.04 0.08 0.08 1
7 0.74 0.06 - 0.06 - - - 0.14 26 0.38 - 0.29 0.21 - 0.02 0.06 - - 0.02 - 0.02 -
WBNL5 1 + - - - - - 1 + - - - 1 + - - - - - - - 1 + - - - - - - - - - - - -
QH 10 0.65 0.35 - - - - 23 1.00 - - - 2
1 0.69 0.05 0.17 0.02 - 0.02 0.05 - 23 0.68 0.16 - - 0.04 0.04 - - 0.02 0.04 - - 0.02
RD 17 0.82 0.18 - - - - 24 0.98 0.02 - - 1
8 0.89 0.08 - 0.03 - - - - 24 0.42 - 0.02 0.25 - 0.20 0.11 - - - - - -
SP 2 + - + - - - 2 + - - - 2 + - - - - - - - 2 + - - - - - - - - + - - -
WBCH5 3 + + - - - - 3 + - - - 3 + - - - - - - - 3 + - - - - - - - - - + - -
WBUK5 2 + + - - - - 2 + - - - 2 + - - - - - - - 2 + - - - - - - - - - + - -
WBD5 35 0.63 0.36 - - - 0.10 44 0.99 0.01 - - 3
8 0.83 0.01 0.08 0.07 0.01 - - - 45 0.82 - 0.06 - - 0.01 - 0.01 0.04 0.01 0.03 0.01 -
WBtotal
5 41 0.60 0.39 - - - 0.1 50 0.99 0.01 - - 4
4 0.85 0.01 0.07 0.06 0.01 - - - 51 0.84 - 0.04 - - 0.01 - 0.01 0.04 0.01 0.04 0.01 -
1 For an explanation of breed acronyms see Table 1. 2 Asterisks indicate that the allele contains a signal peptide variant. 2 Crosses indicate that the correspondent variant is present in that breed, but the number of animals is too low to determine allele frequencies. 3 Dashes indicate that the correspondent variant is not present in that breed. 4 Breeds belonging to the European Warmblood population (Dutch, Swiss, UK and German Warmblood) were also analyzed jointly as WBTOTAL
55
CSN1S1
The genomic reference sequence NC_009146.2 (EquCab2.0) was found to contain a gap with an
estimated size of 674 bp spanning exon 16, which is present in the mRNA reference sequence
NM_001081883.1. The gap was closed by Sanger sequencing of a PCR product revealing an exact
gap size of 731bp (see Supplemental Figure 1).
Subsequently, sequence data of 197 animals were compared in order to find putative variants. As
compared to the genomic reference sequence (Acc. No. NC_009146.2), five previously unknown
non-synonymous nucleotide exchanges were identified within the open reading frame of CSN1S1
defining five putative protein isoforms (Table 4). One of the variants is predicted to affect the signal
peptide sequence; the corresponding allele with the signal peptide variant was termed CSN1S1*A*.
No sequence corresponding to the mRNA reference sequence NM_001081883.1 was found in the
analyzed samples.
The allele CSN1S1*A corresponding to the genomic reference sequence was the most common one
among the examined animals and was found in all breeds (Table 3). A signal peptide variant (c.25
C>A / Leu9Ile) defines the allele CSN1S1*A*), which was common in all breeds except Akhal-
Teke, Dutch Warmblood and Shetlandpony. A nucleotide exchange c.88 G>A (Glu30Lys)
characterizes allele CSN1S1*B, which was identified in Criollo Horses, Fjord Horses and
Shetlandponies. Allele CSN1S1*C is defined by an additional transition (c.470 T>C /
p.Val157Ala). This haplotype was exclusively found in Icelandic Horses. CSN1S1*D differs from
allele A by a T>G transversion in position 428 of the ORF (c.428T>G / p.Leu143Arg) and was
detected in Haflinger and Icelandic Horses. Allele CSN1S1*E is caused by a single nucleotide
exchange from C to A in position 329 (c.329C>A; pPro110Ala) and was found in German
Warmblood Horses as well as in Franches-Montagnes. Additionally, a synonymous nucleotide
exchange was found (c. 633G>A), which was in perfect linkage disequilibrium to the sequence
polymorphism defining allele CSN1S1*D.
56
Table 4. Sequence variants and putative protein alleles of the equine CSN1S1 gene.
αs1-casein protein alleles
Position in
ORF and
protein
Ref. Seq.1
A
A*
B
C
D
E
c.252
p.9
CTT
Leu
ATT
Ile
c.88
p.30
GAA
Glu
AAA
Lys
AAA
Lys
c.329
p.110
CCA
Pro
CAA
Gln
c.428
p.143
CTT
Leu
CGT
Arg
c.470
p.157
GTA
Val
GCA
Ala
1 Variant CSN1S1*A is corresponding to the genomic reference NC_009146.2 2 c.25 is located in the sequence coding for the signal peptide and leads to the signal peptide variant CSN1S1*A*
CSN2
The open reading frame of the CSN2 gene was successfully examined in 243 horses and four
previously unknown nonsynonymous nucleotide exchanges, each defining a putative protein
isoform, were detected (Table 5). Also for this gene, one of the variants affects the signal peptide.
The genomic reference sequence (NC_009146.2) was designated as CSN2*A and represented the
most common allele at this locus (Table 3). The allele with the signal peptide variant CSN2*A* is
characterized by a single nucleotide exchange c. 16C>T leading to a predicted amino acid exchange
from leucine to phenylalanine (p.Leu6Phe) in the signal peptide; this variant was detected with
allele frequencies up to 0.2 in the crossbred horses for dairy production, Criollo Horses, Franches-
Montagnes, Haflinger Horses, Icelandic Horses, Russian Heavy Draft and German Warmblood. A
single transition (c. 277G>A / p.Val93Ile) defines allele CSN2*B, which was found to be rare and
was only detected in Icelandic Horses. A haplotype of two nucleotide exchanges in positions 91
57
and 479 of the open reading frame gives rise to allele CSN2*C (Table 5). Furthermore, 6
synonymous nucleotide exchanges were found in the equine CSN2 gene (c.36C>T; c. 102C>T;
c.123G>A; c. 162G>A; c. 417C>T; c. 465C>T).
Table 5. Sequence variants and putative protein alleles of the equine CSN2 gene.
-casein protein alleles
Position in ORF
and protein
Ref. Seq.1
A
A*
B
C
c.162
p.6
CTT
Leu
TTT
Phe
c.91
p.31
CTT
Leu
TTT
Phe
c.277
p.93
GTT
Val
ATT
Ile
c.479
p.160
CTG
Leu
CCG
Pro
1 Variant CSN2*A is corresponding to the genomic reference NC_009146.2 2 c.16 is located in the sequence coding for the signal peptide and leads to the signal peptide variant CSN2*A*
CSN1S2
Sequencing of the CSN1S2 gene was successfully completed in 205 animals. A total of 6
nonsynonymous single nucleotide variants and one large deletion leading to 8 distinct putative
protein isoforms were identified, 6 of which were considered novel (Table 6).
Allele CSN1S2*A (Acc. No. KT368778) corresponding to the genomic reference sequence
(NC_009146.2) was found to be most frequent across all analyzed breeds. Allele CSN1S2*B (Acc.
No. KT368779), which has already been described by Brinkmann et al. (2015), differs from allele
A by the presence of a 1,339 bp deletion covering two coding exons. It was found in Crossbred
Horses, Fjord Horses, Icelandic Horses, Quarter Horses, Russian Heavy Draft Horses and German
Warmbloods with allele frequencies ranging from 0.01 in Warmblood Horses to 0.35 in Haflinger
58
Horses. The putative allele CSN1S2*C on the other hand, defined by a single nucleotide exchange
c.398C>T leading to a predicted amino acid exchange from threonine to isoleucine in position 133
of the protein (Table 6), was found to be rare occurring at low frequencies in Fjord, Haflinger, and
Quarter Horses as well as German Warmbloods. A non-synonymous transition in position 218 of
the ORF (c.218C>T / p.Thr73Ile) defines allele D. This exchange was found to occur on the long
allele CSN1S2*A as well as on the short allele B and the resulting alleles were thus designated
CSN1S2*D1 and CSN1S2*D2, respectively. Allele D1 was detected at low frequencies in Icelandic
and Quarter Horses as well as Russian Heavy Drafts and German Warmbloods, while CSN1S2*D2
was found in German Warmblood Horses only (Table 3). Equivalently, allele E, which is defined
by two nucleotide exchanges in codons 129 and 217 (see Table 6 for details) was found in
conjunction with the long as well as the short variant and the respective alleles arising from those
haplotypes were termed CSN1S2*E1 and CSN1S2*E2. The former was detected in Fjord,
Haflinger, and Quarter Horses, while the latter was only found in Haflinger and Quarter Horses.
Finally, two transitions in positions 182 and 640 of the ORF (Table 6) characterize the rare allele
CSN1S2*F, which was exclusively detected in Icelandic Horses. Additionally, four synonymous
nucleotide exchanges were detected in equine CSN1S2 (c.21C>T; c.24C>T; c.225A>G;
c.402A>G). The synonymous nucleotide exchange c.225 A>G was always observed in
combination with allele CSN1S2*F in Icelandic horses.
59
Table 6. Sequence variants and putative protein alleles of the equine CSN1S2 gene.
αs2-casein protein alleles
Position in
ORF and
protein
Ref. Seq.1
A
B
C
D1
D2
E1
E2
F
c.182
p.61
AGG
Arg
AAG
Arg
c.218
p.73
ACA
Thr
ATA
Ile
ATA
Ile
c.199-2492
p.67-83
ins.
del.
del.
del.
c.386
p.129
CGG
Arg
CAG
Gln
CAG
Gln
c.398
p.133
ACC
Thr
ATC
Ile
c.640
p.214
CGG
Arg
TGG
Try
c.651
p.217
AGA
Arg AGT
Ser
AGT
Ser
1 Variant CSN1S2*A is corresponding to the genomic reference NC_009146.2. 2 This variant is represented by a large deletion, which has been described by Brinkmann et al. (2015).
CSN3
The ORF of the CSN3 gene was successfully resequenced in 244 animals revealing 6
nonsynonymous nucleotide exchanges, 4 of which had not been described before. A total of 13
putative protein isoforms were predicted from these nucleotide exchanges (Table 7).
The allele represented by the genomic reference sequence (Acc. No. NC_009146.2) was denoted
CSN3*A. It was found to be the most common one in all examined breeds with frequencies of up
to 0.88. Four alleles, namely CSN3*B, CSN3*F, CSN3*H and CSN3*J, were found to differ from
the genomic reference by only one nucleotide exchange each (Table 7). Allele B, which is
characterized by an amino acid exchange from threonine to alanine in codon 29, occurred at a rather
60
high frequency of 0.16 (Table 3) in Quarter Horses, while allele F, which is defined by an
asparagine to lysine exchange in codon 24, was seen at a frequency of 0.2 in Russian Heavy Drafts.
Allele H, which is also defined by a threonine to alanine exchange, but at codon 173, has been
described before (Hobor et al., 2006; Hobor et al., 2008) and was found to occur in Haflinger
Horses and German Warmbloods in our study. The putative protein isoform CSN3*J is
characterized by the occurrence of a premature stop codon leading to a truncated protein lacking
amino acid positions 183 to 185. The allele was found in several breeds at low frequencies. The
variants defining alleles B and J were also identified in conjunction with the variant characterizing
the putative allele CSN3*C (Table 7), which was found in high frequencies of up to almost 0.3 in
Haflinger and Icelandic Horses (Table 3). Likewise, the nucleotide exchanges defining alleles H
and J were found together in a haplotype giving rise to the rare allele CSN3*L. The variations
causing alleles F and H, respectively, were found to jointly define CSN3*G, which was only found
in Haflinger and German Warmbloods. A further non-synonymous nucleotide exchange was
identified in codon 22 (Table 7). This variant did not occur independently, but was only seen along
with the exchange in codon 24, together defining the haplotype of the rare allele CSN3*I (Tables
3 and 7). Finally, an already described (Hobor et al., 2006; Hobor et al., 2008) non-synonymous
nucleotide exchange was found in codon 128 (c.282T>A), which was also not detected
independently. Against the background of allele L e.g., it defines CSN3*K, which was the second
most frequent variant in Franches-Montagnes (Tables 3 and 7). Furthermore, the nucleotide
exchanges were found to exist in additional combinations, namely defining alleles CSN3*D,
CSN3*E, and CSN3*M (Table 7). Allele D was found to exhibit a high frequency in Icelandic
Horses, while variants M and E were only found in Quarter Horses with the latter differing from
the reference sequence in 5 positions.
61
Table 7. Sequence variants and putative protein alleles of the equine CSN3 gene.
-casein protein alleles
Position in
ORF and
protein
Ref. Seq.1
A
B
C
D
E
F
G
H
I
J
K
L
M
c.65
p.22
GTG
Val
GCG
Ala
GCG
Ala
c.72
p.24
AAC
Asn
AAG
Lys
AAG
Lys
AAG
Lys
AAG
Lys
AAG
Lys
c.85
p.29
ACA
Thr
GCA
Ala
GCA
Ala
GCA
Ala
c.3832
p.128
ATA
Ile
AAA
Lys
AAA
Lys
c.5172
p.173
ACC
Thr
GCC
Ala
GCC
Ala
GCC
Ala
GCC
Ala
GCC
Ala
GCC
Ala
GCC
Ala
c.547
p.183
CAA
Gln
TAA
STOP
TAA
STOP
TAA
STOP
TAA
STOP
TAA
STOP
TAA
STOP
1 Variant CSN1S2*A is corresponding to the genomic reference NC_009146.2 2 Hobor et al., 2006; Hobor et al., 2008
Discussion
Methodolgy
Within the current study, DNA sequencing of the open reading frames was used to identify putative
protein variants of the equine caseins. Thereby, 26 new casein variants, including two signal
peptide variants, were detected. As discussed by Gallinat et al. (2013), the main advantages of this
methodology are the easy applicability and the better availability of DNA samples as compared to
protein samples, especially when breeds from different countries are considered. The main
disadvantage, however, is that neither the actual expression of variants nor posttranslational
modifications can be evaluated. Furthermore, variations due to differential alternative splicing
cannot readily be detected. For αs1-casein and ß-casein e.g., shorter variants have been identified
(Girardet et al., 2006; Lenasi et al., 2003; Miranda et al., 2004; Table 1), which can only be
characterized at the transcript or protein level.
62
To confirm the novelty of the identified variants, a BLAST search
(http://blast.ncbi.nlm.nih.gov/Blast.cgi) of the generated sequence data against public databases
was conducted. None of the variants denoted as novel in the current study were identified
confirming their novelty. Interestingly, one polymorphism in CSN1S2 (c.386G>A / p.Arg129Gln)
was not found in the CSN1S2 sequences of Equus caballus, but was identified in the predicted
mRNA sequence of CSN1S2 in Equus przewalskii (Acc. No. XM_008510698.1).
Allele frequencies within breeds were determined by counting. These frequencies have to be taken
with care, because the number of animals per breed was rather small. Nevertheless, these figures
give an overview of the breed distribution for the identified variants. The provisional nomenclature
for the alleles established here will be subject to confirmation at the protein level. Furthermore, in
some instances two or more variants were only found heterozygously within one gene hampering
the unequivocal definition of haplotypes. This was the case for CSN3*I. Due to the large number
of identified variants, it was, however, necessary to establish a nomenclature to simplify
referencing and discussion.
