Protein kinase pUL97 of human cytomegalovirus - functional ... · Rike Nadine Silke Webel aus...

Protein kinase pUL97 of human cytomegalovirus -

functional specification of three individual isoforms

Funktionsanalyse der Proteinkinase pUL97

des humanen Cytomegalovirus hinsichtlich

der Ausprägung von drei verschiedenen Isoformen

Der Naturwissenschaftlichen Fakultät

der Friedrich-Alexander-Universität Erlangen-Nürnberg

zur

Erlangung des Doktorgrades Dr. rer. nat.

vorgelegt von

Rike Nadine Silke Webel

aus Nürnberg

Als Dissertation genehmigt von der Naturwissenschaftlichen Fakultät

der Friedrich-Alexander-Universität Erlangen-Nürnberg

Tag der mündlichen Prüfung: 04. April 2014

Vorsitzender des Promotionsorgans: Prof. Dr. Johannes Barth

Gutachter: Prof. Dr. Andreas Burkovski

Prof. Dr. Manfred Marschall

Table of contents

Table of contents

A Summary 1

A Zusammenfassung 2

B Introduction 3

B-1 Human cytomegalovirus 3

B-2 Characteristics of the multifunctional nature of the HCMV kinase pUL97 5

B-3 Nuclear protein import mechanisms 9

B-4 The occurrence of isoforms in case of herpesviral kinases 10

C Objectives 13

D Materials and Methods 14

D-1 Biological materials 14

D-1.1 Bacteria 14

D-1.2 Human cells 14

D-1.3 Viruses 14

D-1.4 Antibodies 15

D-1.4.1 Primary antibodies 15

D-1.4.2 Secondary antibodies 16

D-2 Nucleic acids and synthetic peptides 16

D-2.1 Oligonucleotides 16

D-2.2 Cloning vectors, expression plasmids and BACmids 19

D-2.2.1 Vector systems 19

D-2.2.2 Ready-to-use plasmids and BACmids 19

D-2.2.3 Plasmids generated in this thesis 20

D-2.2.4 BACmids generated in this thesis 23

D-2.3 Additional nucleic acids 24

D-2.4 Synthetic peptides 24

D-3 Enzymes, buffers and media 25

D-3.1 Enzymes 25

D-3.2 Standard buffers and solutions 26

D-3.3 Media 27

D-3.3.1 Bacterial media 27

D-3.3.2 Cell culture media 27

Table of contents

D-4 Methods 28

D-4.1 Standard molecular biology techniques 28

D-4.2 Cell culture techniques 29

D-4.2.1 Maintenance of human cells 29

D-4.2.2 Transfection procedures 29

D-4.2.3 Infections 30

D-4.3 Coimmunoprecipitation (CoIP) analysis 30

D-4.4 In vitro kinase assay (IVKA) 31

D-4.5 Western blot analysis 31

D-4.6 Immunofluorescence analysis and confocal imaging 32

D-4.7 Semi-automated interactive cell segmentation for the determination

of nucleocytoplasmic intensity ratios 32

D-4.8 Surface plasmon resonance (SPR) analysis 33

D-4.9 Generation of recombinant viruses using the BACmid technology 33

D-4.9.1 Preparation of electrocompetent E. coli GS1783 33

D-4.9.2 Homologous recombination 34

D-4.9.3 Isolation and restriction enzyme digestion of BACmids 35

D-4.9.4 Reconstitution of infectious viral particles 35

D-4.10 Virus titration 36

D-4.11 Quantitative real-time PCR (TaqMan-PCR) 36

E Results 37

E-1 Determination of three isoforms of pUL97 and the mechanism

of isoform formation 37

E-1.1 Expression of three pUL97-specific isoforms during HCMV infection 37

E-1.2 Elucidation of the mechanism of isoform formation 39

E-1.2.1 Evidence for alternative sites of translational initiation 39

E-1.2.2 Confirmation of ATG start codons referring to pUL97 isoforms

by the use of recombinant HCMVs 40

E-1.3 Genetic conservation of isoform initiation sites and sequence motifs

in the ORF UL97 41

E-2 Identification of two bipartite NLS sequences and their relevance

for nuclear translocation of pUL97 isoforms 41

E-2.1 Nuclear accumulation of pUL97 in HCMV-infected cells 41

E-2.2 Differences in subcellular localization between pUL97 isoforms 42

E-2.3 In silico analysis of putative NLS sequences 43

E-2.4 The determinant activity of NLS1 and NLS2 for nuclear translocation of pUL97 44

Table of contents

E-2.5 Impairment of nuclear import after deletion of NLS1/NLS2 45

E-2.6 Properties of the NLS-mediated nuclear import pathway 46

E-2.6.1 Interaction between importin and NLS-peptides of pUL97 46

E-2.6.2 Basic amino acids are critical residues for importin binding 50

E-2.7 Examination of the relevance of NLS1 and NLS2 in recombinant HCMVs 51

E-2.7.1 Generation of recombinant HCMVs carrying deletions of NLS1/NLS2 51

E-2.7.2 Effect of NLS deletions on the kinetics of viral protein expression 52

E-2.7.3 Altered nucleocytoplasmic distribution of pUL97 lacking NLS sequences 54

E-2.7.4 Replication defect of the recombinant HCMV lacking NLS1 and NLS2 55

E-3 Functional aspects of pUL97 isoforms 56

E-3.1 Generation of recombinant HCMVs expressing individual isoforms 56

E-3.2 Influence of pUL97 isoforms on HCMV protein expression kinetics 57

E-3.3 Differential localization pattern of individual isoforms 59

E-3.4 Replication defect of a recombinant HCMV exclusively expressing isoform M157 61

E-3.5 Differences between isoforms concerning properties

of protein-protein interactions 62

E-3.6 Reduced in vitro kinase activity of isoform M157 63

F Discussion 66

F-1 Regulation of the nuclear localization of HCMV protein kinase pUL97 66

F-1.1 A pronounced nuclear accumulation of pUL97 is important for

its biological function 66

F-1.2 Isoform-specific aspects of nuclear localization of pUL97 68

F-2 Relevance of different isoforms of pUL97 for HCMV replication 69

F-2.1 The expression of isoforms is a special feature of HCMV 69

F-2.2 Specific replication characteristics of recombinant HCMVs expressing

individual isoforms 70

F-2.3 Interaction profiles of pUL97 isoforms with viral and cellular proteins 71

F-2.4 Aspects of fine-regulated kinase activity of pUL97 71

G Abbreviations 74

H References 76

I Appendix 86

Summary - 1 -

A Summary

The protein kinase pUL97 has been subject of intense research for more than twenty years,

elucidating its role in phosphorylation of the antiviral drug ganciclovir and its multifunctional

importance for the replication of human cytomegalovirus (HCMV). pUL97 predominantly

accumulates in the nucleus of the host cell to exert influence on very basic steps of viral

replication, like DNA synthesis, gene expression and nuclear capsid egress. However, the exact

mechanism of nuclear translocation was poorly determined and many biochemical as well as

functional characteristics of pUL97 remained to be investigated in more detail.