The selection of animals for the study was initially limited to breeds that are actually used for mare
milk production in Germany. Especially the Haflinger Horse is, not only in Germany, a favored
breed for dairy production and is used by many mare milk farmers. But also other breeds such as
the German Warmblood and the Russian Heavy Draft, or even special breeds such as Criollo,
Quarter Horse, and Icelandic Horse are used by German mare milk farmers, potentially yielding a
higher selling price especially for the male offspring. Thus, a comparatively wide spectrum of
breeds has been covered. Notably, one of the sampled populations represents a crossbreed
including German Riding Pony, Haflinger Horse, Connemara Pony, and New Forrest Pony as well
as further Pony breeds. According to the owner, this breed has especially been produced for dairy
farming and selected for milkability und milk yield. It remains, however, unclear how phenotypes
have been recorded and selection has been conducted.
Breed specific variation patterns
The Icelandic Horse exhibited the highest degree of variability within this study. A total of 19
different casein gene alleles were found in this breed, four of which (CSN1S1*C, CSN2*B,
CSN2*C, CSN1S2*F) were found exclusively within this breed. This seems unexpected in the first
instance, because the breed originates from a small founder population. These animals were
63
brought to Iceland approximately 1,100 years ago and the population has been closed since then
(Adalsteinsson, 1981). However, the samples were not taken on Iceland and Hreidarsdóttir et al.
(2014) reported a higher diversity in terms of effective founders for abroad as compared to the
Icelandic population.
With 18 different alleles, the second most isoforms were identified in German Warmblood Horses
followed by Quarter Horses with 16 alleles, three of which were exclusively found in this breed
(CSN3*B, CSN3*E, CSN3*M). While alleles E and M were found to be rare, CSN3*B had an allele
frequency of 0.15 and might thus be designated as a characteristic allele in Quarter Horses. A
comparatively low variation was found in the crossbreed for dairy production with only 8 casein
gene variants. This is noteworthy as several different breeds have been crossed here. It might,
however, be possible that selection for milk yield has reduced the casein variability, because some
variants have a strong effect on the target trait.
Evolution of the casein variants
Based on the current data, it is in many instances difficult to draw conclusions about the exact
evolution of the putative casein alleles. In most cases, however, the ancestral allele and possible
routes of variant evolution can be inferred.
In the case of CSN1S1, allele A seems to represent the ancestral haplotype because of the high allele
frequencies distributed over all examined breeds (Table 3). The alleles CSN1S1*A*, CSN1S1*B,
CSN1S1*D, and CSN1S1*E differ from CSN1S1*A by only one nucleotide exchange each and
might have directly evolved from the ancestral allele. Allele CSN1S1*C can be derived from allele
B by one additional non-synonymous nucleotide exchange in position 470 of the open reading
frame.
Likewise, allele CSN2*A was found in all breeds at high frequencies, which indicates an ancestral
status of this allele. The other alleles were found to be rare (Table 3) and differ from allele A by
one (CSN2*A*, CSN2*B) or two (CSN2*C) nucleotide exchanges (Table 5).
The situation for CSN1S2 seems to be more complicated. In a previous study, we have identified
two major alleles (CSN1S2*A and CSN1S2*B) differing in length by 17 amino acids due to a large
genomic deletion spanning two coding exons and determined that the deletion has probably
occurred before the ancestor of present-day asses and zebras diverged from the horse lineage
(Brinkmann et al., 2015). Alleles CSN1S2*C and CSN1S2*F differ from the long reference allele
64
A by one and two mutations, respectively, and might have evolved from this allele (Table 6). Two
other alleles, CSN1S2*D and CSN1S2*E, however, do occur in conjunction with both the long and
the short allele; the resulting alleles were termed D1/D2 and E1/E2, respectively (Table 6). Overall,
these are rare, but allele D1 does occur more frequently than D2 (Table 3). Thus, it is possible, that
CSN1S2*D1 might have evolved from the long allele CSN1S2*A and that CSN1S2*D2 represents
a recombinant haplotype. The alleles E1 and E2 are comparably rare and it is possible that the
underlying polymorphisms have been segregating together for a long period. Notably, one of the
polymorphisms defining these alleles (c.386 A>G) was found also in the CSN1S2 sequences of
Equus przewalskii (Acc. No. XM_008510698.1) by BLAST analysis, which supports this
hypothesis.
Several alleles of CSN3 were detected in the current study. It is likely, that either CSN3*A or
CSN3*F might be an ancestral allele. From CSN3*A allele CSN3*B could have evolved by one
sequence variant (c.85A>G) and a further mutation (c.547 C>T) might have led to CSN3*C.
CSN3*F seems to be the basis for the development of the alleles CSN3*G and CSN3*I, each caused
by an additional exchange (Table 7). From CSN3*G, allele CSN3*D might have evolved, which
subsequently could have led to the development of CSN3*E. However, due to the large number of
alleles arising from the various possible haplotypes, the evolution of CSN3 cannot be further
elucidated based on the current data.
Equine casein isoforms - consequences for production and human consumption
In the dairy sector, mare’s milk is a high priced niche product, which is marketed under several
health claims. The production is costly as mares can only be milked with foal at foot. Thus,
selection for milk yield or contents has not taken place so far. Attempts to select for these traits are
furthermore hampered by a lack of routine milk recording schemes, which would be difficult to
implement for several reasons. Especially, the foal’s milk consumption cannot readily be
determined (Doreau and Martuzzi, 2006). A main criterion in the selection of dairy mares would,
however, be good milking ease (Doreau and Boulot, 1989; Doreau and Martuzzi, 2006), but with
the exception of the aforementioned crossbreed for dairy production, no selection does take place
and the potential is still unexploited.
From other dairy species, effects of casein isoforms on performance traits are known (Boettcher et
al., 2004; Heck et al., 2009; Martin et al., 2002), but for the above reasons this cannot be analyzed
65
in dairy mares. However, several of the health benefits empirically ascribed to horse milk might be
attributable to the protein fraction and thus depend on the pattern of protein variants. These benefits
include putative positive effects on gastrointestinal ulcers, digestive and cardiovascular diseases,
diarrhea and gastritis. Also other diseases like tuberculosis, anaemia, chronic hepatitis and nephritis
were traditionally treated with horse milk or kumyß, an alcoholic fermented mare’s milk drink,
especially in Russian sanatoria. Several reasons for the effectiveness were suggested, such as the
fatty acid pattern or the high content of lysozyme and lactoferrin. Also peptides arising from the
hydrolysis of ß-casein may be responsible for health effects. Mare milk and kumyß contain peptides
with hypotensive activity, but specific research on bioactive peptides from mare milk is scarce
(Doreau and Martin-Rosset, 2002). Some current studies provided first scientific evidence of the
health effects of mare milk, there are studies about beneficial effects on atopic dermatitis (Foekel
et al., 2009), chronic-inflammatory bowel diseases (Schubert et al., 2009) or cardiovascular
diseases (Chen et al., 2010). The extended knowledge about the equine milk protein genes might
provide a basis for further studies about the effect of mare milk on human health, especially related
to the release of bioactive peptides.
Mare’s milk is also considered a hypoallergenic foodstuff. It has been shown in vitro and in vivo,
that this milk is tolerated by 96% of children, who are affected by cow milk allergy (CMA)
(Businco et al., 2000; Curadi et al., 2001). CMA is an IgE mediated allergenic reaction causing a
broad range of symptoms such as atopic dermatitis, constipation and infantile colic. This condition
affects approximately 2% of infants when nourished with milk replacements on cow milk basis
(Heine et al., 2002). Among the caseins, αs1-casein has been identified as the protein with the
highest allergenic potential and many individuals affected by CMA show a high titer of IgE specific
for this protein (Gaudin et al., 2008; Lisson, 2014; Ruiter et al., 2006; Schulmeister et al., 2009;
Shek et al., 2005). Several reasons for the low allergenicity of mare’s milk are discussed, for
example the absence the epitopes relevant for the IgE binding. In the current study, a signal peptide
variant leading to the allele CSN1S1*B* was detected, which might principally cause a reduced
content or absence of αS1-casein. This variant was found to be very common with allele frequencies
of up to 0.5. We were, however, not able to assess, whether the altered signal peptide affects protein
expression. This should be subject to further studies.
66
Conclusions
Within the current study, the genetic diversity of equine casein genes was assessed at the DNA-
level in 253 horses belonging to 14 different breeds or populations. Thereby, 32 different putative
casein isoforms were identified, 26 of which can be considered novel. This study gives, for the first
time, a comprehensive overview of genetic variability at the casein loci in horses including
noteworthy findings such as the high degree of variability in Icelandic horses. The results provide
a foundation for further research into the properties of the equine milk protein fraction.
Acknowledgements
This project was founded by the German Federal Ministry of Education and Research (Bonn,
Germany) within the competence network “Food Chain Plus” (FoCus, grant no. 0315539A). The
authors would like to thank all the mare’s milk producers for providing samples, Julia Tetens for
her help with sample collection and Gabriele Ottzen-Schirakow for expert technical assistance.
References
Adalsteinsson, S. 1981. Origin and conservation of farm animal populations in Iceland.
Zeitschrift für Tierzüchtung und Züchtungsbiologie 98(1-4):258–264.
Brinkmann, J., Koudelka, T., Keppler, J. K., Tholey, A., Schwarz, K., Thaller, G., Tetens, J.
2015. Characterization of an Equine α-S2-casein Variant due to a 1.3 kb Deletion Spanning Two
Coding Exons. DOI: 10.1371/journal.pone.0139700
Businco, L., Giampietro, P. G., Lucenti, P., Lucaroni, F., Pini, C., Di Felice, G., Iacovacci, P.,
Curadi, C., Orlandi, M. 2000. Allergenicity of mare’s milk in children with cow’s milk allergy.
Journal of Allergy and Clinical Immunology 105(5):1031–1034.
Caroli, A. M., Chessa, S., Erhardt, G. J. 2009. Invited review: milk protein polymorphisms in
cattle: effect on animal breeding and human nutrition. J. Dairy Sci. 92(11):5335–5352.
67
Chen, Y., Wang, Z., Chen, X., Liu, Y., Zhang, H., Sun, T. 2010. Identification of angiotensin I-
converting enzyme inhibitory peptides from koumiss, a traditional fermented mare's milk. J.
Dairy Sci. 93(3):884–892.
Curadi, M. C., P. G. Giampietro, P. Lucenti, and M. Orlandi. 2001. Use of mare milk in pediatric
allergology., Firenze, 12.-15.06.2001.
Doreau, M., Boulot, S. 1989. Recent knowledge on mare milk production: A review. Livestock
Production Science 22(3-4):213–235.
Doreau, M., Martin-Rosset, W. 2002. Dairy animals: horse. p. 630–637. In H. Roginski, J. A.
Fuquay, and P. F. Fox (eds.). Encyclopedia of dairy sciences. Academic Press, London, UK.
Doreau, M., Martuzzi, F. 2006. Milk yield of nursing and dairy mares. p. 77–87. In N. Miraglia,
and W. Martin-Rosset (eds.). Nutrition and feeding of the broodmare. Academic Publishers,
Wageningen.
Drögemüller, M., Jagannathan, V., Welle, M. M., Graubner, C., Straub, R., Gerber, V., Burger,
D., Signer-Hasler, H., Poncet, P.-A., Klopfenstein, S., Niederhäusern, R. von, Tetens, J., Thaller,
G., Rieder, S., Drögemüller, C., Leeb, T. 2014. Congenital hepatic fibrosis in the Franches-
Montagnes horse is associated with the polycystic kidney and hepatic disease 1 (PKHD1) gene.
PloS one 9(10):e110125.
Egito, A. S., Girardet, J.-M., Miclo, L., Mollé, D., Humbert, G., Gaillard, J.-L. 2001.
Susceptibility of equine κ- and β-caseins to hydrolysis by chymosin. International Dairy Journal
11(11-12):885–893.
Egito, A. S., Miclo, L., López, C., Adam, A., Girardet, J.-M., Gaillard, J.-L. 2002. Separation and
characterization of mares' milk alpha(s1)-, beta-, kappa-caseins, gamma-casein-like, and proteose
peptone component 5-like peptides. J. Dairy Sci. 85(4):697–706.
68
Foekel, C., Schubert, R., Kaatz, M., Schmidt, I., Bauer, A., Hipler, U.-C., Vogelsang, H., Rabe,
K., Jahreis, G. 2009. Dietetic effects of oral intervention with mare's milk on the Severity Scoring
of Atopic Dermatitis, on faecal microbiota and on immunological parameters in patients with
atopic dermatitis. Int J Food Sci Nutr 60 Suppl 7:41–52.
Frischknecht, M., Neuditschko, M., Jagannathan, V., Drögemüller, C., Tetens, J., Thaller, G.,
Leeb, T., Rieder, S. 2014. Imputation of sequence level genotypes in the Franches-Montagnes
horse breed. Genetics, selection, evolution GSE 46:63.
Gallinat, J. L., Qanbari, S., Drögemüller, C., Pimentel, E. C. G., Thaller, G., Tetens, J. 2013.
DNA-based identification of novel bovine casein gene variants. J. Dairy Sci. 96(1):699–709.
Gaudin, J.-C., Rabesona, H., Choiset, Y., Yeretssian, G., Chobert, J.-M., Sakanyan, V., Drouet,
M., Haertlé, T. 2008. Assessment of the immunoglobulin E-mediated immune response to milk-
specific proteins in allergic patients using microarrays. Clin. Exp. Allergy 38(4):686–693.
Girardet, J.-M., Miclo, L., Florent, S., Mollé, D., Gaillard, J.-L. 2006. Determination of the
phosphorylation level and deamidation susceptibility of equine beta-casein. Proteomics
6(12):3707–3717.
Heine, R. G., Elsayed, S., Hosking, C. S., Hill, D. J. 2002. Cow's milk allergy in infancy. Curr
Opin Allergy Clin Immunol 2(3):217–225.
Hobor, S., Kunej, T., Dovč, P. 2008. Polymorphisms in the kappa casein (CSN3) gene in horse
and comparative analysis of its promoter and coding region. Anim. Genet. 39(5):520–530.
Hobor, S., Kunej, T., Lenasi, T., Dovč, P. 2006. Kappa casein gen (CSN3) in horse: Kapa
kazeinski gen (CSN3) pri konju genetic variability in exon 1 and 4 genetska variabilnost v eksonu
1 in 4. Acta agriculturae Slovenica 88(2):83–89.
69
Hreidarsdóttir, G., Árnason, T., Svansson, V., Hallson, J. 2014. Analysis of the history and
population structure of the Icelandic horse using pedigree data and DNA analyses. Icel. Agric.
Sci.(27):63–79.
Iametti, B. S., Tedeschi, G., Oungre, E., Bonomi, F. 2001. Primary structure of kappa-casein
isolated from mares' milk. J. Dairy Res. 68(1):53–61.
Inglingstad, R. A., Devold, T. G., Eriksen, E. K., Holm, H., Jacobsen, M., Liland, K. H., Rukke,
E. O., Vegarud, G. E. 2010. Comparison of the digestion of caseins and whey proteins in equine,
bovine, caprine and human milks by human gastrointestinal enzymes. Dairy Sci. Technol.
90(5):549–563.
Lenasi, T., Kokalj-Vokac, N., Narat, M., Baldi, A., Dovč, P. 2005. Functional study of the equine
beta-casein and kappa-casein gene promoters. J. Dairy Res. 72 Spec No:34–43.
Lenasi, T., Rogelj, I., Dovč, P. 2003. Characterization of equine cDNA sequences for αS1-, β-
and κ-casein. J. Dairy Res. 70(1):29–36.
Lisson, M. 2014. Appearance of epitopes in bovine milk protein variants, their allergenicity and
potential use in human nutrition. Zugl.: Gießen, Univ., Diss., 2014. 1. Aufl. Édition scientifique.