The present study demonstrates for the first time that pUL97 is expressed in three distinct

isoforms during HCMV infection with laboratory-adapted and naturally occurring strains. Using a

series of plasmid-based expression constructs as well as recombinant HCMVs, the mode of

isoform formation was specified as alternative initiation of translation at the in-frame ATG start

codons M1, M74 and M157, respectively. Sequence alignments revealed an overall

conservation and restriction of these start codons for human cytomegaloviruses. As an important

finding, immunofluorescence analyses verified the positions of two candidate nuclear localization

signals (NLS) within the mostly unstructured N-terminus at amino acids 6-35 (NLS1) and 190-

213 (NLS2). Both NLS sequences were classified as bipartite motifs, highly conserved among

HCMV strains and capable to interact with the adaptor molecule importin . Moreover, NLS

deletion mutants were used to identify the relevance of NLS1 and NLS2 for efficient

translocation of pUL97 into the nucleus. Only minor effects were detectable after deletion of a

single NLS sequence, but simultaneous deletion of NLS1 and NLS2 caused a strongly reduced

nuclear import of pUL97 and a severe replication defect of HCMV. Interestingly, the N-terminally

truncated isoforms M74 and M157, per se lacking NLS1, were characterized with incomplete

nuclear translocation compared to isoform M1, and nuclear import was even missing after

deletion of NLS2. Potential functional differences between the pUL97 isoforms and their

individual impact on HCMV replication were investigated by recombinant HCMVs expressing

single isoforms. CoIP experiments illustrated an isoform-specific interaction profile, showing that

isoforms M1 and M74 were able to bind the pUL97 substrates pUL44 and pp65, while isoform

M157 almost failed to interact. Moreover, the kinase activity of isoform M157 in terms of

autophosphorylation as well as pp65 and histone substrate phosphorylation was substantially

reduced compared to isoforms M1 and M74. In line with these data was the observation that

exclusive expression of isoform M157 caused a 10-fold replication defect of HCMV, while

isoforms M1 and M74 mediated viral replication characteristics very similar to wild-type. Taken

together, this study provides evidence for the expression of three pUL97 isoforms, which are

fine-regulated in their nuclear translocation, differ in their interaction and phosphorylation

potential, and thus possess individual importance for HCMV replication.

Zusammenfassung - 2 -

A Zusammenfassung

Seit mehr als zwanzig Jahren ist die Proteinkinase pUL97 aufgrund ihrer Rolle bei der

Phosphorylierung des Medikaments Ganciclovir sowie ihrer ausgeprägten Multifunktionalität

während der Replikation des humanen Cytomegalovirus (HCMV) Gegenstand intensiver

Forschung. pUL97 akkumuliert überwiegend im Zellkern und reguliert dort grundlegende Schritte

der viralen Replikation, wie die genomische DNA-Synthese, die Genexpression und den

nukleären Kapsidexport. Der genaue Translokationsmechanismus von pUL97 in den Zellkern

sowie viele biochemische und funktionelle Eigenschaften blieben bislang jedoch unklar.

Die vorliegende Studie zeigt zum ersten Mal die Expression von drei verschiedenen

pUL97-Isoformen während der HCMV-Infektion mit Laborstämmen sowie mit natürlich

vorkommenden Isolaten. Mittels Plasmid-basierter Expressionskonstrukte und rekombinanter

HCMVs wurde eine alternative Translationsinitiation an den Startcodons M1, M74 und M157 für

die Ausbildung der Isoformen ermittelt. Sequenzanalysen zeigten eine Gesamtkonservierung

und Restriktion dieser Startcodons auf humane Cytomegaloviren. Durch Immunfluoreszenz-

analysen wurde die Position zweier Kernlokalisationssignale im größtenteils unstrukturierten

N-Terminus zwischen den Aminosäuren 6-35 (NLS1) beziehungsweise 190-213 (NLS2)

nachgewiesen. Beide NLS-Sequenzen wurden als zweiteilige Motive klassifiziert, sind unter

HCMV-Stämmen hochkonserviert und interagieren mit dem Adaptermolekül Importin . Zudem

wurden NLS-Deletionsmutanten verwendet, um die Bedeutung von NLS1 und NLS2 für den

effizienten Kernimport von pUL97 zu demonstrieren. Während die Deletion einer einzelnen NLS-

Sequenz nur geringe Auswirkungen hatte, führte die gleichzeitige Deletion von NLS1 und NLS2

zu einem stark verminderten Kernimport von pUL97 und zu einem schweren Replikationsdefekt

von HCMV. Interessanterweise war der Kernimport der N-terminal verkürzten Isoformen M74

und M157, welchen das NLS1 per se fehlt, eingeschränkt und wurde durch Deletion von NLS2

vollständig verhindert. Rekombinante HCMVs, welche einzelne Isoformen exprimierten, wurden

verwendet, um funktionelle Unterschiede und den individuellen Einfluss der Isoformen auf die

HCMV-Replikation zu ermitteln. CoIP-Experimente zeigten ein Isoform-spezifisches Interaktions-

profil, wobei die Isoformen M1 und M74 imstande waren, die Substratproteine pUL44 und pp65

effizient zu binden, während Isoform M157 nur schwach interagierte. Außerdem war die Kinase-

aktivität der Isoform M157 im Hinblick auf die Autophosphorylierung sowie die Phosphorylierung

von pp65 und Histonen gegenüber der Aktivität anderer Isoformen stark reduziert. Die alleinige

Expression von Isoform M157 führte zum 10-fachen Replikationsdefekt von HCMV gegenüber

der Wildtyp-ähnlichen Situation unter Bildung der Isoformen M1 und M74. Zusammenfassend

liefert diese Studie den experimentellen Nachweis für das Auftreten von drei pUL97-Isoformen,

welche sich in ihrer nukleären Translokation sowie ihrem Interaktions- und Phosphorylierungs-

potential unterscheiden und für die HCMV-Replikation individuelle Bedeutung besitzen.

Introduction - 3 -

B Introduction

B-1 Human cytomegalovirus

Human herpesviruses are classified on the basis of their biological characteristics into the three

subfamilies -Herpesvirinae (herpes simplex viruses type 1 and 2, varicella-zoster virus), -

Herpesvirinae (human cytomegalovirus, human herpesviruses type 6 and 7) and -Herpesvirinae

(Epstein-Barr virus and Kaposi’s sarcoma-associated herpesvirus). The human cytomegalovirus

(HCMV) represents the prototype of -Herpesvirinae and is characterized by a restricted range

of host species specificity and a prolonged replication cycle (Davison A. J., 2010; Davison et al.,

2009; Mocarski et al., 2007; Roizman et al., 1992 and 1981). HCMV as a ubiquitous human

pathogen is widespread throughout the human population with a seroprevalence ranging

between 40-90 % depending on the developmental stage of the country (Mocarski et al., 2007).

In general, HCMV infection of immunocompetent individuals is mostly asymptomatic or

manifested in mild infectious mononucleosis symptoms. However, persons with a suppressed

immune system, such as transplant recipients or AIDS patients, can develop severe and even

life-threatening diseases, like pneumonia, hepatitis, gastroenteritis, retinitis or encephalitis

(Rafailidis et al., 2008; Steininger C., 2007; Sissons et al., 2002; Vancikova and Dvorak, 2001).

Virus transmission occurs either by horizontal transfer via infectious body fluids or by vertical

transfer from mother to child in a perinatal or postnatal way. HCMV infection is characterized by

a lifelong persistence (Morris et al., 2010; Hamprecht et al., 2008; Mocarski et al., 2007).