VVB Laufersweiler, Gießen.
Malacarne, M., Martuzzi, F., Summer, A., Mariani, P. 2002. Protein and fat composition of
mare's milk: some nutritional remarks with reference to human and cow's milk. International
Dairy Journal 12(11):869–877.
Martin, P., Grosclaude, F. 1993. Improvement of milk protein quality by gene technology.
Livestock Production Science 35(1-2):95–115.
Martin, P. D., Miclo, L., Rebours, E., Matéos, A., Miranda, G. 2009. Equus caballus mRNA
encoding CSN1S2 (alphaS2-casein) precursor (GenBank GU196267). Genetique Animale et
70
Biologie Integrative (GAI), INRA, Domaine de Vilvert, Jouy-En-Josas 78350, France.
Unpublished.
Miclo, L., Girardet, J.-M., Egito, A. S., Mollé, D., Martin, P., Gaillard, J.-L. 2007. The primary
structure of a low-Mr multiphosphorylated variant of beta-casein in equine milk. Proteomics
7(8):1327–1335.
Milenkovic, D., Martin, P., Guérin, G., Leroux, C. 2002. A specific pattern of splicing for the
horse αS1-Casein mRNA and partial genomic characterization of the relevant locus. Genet Sel
Evol 34(4):509.
Miller, S. A., Dykes, D. D., Polesky, H. F. 1988. A simple salting out procedure for extracting
DNA from human nucleated cells. Nucleic Acids Res. 16(3):1215.
Miranda, G., Mahé, M.-F., Leroux, C., Martin, P. 2004. Proteomic tools to characterize the
protein fraction of Equidae milk. Proteomics 4(8):2496–2509.
Ochirkhuyag, B., Chobert, J.-M., Dalgalarrondo, M., Haertlé, T. 2000. Characterization of mare
caseins. Identification of αS1 - and αS2 - caseins. Lait 80(2):223–235.
Rozen, S., Skaletsky, H. 2000. Primer3 on the WWW for general users and for biologist
programmers. Methods Mol. Biol. 132:365–386.
Ruiter, B., Trégoat, V., M'rabet, L., Garssen, J., Bruijnzeel-Koomen, C A F M, Knol, E. F.,
Hoffen, E. 2006. Characterization of T cell epitopes in alphas1-casein in cow's milk allergic,
atopic and non-atopic children. Clin. Exp. Allergy 36(3):303–310.
Schubert, R., Kahle, C., Kauf, E., Hofmann, J., Hobert, I., Gruhn, B., Häfer, R., Vogelsang, H.,
Jahreis, G. 2009. Dietetic efficacy of mare’s milk for patients with chronic inflammatory bowel
diseases – clinical study. Ernährung/Nutrition 33(7-8):314–321.
71
Schulmeister, U., Hochwallner, H., Swoboda, I., Focke-Tejkl, M., Geller, B., Nystrand, M.,
Härlin, A., Thalhamer, J., Scheiblhofer, S., Keller, W., Niggemann, B., Quirce, S., Ebner, C.,
Mari, A., Pauli, G., Herz, U., Valenta, R., Spitzauer, S. 2009. Cloning, expression, and mapping
of allergenic determinants of alphaS1-casein, a major cow's milk allergen. J. Immunol.
182(11):7019–7029.
Selvaggi, M., Laudadio, V., Dario, C., Tufarelli, V. 2014. Major proteins in goat milk: an updated
overview on genetic variability. Mol. Biol. Rep. 41(2):1035–1048.
Selvaggi, M., Pesce Delfino, A. R., Dario, C. 2010. Exon 1 polymorphisms in the equine CSN3
gene: SNPs distribution analysis in Murgese horse breed. Anim. Biotechnol. 21(4):252–256.
Shek, L. P. C., Bardina, L., Castro, R., Sampson, H. A., Beyer, K. 2005. Humoral and cellular
responses to cow milk proteins in patients with milk-induced IgE-mediated and non-IgE-
mediated disorders. Allergy 60(7):912–919.
Uniacke-Lowe, T., Huppertz, T., Fox, P. F. 2010. Equine milk proteins: Chemistry, structure and
nutritional significance. International Dairy Journal 20(9):609–629.
73
CHAPTER IV:
CHARACTERIZATION OF AN EQUINE αs2-CASEIN VARIANT DUE A 1.3 KB
DELETION SPANNING TWO CODING EXONS
Julia Brinkmann1, Tomas Koudelka2, Julia K. Keppler3, Andreas Tholey2, Karin Schwarz3, Georg
Thaller1, Jens Tetens1
1 Institute of Animal Breeding and Husbandry, Christian-Albrechts-Universität Kiel, Kiel,
Germany
2 Systematic Proteomics & Bioanalytics, Institute for Experimental Medicine, Christian-
Albrechts-Universität Kiel, Kiel, Germany
3 Institute of Human Nutrition and Food Science, Division of Food Technology, Christian-
Albrechts-Universität Kiel, Kiel, Germany
Published in PLOS ONE (2015)
DOI: 10.1371/journal.pone.0139700
74
Abstract
The production and consumption of mare’s milk in Europe has gained importance, mainly based
on positive health effects and a lower allergenic potential as compared to cows’ milk. The
allergenicity of milk is to a certain extent affected by different genetic variants. In classical dairy
species, much research has been conducted into the genetic variability of milk proteins, but the
knowledge in horses is scarce. Here, we characterize two major forms of equine αS2-casein arising
from genomic 1.3 kb in-frame deletion involving two coding exons, one of which represents an
equid specific duplication. Findings at the DNA-level have been verified by cDNA sequencing
from horse milk of mares with different genotypes. At the protein-level, we were able to show by
SDS-page and in-gel digestion with subsequent LC-MS analysis that both proteins are actually
expressed. The comparison with published sequences of other equids revealed that the deletion has
probably occurred before the ancestor of present-day asses and zebras diverged from the horse
lineage.
Introduction
Horses are of minor importance in global dairy production, but mare’s milk has traditionally been
consumed in Mongolia, Kazakhstan, Kyrgyzstan or Tajikistan (Uniacke-Lowe et al., 2010). The
global amount of production is not exactly known, but it has been estimated that approximately 30
million people worldwide are regularly consuming mare’s milk (Martuzzi and Vaccari Simonini,
2010). Also in Europe, especially in Italy, Hungary, The Netherlands and Germany, the production
and consumption of mare’s milk have gained more and more importance; roughly 1 million kg of
mare’s milk are produced in Europe (Fox and Uniacke, 2010). This increased interest is mainly
based on positive health effects. The milk of horses and donkeys is e.g. tolerated by the majority
of children suffering from cow’s milk protein allergy, a condition that affects approximately 2% of
infants when nourished with milk replacements on cow milk basis (Curadi et al., 2001; Businco et
al., 2000). Moreover, positive effects of mare’s milk consumption on diseases like atopic dermatitis
(Foekel et al., 2009), Morbus Crohn (Schubert et al., 2009) or cardiovascular diseases (Chen et al.,
2010) have been reported.
The composition of equine milk, and especially the milk protein fraction, is very different from
that of cows’ milk. It is lower in fat and protein, but has a high lactose content similar to what is
75
found in human milk (Malacarne et al., 2002; Uniacke-Lowe et al., 2010). While in cattle the casein
fraction accounts for the major part of the total milk protein, the casein to whey ration in horses is
around 1.1:1, which more closely resembles human milk (Malacarne et al., 2002; Uniacke-Lowe
et al., 2010). In fact, it has been reported that the balance between caseins and whey proteins is a
major determinant of cow’s milk allergenicity (Lara-Villoslada et al., 2005) possibly giving an
explanation for the low allergenic potential of horse milk. However, there is also strong evidence
that genetic milk protein variants affect the allergenicity of milk protein based on the presence or
absence of particular epitopes (Lisson et al., 2013; Lisson et al., 2014). While there has been intense
research into the genetic variability of milk proteins in ruminants and especially in dairy cows
(Caroli et al., 2009), the knowledge about equine milk protein variation is scarce, especially for the
caseins. However, in the donkey different variants of αS2-casein have been described, also
involving a large deletion exons 4-6 (Saletti et al., 2012).
In the present study, we characterized a major protein variant arising from a 1.3 kb in-frame-
deletion covering two exons and proved the protein by means of LC-MS based analytics at the
protein level.
Material and Methods
Animals and samples
Genomic DNA was extracted from hair samples of 193 domestic horses from 8 different breeds
that are actually used for mare’s milk production in Germany applying a modified Miller protocol
(Miller et al., 1988). The animals were selected to be as unrelated as possible. Hair samples were
obtained from 14 different private studs with permission of and in cooperation with the owners by
pulling out several hairs from the mane or the tail. Furthermore, individual milk samples were
collected from four Haflinger mares with known genotype. These samples were taken by the
owners during routine milking of the mares. In concordance with German Animal welfare
legislation, these sampling procedures do not require a permission or approvement.
DNA sequencing
Primer pairs were designed to amplify the coding exons contributing of equine CSN1S2 and
adjacent intronic regions using the Primer 3 software (Rozen and Skaletsky, 2000) based on the
genomic reference sequence of the casein gene CSN1S2 (Acc. No NC_009146.2). A further Primer
76
pair (Forward: 5’- GGAAAAGATTTGTGAGCCATTTG-3’, Reverse: 5’-
GCTGGATAATTGCTCAACACTCA-3’) was designed to specifically amplify the entire region
of CSN1S2 encompassing the deletion. PCR amplification and DNA sequencing were done as
previously described (Gallinat et al., 2013). The obtained sequences were analyzed and compared
with the genomic reference sequence (Acc. No. NC_009168.2) using the software Sequencher 4.9
(Gene Codes Corp., Ann Arbor, MI).
RNA isolation from milk samples and cDNA synthesis
Individual milk samples were obtained from four mares with known deletion genotype. An aliquot
of 40 ml was centrifuged at 6,000 g for 10 minutes. The supernatant including the milk fat layer
was discarded and remaining milk fat was thoroughly removed with alcohol wipes. The cell pellet
was washed three times with 1x phosphate buffered saline. Cells were homogenized using
QIAShredder columns (Qiagen, Hilden, Germany) and total RNA was isolated using the Qiagen
RNeasyMini Kit (Qiagen, Hilden, Germany) according to the manufacturer’s instructions. The
isolated RNA was transcribed into cDNA using SuperScript® III First-Strand Synthesis SuperMix
kit (Invitrogen) with oligo-dT primers. PCR amplification and sequencing was done with primers
located in the untranslated regions (Forward: 5’-TGCCTGCACTTTCTTGTCTTCCA-3’, Reverse:
5’-TGCACAGTCTTCATTTGGCTTGA-3’).
Protein and peptide analysis
Individual milk samples of two mares with known genotype were used for protein analysis. These
samples were dialyzed to remove lactose, subsequently freeze dried and stored at -18 °C for 4
months. Lyophilized milk powder was dissolved in Laemmli buffer (1x) at a concentration of 2
mg/mL and 10 and 20 µg of crude protein was loaded onto a 12% SDS-PAGE gel (150V for 85
min). Gel bands were destained, reduced and alkylated and then subsequently in gel-digested
overnight with trypsin (60 ng) using standard protocols. Peptides were extracted from the gel, dried
down using vacuum centrifugation and resuspended in 3% acetonitrile (ACN) and 0.1%
trifluroacetic acid (TFA) before being analyzed by LC-MS.
Nano-UHPLC-MS was performed on an UltiMate 3000 RSL Nano/Cap System (Thermo Fisher
Scientific, Bremen, Germany) coupled online to an Orbitrap QExactive (Thermo Fisher Scientific).
Samples were desalted for 4 minutes (Acclaim PepMap100 C-18, 300 µm I.D. x 5 mm, 5 µm, 100
77
Å, Thermo Fisher Scientific) at a flow rate of 30 µL/min using 3% ACN, 0.1% TFA. An Acclaim
PepMap100 C-18 column (75 µm I.D. x 500 mm, 2 µm, 100 Å, Thermo Fisher Scientific) was
used for analytical separation at a flow rate of 300 nL/min using binary gradients of buffers A
(0.05% FA) and B (80% ACN and 0.04% FA). The elution used gradient steps of 5-50% B (4-30
min) and 50-90% B (30-35 min) followed by an isocratic wash (90% B, 35-45 min) and column
re-equilibration (5% B, 45-60 min) steps.
MS scans were acquired in the mass range of 300 to 2,000 m/z at a resolution of 70,000. The ten
most intense signals were subjected to HCD fragmentation using a dynamic exclusion of 15 s.
MS/MS parameters - minimum signal intensity: 1000, isolation width: 3.0 Da, charge state: ≥2,
HCD resolution: 15,000, Normalized collision energy of 25. Lock mass (445.120025) was used for
data acquired in MS mode.
HCD spectra were searched using Proteome Discoverer 1.4 (1.4.0.288, Thermo Fisher Scientific)
with the Sequest-HT search algorithm against the complete reviewed and unreviewed Equus
caballus database (28,188 sequences, downloaded 2015.07.16) with common contaminants
(ftp://ftp.thegpm.org/fasta/cRAP/) appended. The following database search settings were used:
MS tolerance; ± 10 ppm, MS2 Tolerance; 0.02 Da, enzyme specificity; trypsin with up to three
missed cleavages allowed. Carbamidomethylation on cysteine residues was set as a fixed
modification while, oxidation on methionine, and phosphorylation on serine and threonine residues
was set as a variable modification. Only peptides which were identified with medium confidence
(FDR <5%) were included.
Results and Discussion
DNA sequencing and mutation screening
The current annotation of the equine CSN1S2 gene (GeneID 100327035) is based on the mRNA
reference sequence NM_001170767.2 containing 15 coding exons with an open reading frame of
645 bp. In an attempt to resequence the open reading frame using exon flanking primer pairs, we
recognized that the PCR reactions for exons 8 and 9 consistently failed in particular horses. In order
to unravel the possible cause for this phenomenon, we amplified a 2.6 kb fragment spanning the
entire region. While the expected product was obtained from samples that had been successfully
amplified before, the product obtained from initially unsuccessful samples was found to be
approximately 1.3 kb shorter (Figure 1). Subsequent Sanger sequencing of the products revealed
78
the presence of a 1,339 bp deletion in the short variant (Figure 2A), while the long product was
found to completely correspond to the genomic reference sequence (NC_009146.2). Analysis of
this sequence revealed the presence of a 309 bp duplication of the region encompassing exon 8 of
the gene (Figure 2A). Because this duplication is located exactly at the boundary of the deletion,
the exact position cannot be determined, i.e. it cannot be ruled out, whether the upstream or
downstream duplicate is involved in the deletion.
A total of 193 horses belonging to 8 breeds (Table 1) were tested for the presence of the deletion
by PCR and subsequent agarose gel electrophoresis (Figure 1). The deletion was found to be
present in all analyzed breeds; the highest frequencies of 0.36 and 0.25 were observed in Haflinger
and Icelandic horses, respectively. Notably, these breeds are common in mare’s milk production,
especially the Haflinger breed is widely used. This might possibly indicate an effect of the mutation
or a certain casein-haplotype on milk yield as this is e.g. the case in cattle (McLean et al., 1984;
Ikonen et al., 2001).
Table 1. Frequencies of the 1.3 kb deletion in different horse breeds.