Consequences of congenital infections are anomalies in the central nervous system of the child,

like mental retardation, hearing loss, visual defects or epilepsy (Tsutsui Y., 2009). Available

antiviral compounds for treatment of HCMV diseases are ganciclovir, its prodrug valganciclovir,

cidofovir, foscarnet and fomivirsen (Schreiber et al., 2009). With the exception of the

oligonucleotide fomivirsen, that blocks translation of the essential immediate early protein

IE2p86 by binding to its complementary mRNA sequence, all other drugs approved so far target

the viral DNA polymerase pUL54. The nucleotide analog cidofovir and the pyrophosphate analog

foscarnet directly interfere with polymerase activity, whereas the nucleoside analogs ganciclovir

and valganciclovir have to be activated by phosphorylation. This is initially accomplished by the

activity of the HCMV-encoded protein kinase pUL97 (De Clercq E., 2003; Azad et al., 1993;

Littler et al., 1992; Sullivan et al., 1992; Chrisp and Clissold, 1991). Although application of these

antiviral compounds relieves HCMV-associated symptoms, severe adverse effects and the

generation of drug-resistant virus variants is a frequent consequence (Lurain and Chou, 2010).

In order to establish new antiviral compounds it is important to study the characteristics of gene

regulation of this complex human pathogen in detail.

Introduction - 4 -

The virion comprises a linear double-stranded DNA genome of about 235 kilobase pairs

encoding more than 200 open reading frames (ORF). The icosahedral protein capsid, enclosing

the viral genome, is embedded into a proteinaceous tegument and surrounded by a host cell-

derived envelope including viral glycoproteins (Kalejta R. F., 2008; Mocarski et al., 2007).

Attachment of infectious viral particles to the surface of the host cell is mediated by low-affinity

binding of glycoprotein gB to the cellular receptor heparan sulfate (Compton et al. 1993).

Afterwards, fusion processes triggered by additional interactions of the heterodimeric

glycoprotein complex gH/gL with further receptor proteins occur (Connolly et al., 2011; Theiler

and Compton, 2001). However, the exact mechanism of viral entry is still under investigation.

Directly upon entry, the viral capsid and associated tegument proteins are released into the

cytoplasm and translocated along cellular microtubules to the nuclear pore complex (NPC),

where the viral DNA genome is injected into the nucleus (Ogawa-Goto et al., 2003). During lytic

HCMV replication, viral gene expression is regulated in a cascade-like manner consisting of

immediate early (IE), early (E) and late (L) phases (Pellett and Roizman, 2007). First, viral

tegument proteins provide expression of IE transactivator proteins, like IE1p72 and IE2p86,

which are most abundant and critical for initiation of E gene transcription. E proteins are involved

in viral genome replication and numerous regulatory processes throughout progression of the

infection cycle. Specific E transactivators provide transcription of L gene products representing

mainly structural components for generation of mature virions. As a prerequisite for the start of

DNA replication, the viral genome exists as a circularized episome serving as a template for the

formation of a long continuous concatemer produced via the rolling cycle mechanism (Pari G. S.,

2008). During encapsidation this concatemeric DNA is cleaved by the viral terminase complex

and packaged into preformed progeny nucleocapsids (Bogner E., 2002). These DNA-filled

capsids need to traverse the nuclear envelope during the process of nucleocytoplasmic egress.

A nuclear egress complex (NEC), composed of several viral and cellular components, induces

the generation of lamina-depleted areas representing accessible sites for membrane budding of

the viral capsids (Milbradt et al., 2009). Formation of a primary envelopment at the inner nuclear

membrane followed by a de-envelopment step at the outer nuclear membrane provides the

release of uncoated nucleocapsids into the cytoplasm (Mettenleiter T. C., 2013; Lee and Chen,

2010; Mettenleiter T. C., 2004). Within the cytoplasmic viral assembly compartment (cVAC),

including components of rearranged host organelles, the nucleocapsids associate with

constitutive tegument proteins and gain their final envelope (Tandon and Mocarski, 2012).

Potential budding sites, as discussed for alternative modes of secondary envelopment, are

represented by Golgi-derived vesicles, endoplasmatic reticulum (ER)-Golgi intermediates and

endosomes (Das et al., 2007; Turcotte et al., 2005; Sanchez et al., 2000a). After envelopment,

the mature viral particles are transported to the plasma membrane and released from the host

cell into the extracellular space. Interestingly, HCMV-infected cells also produce noninfectious

Introduction - 5 -

enveloped particles and dense bodies, but the significance is not well understood (Tandon and

Mocarski, 2012). Moreover, it should be mentioned that during natural infection in vivo, HCMV

particles can reside predominantly in a cell-associated state so that the free dissemination of

virus is limited.

Lytic HCMV infection occurs in a number of different tissues, preferentially in epithelial cells

driving viral transmission, in endothelial and hematopoietic cells mediating systemic spread

within the patient as well as in fibroblasts and smooth muscle cells representing primary targets

for productive replication (Sinzger et al., 2008). Interestingly, permanent cultivation of HCMV

strains within a specific cell type eventually leads to a restriction in cell tropism based on

mutation and sequence adaptation of the viral genome. This phenomenon is exemplified by the

laboratory AD169 strain, which was initially isolated from adenoid tissue, but became strongly

fibroblast-adapted after long-lasting passaging in cell culture, thus lacking at least 22 genes

compared to clinical isolates (Michel and Mertens, 2004). Typical reservoirs for the

establishment of HCMV latency are hematopoietic progenitor cells of the myeloid lineage

(Sinclair J., 2008; Khaiboullina et al., 2004). Latent infection is characterized by minimized viral

gene expression of the episomal state of viral genomes as well as the lack of production of

infectious virus. Latency may alternate with periodical HCMV reactivation (Reeves and Sinclair,

2013). The complexity of HCMV replication is also explained by distinctive interactions between

viral and host cell proteins. These viral-cellular protein interactions play similarly important roles

during lytic replication and latency. A crucial regulatory role in terms of the interplay between

HCMV and its host is attributed to protein kinases, which can specifically phosphorylate various

substrate proteins to create a favorable environment for viral replication.

B-2 Characteristics of the multifunctional nature of the HCMV

kinase pUL97

Herpesviral protein kinases are divided on the basis of their structural homology into the “UL”

group, which is present in all subfamilies of Herpesvirinae, and the “US” group, which is

restricted to -herpesviruses. Due to the conservation of their presence within the herpesviral

subfamilies, “UL” group members are also referred to as conserved herpesviral protein kinases

(CHPK; Gershburg and Pagano, 2007). Their kinase domains are clustered in 11 subdomains

(SD) showing high similarities to cellular protein kinases within the functionally relevant motifs.

The ATP-binding site is supposed to locate within SD I-V, whereas the putative catalytic region

mostly refers to SD VI-XI. However, specific properties of the tertiary structure may provide

exceptions from this rule in individual herpesviral protein kinases. To date, no X-ray-based

structure of a herpesviral protein kinase has been published. The essential glycine-rich motif

Introduction - 6 -

(GXXGXG), comprised within SD I, and the invariant lysine residue within SD II are highly

conserved throughout familiar protein kinases (Kuny et al., 2010; Romaker et al., 2006). Due to

the fact that kinase activity is directed to the phosphorylation of serine and threonine residues,

CHPKs are classified as serine/threonine-type protein kinases. They are typically expressed with

early-late kinetics and are incorporated into mature viral particles as tegument proteins. Although

not absolutely essential for viral replication, they generally support distinct steps early and late in

the replication cycle of HCMV by phosphorylating various cellular and viral substrate proteins

(Kuny et al., 2010). In particular, the HCMV-encoded CHPK pUL97 is an important determinant

for efficient replication. Deletion of the ORF UL97 from the viral genome or pharmacological

inhibition of the kinase activity results in a severe replication defect of HCMV by a factor of 100-

1000 (Marschall et al., 2002; Prichard et al., 1999). Expression of pUL97 is initiated early in

infection from a large transcriptional unit, which is supposed to generate the proteins pUL92 to

pUL99 (Mocarski et al., 2007; Wing and Huang, 1995). Full-length pUL97 comprises 707 amino

acids and is divided in a regulatory region within the N-terminal part as well as a catalytic region

comprising the C-terminal kinase domain (Prichard M. N., 2009). Continuing investigations

detected further pUL97-specific products suggesting a more complex regulation of expression

(Schregel et al., 2007; Marschall et al., 2003). Interestingly, purified pUL97 forms homodimers

and oligomers through a self-interaction domain, which is located between amino acid residues

231-280, and possesses a strong autophosphorylation activity with specific target sites located

within the regulatory N-terminal region (Schregel et al., 2007; Baek et al., 2002; He et al., 1997).

However, the requirement of pUL97 multimerization and autophosphorylation for its enzyme

activity as well as for an efficient substrate phosphorylation is controversially discussed. The

report by Schregel et al. (2007) stated that pUL97 self-interaction is a prerequisite for full kinase

activity.

Critical steps in HCMV replication, like the generation of a favorable host cell environment,

viral DNA replication and gene expression, the egress of viral nucleocapsids as well as events in

the morphogenesis of mature virus particles, are regulated by pUL97 (Mocarski et al., 2007). In

particular, an inhibitory phosphorylation of the retinoblastoma (Rb) protein on specific cyclin-

dependent kinase (CDK) consensus sites results in the expression of E2F-responsive genes

promoting G1/S-phase transition of the cell cycle and viral genome synthesis (Kuny et al., 2010;

Prichard M. N., 2009; Prichard et al., 2008; Hume et al., 2008; Fig. 1). Three putative Rb binding

motifs within pUL97 between amino acids 149-153 (LRCRE), 426-430 (LACID) and 691-695

(IICEE) were described and are still discussed regarding functional aspects. Moreover, viral

DNA replication is supposed to be directly regulated by pUL97 through its ability to

phosphorylate the essential DNA polymerase processivity factor pUL44 (Fig. 1). The region

responsible for this interaction is located within the kinase domain, i.e. amino acids 366-459

(Krosky et al., 2003; Marschall et al., 2003). It has been shown that pUL97 and pUL44

Introduction - 7 -

accumulate within viral replication compartments and that this distinct colocalization can be

prevented by treatment with inhibitors of viral DNA synthesis or pUL97 activity (Gershburg and

Pagano, 2007). An involvement of pUL97 in the regulation of viral gene expression has also

been postulated. Cellular RNA polymerase II is phosphorylated by pUL97 on its C-terminal

domain (CTD) promoting the initiation of viral transcription (Baek et al., 2004; Fig. 1). Typically,

the phosphorylation pattern of the repeated heptapeptide consensus sequence (TSPTSPS),

constituting the CTD, is regulated by transcription-associated CDKs modifying primarily serine

residues at positions 2 and 5 (Meinhart et al., 2005). In addition to this regulatory phenomenon,

phosphorylation of the viral protein pUL69 by pUL97 and several CDKs has been demonstrated.

Thereby, pUL69 is modulated in its function as an efficient transactivator for multiple promoters

as well as its mRNA export activity (Thomas et al., 2009; Rechter et al., 2009; Fig. 1).

Experimental inhibition of pUL97 or CDK activity, respectively, resulted in modified pUL69

localization as characterized by an intranuclear speckled aggregation (Marschall et al. 2011).

The specific pUL69 interaction site maps to the regulatory N-terminal region of pUL97, i.e. to

amino acids 231-336 (Thomas et al., 2009). In addition to this impact on the regulated mRNA

transport, pUL97 might exert an influence on translation levels by phosphorylating the eukaryotic

elongation factor EF-1 that can be likewise phosphorylated by CDKs and determines the

general efficiency of protein translation (Romaker et al., 2006; Kawaguchi et al., 2003; 1999; Fig.

1). The most important impact of pUL97 on the regulation of HCMV replication is its role during

the viral nucleocapsid egress. As a component of the viral-cellular nuclear egress complex

(NEC), pUL97 is recruited to the nuclear envelope, where it can specifically phosphorylate

nuclear lamins on CDK consensus sites, triggering the generation of lamina-depleted areas as

potential budding sites for the viral capsids (Milbradt et al., 2010; 2009; Hamirally et al., 2009;

Camozzi et al., 2008; Fig. 1). Association of pUL97 with the NEC core pUL50-pUL53 as well as

with the lamin B receptor (LBR) is mediated by direct interaction with the multi-ligand binding

protein p32 through pUL97 amino acids 181-365 (Marschall et al., 2005). Interestingly, also the

protein kinase C (PKC) is recruited to the nuclear lamina by specific interactions with p32 and

pUL50. PKC as well as the cell cycle-associated CDK1 are known cellular protein kinases

phosphorylating the nuclear lamins during apoptosis or mitosis, respectively (Collas et al., 1997;

Peter et al., 1990). In the absence of pUL97, viral capsids fail to egress into the cytoplasm, but

accumulate within the nucleus, highlighting the significance of pUL97 for nuclear capsid egress

(Wolf et al., 2001). The regulation of virion morphogenesis is a complex process and it is

assumed that pUL97 is also involved in this late step, for instance by phosphorylating the

tegument protein pp65 (Becke et al., 2010; Fig. 1). Due to the fact that pUL97 utilizes CDK

consensus sites to phosphorylate common substrate proteins, it has been classified as a CDK

ortholog (Marschall et al., 2011). This concept was substantiated by a yeast complementation

assay that showed pUL97 can rescue a G1/S cell cycle defect of Saccharomyces cerevisiae

Introduction - 8 -

mutants lacking CDK function (Hume et al. 2008). Interestingly, while CDKs are fine-regulated

by their corresponding cyclins as well as by specific activators and inhibitors, pUL97 has not

been supposed to be controlled in its enzyme activity by similar ways (Kuny et al. 2010).

Referring to this, our recent investigations, however, provided evidence for a cyclin T1 binding

site matching with the pUL97 self-interaction domain between amino acids 231-280 (Graf et al.,

2013). The physiological relevance of this interaction has to be determined. Since the main

regulatory functions of pUL97 are exerted in the nucleus of the host cell, it is not surprising that

pUL97 shows a strong tendency to rapid nuclear translocation during the time course of infection

(van Zeijl et al., 1997). The nuclear accumulation of pUL97 seemed to be provided by the N-

terminal region carrying putative candidate sites for nuclear localization signals (NLS; Michel et

al., 1996; 1998).

FIGURE 1. Importance of pUL97 for HCMV replication. The phosphorylation of viral proteins (pUL44, pUL69, pp65)

and cellular proteins (Rb, RNA polymerase II, EF-1 , p32, nuclear lamins) by pUL97 regulates important steps of the

cytomegaloviral replication cycle. Rb, retinoblastoma protein; EF-1 , elongation factor 1 , phos., phosphorylation.

Introduction - 9 -

B-3 Nuclear protein import mechanisms

Eukaryotic cells possess a variety of different compartments that represent individual sites for

complex regulatory processes. One key compartment is the cell nucleus, enclosed by a lipid

double-membrane, which separates genetic material from the surrounding cytoplasm. Large

proteinaceous structures termed nuclear pore complexes (NPC) are embedded within the

nuclear envelope, forming tightly regulated channels that enable a bidirectional translocation of

macromolecules between both compartments (Fahrenkrog and Aebi, 2003). While small

molecules < 40-60 kDa can passively diffuse through NPCs, an energy-dependent, selective

transport is required for larger macromolecules (Marfori et al., 2011; Alvisi et al., 2008; Lange et

al., 2007; Weis K., 1998). Import and export pathways are both regulated by the GTPase Ran,

based on an asymmetric nucleocytoplasmic distribution of its GTP- and GDP-bound forms. This

gradient is mainly controlled by the nuclear Ran guanine nucleotide exchange factor (RanGEF)

and the cytoplasmic Ran GTPase-activating protein (RanGAP; Marfori et al., 2011; Lange et al.,

2007). Cargo proteins comprising specific target sequences termed nuclear localization signals

(NLS) or nuclear export signals (NES) are recognized by distinct karyopherins and subsequently

transported in and out of the nucleus (Weis K., 1998). These short linear motifs are typically

arranged within flexible loops or between globular domains, often at the protein termini (Neduva

and Russell, 2005). Nuclear protein import is either mediated by interaction of the NLS sequence

with an adaptor protein of the importin family, bridging the association to importin 1, or direct

binding to one of the various importin karyopherins (Alvisi et al., 2008; Conti, E., 2002).