Breed n ins/insa ins/dela del/dela Frequency of deletion
Crossbredb 21 14 6 1 0.19
Criollo 27 24 3 0 0.06
Fjord Horse 3 2 1 0 -c
Haflinger Horse 39 17 16 6 0.36
Icelandic Horse 24 13 10 1 0.25
Quarter Horse 20 16 3 1 0.13
Russian Heavy Draft 24 20 3 1 0.10
German Warmblood 35 33 2 0 0.03
TOTAL 193 139 44 10 0.17
a ins = long variant corresponding to the genomic reference NC_009146.2; del = short variant encompassing the 1,339
bp deletion spanning two coding exons. b A synthetic cross involving German Riding Pony, Haflinger Horse, Connemara Pony and New Forrest Pony; bred
for milk yield. c The frequency in Fjord Horses is not reported with respect to the small sample size, but the breed is included in the
total values.
79
Figure 1. Agarose gel electrophoresis of PCR products spanning the 1.3 kb deletion. The upper visible band
corresponds to the long variant (denoted as +), the lower one to the short variant containing the deletion (denoted as
). Only in heterozygotes, a third band with a size of approximately 2.1 kb is visible, which is possibly arising from
asymmetric hybridization of the alleles due to the presence of a duplication. The breeds of the corresponding samples
are given above the lanes (RHD = Russian Heavy Draft, GWb = German Warmblood, IC = Icelandic Horse, HF =
Haflinger).
Figure 3. Agarose gel electrophoresis of equine CSN1S2 cDNA. The RNA was isolated from the milk of a mare
being homozygous for the deletion (/).and three mares homozygous for the long variant (+/+).
80
Figure 2. Structure of the long and short equine αs2-casein variants. A. Genomic organization of the respective gene segment. Grey shading indicates the equid
specific 309 bp duplication comprising coding exons 8 and 10, respectively. The 1.3 kb in-frame-deletion is indicated above the figure. B. Structures the resulting
transcript variants. C. Protein alignment of available ungulate αs2-casein protein sequences.
81
Analysis of transcripts
The duplicated region within the 1.3 kb deletion contains a coding exon with a length of 24 bp.
The two copies were found to be completely identical including intact splice sites. However, only
one of the identical exons is present in the current RefSeq transcript NM_001170767.2. Thus, it
was unclear which exons are transcribed and whether both variants are transcribed at all. Therefore,
we purified total RNA from the skimmed milk of four mares, three of them being homozygote for
the long and one for the short variant, respectively. After reverse transcription, the CSN1S2
transcripts were amplified using primers located in the untranslated regions. Agarose gel
electrophoresis of the PCR products revealed a difference of approximately 50 bp between the
alternatively homozygote animals (Figure 3) showing that both, a long and a short transcript, were
actually expressed. Subsequently, the open reading frames of both transcripts were sequenced. The
difference was found to be due to a 51 bp in-frame insertion/deletion after exon eight encompassing
the duplicated exon as well as a previously not annotated exon that perfectly aligns within the 1.3
kb deletion (Figure 2A/B). Exon numbering was consequently adapted counting the newly
annotated exon as exon 9 and the duplicate of exon 8 as exon 10. Although the genome assembly
(EqCab2.0) comprises the long variant, the RefSeq transcript NM_001170767.2 used for
annotation represents the short variant. A BLAST search showed that both transcripts had been
reported before (GenBank KP658381.1 and KP658382.1) and both variant transcripts have recently
been added to the unreviewed UniProt database (Acc. No. A0A0C5DH76 and D2KAS0), but no
further information or publication is available. The transcript sequences from the current study are
available under the accession numbers KT368778 and KT368779.
Comparative analysis
Translations of the long and short transcript, respectively, were aligned to available protein
sequences of domestic donkey (Acc. No. CAV00691.1 (Chianese et al., 2010)), cattle (Acc. No.
NP776953.1), sheep (Acc. No. NP_001009363.1), goat (Acc. No. NP_001272514.1) and pig (Acc.
No. NP_001004030.1). From Figure 2C it can be seen that the duplication of exon 8/10 is unique
to donkey and horse, while the equine exon 9 appears to have a homologous sequence in other
ungulates. A BLAST search against the genome assembly of Przewalski’s horse (Burgud assembly,
CGF0000696695.1), a species that separated from the ancestral population of domesticated horses
38-72 kyr BP ago (Schubert et al., 2014; Orlando et al., 2013), also revealed the presence of the
82
long variant including the duplicated exon. Furthermore, the small read archive data sets of a
Middle Pleistocene horse, the “Thistle Creek horse” sequenced by Orlando and colleagues
(Orlando et al., 2013) (BioProject Accession PRJNA205517), as well as of several asses and zebras
sequenced by Jónsson and colleagues ((2014), BioProject Accession PRJEB7446) were checked
for reads either falling into the deleted region (indicating the long variant) or being split at the
boundaries (indicating the short variant). Only a single read almost perfectly aligning within the
deletion was found in the Middle Pleistocene horse, which might point to the presence of the long
variant. In the Somalian wild ass (E. asinus somalicus), we only identified the long variant, while
both alleles were found in the Tibetian Kiang (E. kiang). The sequenced Onager (E. hemionus
onager) was found to be homozygous for the deletion. These findings indicate that the duplication
event giving rise to an additional coding exon as well the deletion might be specific to equids and
must both have occurred before the ancestor of present-day asses and zebras dispersed into the Old
World 2.1–3.4 Mya (Jónsson et al., 2014). However, all analyzed zebras (Jónsson et al., 2014)
(Hartmanns Mountain zebra, E. zebra hartmannae; Grevy zebra, E. grevyi; Böhm’s plains zebra,
E. quagga boehmi as well as the extinct Quagga, E. q. quagga) were found to be homozygous for
the complete deletion. It seems also possible that the deletion initially occurred in horses and
represents the result of a gene flow between horses and ass species. It has been shown that this has
played a significant role in equid evolution (Jónsson et al., 2014).
Protein and peptide analysis
Lyophilized milk powder from two mares being homozygote for the long and short variant,
respectively, were analyzed using SDS-PAGE resulting in different patterns of distinct bands
(Figure 4). In-gel trypsin digestion and analysis by LC-MS revealed the presence of unique
peptides only for the long form of αs2-casein (A0A0C5DH76) in milk of the animal homozygous
for the insertion, i.e., peptides FPTEVYSSSSSSEESAK, FPTEVYSSSSSSEESAKFPTER,
FPTEVYSSSSSSEESAKFPTEREEK and NINEMESAKFPTEVYSSSSSSEESAK. Interestingly,
these peptides were identified in both phosphorylated (singly phosphorylated at different residues)
and non-phosphorylated forms. Evidence for multiple phosphorylations on these peptides was also
observed. Unique peptides for the short form of αs2-casein (D2KAS0) were only identified in milk
from the mare homozygous for the deletion, i.e., NINEMESAKFPTER,
NINEMESAKFPTEREEK, NINEMESAKFPTEREEKEVEEK (Figure 5, Table 2). As commonly
83
observed in MS based protein analytics, a 100% sequence coverage was not reached; however, the
proteotypic peptides identified allowed clearly to distinguish the two equine αS2-casein variants.
Therefore, it can be concluded that both protein variants differing in length by 17 aa are expressed.
The comparative analysis has shown that the long variant is probably the equid specific ancestral
variant, but the deletion also seems to have been present before zebras and asses diverged from
horses. Thus, we propose to term the long variant CSN1S2*A and the short variant CSN1S2*B.
Generally, the milk proteome is very complex both due to the presence of genetic variants and
posttranslational modifications (Uniacke-Lowe et al., 2013). Here, both genetic variants as well as
differently phosphorylated peptides have been detected. Recent proteomic studies (Uniacke-Lowe
et al., 2013; Hinz et al., 2012) have demonstrated considerable microheterogeneity for equine
caseins, especially -casein (Uniacke-Lowe et al., 2013). However, these studies did not report any
findings regarding αS2-casein, probably due to its very low concentration in horse milk (Uniacke-
Lowe et al., 2010). However, Ochirkhuyag et al. (2000) reported the presence of two distinct bands
for this protein.
84
Table 2. Bands excised from a mare with +/+-genotype (upper part) and / genotype (lower part), respectively, and
major milk proteins identified are shown (only those with > 20 PSMs). αS2-Casein with accession no. A0A0C5DH76
is the long form (231 AA) while αS2-casein with accession no. D2KAS0 is the shorter form of αS2-casein (214 AAs).
Unique peptides were only identified for the long form of αS2-casein (A0A0C5DH76) in the +/+-mare, while unique
peptides for the short form of αS2-casein (D2KAS0) were identified only in milk from the /-mare.
Band Accession Description Coverage (%) #Unique
Peptides #Peptides #PSMs
Mare homozygous for long variant (+/+)
1
Q9GKK3 ß-casein 35.68 9 9 87
D2KAS0 αs2-casein 49.53 0 13 35
A0A0C5DH76 CSN1S2 protein 45.89 0 13 35
2
Q9GKK3 ß-casein 32.78 8 8 45
A0A0C5DH76 αs2-casein 72.73 2 17 45
D2KAS0 αs2-casein 64.02 0 15 43
P82187 κ-casein 23.78 7 9 40
Q95KZ7 αs1-casein 41.35 1 12 31
3
Q9GKK3 ß-casein 35.68 11 11 138
Q95KZ7 αs1-casein 45.67 2 15 47
A0A0C5DH76 αs2-casein 58.01 1 14 31
D2KAS0 αs2-casein 54.67 0 13 30
P82187 κ-casein 23.78 4 6 21
4
Q95KZ7 αs1-casein 45.67 2 15 67
Q9GKK3 ß-casein 35.68 10 10 35
A0A0C5DH76 αs2-casein 60.17 2 16 31
D2KAS0 αs2-casein 54.67 0 14 29
5
A0A0A1E470 Immunoglobulin lambda
light chain variable
region (fragment)
46.46 2 12 62
A0A0C5DH76 αs2-casein 71.86 3 20 59
D2KAS0 αs2-casein 63.08 0 17 52
Mare homozygous for short variant (/)
1 Q9GKK3 ß-casein 35.68 10 10 80
2
Q9GKK3 ß-casein 35.68 12 12 139
Q95KZ7 αs1-casein 45.67 2 16 75
Q8SPR1 αs1-casein 63.68 0 18 65
D2KAS0 αs2-casein 73.36 2 20 60
A0A0C5DH76 αs2-casein 58.44 0 18 58
P82187 κ-casein 29.73 3 6 34
3
D2KAS0 αs2-casein 73.36 1 24 82
Q9GKK3 ß-casein 35.68 11 11 80
A0A0C5DH76 αs2-casein 67.97 0 23 78
Q95KZ7 αs1-casein 31.25 2 9 24
85
Figure 4. SDS-PAGE of crude mare’s milk being homozygous for the deletion (Δ/Δ) and homozygous for the
long variant (+/+). Ten and 20 µg of crude milk from both mares was loaded in duplicate. Excised bands that were
in-gel digested with trypsin and later analyzed by LC-MS are indicated. M (Roti®-Mark Bicolor protein standard); B
(Blank, Laemmli buffer).
Figure 5 Combined sequence coverage (all bands excised) of αS2-casein in mare with +/+ genotype (A) and Δ/Δ
genotype (B). From the +/+ genotype only unique peptides were identified for the longer αS2-casein form (Accession
no. A0A0C5DH76, 231 AAs). Sequence which is unique to A0A0C5DH76 is underlined. For the Δ/Δ genotype only
unique peptides were identified for the shorter alphaS2-casein form (Accession no. D2KAS0, 214 AAs). Sections in
green represents parts of the protein which were identified by the sequest-HT algorithm.
86
Conclusion
Within the current study, we have characterized two major variants of equine αS2-casein, which we
named CSN1S2*A and CSN1S2*B. The variation is due to a 1.3 kb in-frame deletion involving two
coding exons corresponding to 17 amino acid residues. One of those exons has arisen from a
duplication that is probably specific to the equid lineage. We verified both genomic variants at the
transcript as well as the protein level and were able to demonstrate that these variants are also
segregating in asses, meaning that they are likely to have occurred before the first ancestor of
present-day asses and zebras dispersed into the Old World 2.1–3.4 Mya.
Acknowledgements
This project was funded by the German Federal Ministry of Education and Research (Bonn,
Germany) within the competence network “Food Chain Plus” (FoCus, grant no. 0315539A). The
authors would like to thank all the mare’s milk producers for providing hair samples, Haflinger
stud Seraphin for providing milk samples, Julia Tetens for her help with sample collection and
Gabriele Ottzen-Schirakow for expert technical assistance.
References
Businco, L., Giampietro, P. G., Lucenti, P., Lucaroni, F., Pini, C., Di Felice, G., Iacovacci, P.,
Curadi, C., Orlandi, M. 2000. Allergenicity of mare’s milk in children with cow’s milk allergy.
Journal of Allergy and Clinical Immunology 105(5):1031–1034.
Caroli, A. M., Chessa, S., Erhardt, G. J. 2009. Invited review: milk protein polymorphisms in
cattle: effect on animal breeding and human nutrition. J. Dairy Sci. 92(11):5335–5352.
Chen, Y., Wang, Z., Chen, X., Liu, Y., Zhang, H., Sun, T. 2010. Identification of angiotensin I-
converting enzyme inhibitory peptides from koumiss, a traditional fermented mare's milk. J.
Dairy Sci. 93(3):884–892.
87
Chianese, L., Calabrese, M. G., Ferranti, P., Mauriello, R., Garro, G., Simone, C. de, Quarto, M.,
Addeo, F., Cosenza, G., Ramunno, L. 2010. Proteomic characterization of donkey milk
"caseome". J Chromatogr A 1217(29):4834–4840.
Curadi, M. C., P. G. Giampietro, P. Lucenti, Orlandi, M. 2001. Use of mare milk in pediatric
allergology., Firenze, 12.-15.06.2001.
Foekel, C., Schubert, R., Kaatz, M., Schmidt, I., Bauer, A., Hipler, U.-C., Vogelsang, H., Rabe,
K., Jahreis, G. 2009. Dietetic effects of oral intervention with mare's milk on the Severity Scoring
of Atopic Dermatitis, on faecal microbiota and on immunological parameters in patients with
atopic dermatitis. Int J Food Sci Nutr 60 Suppl 7:41–52.
Fox, P. F., Uniacke, T. 2010. Chemical and physico-chemical properties of equid milk. p. 39. In
Book of Abstracts of the 61st Annual Meeting of the European Association for Animal
Production: Heraklion - Crete Island, Greece, 23-27 August 2010. Wageningen Academic Pub.
Gaillard, J.-L., Qanbari, S., Drögemüller, C., Pimentel, E. C. G., Thaller, G., Tetens, J. 2013.
DNA-based identification of novel bovine casein gene variants. J. Dairy Sci. 96(1):699–709.
Ikonen, T., Bovenhuis, H., Ojala, M., Ruottinen, O., Georges, M. 2001. Associations between
casein haplotypes and first lactation milk production traits in Finnish Ayrshire cows. J. Dairy Sci.
84(2):507–514.
Jónsson, H., Schubert, M., Seguin-Orlando, A., Ginolhac, A., Petersen, L., Fumagalli, M.,
Albrechtsen, A., Petersen, B., Korneliussen, T. S., Vilstrup, J. T., Lear, T., Myka, J. L.,
Lundquist, J., Miller, D. C., Alfarhan, A. H., Alquraishi, S. A., Al-Rasheid, K. A. S., Stagegaard,
J., Strauss, G., Bertelsen, M. F., Sicheritz-Ponten, T., Antczak, D. F., Bailey, E., Nielsen, R.,
Willerslev, E., Orlando, L. 2014. Speciation with gene flow in equids despite extensive
chromosomal plasticity. Proceedings of the National Academy of Sciences of the United States of
America 111(52):18655–18660.