Notably, the different importins are expressed in a tissue-specific manner and vary in their NLS-

binding specificity (Alvisi et al., 2008). Direct interaction of importin with components of the

NPC allows for efficient nuclear translocation of the entire complex through the

nucleocytoplasmic transfer channel. The binding to Ran-GTP causes specific conformational

changes in the secondary structure of importin and subsequently the release of the NLS-

bearing cargo protein into the nucleus (Alvisi et al., 2008; Weis K., 1998). In the process of

nucleocytoplasmic export, nuclear proteins require NES sequences for binding to an exportin-

Ran-GTP complex, followed by cytoplasmic translocation and a subsequent dissociation of the

cargo in the cytoplasm as induced by the hydrolysis of GTP to GDP (Alvisi et al., 2008). The

coexistence of NLS and NES sequences on a single cargo protein confers the ability to shuttle

between the nuclear and the cytoplasmic compartment. Interestingly, both types of signals

possess high diversity in their content of coregulatory sequences and overall organization,

thereby increasing the complexity of regulation of the nucleocytoplasmic translocation.

NLS sequences could be classified on the basis of their amino acid sequences and their

specific recognition by importins. Classical NLS sequences are either monopartite, comprising a

single cluster of consecutive basic residues, or bipartite, composed of two clusters separated by

Introduction - 10 -

a short linker region. Both are typically recognized by importin with a preferential interaction of

monopartite NLS sequences to the major binding pocket, while bipartite NLS sequences typically

bind to the major plus the minor binding pockets (Marfori et al., 2011; Fontes et al., 2000; Conti

and Kuriyan, 2000; Conti et al., 1998). Prototypes of these two categories are on the one hand

the monopartite NLS (PKKKRKV) of the simian virus 40 (SV-40) large T antigen and on the

other hand the bipartite NLS (KRPAAIKKAGQAKKKK) of the histone assembly factor

nucleoplasmin (Görlich and Mattaj; 1996). Interestingly, importin binding is not restricted to

classical NLS sequences, but is also described for complex structures, like the NLS of the

HCMV-encoded multifunctional regulator pUL84 that consists of 282 amino acids (Lischka et al.,

2003). Non-classical NLS sequences are typically recognized by various -karyopherins. Their

mechanism of action is not well understood, due to the fact that they do not share consensus

sequences (Marfori et al. 2011). Remarkably, the rate of nuclear protein import is correlated in a

linear fashion with the affinity of the specific target signal to bind its respective importin (Yang et

al., 2010; Hu and Jans, 1999). This mode of interaction may be controlled by site-specific

phosphorylation within or nearby the target signals (Alvisi et al., 2008; Jans et al., 2000).

Interestingly, a phosphorylation-mediated fine-regulation of the nuclear import could recently be

demonstrated for the HCMV-encoded DNA polymerase processivity factor pUL44, which is a

substrate for cellular protein kinases as well as for the viral pUL97 enzyme. While distinct

phosphorylation sites are utilized by the two cellular kinases CK2 and PKC, the phosphorylation

sites of pUL97 are undefined (Alvisi et al., 2008).

B-4 The occurrence of isoforms in case of herpesviral kinases

Expression of closely related isoforms is commonly used to fine-regulate important proteins in

terms of their intracellular distribution and functionality. Herpes simplex virus type 1 (HSV-1)

encodes a thymidine kinase as well as two serine/threonine protein kinases, which are involved

in the regulation of different steps of viral replication (Roizman and Knipe, 2001). Interestingly,

the thymidine kinase is expressed in three individual isoforms. After transcription of a single

mRNA, the isoforms are generated by the use of alternative initiation sites of translation, i.e. by

initiation at one of three different in-frame ATG start codons. While the full-length protein starts

with the first methionine (M1), two N-terminally truncated products are most probably generated

from the downstream initiation sites M46 and M60, respectively (Haarr et al., 1985; Marsden et

al., 1983). Notably, the mode of bypassing distinct ATG start codons, also referred to as leaky

ribosomal scanning, may be directly determined by the nucleotide sequence flanking the

respective initiation sites (Kozak, M., 1989; 1987). To date, no functional differences between

the three isoforms could be demonstrated when analyzed separately, but it is supposed that

Introduction - 11 -

dimerization of the isoforms in various combinations may lead to fine-regulatory differences of

the complexes (Haarr et al., 1985). Interestingly, a NLS is provided by amino acids 25-33

(RRTALRPRR), a region only contained within the full-length isoform. Together with the two

basic sections R236-R237 and K317-R318, this N-terminal NLS is thought to be the determining

factor for an efficient nuclear translocation of the thymidine kinase (Degrève et al., 1998, 1999).

Although this idea is in accordance with the predominant nuclear localization of the thymidine

kinase, the question has been raised, whether there may be isoform-specific differences in the

subcellular compartmentalization. Elucidation of this aspect may provide further insights into the

regulatory role of the HSV-1 thymidine kinase.

Concerning the mechanism of isoform formation, an interesting point was described for the

HSV-1-encoded serine/threonine protein kinase expressed by the ORF US3. Two distinct

transcripts, both possessing in-frame alternative sites of translational initiation, but varying in

their 5’ nucleotide sequences, are responsible for the expression of two individual isoforms. The

full-length protein kinase pUS3 is generated from the first ATG start codon of the longer

transcript and consists of 481 amino acids. The N-terminally truncated isoform pUS3.5 is

translated from the shorter transcript and initiates at the second in-frame ATG start codon, i.e.

lacking 76 amino acids of the N-terminus of this ORF, but containing its entire C-terminal part

(Poon and Roizman 2005; Purves et al. 1987; McGeoch et al., 1985). A comparison of the

expression pattern between the two isoforms showed that pUS3 is abundant and strongly

accumulates in HSV-1-infected cells, whereas pUS3.5 is only produced to small amounts.