88
Lara-Villoslada, F., Olivares, M., Xaus, J. 2005. The balance between caseins and whey proteins
in cow's milk determines its allergenicity. J. Dairy Sci. 88(5):1654–1660.
Lisson, M., Lochnit, G., Erhardt, G. 2013. Genetic variants of bovine beta- and kappa-casein
result in different immunoglobulin E-binding epitopes after in vitro gastrointestinal digestion. J.
Dairy Sci. 96(9):5532–5543.
Lisson, M., Novak, N., Erhardt, G. 2014. Immunoglobulin E epitope mapping by microarray
immunoassay reveals differences in immune response to genetic variants of caseins from
different ruminant species. J. Dairy Sci. 97(4):1939–1954.
Malacarne, M., Martuzzi, F., Summer, A., Mariani, P. 2002. Protein and fat composition of
mare's milk: some nutritional remarks with reference to human and cow's milk. International
Dairy Journal 12(11):869–877.
Martuzzi, F., Vaccari Simonini, F. 2010. Advances on equine milk and derivatives for human
consumption. p. 40. In Book of Abstracts of the 61st Annual Meeting of the European
Association for Animal Production: Heraklion - Crete Island, Greece, 23-27 August 2010.
Wageningen Academic Pub.
McLean, D. M., Graham, E. R., Ponzoni, R. W., McKenzie, H. A. 1984. Effects of milk protein
genetic variants on milk yield and composition. Journal of Dairy Research 51(04):531–546.
Miller, S. A., Dykes, D. D., Polesky, H. F. 1988. A simple salting out procedure for extracting
DNA from human nucleated cells. Nucleic Acids Res. 16(3):1215.
Orlando, L., Ginolhac, A., Zhang, G., Froese, D., Albrechtsen, A., Stiller, M., Schubert, M.,
Cappellini, E., Petersen, B., Moltke, I., Johnson, P. L. F., Fumagalli, M., Vilstrup, J. T.,
Raghavan, M., Korneliussen, T. S., Malaspinas, A.-S., Vogt, J., Szklarczyk, D., Kelstrup, C. D.,
Vinther, J., Dolocan, A., Stenderup, J., Velazquez, A. M. V., Cahill, J., Rasmussen, M., Wang,
X., Min, J., Zazula, G. D., Seguin-Orlando, A., Mortensen, C., Magnussen, K., Thompson, J. F.,
89
Weinstock, J., Gregersen, K., Røed, K. H., Eisenmann, V., Rubin, C. J., Miller, D. C., Antczak,
D. F., Bertelsen, M. F., Brunak, S., Al-Rasheid, K. A. S., Ryder, O., Andersson, L., Mundy, J.,
Krogh, A., Gilbert, M. T. P., Kjær, K., Sicheritz-Ponten, T., Jensen, L. J., Olsen, J. V., Hofreiter,
M., Nielsen, R., Shapiro, B., Wang, J., Willerslev, E. 2013. Recalibrating Equus evolution using
the genome sequence of an early Middle Pleistocene horse. Nature 499(7456):74–78.
Rozen, S., Skaletsky, H. 2000. Primer3 on the WWW for general users and for biologist
programmers. Methods Mol. Biol. 132:365–386.
Saletti, R., Muccilli, V., Cunsolo, V., Fontanini, D., Capocchi, A., Foti, S. 2012. MS-based
characterization of α(s2)-casein isoforms in donkey's milk. J Mass Spectrom 47(9):1150–1159.
Schubert, M., Jónsson, H., Chang, D., Der Sarkissian, C., Ermini, L., Ginolhac, A., Albrechtsen,
A., Dupanloup, I., Foucal, A., Petersen, B., Fumagalli, M., Raghavan, M., Seguin-Orlando, A.,
Korneliussen, T. S., Velazquez, A. M. V., Stenderup, J., Hoover, C. A., Rubin, C.-J., Alfarhan, A.
H., Alquraishi, S. A., Al-Rasheid, K. A. S., MacHugh, D. E., Kalbfleisch, T., MacLeod, J. N.,
Rubin, E. M., Sicheritz-Ponten, T., Andersson, L., Hofreiter, M., Marques-Bonet, T., Gilbert, M.
T. P., Nielsen, R., Excoffier, L., Willerslev, E., Shapiro, B., Orlando, L. 2014. Prehistoric
genomes reveal the genetic foundation and cost of horse domestication. Proc. Natl. Acad. Sci.
U.S.A. 111(52):E5661-9.
Schubert, R., Kahle, C., Kauf, E., Hofmann, J., Hubert, I., Gruhn, B., Hafer, R., Vogelsang, H.,
Jahreis, G. 2009. Dietetic efficacy of mare's milk for patients with chronic inflammatory bowel
diseases - clinical study. Ernährung 33(7/8):314–321.
Uniacke-Lowe, T., Huppertz, T., Fox, P. F. 2010. Equine milk proteins: Chemistry, structure and
nutritional significance. International Dairy Journal 20(9):609–629.
91
GENERAL DISCUSSION
The present study is part of the competence network FoCus (Food Chain Plus) which aims to
identify health-promoting ingredients of milk and to use them for functional dairy products. The
exploration of the functional dairy products and the investigation of the effects of these products
on nutrition related disorders are a focal point of the project. The effects of milk and milk products
on human health are of interest not only for science but also for the dairy industry and the
disposability of products, which are optimized with respect to their bioactive components.
Primarily, cow milk and cow milk products were investigated in the FoCus project. The interest in
mare milk arose due to the observed health benefit effects of mare milk and mare milk products on
diseases like atopic dermatitis (Foekel et al., 2009), chronic inflammatory bowel diseases (Schubert
et al., 2009) or cardiovascular disorders (Chen et al., 2010). Furthermore, mare milk is tolerated by
96 % of children affected by cow milk protein allergy (Businco et al., 2000; Curadi et al., 2001).
The milk proteins are known to contribute to the health affecting components of milk, and the high
nutritional value of milk is based not only on the supply of many vitamins, minerals and fatty acids,
but also in the high quality protein, which provides all essential amino acids. During digestion,
milk proteins are degraded into peptides which may have bioactive functions and influence human
health. Whereas there are several studies dealing with the release of bioactive peptides from bovine
milk proteins (Clare and Swaisgood, 2000), the knowledge about the release of these peptides from
horse milk is scarce. Due to alterations in the amino acid sequence caused by single nucleotide
exchanges or deletions as well as duplications on the DNA level, the release of these bioactive
peptides may be affected as gene mutations can alter the cleavage sites for proteolytic enzymes.
Furthermore, amino acid exchanges can modify the binding epitopes for IgE mediated allergenic
reactions, which affects the allergenic potential of the milk. In addition, milk protein variants may
influence the processing properties of the milk. Therefore, the aim of this study was to unravel the
degree of genetic variability in equine milk protein genes. To this end, the six main milk protein
genes of 198 horses were resequenced. Furthermore, data from next generation sequencing of 55
horses was evaluated and the structure of CSN1S2, the gene coding for αs2-casein, was analyzed on
RNA, DNA and protein level. The results of the sequencing of equine ß-lactoglobulin are illustrated
in Chapter II, variants of equine casein genes are summarized in Chapter III and the results of the
examination of equine CSN1S2 are topic of Chapter IV. Altogether, 44 milk protein gene variants
92
were identified, 35 of them considered as novel. Moreover, two additional coding exons were
identified for equine CSN1S2, and ancient duplication and deletion events in this gene were shown
on DNA, as well as on the RNA and protein level. The result of the sequencing of equine α-
lactalbumin will be illustrated in the following and discussed together with the results of the other
milk protein genes in a general context.
Resequencing of equine α-lactalbumin
In Chapter II the results of the sequencing of the equine whey protein genes LGB1 and LGB2 are
described. The results of the sequencing of LALBA, the gene coding for α-lactalbumin, were not
incorporated in this study. As these results are interesting for the general discussion they are
presented in the following.
For the resequencing of the open reading frame of LALBA a total of four primer pairs was designed
(Supplemental Table 5). PCR amplification and DNA sequencing were done as described by
Gallinat et al. (2013). Equine LALBA was successfully sequenced in 183 horses belonging to 8
breeds (Supplemental Table 6). All the examined animals showed no differences to the genomic
GenBank reference sequence NC_009149.2 and the corresponding mRNA sequence
XM_001915789 and no genetic variability was found in this gene. The uniformity of equine
LALBA will be subject to discussion below.
Selected animals and applied methods
Equine DNA was isolated from blood and hair samples which were collected from farms in
Germany. We focused on breeds which are used for dairy production in Germany. Nevertheless,
we tried to cover a wide spectrum of different breeds that provide high genetic variability.
Therefore, not only samples of the widely used dairy breed Haflinger were analyzed, but also from
German Warmblood Horses, some special breeds as well as one heavy breed. One of the examined
breeds was a crossbreed for dairy production. Mares kept in this stud have been selected for some
generations for milk yield and milkability, which is a very rare breeding objective in horse
breeding. The blood samples and the hair samples showed no considerable differences of the
isolated DNA regarding DNA yield and quality. The main advantage of hair samples is that no
veterinarian is required for sample collection. To properly take a hair sample, some hairs with roots
from mane or tail need to be ripped out. This procedure was very easy and needed only scarce
93
intervention to the animals. Furthermore, the handling of hair samples was uncomplicated with
regard to transport and storage. The DNA isolated from these samples was examined by direct
sequencing. Almost all known variants of equine milk protein genes and 35 newly identified
variants were found with this method, which demonstrates that it presents an advantageous
approach for detecting milk protein variants on the genetic level. Recent progress in DNA-
sequencing made this method feasible with regard to costs and time, results can be generated
quickly and genotypes for each animal are available, which is an advantage compared to milk
protein analysis from pooled samples. Furthermore, DNA material is easier to sample than milk,
which is required for protein analysis. The main disadvantage of our method is that it provides no
information about the expression of the identified variants. As there are already splicing variants
described in equine milk proteins, analysis of RNA would be eligible. A first step towards this
approach was the RNA analysis of CSN1S2 (Chapter IV). For RNA isolation milk samples are
indispensable even though they are more difficult to gain. Due to the fact that we had Haflinger
mares from a local dairy stud in our study, it was possible to obtain milk samples from four mares
which were already genotyped. The RNA isolation from this milk was done with a RNeasyMini
Kit (Qiagen GmbH, Hilden, Germany) as described by the manufacturer. This method was a
suitable method for mare milk and we were able to extract adequate RNA yield from the fresh
whole mare milk. Certainly, it was of special importance to monitor strict hygienic standards during
milking and preperation to prevent the RNA from degradation by RNase. Likewise, the time
between milking and processing the milk in the lab should be as short as possible, to achieve a high
RNA yield. cDNA was written from the RNA with SuperScript® III First-Strand Synthesis
SuperMix kit (Invitrogen). For optimum results in sequencing the cDNA, the RNA should be
cleaned off thoroughly to remove free dNTPs, primers and further contaminations. With the
generated cDNA it was possible to confirm our DNA based results of the structure of CSN1S2 and
to expand the mRNA sequence for one coding exon which was previously not annotated.
Furthermore, duplication and deletion events in this gene were elucidated. By in-gel digestion of
crude milk from two mares it was possible to confirm the differences in length of equine αs2-caseins
observed on the genetic level on the protein level as well.
To expand our selection of equine breeds, individual whole genome sequence variant calling data
of a total 55 horses of 11 different breeds were incorporated in the study. The results of the
sequencing of the German equine dairy breeds were confirmed with this data to a large extent.
94
A problem in equine dairy production is that nearly no milk performance data is recorded. Data
about milk yield, protein and fat content of the equine milk are hardly available, so that possible
association of genotype data with phenotypes cannot be investigated. Conclusions about
advantages or disadvantages of a certain milk protein genotype compared to cattle (Caroli et al.,
2009) are difficult to make.
With the applied methods, it was possible to archieve substantial new information about the equine
milk protein genes. Nevertheless, the genetic variants of equine milk protein genes and the
provisional nomenclature of these variants should be validated in future studies on RNA and
protein level.
Impact of variability of milk protein genes in horses
Genetic variability of milk protein genes is well characterized in bovine milk and several different
variants of the six main milk proteins are known (Caroli et al., 2009). Ovine (Giambra and Erhardt,
2012) and caprine (Selvaggi et al., 2014) milk protein variants were subject to scientific interest as
well. In these typical dairy species, the knowledge about different milk protein variants, which
might alter the quality of the milk and influence the nutritive value as well as the processing
properties, is of interest for the economic value of the milk and consequently for breeding decisions.
Recently, commercial interest arises for functional milk products with optimized bioactive
components. Claimed health benefits of milk products may be an important argument for the
customer making a purchase decision. Horses are not a typical dairy species and the extent of mare
milk production is much lower than milk production in cattle or even in sheep or goat. As the mare
milk production in Europe amounts to roughly 1 million kg (Fox and Uniacke, 2010), the economic
impact of mare milk is negligible compared to the typical dairy species. The sale of mare milk is
therefore mostly based on direct marketing. However, there is specific interest in mare milk
because health effects of mare milk have empirically been known since decades. So far, studies
about mare milk proteins are mainly based on protein level (Miranda et al., 2004), some studies are
dealing with RNA analysis (Lenasi et al., 2003). DNA based results are scarce (Hobor et al., 2006;
2008) and knowledge about equine milk protein variants is marginal. However, the present study
identified several previously unknown equine milk protein variants. For αs1-casein, 6 gene variants
were found and 4 gene variants of ß-casein were detected. The analysis of αs2-casein revealed 8
gene variants and 13 variants of equine κ-casein were found (Chapter III). Equine lactoglobulin I
95
was less variable with only two genetic variants, besides the reference sequence only one signal
peptide variant of this gene was found. With 10 genetic variants, equine ß-lactoglobulin II showed
more genetic variability (Chapter II). Equine α-lactalbumin was least variable, all animals involved
in our study were uniform considering the open reading frame of LALBA, the gene coding for this
protein.
The uniformity of equine LALBA is probably due to its particular importance in lactose synthesis.
Stacey et al. (1995) showed that in mice an α-lactalbumin deficit caused by a deletion of the
LALBA gene leads to a reduced amount of thickened milk containing little or no lactose, which is
not sufficient to nurse the offspring. Nevertheless, prior studies described multiple forms of equine
α-lactalbumin. Girardet et al. (2004) found different isoforms of equine α-lactalbumin, explained
by posttranslational modifications, which were not investigated in our study. Godovac-
Zimmermann et al. (1987) detected three different isoforms of α-lactalbumin, declared by amino
acid exchanges in the mature protein (Chapter I). In case of the two lactoglobulin genes, LGB1 was
found to be strongly conserved across breeds, while LGB2 was highly variable. This indicates a
higher selective pressure on LGB1 and suggests that it is the ancestral paralogue which has a crucial
function that has to be maintained. In ruminants there is only one gene coding for ß-lactoglobulin,
but the existence of a ß-lactoglobulin pseudogene was demonstrated (Passey and Mackinlay, 1995).