Interestingly, this quantitative relation was reversed when the gene encoding the infected-cell

protein 22 (ICP22) was deleted. However, the mechanism responsible for this regulation has not

been determined to date (Poon et al., 2006). For the well-characterized full-length pUS3, several

biological functions have been described, like the prevention of apoptosis, the maturation of viral

particles and an involvement in the regulated cell-to-cell spread of HSV-1 (Finnen and Banfield

2010; Wisner et al. 2009; Mou et al., 2007; Ogg et al., 2004; Benetti and Roizman 2004;

Reynolds et al., 2002; Munger and Roizman 2001; Leopardi et al., 1997). Recently, it could be

demonstrated that both kinase isoforms exhibit functional similarities in terms of substrate

phosphorylation, i.e. both isoforms are able to phosphorylate the histone deacetylases 1 and 2

(HDAC1 and 2), the protein kinase A regulatory subunit II (PKA RII ) and the viral egress

protein pUL31. Moreover, pUS3 and pUS3.5 are both able to cofractionate with mitochondria

prepared from HSV-1 infected cells. It appears noteworthy that pUS3.5 is supposed to exhibit a

lesser impact on blocking apoptosis or regulating nuclear capsid egress (Poon et al., 2006). The

two homologous isoforms in pseudorabies virus (PRV) differ in their localization pattern. While

the full-length isoform is translocated to mitochondria, the N-terminally truncated isoform lacks

the mitochondrial localization signal and is predominantly imported into the nucleus (Calton et

al., 2004; van Zijl et al., 1990). Quantification of the expression levels of the isoforms in PRV-

Introduction - 12 -

infected cells revealed high amounts of the truncated version, whereas the full-length isoform is

only slightly detectable. Previous reports provided evidence that both kinases share anti-

apoptotic functions, although these functions seem to be mostly fulfilled by the full-length isoform

and only to a lesser extent by the truncated isoform (Geenen et al., 2005). Further analysis of

isoform-specific characteristics is required to get a more detailed insight into the multifunctional

roles of these protein kinases.

Objectives - 13 -

C Objectives

Human cytomegalovirus (HCMV) exhibits a complex host-interactive replication cycle, which is

strongly subject to the regulatory activity of cellular as well as viral protein kinases. Intense

research on the viral protein kinase pUL97 demonstrated the specific phosphorylation of a

variety of substrate proteins to modulate their activity in a way to adopt the cellular environment

for lytic HCMV replication. Hereby, several fundamental processes, such as viral DNA synthesis,

gene expression, nuclear capsid egress and virion morphogenesis are regulated in a kinase-

specific manner. Importantly, the nuclear accumulation of pUL97 has a strong impact on its

various functions. The mechanism of nuclear translocation that is most likely mediated through

NLS sequences contained within the N-terminal regulatory region of pUL97, however, has not

been determined so far. Interestingly, recent studies of our group suggested the generation of

more than one pUL97-specific protein. Thus, a more detailed biochemical and functional

characterization should provide further insights into the molecular properties required for the

multifunctionality of pUL97.

The aim of the present study was to address questions arising with the detection of pUL97-

specific isoforms: (i) the mode of isoform formation, (ii) their subcellular localization and (iii) their

functionality and importance for HCMV replication. To this end, Western blot analyses based on

material from HCMV-infected as well as plasmid-transfected cells should be performed.

Moreover, the intracellular localization of the proteins was thought to be determined by

immunofluorescence analysis using confocal laser-scanning microscopy. Predicted candidate

NLS sequences should be analyzed for their potency to confer nuclear protein translocation. The

connection between intracellular trafficking of pUL97 and its regulatory role during the viral

replication cycle should be investigated by the generation and analysis of recombinant HCMVs.

Furthermore, potential differences between the pUL97 isoforms and their individual impact on

the viral replication kinetics had to be addressed. In particular, recombinant HCMVs expressing

single isoforms of pUL97 were planned to be used in infection experiments to analyze specific

functional properties. Altogether, these experimental settings were designed to characterize the

pUL97-specific isoforms and their importance for HCMV replication.

Materials and Methods - 14 -

D Materials and Methods

D-1 Biological materials

D-1.1 Bacteria

Escherichia coli (E. coli) DH10B: F- araD139 (ara, leu) 7697 lacX74 galU galK rpsL deoR

Ф80dlacZ M15 endA1 nupG recA1 mcrA (mrr hsdRMS mcrBC) (Grant et al., 1990)

E. coli GS1783: DH10B cI857 (cro-bioA)<>araC-PBADI-SceI (Tischer et al., 2010)

D-1.2 Human cells

HFF: primary human foreskin fibroblasts

HEL: primary human embryonic lung fibroblasts

HEK293T: human embryonic kidney epithelial cell line transformed by adenovirus type 5 (Ad5)

containing a gene region that encodes for the simian virus 40 (SV40) large T-antigen (Pear et

al., 1993)

HeLa: human cervical carcinoma cell line that is positive for the human papillomavirus type 16

(HPV-16; Nelson-Rees and Flandermeyer, 1976)

D-1.3 Viruses

HCMV AD169: laboratory strain initially isolated from adenoid tissue (Rowe et al., 1956)

HCMV R3: clinical isolate possessing a cysteine to tryptophan exchange mutation within ORF

UL97 at amino acid position 603 (C603W) that confers a low-level resistance against ganciclovir

(GCV) and cidofovir (CDV; Herget et al., 2004)

HCMV R4: clinical isolate possessing a leucine to serine exchange mutation within ORF UL97 at

amino acid position 595 (L595S) that confers GCV resistance (also referred to as Iso 4; Efferth

et al., 2002)

HCMV UL97(M1L): recombinant virus expressing the HCMV protein kinase pUL97 carrying a

methionine to leucine exchange mutation at amino acid position 1 (kindly provided by S. Chou,

Portland, USA)


HCMV UL97(157-707): recombinant virus expressing the HCMV protein kinase pUL97 lacking

amino acid residues 156 (kindly provided by S. Chou, Portland, USA)

D-1.4 Antibodies

D-1.4.1 Primary antibodies

mAb-UL97 (Alabama): mouse monoclonal antibody for detection of the HCMV protein kinase

pUL97 (kindly provided by M. Prichard, Birmingham, USA)

mAb-UL97 (Rijeka): mouse monoclonal antibody for detection of the HCMV protein kinase

pUL97 (kindly provided by T. Lenac, Rijeka, Croatia)

mAb-Flag (M2): mouse monoclonal antibody directed against the Flag epitope (DYKDDDDK;

Sigma-Aldrich, Deisenhofen, Germany)

mAb-lamin A/C (636): mouse monoclonal antibody for detection of lamin A and C (Santa Cruz

Biotechnology, Santa Cruz, USA)

mAb- -gal: mouse monoclonal antibody for detection of -galactosidase (Millipore, Schwalbach,

Germany)

mAb-IE1 (63-27): mouse monoclonal antibody for detection of the HCMV immediate early

protein IE1 (UL123; Andreoni et al., 1989)

mAb-UL44 (BS 510): mouse monoclonal antibody for detection of the HCMV DNA polymerase

processivity factor pUL44 (kindly provided by B. Plachter, Mainz, Germany)

mAb-pp28 (41-18): mouse monoclonal antibody for detection of the HCMV phosphoprotein

pp28 (UL99; Sanchez et al., 2000b)

mAb-pp65 (65-33): mouse monoclonal antibody for detection of the HCMV phosphoprotein

pp65 (UL83; kindly provided by W. J. Britt; Birmingham, USA)

mAb- -actin (AC-15): mouse monoclonal antibody for detection of β-actin (Sigma-Aldrich,

Deisenhofen, Germany)

pAb-UL97 (Ulm): rabbit polyclonal antibody for detection of the HCMV protein kinase pUL97

(kindly provided by D. Michel, Ulm, Germany)

pAb-UL97 (Boston): rabbit polyclonal antibody for detection of the HCMV protein kinase pUL97

(kindly provided by D. Coen, Boston, USA)


pAb-UL97-Pep(aa1-16): rabbit polyclonal antibody directed against amino acids 1-16 of the

HCMV protein kinase pUL97 (Axxima Pharmaceuticals, München)

D-1.4.2 Secondary antibodies

All secondary antibodies coupled to horseradish peroxidase (HRP) or conjugated with

fluorescent dyes were purchased from Dianova (Hamburg, Germany).