Eleven variants of bovine ß-lactoglobulin were described (Caroli et al., 2009), nearly as variable
as the equine ß-lactoglobulin II. Equine κ-casein was the most variable gene among the casein
genes with 13 variants detected within our study. Similar variability of κ-casein was observed in
cattle, with 14 variants of this gene noted (Caroli et al., 2009). In sheep, this gene showed almost
no variability (Ceriotti et al., 2004; Feligini et al., 2005), the selection for good cheese making
properties in sheep was discussed as a possible reason for the conservation of ovine κ-casein
(Ceriotti et al., 2004; Tetens, 2014). Even though this gene was shown to be highly variable in
horses as well as in cattle, κ-casein is essential for lactation. Shekar et al. (2006) showed that a lack
of this gene leads to destabilization of micelles, resulting in failure of lactation in mice. This result
was in contrast to comparable studies in goats with a lack of αs1-casein (Chanat et al., 1999) and in
mice with a lack of ß-casein (Kumar et al., 1994). A lack of these genes was not critical for lactation
or milk micelle formation, although the lack of αs1-casein reduces the rate of transport of the other
caseins. Even though lactation was sustained in the animals lacking αs1- or ß-casein, the growth of
the suckling pup was reduced in mice (Kolb et al., 2011; Kumar et al., 1994). Shekar et al. (2006)
96
concluded, that these caseins are functionally redundant. Nevertheless, equine αs1-, ß- and αs2-
casein were observed to be less variable than κ-casein in our study. The least variable casein was
ß-casein with only four gene variants, one of them a signal peptide variant. In contrast, bovine ß-
casein showed a considerably high variability with 14 variants (Caroli et al., 2009; Gallinat et al.,
2013), being therefore the most variable bovine milk protein. A signal peptide variant was found
for αs1-casein as well, with considerably high allele frequencies up to 0.5. Whether this genetic
variant can be translated into a protein remains to be demonstrated. Possibly a lack of this protein
in animals homozygote for the signal peptide variant is compensated by the functional redundancy
of the other calcium sensitive casein genes. The equine casein genes were similar to other species
genetic variability but the casein cluster is highly conserved concerning organization and
orientation of the genes (Rijnkels, 2002), due to the importance of the caseins in lactation and
therefore in successful rear of the offspring.
Breed diversity regarding milk protein variants
The horse breeds in the current study differed in their genetic variability of milk protein genes. On
the one hand the dairy crossbreed with only 15 variants within the six main milk protein genes, on
the other hand the Icelandic Horse with 28 variants in total, nearly twice as many as the crossbreed.
Differences in variability can originate from breeding histories of the individual breeds; influencing
factors may be long time isolation as in Icelandic Horses or bottleneck effects as in Russian Heavy
Drafts. Due to the crossing of several different pony breeds (German Riding Pony, Haflinger Horse,
Connemara Pony, New Forrest Pony and further pony breeds), a high genetic variability for these
animals was expected, but this was not the case. Only two variants of CSN3, the gene coding for
equine κ-casein, were detected even though this gene was quite variable in other breeds with up to
seven different variants. Also the other caseins of crossbreed animals showed comparatively low
variability. In contrast, LGB2 of crossbred horses was more variable, with one variant exclusive to
this population. Maybe the selection of milk yield and milkability in crossbreed horses is the reason
for this low variability in caseins. Due to the close linkage of the casein genes, effects of individual
caseins are different to estimate (Lien et al., 1995), but studies on bovine casein genes showed that
some casein haplotypes influence the quality of the milk concerning fat or protein content.
Furthermore, effects on milk yield were observed (Boettcher et al., 2004). Possibly, a specific
casein haplotype leads to advantages in milk quality or yield, and animals with this genotype were
97
preferred in breeding selections. In German Warmblood Horses 25 variants of the six main milk
proteins were detected. The Warmblood samples from other countries were similar to German
Warmbloods. Due to fact, that only two UK Warmbloods, two Swiss Warmbloods and one Dutch
Warmblood were incorporated in the study it is possible that more infrequent variants of these
breeds were not found. In these animals the main German Warmblood variants were present, maybe
because extensive exchange of breeding stock between breeding organizations has been going on
for many years (Koenen et al., 2004). Only in one UK Warmblood Horse a variant was detected
which was not found in other Warmblood breeds, but in Haflinger Horses, Criollos and Franches-
Montagnes (LGB2*D1). Franches-Montagnes can be considered as light Draft or as heavy
Warmblood. The gene variants of LGB2, detected in this breed, showed considerable differences
to those from Warmblood Horses, being more similar to Haflinger Horses than to Warmbloods. In
case of the caseins, the Franches-Montagnes showed more similarities to Warmblood Horses. With
variants CSN1S1*E and CSN3*K, the Franches-Montagnes had two casein gene variants, which
are otherwise only common to warmblood breeds. These results contribute to the classification
between warmblood and draft horses, since influence from draft horses is discussed for the
Haflinger as well (Nissen, 1997).
Derivation of Casein Haplotypes
The four equine casein genes CSN1S1, CSN2, CSN1S2 and CSN3 are in close linkage in a 290 kb
cluster on chromosome 3 (ECA3) (Milenkovic et al., 2002; Egito et al., 2002; Lenasi et al., 2003;
Miranda et al., 2004; Lenasi et al., 2005; Girardet et al., 2006; Miclo et al., 2007; Martin et al.,
2009; Selvaggi et al., 2010). In Chapter III, 31 different casein gene variants were described, 26 of
them considered novel. As described in cattle, different casein variants can influence the nutritional
value of the milk (Martin et al., 2002), but the close physical location of the four caseins, which is
comparable in cattle and horses, makes it difficult to estimate effects of individual casein genes
(Lien et al., 1995). Studies on bovine casein genes showed that some casein haplotypes influence
the quality of the milk concerning fat or protein content, furthermore, effects on milk yield were
reported (Boettcher et al., 2004). The different breeds in our study showed considerable differences
in the variability of their casein genes. Presently, no studies about the influence of equine casein
haplotypes on the nutritional quality of mare milk were available; hence our intention was to
derivate the main equine casein haplotypes and to demonstrate differences between breeds. For
98
haplotype reconstruction, PHASE 2.1 (Stephens et al., 2001; Stephens and Donnelly, 2003) was
used, a program which implements a Bayesian statistical method for reconstructing haplotypes
from population genotype data. For the estimation of haplotypes, German Warmblood Horses and
crossbreed horses were selected. Furthermore, Haflinger Horses, which are the most frequent used
breed for mare milk production in Germany, were included in the analysis. In total, 102 individuals
and all 21 identified non-synonymous nucleotide exchanges were included in the haplotype
reconstruction. The default model of a case-control permutation test was used and the German
Warmblood Horses, Haflingers and crossbreed horses are subdivided into 3 groups. The estimated
haplotypes have to be taken with care, because the sample size is low, but the estimated haplotypes
may provide a first insight of casein haplotype distribution among equine breeds. Haplotype
frequencies of 0.1 and lower were not specified in the analysis. Figure 1 summarizes the most
frequent haplotypes across all breeds (Crossbreed, German Warmblood, Haflinger) and their
distribution within each breed. Haplotype order is CSN1S1, CSN2, CSN1S2 and CSN3 (αs1- ß-, αs2-
, and κ-casein encoding gene) and the haplotypes were previously deducted from genotypes.
99
Figure 1. Percentage of the most frequent casein haplotypes (CSN1S1, CSN2, CSN1S2, CSN3) within Haflinger
Horses, German Warmblood Horses and crossbreed horses
A total of 21 equine casein haplotypes were identified. The most frequent haplotype was AAAA
(CSN1S1*A-CSN2*A-CSN1S2*A-CSN3*A), with frequencies from 0.29 in Haflinger Horses up to
0.63 in Warmblood Horses. The second most frequent haplotype was A*AAA, in Haflinger Horses
with a frequency of 0.29 as common as AAAA. Again, considerable differences in haplotype
frequencies were observed between the different breeds, the crossbreed horses have an A*AAA
frequency similar to Haflinger Horses (0.21), whereas in Warmblood Horses it is only 0.08.
Nevertheless, it should be taken into account that the haplotype A*AAA includes a signal peptide
variant of CSN1S1, and currently it is not clear whether this variant is translated into a protein or
whether this variant is a null allele, as well as for other haplotypes including signal peptide variants
100
of CSN1S1 or CSN2. In general, the three breeds showed considerable differences in haplotype
distribution. In crossbreed horses, seven main haplotypes are deviated. The haplotypes AAAA and
AABA and the haplotypes A*A*AC and A*A*BC include the long and the short variant of CSN1S2
each, thus they differ from each other by an 1.3 kb deletion along CSN1S2, as described in Chapter
IV. The haplotype AAE1A was private to crossbreed horses. In this population, all haplotypes were
described with the 7 main haplotypes and no further haplotypes with a frequency of 0.1 or lower,
as found in German Warmbloods and Haflinger Horses, were found. This is in line with the
comparatively low genetic variability of the caseins of the dairy crossbreed. In Haflinger Horses,
five main haplotypes were estimated. As in the crossbreed horses, the haplotype AAAA was found
as short variant AABA as well. The haplotype AAE2C was private to Haflinger Horses. As in the
other breeds, the long variant AAAA and the short variant AABA were found in German Warmblood
Horses. With an allele frequency of 0.18, a comparatively high number of haplotypes with a
frequency of 0.1 or lower was found in this breed. Three haplotypes were private to German
Warmblood Horses, notably AAAC, A*AD1A and A*AAK. Nevertheless, for a definitive
assignment of particular casein haplotypes to individual horse breeds, more animals in total and for
each breed are required.
Mare milk for human health
Mare milk is empirically known to exhibit several health effects. In naturopathy, mare milk is used
to cure diseases like high blood pressure, bowel diseases and skin problems. Mare milk is also used
for the improvement of general physical health as mare milk is said to give more energy and to
raise the vitality. Several further indications of mare milk in naturopathy are known. None of these
effects is scientifically proven, although the effectiveness of mare milk was confirmed by long
experience of Russian sanatoria. Various literature from the former USSR is available, summarized
by Lozovich (1995). Recent studies provided first evidence for scientific elucidation of health
effects of mare milk (Chen et al., 2010; Foekel et al., 2009; Schubert et al., 2009). The more detailed
knowledge about structure and variability of equine milk proteins supplied by the present study is
a useful tool for further studies, especially about the release of different bioactive peptides from
mare milk. Mare milk is also discussed as substitute in case of a cow milk protein allergy (CMA)
(Businco et al., 2000; Curadi et al., 2001). Businco et al. (2000) showed that mare milk is tolerated
by 96% of children with CMA. The main allergens in case of a milk protein allergy are ß-
101
lactoglobulin, α-lactalbumin and αs1-casein, although no single protein can be held responsible for
the major part of allergenicity in milk (Lisson, 2014). The absence of IgE binding epitopes in
equine milk, probably due to differences in the amino acid sequence, was discussed as possible
explanation for the better tolerability of mare milk (Curadi et al., 2001; Businco et al., 2000). The
results of the recent study may thus be an important source for further investigations about the
allergenicity of mare milk. Very interesting in this context is the variant CSN1S1*A*, which is a
signal peptide variant of one of the main allergens in case of CMA. The casein haplotype A*AAA,
including this signal peptide variant, was the second most frequent casein haplotype among the
crossbreed horses, Haflinger Horses and German Warmblood Horses. Possibly the signal peptide
variant leads to a lack of this protein in the milk of animals homozygote for the CSN1S1*A*, which
is a proper explanation for a better tolerability of milk from animals with this genotype.
REFERENCES
Boettcher, P. J., Caroli, A., Stella, A., Chessa, S., Budelli, E., Canavesi, F., Ghiroldi, S.,
Pagnacco, G. 2004. Effects of casein haplotypes on milk production traits in Italian Holstein and
Brown Swiss cattle. J Dairy Sci 87(12):4311–4317.
Businco, L., Giampietro, P. G., Lucenti, P., Lucaroni, F., Pini, C., Di Felice, G., Iacovacci, P.,
Curadi, C., Orlandi, M. 2000. Allergenicity of mare’s milk in children with cow’s milk allergy.
Journal of Allergy and Clinical Immunology 105(5):1031–1034.
Caroli, A. M., Chessa, S., Erhardt, G. J. 2009. Invited review: milk protein polymorphisms in
cattle: effect on animal breeding and human nutrition. J. Dairy Sci. 92(11):5335–5352.
Ceriotti, G., Chessa, S., Bolla, P., Budelli, E., Bianchi, L., Duranti, E., Caroli, A. 2004. Single
nucleotide polymorphisms in the ovine casein genes detected by polymerase chain reaction-single
strand conformation polymorphism. J. Dairy Sci. 87(8):2606–2613.
102
Chanat, E., Martin, P., Ollivier-Bousquet, M. 1999. Alpha(S1)-casein is required for the efficient
transport of beta- and kappa-casein from the endoplasmic reticulum to the Golgi apparatus of
mammary epithelial cells. J Cell Sci 112 (Pt 19):3399–3412.
Chen, Y., Wang, Z., Chen, X., Liu, Y., Zhang, H., Sun, T. 2010. Identification of angiotensin I-
converting enzyme inhibitory peptides from koumiss, a traditional fermented mare's milk. J.
Dairy Sci. 93(3):884–892.
Clare, D. A., Swaisgood, H. E. 2000. Bioactive Milk Peptides: A Prospectus. Journal of Dairy
Science 83(6):1187–1195.
Curadi, M. C., P. G. Giampetro, P. Lucenti, and M. Orlandi. 2001. Use of mare milk in pediatric
allergology., Firenze, 12.-15.06.2001.
Egito, A. S., Miclo, L., López, C., Adam, A., Girardet, J. M., Gaillard, J. L. 2002. Separation and
characterization of mares' milk alpha(s1)-, beta-, kappa-caseins, gamma-casein-like, and proteose
peptone component 5-like peptides. J. Dairy Sci. 85(4):697–706.
Feligini, M., Vlaco, S., Curik, V. C., Parma, P., Greppi, G., Enne, G. 2005. A single nucleotide
polymorphism in the sheep kappa-casein coding region. J. Dairy Res. 72(3):317–321.
Foekel, C., Schubert, R., Kaatz, M., Schmidt, I., Bauer, A., Hipler, U.-C., Vogelsang, H., Rabe,
K., Jahreis, G. 2009. Dietetic effects of oral intervention with mare's milk on the Severity Scoring
of Atopic Dermatitis, on faecal microbiota and on immunological parameters in patients with
atopic dermatitis. Int J Food Sci Nutr 60 Suppl 7:41–52.
Fox, P. F., Uniacke, T. 2010. Chemical and physico-chemical properties of equid milk. p. 39. In
Wageningen Academic Publishers (ed.). Book of Abstracts of the 61st Annual Meeting of the
European Association for Animal Production, Heraklion - Crete Island, Greece, 23-27 August
2010.
103
Gallinat, J. L., Qanbari, S., Drögemüller, C., Pimentel, E. C. G., Thaller, G., Tetens, J. 2013.
DNA-based identification of novel bovine casein gene variants. J. Dairy Sci. 96(1):699–709.
Giambra, I., Erhardt, G. 2012. Milk proteins, milk protein variants and the importance for the
sheep breeding – a review. Züchtungskunde (84 (1)):52–73.
Girardet, J.-M., Miclo, L., Florent, S., Mollé, D., Gaillard, J.-L. 2006. Determination of the
phosphorylation level and deamidation susceptibility of equine beta-casein. Proteomics
6(12):3707–3717.
Girardet, J.-M., N’negue, M.-A., Egito, A., Campagna, S., Lagrange, A., Gaillard, J.-L. 2004.
Multiple forms of equine α-lactalbumin: evidence for N-glycosylated and deamidated forms.
International Dairy Journal 14(3):207–217.
Godovac-Zimmermann, J., Shaw, D., Conti, A., McKenzie, H. 1987. Identification and the
primary structure of equine alpha-lactalbumin B and C (Equus caballus, Perissodactyla). Biol.
Chem. Hoppe-Seyler 368(4):427–433.
Hobor, S., Kunej, T., Dovc, P. 2008. Polymorphisms in the kappa casein (CSN3) gene in horse
and comparative analysis of its promoter and coding region. Anim. Genet. 39(5):520–530.
Hobor, S., Kunej, T., Lenasi, T., Dovč, P. 2006. Kappa casein gen (CSN3) in horse: Kapa
kazeinski gen (CSN3) pri konju genetic variability in exon 1 and 4 genetska variabilnost v eksonu
1 in 4. Acta agriculturae Slovenica 88(2):83–89.
Kaminogawa, S., McKenzie, H. A., Shaw, D. C. 1984. The amino acid sequence of equine alpha-
lactalbumin. Biochem. Int. 9(5):539–546.
Koenen, E., Aldridge, L., Philipsson, J. 2004. An overview of breeding objectives for warmblood
sport horses. Livestock Production Science 88(1-2):77–84.
104
Kolb, A. F., Huber, R. C., Lillico, S. G., Carlisle, A., Robinson, C. J., Neil, C., Petrie, L.,
Sorensen, D. B., Olsson, I. A. S., Whitelaw, C. B. A. 2011. Milk lacking α-casein leads to
permanent reduction in body size in mice. PLOS ONE 6(7):e21775.
Kumar, S., Clarke, A. R., Hooper, M. L., Horne, D. S., Law, A. J., Leaver, J., Springbett, A.,
Stevenson, E., Simons, J. P. 1994. Milk composition and lactation of beta-casein-deficient mice.
PNAS 91(13):6138–6142.
Lenasi, T., Kokalj-Vokac, N., Narat, M., Baldi, A., Dovc, P. 2005. Functional study of the equine
beta-casein and kappa-casein gene promoters. J. Dairy Res. 72 Spec No:34–43.
Lenasi, T., Rogelj, I., Dovc, P. 2003. Characterization of equine cDNA sequences for αS1-, β-
and κ-casein. J. Dairy Res. 70(1):29–36.
Lien, S., Gomez-Raya, L., Steine, T., Fimland, E., Rogne, S. 1995. Associations Between Casein
Haplotypes and Milk Yield Traits. Journal of Dairy Science 78(9):2047–2056.
Lisson, M. 2014. Appearance of epitopes in bovine milk protein variants, their allergenicity and
potential use in human nutrition. Zugl.: Gießen, Univ., Diss., 2014. 1. Aufl. Édition scientifique.
VVB Laufersweiler, Gießen.
Lozovich, S. 1995. Medical uses of whole and fermented mare milk in Russia. Cultured Dairy
Products Journal(30):18–21.
Martin, P., Szymanowska, M., Zwierzchowski, L., Leroux, C. 2002. The impact of genetic
polymorphisms on the protein composition of ruminant milks. Reprod. Nutr. Dev. 42(5):433–
459.
Martin, P. D., Miclo, L., Rebours, E., Mateos, A., Miranda, G. 2009. Equus caballus mRNA
encoding CSN1S2 (alphaS2-casein) precursor (GenBank GU196267). Genetique Animale et
105
Biologie Integrative (GAI), INRA, Domaine de Vilvert, Jouy-En-Josas 78350, France.
Unpublished.
Miclo, L., Girardet, J.-M., Egito, A. S., Mollé, D., Martin, P., Gaillard, J.-L. 2007. The primary
structure of a low-Mr multiphosphorylated variant of beta-casein in equine milk. Proteomics
7(8):1327–1335.
Milenkovic, D., Martin, P., Guérin, G., Leroux, C. 2002. A specific pattern of splicing for the
horse αS1-Casein mRNA and partial genomic characterization of the relevant locus. Genet Sel
Evol 34(4):509.
Miranda, G., Mahé, M.-F., Leroux, C., Martin, P. 2004. Proteomic tools to characterize the
protein fraction of Equidae milk. Proteomics 4(8):2496–2509.
Nissen, J. 1997. Enzyklopädie der Pferderassen: Europa. Kosmos, Stuttgart.
Passey, R. J., Mackinlay, A. G. 1995. Characterisation of a second, apparently inactive, copy of
the bovine beta-lactoglobulin gene. Eur. J. Biochem. 233(3):736–743.
Rijnkels, M. 2002. Multispecies comparison of the casein gene loci and evolution of casein gene
family. J Mammary Gland Biol Neoplasia 7(3):327–345.
Schubert, R., Kahle, C., Kauf, E., Hofmann, J., Hobert, I., Gruhn, B., Häfer, R., Vogelsang, H.,
Jahreis, G. 2009. Dietetic efficacy of mare’s milk for patients with chronic inflammatory bowel
diseases – clinical study. Ernährung/Nutrition 33(7-8):314–321.
Selvaggi, M., Laudadio, V., Dario, C., Tufarelli, V. 2014. Major proteins in goat milk: an updated
overview on genetic variability. Mol. Biol. Rep. 41(2):1035–1048.
Selvaggi, M., Pesce Delfino, A. R., Dario, C. 2010. Exon 1 polymorphisms in the equine CSN3
gene: SNPs distribution analysis in Murgese horse breed. Anim. Biotechnol. 21(4):252–256.
106
Shekar, P. C., Goel, S., Rani, S. D. S., Sarathi, D. P., Alex, J. L., Singh, S., Kumar, S. 2006.
kappa-casein-deficient mice fail to lactate. Proc Natl Acad Sci U S A 103(21):8000–8005.
Stacey, A., Schnieke, A., Kerr, M., Scott, A., McKee, C., Cottingham, I., Binas, B., Wilde, C.,
Colman, A. 1995. Lactation is disrupted by alpha-lactalbumin deficiency and can be restored by
human alpha-lactalbumin gene replacement in mice. Proc. Natl. Acad. Sci. U.S.A. 92(7):2835–
2839.
Stephens, M., Donnelly, P. 2003. A comparison of bayesian methods for haplotype
reconstruction from population genotype data. American journal of human genetics 73(5):1162–
1169.
Stephens, M., Smith, N. J., Donnelly, P. 2001. A new statistical method for haplotype
reconstruction from population data. American journal of human genetics 68(4):978–989.
Tetens, J. L. 2014. Genetic variability of bovine and ovine milk protein genes. Dissertation,
Universität Kiel. Schriftenreihe des Instituts für Tierzucht und Tierhaltung der Christian-
Albrechts-Universität zu Kiel; Heft 208
107
GENERAL SUMMARY
In contrast to bovine, ovine or caprine milk, mare milk is a rather uncommon source of nutrition,
not only because the production is quite demanding. Nevertheless, the use of mare milk in human
nutrition is appreciated since decades. Mare milk has a high nutritional value with a high-quality
protein. The protein composition of this milk is similar to the protein composition of human milk.
Furthermore, mare milk can improve human´s health and is thus used in naturopathy to cure several
diseases. First scientific evidence for the effectiveness of this milk in case of chronic-inflammatory
bowel diseases, atopic dermatitis and cardiovascular diseases were provided in the last years,
however, the exact mechanism of action remains unknown until today. Moreover, horse milk is
used as hypoallergenic alternative in case of a cow milk protein allergy (CMA).
This study was conducted within the scope of the competence network Food Chain Plus (FoCus)
which aims to identify health benefitting compounds of milk. Due to the special properties of mare
milk regarding human health and usability as hypoallergenic food source this milk became the
focus of interest of this project. The protein fraction and especially the six main milk proteins αs1-
, ß-, αs2- and κ-casein, as well as α-lactalbumin and ß-lactoglobulin play an important role in the
health effects of mare milk. Milk protein variants, as already described in the typical dairy species,
may have an influence not only on production traits, but also on the health effects of mare milk.
Due to alterations in the amino acid sequence, the release of bioactive peptides during digestion
can be influenced. Furthermore, these alterations can influence IgE binding epitopes, which may
alter the allergenic potential of mare milk.
Therefore, the aim of the current study was to investigate the structure and variability of the six
main protein genes of mare milk. For this approach, the open reading frames of these genes were
resequenced in a total of 253 horses of 14 different breeds.
Chapter I gives an overview of the available literature. After the history of the horse as a dairy
animal is shortly illustrated, the production of mare milk is explained. The composition of mare
milk is described in detail, with special regard to the protein composition. The six main milk
proteins are described and the current knowledge about the variability of these genes is mentioned.
The chapter is completed with details about the utilization of horse milk and the described effects
on human health are pointed out.
108
In Chapter II the results of the sequencing of the equine milk proteins LGB1 and LGB2 are
demonstrated. The two paralogous genes, which are coding for ß-lactoglobulin I and II were
sequenced in in 249 horses of 14 breeds. In LGB1, besides the known variants only one signal
peptide variant was found. In LGB2, 10 genetic variants were detected, 8 of them considered novel.
A provisional nomenclature was established for these variants. The striking differences in
variability of the two genes may lead to the conclusion that LGB1 is the ancestral variant of the
two paralogues genes, which has an important function and thus underlies a high selection pressure.
Chapter III presents the results of the sequencing of the open-reading-frame of the four casein
genes CSN1S2, CSN2, CSN1S2 and CSN3. The analysis of the DNA from 253 horses of 14 different
breeds revealed 21 non-synonymous and 11 synonymous nucleotide exchanges. This results in 31
predicted casein gene variants, 26 of them previously unknown. In case of αs1-casein, a signal
peptide variant was identified with comparatively high allele frequencies up to 0.5. If this variant
is translated into a protein remains to be demonstrated. Because this casein belongs to the main
allergens in case of CMA, this variant is of special interest for the allergenicity of mare milk. A
provisional nomenclature was established for the variants.
Chapter IV comprises the annotation of a 1.3 kb deletion of CSN1S2, the gene coding for αs2-
casein. The deletions spans two coding exons, one of them an equid specific duplication of a known
exon. To confirm the DNA-based results, cDNA was obtained from milk of mares with known
genotype and sequenced afterwards. Moreover, on the protein level with SDS-page and in-gel
digestion with following LC-MS analysis, it was possible to show that both proteins are expressed.
The comparison with published sequences of other equids revealed that the deletion has probably
occurred before the ancestor of present-day asses and zebras diverged from the horse lineage.
So far, the knowledge about the variability of equine milk protein genes was limited. Within the
current study, it was possible to show that there are several variants of the six main milk proteins
in horses. The method of direct sequencing was proven as an excellent instrument to detect the
known and new variants. As mare milk was observed to influence human`s health, the improved
knowledge about the protein fraction may help to understand the mechanism of action of mare
109
milk. Furthermore, milk protein variants may influence the allergenicity of milk considerably.
Therefore, the results of this study are a useful tool for further research on health beneficial effects
and allergenicity of mare milk.
111
ALLGEMEINE ZUSAMMENFASSUNG
Im Gegensatz zu Kuh-, Schaf- oder Ziegenmilch stellt Stutenmilch ein eher außergewöhnliches
Nahrungsmittel dar was nicht zuletzt der aufwendigen Produktion geschuldet sein dürfte.
Gleichwohl wird die Verwendung von Stutenmilch seit Jahrhunderten geschätzt. Stutenmilch hat
eine sehr gute nutritive Wertigkeit mit einer hervorragenden Proteinzusammensetzung, welche der
Proteinzusammensetzung menschlicher Milch ähnelt. Weiterhin kann Stutenmilch die Gesundheit
des Menschen positiv beeinflussen und wird daher hauptsächlich in der Naturheilkunde als
Heilmittel für verschiedene Krankheiten eingesetzt. Erste wissenschaftliche Belege für die
Wirksamkeit der Stutenmilch bei chronisch-entzündlichen Darmerkrankungen, Neurodermitis und
kardiovaskulären Erkrankungen konnten in den letzten Jahren erbracht werden, der genaue
Wirkmechanismus ist hingegen bis heute unbekannt. Die Milch von Pferden wird auch als
hypoallergenes Lebensmittel im Falle einer Kuhmilchproteinallergie (CMA) genutzt.
Das Kompetenznetzwerk Food Chain Plus (FoCus), im Rahmen dessen diese Studie angefertigt
wurde, hat es sich zum Ziel gesetzt, gesundheitsfördernde Inhaltstoffe der Milch zu identifizieren.
Durch ihre besonderen Eigenschaften im Hinblick auf die Gesundheit des Menschen und ihre
Nutzbarkeit als hypoallergenes Lebensmittel rückte die Stutenmilch in den Fokus des Interesses
im Rahmen dieses Projektes. Da die Proteinfraktion dieser Milch nicht nur für die Allergenität der
Milch, sondern auch für ihre Gesundheitseffekte von großer Bedeutung scheint, war das Ziel der
vorliegenden Studie, die Struktur und Variabilität der equinen Milchproteingene zu erforschen. Die
sechs Hauptmilchproteine αs1-, ß-, αs2- und κ-Casein, sowie α-Lactalbumin und ß-Lactoglobulin
sind sowohl beim Rind als auch bei Schaf und Ziege dafür bekannt, sehr variabel zu sein. Durch
genetische Variabilität von Milchproteinen kann es zur Beeinflussung von gesundheitlichen
Effekten durch die Freisetzung von bioaktiven Peptiden kommen und auch die Allergenität der
Milch kann beeinflusst werden.
In Kapitel I wird ein Überblick über die vorhandene Literatur gegeben. Nachdem zunächst kurz
auf die Geschichte des Pferdes in der Milchproduktion eingegangen wird, wird die Produktion von
Stutenmilch erläutert. Auf die Zusammensetzung dieser Milch wird ausführlich eingegangen und
die Proteinfraktion findet dabei besondere Berücksichtigung. Die sechs Hauptmilchproteine
werden erläutert und bestehendes Wissen über die Variabilität dieser Gene wird dargelegt.
112
Abgeschlossen wird dies Kapitel mit Fakten über die Nutzung von Stutenmilch, wobei auch die
beschriebenen Effekte auf die Gesundheit des Menschen und die Allergenität berücksichtigt
werden.
Kapitel II widmet sich den equinen Molkenproteingenen LGB1 und LBG2. Die zwei paralogen
Gene, welche für ß-Lactoglobulin I und II codieren, wurden in 249 Pferden aus 14 Rassen re-
sequenziert. Neben den bekannten Varianten konnte nur eine Signalpeptidvariante von LGB1
identifiziert werden. LGB2 dagegen zeigte zehn Genvarianten, acht davon waren vorher unbekannt.
Für diese Varianten wurde eine vorläufige Nomenklatur erstellt. Die unterschiedliche Variabilität
der beiden Gene kann ein Hinweis darauf sein, dass LGB1 die anzestrale Variante der beiden
paralogen Gene ist, die eine essentielle Funktion hat und somit einem hohen Selektiondruck
unterliegt.
In Kapitel III werden die Ergebnisse der Re-Sequenzierung des offenen Leserahmens der vier
Caseingene CSN1S1, CSN2, CSN1S2 und CSN3 vorgestellt. Die Analyse der DNA von 253 Pferden
aus 14 Rassen ergab 21 nicht-synonyme, sowie 11 synonyme Nukleotidaustausche. Dies führte 31
Caseinvarianten von denen 26 bislang noch nicht bekannt waren. Im Fall von αs1-Casein konnte
eine Signalpeptidvariante mit vergleichsweise hohen Allelfrequenzen bis hin zu 0,5 identifiziert
werden. Ob diese Signalpeptidvariante überhaut in ein Protein übersetzt wird, bleibt zu klären. Da
dies Casein zu den Hauptallergenen bei CMA gehört, ist diese Variante bezüglich der Allergenität
der Stutenmilch besonders interessant. Für die Caseinvarianten wurde eine vorläufige Nomenklatur
erstellt.