HRP-coupled goat anti-mouse IgG (H+L) and anti-rabbit IgG (H+L)

Alexa 488-conjugated goat anti-rabbit IgG (H+L)

Alexa 488- and Alexa 555-conjugated goat anti-mouse IgG (H+L)

D-2 Nucleic acids and synthetic peptides

D-2.1 Oligonucleotides

All oligonucleotides were purchased from Biomers.net GmbH (Ulm, Germany). The respective

sequences are annotated from 5’ to 3’. Sequences corresponding to the gene of interest are

underlined, restriction enzyme cleavage sites highlighted in bold, Flag and HA epitopes in italics

and sites of mutagenesis in small letters.

Table 1. Primers for amplification

designation nucleotide sequence

5-UL97(1)-HindIII TAGAAGCTTATGTCCTCCGCACTTCGGTCTCGG

5-UL97(74)-HindIII TAGAAGCTTATGGCCGACGAGGCCGGCGGC

5-UL97(M1L)-HindIII TAGAAGCTTcTGTCCTCCGCACTTCGGTCTCGG

5-UL97(6)-AflII TGACTTAAGCGGTCTCGGGCTCGCTCGG

5-UL97(164)-AflII TGACTTAAGCGCGACGGCGACGTGACCAGC

5-UL97(190)-AflII TGACTTAAGCGCGGTGGACGCAAACGCCCG

5-UL97( 6-35)-HindIII TAGAAGCTTATGTCCTCCGCACTTCA

GTGGATGCGCGAAGCTGCGCAGGCC

5-UL97( 190-213) GAGCGGCGTCGTGGGCGGTGTGGACGCGGTGC

5- UL97 TCGGTGTGGTAGCTAGTGCAGCCTTAGGAACAGGGAA GACTGTCGCCACTTAGGGATAACAGGGTAATCGATTT


5-UL97lang/UL96-EcoRI TAGGAATTCTCGGTGTGGTAGCTAGTGCAGCCTTAGGAACAGGG

AAGACTGTCGCCACTATGTCCTCCGCACTTCGGTCTCGGGCTC

5-UL97(M1L)lang/UL96-EcoRI TAGGAATTCTCGGTGTGGTAGCTAGTGCAGCCTTAGGAACAGGG

AAGACTGTCGCCACTCTGTCCTCCGCACTTCGGTCTCGGGCTC

5-aphAI/UL97-PstI TAGCTGCAGAAGCTGCTCATCTGCGACCCGCACGCGCGTTTC

CCCGTAGCCGGCCTACGTAGGGATAACAGGGTAATCGATTT

5-UL97( 6-35) AGGAACAGGGAAGACTGTCGCCACTATGTCCTCCGCACTTCA GTGGATGCGCGAAGCTGCTAGGGATAACAGGGTAATCGATTT

5-UL97( 190-213) CACCGGCGGCAGCGACCCCTCGGACAGCGTGAGCGGCGTCGT GGGCGGTGTGGACGCGGTTAGGGATAACAGGGTAATCGATTT

3-UL97(707 ohne Stop)-XbaI-Flag TAGTCTAGACTTGTCGTCATCGTCTT TGTAGTCCTCGGGGAACAGTTGGCG

3-UL97(35)-XbaI TGATCTAGAGCGCCGGCGCGCCCTGCTGG

3-UL97(213)-XbaI TGATCTAGAACGACGTCGGCACAGCGGGG

3-UL97(198)-XbaI TGATCTAGAACGCAACGGGCGTTTGCGTCC

3-UL97( 190-213) CACCGCCCACGACGCCGCTCACGCTGTCCGAG

3- UL97 ACCTTCTCTGTTGCCTTTCCCCTCAGCAACCGTCACGTTCC

GCGTCCCGGAGTGGCGACAGTCTTCCCTGTTCCTAAGGCTG CACTAGCTACCACACCGAGCCAGTGTTACAACCAATTAACC

3-UL97-HA/UL98-XbaI TAGTCTAGAACCTTCTCTGTTGCCTTTCCCCTCAGCAA

CCGTCACGTTCCGCGTCCCGGTTAAGCGTAATCTGGAA CATCGTATGGGTACTCGGGGAACAGTTGGCGGCAGTC

3-UL97-Flag/UL98-XbaI TAGTCTAGAACCTTCTCTGTTGCCTTTCCCCTCAGCA ACCGTCACGTTCCGCGTCCCGGTTACTTGTCGTCATC GTCTTTGTAGTCCTCGGGGAACAGTTGGCGGCAGTC

3-aphAI-PstI TAGCTGCAGGCCAGTGTTACAACCAATTAACC

3-UL97( 6-35) CGGCTTGAGCGGCGGCCTGCGCAGCTTCGCGCATCCACTGAA

GTGCGGAGGACATAGTGGGCCAGTGTTACAACCAATTAACC

3-UL97( 190-213) CCACGTCGTTTTCTTCGAGCACCGCGTCCACACCGCCCACGA CGCCGCTCACGCTGTCCGGCCAGTGTTACAACCAATTAACC

Table 2. Primers for sequencing


UL97-start-f ATAACGACAGTGTCGGTGTGGTAG

UL97-107f AGTGGATGCGCGAAGCTGCGCAGG

UL97-311f CATGCGTTCGAAGTGACGTGATGC

UL97-478f CATGTGGTCGTTCGAGTACGATCG

UL97-654f CGCGGTGCTCGAAGAAAACGACG

UL97-816f ATTGCACCTGTTCCAACGACCAGA


UL97-976f TTGTTATGCCGTGGACATGAGCGA

UL97-1207f CTGCTGTCTGCTGCACAACGTCA

UL97-1382f ATGAACGTGCTCATCGACGTGAAC

UL97-1548f TGCGCGAATGTTACCACCCTGCTT

UL97-1741f CACGGAGGCGTTGCTCTTTAAGCA

UL97-1910f TTTGTGGAGGCCAAGATGTCCTCG

UL97-200rev TCATCAACGTGAGCCTGGGCGACC

UL97-410rev CGAGACGACGTGGACGGCACTACG

UL97-567rev ACGCCGCTCACGCTGTCCGAGG

UL97-752rev TACCGCTGAGCGGCTGCGGAATGC

UL97-886rev GCAAGAACATACGCGGGTCGCAC

UL97-1071rev ACCTTGACCACGCGATAGCGATCGA

UL97-1254rev TCTGTGTGGAAACGTCGATGTACC

UL97-1491rev ACACAGCGCTCGTTGTAATCCGGA

UL97-1659rev TCCGACATGCAATAACGCCGTAGG

UL97-1809rev TGCGTGAGCTTACCGTTCTCCAAC

UL97-1979rev TCTGCGAGCATTCGTGGTAGAAGC

UL97-2175rev TTCTCTGTTGCCTTTCCCCTCAGC

UL97.140304T TTGGTGGACTCGGTTTCGGCG

UL97.140341T CTGGAGGTCGACGACGCCGTC

UL97.142418B GCGACACGAGGACATCTTGG

UL97.142644B CCTTTCCCCTCAGCAACCGTC

Table 3. Primers for quantitative real-time PCR (TaqMan-PCR)


CMV 3’ GAGCAGACTCTCAGAGGATCGG

CMV 5’ AAGCGGCCTCTGATAACCAAG

CMV MIE FAM/TAMRA CATGCAGATCTCCTCAATGCGGCG


D-2.2 Cloning vectors, expression plasmids and BACmids

D-2.2.1 Vector systems

pcDNA3.1: eukaryotic expression vector containing a multiple cloning site (MCS) for insertion of

the open reading frame (ORF) of interest that is subsequently expressed under the control of the