Kapitel IV beinhaltet die Aufklärung einer 1,3 kb großen Deletion auf CSN1S2, dem Gen, welches
für αs2-Casein codiert. Die Deletion beinhaltet zwei codierende Exons, von denen eins eine für
Equiden typische Duplikation eines bekannten Exons darstellt. Um die DNA-basierten Ergebnisse
zu bestätigen, wurde aus der Milch von Stuten mit bekanntem Genotyp cDNA gewonnen und
sequenziert. Ferner konnte auf Proteinebene mit SDS-page und In-Gel-Verdau mit nachfolgender
LC-MS Analyse nachgewiesen werden, dass beide Proteine expressiert werden. Durch den
Vergleich mit bekannten Sequenzen von anderen Equiden konnte gezeigt werden, dass die Deletion
113
vermutlich bereits vorhanden war, bevor die Vorfahren der heutigen Esel und Zebras sich von den
Pferden abspalteten.
Bislang war wenig über die Variabilität der Milchproteine aus Stutenmilch bekannt. Mit der
vorliegenden Studie konnte gezeigt werden, dass auch beim Pferd verschiedene Varianten der
sechs Hauptmilchproteine zu finden sind. Die Methode der direkten Sequenzierung war ein
hervorragendes Instrument um die bekannten und bisher unbekannte Varianten zu entdecken.
Kenntnisse über die Milchproteinvarianten des Pferdes können einen Beitrag leisten zur
Aufklärung des Wirkmechanismus der Stutenmilch im menschlichen Körper. Weiterhin können
Milchproteinvarianten die Allergenität der Milch erheblich beeinflussen. Die Ergebnisse der
vorliegenden Studie sind somit eine ausgezeichnete Grundlage für weitere Analysen zur
Stutenmilch und ihrer Wirksamkeit.
115
SUPPLEMENTAL TABLES
Supplemental Table 1. Individual genome coverage for whole-genome sequences incorporated in the study.
Sample ID sex breed coverage
HF10 f Haflinger 10.4
FM2001 m Franches-Montagnes 8.8
RAO310 m Swiss Warmblood 12.7
RAO441 m Swiss Warmblood 5.6
FM1178 m Franches-Montagnes 5.3
FM1785 m Franches-Montagnes 17.7
FM1190 m Franches-Montagnes 19.2
FM1951 m Franches-Montagnes 22.6
FM1176 m Franches-Montagnes 16.1
FM1435 m Franches-Montagnes 15.1
FM0431 m Franches-Montagnes 14.4
FM0467 m Franches-Montagnes 18.0
FM0474 m Franches-Montagnes 18.8
FM1041 m Franches-Montagnes 9.4
FM1030 m Franches-Montagnes 19.7
P1 m German Warmblood 16.4
FM0001 f Franches-Montagnes 25.3
FM0570 m Franches-Montagnes 16.2
FM0673 f Franches-Montagnes 20.2
FM0664 f Franches-Montagnes 7.5
FM0238 m Franches-Montagnes 9.7
FM2218 m Franches-Montagnes 13.7
FM0334 m Franches-Montagnes 10.7
FM1798 m Franches-Montagnes 16.3
FM1932 m Franches-Montagnes 12.3
FM1948 m Franches-Montagnes 9.9
FM0450 m Franches-Montagnes 18.4
FM0512 m Franches-Montagnes 15.9
FM1048 f Franches-Montagnes 10.7
FM1215 f Franches-Montagnes 13.2
FM1339 f Franches-Montagnes 17.1
FM1369 f Franches-Montagnes 16.1
FM1459 f Franches-Montagnes 16.6
FM1625 m Franches-Montagnes 16.3
UKH3 f UK Warmblood 19.1
BW01 m German Warmblood 17.9
BY01 m German Warmblood 18.2
HAN01 m German Warmblood 14.0
HOL01 m German Warmblood 20.7
HOL02 m German Warmblood 13.1
OLD01 m German Warmblood 20.5
116
Sample ID sex breed coverage
OLD02 m German Warmblood 17.4
TRA01 m German Warmblood 14.8
TRA02 m German Warmblood 23.8
WF01 m German Warmblood 22.2
WF02 m German Warmblood 17.2
UKH4 f UK Warmblood 20.1
SW024 NA Swiss Warmblood 12.4
KWPN1 NA Dutch Warmblood 12.4
IS074 m Icelandic 11.1
AKT001 m Akhal-Teke 33.0
Supplemental Table 2. Primer sequences for the resequencing of equine ß-lactoglobulin genes LGB1 and LGB21
Gene Exon Primer forward (5`-3`) Primer reverse (3`-5`) Product
size
LGB1 2 TCCTATTGTCCCAGTCAAGGAAG GACATGGCTGGAGATGGAAAAAT 793
3 AGAACCGCAACCCAATTCCT ACAATCCTGGGGTTTGAGTCCT 668
4 TCTCTCTGGCTCCATCTGACTTCT AGGGTATGACAGGATGGGTCAA 664
5 TGGAGACCTCATTTCTCAACCAC TGAACAAAGCCTGTTGGATTCAT 667
6 CACTTTTCTTCCTGTGACCATGC CAGTTCCAGCCATTCCCAAA 765
7 TCGATGAGGAGATCATGGAGAAA CCAGAAGTAGTGGTGGGGACATAA 616
LGB2 2 AAGGCTTCCTATTGTCCCAGTTG CAAGCTTCCCACCCTCAAAATAA 507
3 GGGTTGACACAGCAGGGTTATTT TATGTGGTCAGCCTGTTAGTCCA 528
4 GATTTCCTAGCTGTGTCCCTTGA TCCTATGTCAAGCAGGGAGAACA 590
5 TCTGGGGTCCATAACACTTGCT TCATTGAAAATCTCCTTCCGTCA 676
6 GGGCCATTTTCCTACCATAACTG TGGTTGGTACGTTACCCGATGA 686
7 GGGCCATTTTCCTACCATAACTG CAGTTCCAGCCATTCCCAAA 780
1 The annealing temperature was 62°C for all primer pairs
117
Supplemental Table 3. Primer sequences for the resequencing of equine casein genes1
Gene Exon Primer forward (5`-3`) Primer reverse (3`-5`) Product
size
CSN1S1 2 CCGAATCAAACGTTCTGTTTTAGAG
T
TGAAGCATTTCTACAGTTTCAGTGTCA 495
3 TTCCTTTTTGTTCCAAGGGAAAC TTCAACGTGTGAAATGAGACCAA 580
4 TGGAACTTAAGCGATGTGCTGAT CGAACACGCATTTAATGAAAACA 556
5 TAGGCCCGGTAAAGAAGAGATGA GATTTTGCAAAGGAAAGCACAAG 474
6-7 TCAAGTCCCAGGAAAAACATTGA TGTCTGACTGAAAAGTTCAAGGAAA 780
8 TCATCAAGGGTGTTAGATAAAGCA
GT
GGGCCATGTAGACAATAGTGACA 500
9 CTTTTGGTTAGTTCAGGCCAGGT TGGGATGGTAGAGGCAGAGTTTT 499
10 TTCCATCTTGAAACTGGTTGTTG TTTTCCCAGAAACAATTCTGCAAT 681
11-12 GAAAGCGGTGAGAAGAGAAAAGG GATCCCCAAGGAGACTGTGAAAT 598
13 AAGTAAAATTGCCCAAATGCTCA TGCAACATCAGGGAGGCTATAAA 622
14 TCCACTGGAATTCATCATTACCG CACATTCATTTTGCAGTGTACCAA 623
15 TCCTGGAGAACTGGTAGGCTATT TCCCATCCAAAGAATAGTGGTCA 498
16 GCTAGGCCAATTCCATACGAATC TCACAGCATGAATAGCCAGTAGGA 569
17 TATTTCCTCCCCAAACTCCCATA ACTTTCAGAAGGGGGCCTTTTAG 1131
18 CTAAAAGGCCCCCTTCTGAAAGT GCTCACACGTTCCTGATTAATGG 561
19 TTCAACTTTATCCTCCTGGCACTT TTGGGTTCACCAGAGTCTCAAAG 677
CSN2 2 TGAGATGAAACAGAGTGAGGTAGG
G
GGTTGCACATGAATGCAACTGT 663
3-4 TCAAAAACTGTTCTTCATGCAGGT TGAATGAGGTCAGTGCAGAGAGA 699
5-6 AAACAAGGTGTCTGCATTAACACA
T
TGTTTATTGAAAACAGGCATACCA 812
7 AGTAGCCTTCACATGACCCAAAA CTTCCCAATGCTCAGTTTCCTCT 971
8 TGGGCTTGAAATAAGGAAGGTTT TCAGGTCAGTAAATAACAGCCAACTG 695
CSN1S2 2 CAGTCTTCATGCTTCTTTCCCAAC TCCTGTCTAAACATCACGGATTCA 644
3 AAAAACTGAGAACACAACCACTTC
C
GATGTCTTTGGGCACCTGTTATG 664
4-5 TCTGTGGATGATATTTGGGGAAA GGGGAAGACAAGTAAAGTGATGGA 674
6 GGAAAAGATTTGTGAGCCATTTG TCTGGGAATTGATTCATGCAAAA 463
7 CAATGACAATAAATACCACTGGTT
GC
TGACTAAAGGGGACAGGGAAAAA 664
8 TTTTTCCCTGTCCCCTTTAGTCA GTGACCAGAAGAAATCCTCAGCA 568
9 ACACAGAATGAGGGCTCTGATGA AAGTTGAGTGGGCGTTAACATGA 661
10 TGTTCTGGAGGCTTCAATTAATCA GAAAGAACTTGGAAGTCGTGTGA 781
11 GCTAGAGACAAAATGCCCAACAA TTTCTGTTCTGCCATCCACAAAT 635
12 TTGGTTCCCTGATGAGCTATGTC CATGACTTTTCTGGGAACACCTG 627
13-14 TTGCATGTGCCTATACTCCACAA AACTGGGGAATAATGGTTTGGTG 670
15 CTTGCCTTCTGACACATCCTTTC AACAAACACTTGAGAAATTTAAGTCCA 660
16 AAATAAGTCACTCCATTTCTCAGCA CACATGGATGCAAATTACACAGG 682
CSN3 2 GTGGCATTTTCCACTTTCTTTCC TCCTAGGAACTAAAAGCATATCCAGA 664
3 TGAATTTTTCTGCCTAGGTGGTG TGACTGGTTGCTAAAGTGATGTTTTT 685
4 GTTGCTGGGTTCACTACTTCCAA TGTCTTTGTGTGTGTGTAGCATTGA 943 1 The annealing temperature was 62°C for all primer pairs
118
Supplemental Table 4. Primer sequences for the resequencing of equine LALBA1
Gene Exon Primer forward (5`-3`) Primer reverse (3`-5`) Product
size
LALBA 2 CTGATTGCCTCGTTCATGTTACC AGGGTCAAATAATGGCAGAAAGG 685
3 TATAAAGGCGTCACTTTGCCTGA GGGCTTCTCCAGAGGAATTATCA 813
4 TGATCAACAAATCCGCAGAGAGT TTCAAGTCCAAGTGAAGGGAGGT 654
5 CCCTATGGCCCATTTATCCATTA ATAACCTATGGCGTCAGTGTCCA 604
1 The annealing temperature was 62°C for all primer pairs
Supplemental Table 5: Animals used in the sequencing of equine LALBA
Breed n
CB Crossbreed for Dairy Production 21
CR Criollo Horse 25
FJ Fjord Horse 3
HF Haflinger 37
IC Icelandic Horse 23
QH Quarter Horse 19
RU Russian Heavy Draft 24
WBD German Warmblood 31
119
SUPPLEMENTAL FIGURES
Supplemental Figure 1. Closure of a gap in the genomic data of CSN1S1.
Unknown region on chromosome 3, region 64657164 – 64957836, locus of CSN1S1, GenBank accession number
NC_009146.2
Figure: Open bars represent introns, black bars represent known regions, red bars represent the unknown region, the
box represents exon 16, Sequence: italic letters represent known regions, bold letters the unknown region, capital
italic letters exon 16, numbers given on the top and on the left are only for orientation and do not correspond to the
positions on the chromosome
121
DANKSAGUNG
An dieser Stelle bedanke ich mich bei allen Personen, die mich während meiner Promotionszeit
begleitet haben und zum Gelingen dieser Arbeit beigetragen haben.
Meinem Doktorvater Herrn Prof. Dr. Thaller danke ich sehr für die Überlassung des Themas, die
wissenschaftliche Betreuung und die Chance, meine Ergebnisse auf Tagungen zu präsentieren.
Mein besonderer Dank gilt Herrn Dr. habil. Jens Tetens für die überaus kompetente, dabei stets
freundliche und gut gelaunte Betreuung bei der Durchführung meiner wissenschaftlichen Arbeit.
Für die finanzielle Unterstützung im Rahmen des Kompetenznetzwerkes Food Chain Plus (FoCus)
danke ich dem Bundesministerium für Bildung und Forschung.
Herzlich danke ich auch Gabriele Ottzen-Schirakow, die mir im Labor immer mit Rat und Tat zur
Seite stand und stets eine Lösung für jedes Problem parat hatte. Außerdem danke ich allen jetzigen
und ehemaligen Bewohnern des Labortraktes für das schöne Arbeitsklima und die netten
Gespräche.
Allen beteiligten Stutenmilchproduzenten sei mein herzlicher Dank ausgesprochen dafür, dass ich
die Milchstuten beproben durfte, aber auch dafür, dass ich einen Einblick in die Betriebsabläufe
bekommen konnte und viele Informationen zur Stutenmilchproduktion in Deutschland erhalten
habe. Besonders danken möchte ich Familie Seraphin für immerwährende Hilfsbereitschaft und
die Bereitstellung von Milchproben.
Vielen Dank an alle Mitarbeiter des Instituts für Tierzucht für eine schöne Zeit zusammen.
Besonders danken möchte ich Kristina, Imke, Nina, Lukas, Jule und Marvin für nette
Mittagessenrunden, Bastelaktionen, den gemeinsamen Einsatz beim Hoffest, das ein oder andere
Eis mit Erdbeeren und die vielen netten Gespräche zwischendurch.
122
Ein großes Dankeschön gilt Dr. Julia Tetens. Es war eine wundervolle Zeit in unserem Büro, auf
gemeinsamen Deutschlandtrip und bei all unseren Klönschnacks. Aus einer Kollegin ist eine
wunderbare Freundin geworden und viele Zusammenkünfte, Ausritte und „Mutti-Runden“ sollen
noch folgen!
Ein ganz besonderer Dank gilt meiner Mutter und meinem Bruder. Vielen Dank dafür, dass ihr
stets hinter mir steht und mir immer mit Rat und Tat zur Seite seid.
Der allergrößte Dank geht an meinen Mann und meine Tochter. Ohne Euch wäre diese Arbeit nicht
möglich gewesen!
123
LEBENSLAUF
ALLGEMEINE INFORMATIONEN
Name Julia Elena Margot Elisabeth Brinkmann
Geboren 17. Dezember 1983 in Kiel
Staatsangehörigkeit Deutsch
AUSBILDUNG
2009-2011 Studium der Agrarwissenschaften an der
Christian-Albrechts-Universität zu Kiel;
Abschluss Master of Science
2007-2009 Studium der Agrarwissenschaften an der
Christian-Albrechts-Universität zu Kiel;
Abschluss Bachelor of Science
2003-2007 Ausbildung zur Pferdewirtin, Schwerpunkt
Reitausbildung
2003 Abitur Christian-Dietrich Grabbe Gymnasium
Detmold
BERUFLICHE TÄTIGKEIT
2012-2015 Wissenschaftliche Mitarbeiterin am Institut für
Tierzucht der Christian-Albrechts-Universität
zu Kiel
Top Related