HCMV immediate early promoter and enhancer; neomycin and ampicillin resistance cassettes

enables the selection of transfected cell clones (Invitrogen, Karlsruhe, Germany)

pHM830: eukaryotic expression vector for mapping of NLS sequences; insertion of the ORF of

interest using the MCS allows for expression of a fusion protein that contain an N-terminal GFP

part and a C-terminal -galactosidase part (Sorg and Stamminger, 1999)

pBluescript II KS+: bacterial expression vector containing a MCS for insertion of the ORF of

interest that is subsequently expressed under the control of the lac promoter; an ampicillin

resistance cassette enables the selection of transformed cell clones (Agilent Technologies Sales

& Services GmbH & Co.KG Life Sciences & Chemical Analysis, Waldbronn, Germany)

pEPkan-S: pcDNA-based eukaryotic expression vector containing the kanamycin resistance

cassette aphAI, two I-SceI restriction sites in opposite orientation and a sequence for the Flag

epitope (kindly provided by B. K. Tischer, Berlin, Germany; Tischer et al., 2006)

D-2.2.2 Ready-to-use plasmids and BACmids

pcDNA-UL97-F (pF721): eukaryotic expression plasmid encoding the HCMV protein kinase

pUL97 that is C-terminally fused to the Flag epitope (Marschall et al., 2001)

pcDNA-UL97-HA (pF722): eukaryotic expression plasmid encoding the HCMV protein kinase

pUL97 that is C-terminally fused to the HA epitope (Marschall et al., 2001)

pcDNA-UL97(38-707)-F (pHM2191): eukaryotic expression plasmid encoding amino acid

residues 38-707 of the HCMV protein kinase pUL97 that is C-terminally fused to the Flag epitope

(Webel et al., 2011)


residues 74-707 of the HCMV protein kinase pUL97 that is C-terminally fused to the Flag epitope

(Webel et al., 2011)


residues 111-707 of the HCMV protein kinase pUL97 that is C-terminally fused to the Flag

epitope (Marschall et al., 2005)



residues 157-707 of the HCMV protein kinase pUL97 that is C-terminally fused to the Flag

epitope (Webel et al., 2011)

pcDNA-UL97(M1L)-F (pHM2190): eukaryotic expression plasmid encoding the HCMV protein

kinase pUL97 carrying a methionine to leucine exchange mutation at amino acid position 1 and

is C-terminally fused to the Flag epitope (Schregel et al., 2007)

pcDNA-UL97(Mx4)-F (pHM2587): eukaryotic expression plasmid encoding the HCMV protein

kinase pUL97 carrying point mutations in the four in-frame ATG start codons at amino acid

positions 38, 74, 111, 157 and is C-terminally fused to the Flag epitope (Webel et al., 2011)

pcDNA-UL97(K355M)-F (pF715): eukaryotic expression plasmid encoding the HCMV protein

kinase pUL97 carrying an inactivating point mutation of the essential lysine codon within the ATP

binding site and C-terminally fused to the Flag epitope (Marschall et al., 2001)

pCB6-pp71 (pF635): eukaryotic expression plasmid encoding the HCMV tegument protein pp71

(kindly provided by B. Plachter, Mainz, Germany)

Cre recombinase (pF632): eukaryotic expression plasmid for the Cre recombinase (kindly

provided by G. Hahn, Munich, Germany)

pHB15: BACmid containing the genomic sequence of the HCMV laboratory strain AD169

(Hobom et al., 2000)

D-2.2.3 Plasmids generated in this thesis

GFP-UL97(6-35)- -gal (pHM3520): eukaryotic expression plasmid encoding a fusion protein

composed of the amino acid residues 6-35 of the HCMV protein kinase pUL97 that is C-

terminally fused to GFP and N-terminally fused to a part of -galactosidase; constructed by the

use of oligonucleotides 5-UL97(6)-AflII and 3-UL97(35)-XbaI as well as the template pcDNA-

UL97-F and the vector pHM830

















UL97- -gal (pHM3524): eukaryotic expression plasmid encoding the HCMV protein kinase

pUL97 that is C-terminally fused to a part of -galactosidase; constructed by the use of

oligonucleotides 5-UL97(1)-HindIII and 3-UL97(707 ohne Stop)-XbaI-Flag as well as the

template pcDNA-UL97-F and the vector pHM830

UL97(Mx4)- -gal (pHM3525): eukaryotic expression plasmid encoding the HCMV protein

kinase pUL97 carrying point mutations in the four in-frame ATG start codons at amino acid

positions 38, 74, 111, 157 and is C-terminally fused to a part of -galactosidase; constructed by

the use of oligonucleotides 5-UL97(1)-HindIII and 3-UL97(707 ohne Stop)-XbaI-Flag as well as

the template pcDNA-UL97(Mx4)-F and the vector pHM830

UL97(M1L)- -gal (pHM3526): eukaryotic expression plasmid encoding the HCMV protein

kinase pUL97 carrying a methionine to leucine exchange mutation at amino acid position 1 and

is C-terminally fused to a part of -galactosidase; constructed by the use of oligonucleotides 5-

UL97(M1L)-HindIII and 3-UL97(707 ohne Stop)-XbaI-Flag as well as the template pcDNA-

UL97(M1L)-F and the vector pHM830

UL97(74-707)- -gal (pHM3527): eukaryotic expression plasmid encoding amino acid residues

74-707 of the HCMV protein kinase pUL97 that is C-terminally fused to a part of -galactosidase;

constructed by the use of oligonucleotides 5-UL97(74)-HindIII and 3-UL97(707 ohne Stop)-XbaI-

Flag as well as the template pcDNA-UL97-F and the vector pHM830

UL97( 6-35)- -gal (pHM3579): eukaryotic expression plasmid encoding the HCMV protein

kinase pUL97 that contains a deletion of amino acid residues 6-35 and is C-terminally fused to a

part of -galactosidase; constructed by the use of oligonucleotides 5-UL97(Δ6-35)-HindIII and 3-

UL97(707 ohne Stop)-XbaI-Flag as well as the template pcDNA-UL97(38-707)-F and the vector

pHM830


UL97( 190-213)- -gal (pHM3580): eukaryotic expression plasmid encoding the HCMV protein

kinase pUL97 that contains a deletion of amino acid residues 190-213 and is C-terminally fused

to a part of -galactosidase; two PCR products were amplified by the use of oligonucleotides 5-

UL97(1)-HindIII and 3-UL97(Δ190-213) or 5-UL97(Δ190-213) and 3-UL97(707 ohne Stop)-XbaI-

Flag, respectively, as well as the template pcDNA-UL97-F; afterwards an overlap extension PCR

was performed and the generated fragment was inserted into the vector pHM830

UL97(M1L/ 190-213)- -gal (pHM3581): eukaryotic expression plasmid encoding the HCMV

protein kinase pUL97 that carries a methionine to leucine exchange mutation at amino acid

position 1, contains a deletion of amino acid residues 190-213 and is C-terminally fused to a part

of -galactosidase; constructed by the use of oligonucleotides 5-UL97(M1L)-HindIII and 3-

UL97(707 ohne Stop)-XbaI-Flag as well as the template UL97( 190-213)- -gal and the vector

pHM830

UL97( 6-35/ 190-213)- -gal (pHM3711): eukaryotic expression plasmid encoding the HCMV

protein kinase pUL97 that contains deletions of amino acid residues 6-35 as well as 190-213

and is C-terminally fused to a part of -galactosidase; constructed by the use of oligonucleotides

5-UL97(Δ6-35)-HindIII and 3-UL97(707 ohne Stop)-XbaI-Flag as well as the template

UL97( 190-213)- -gal and the vector pHM830

pBluescript-UL97-HA (pHM3535): eukaryotic expression plasmid encoding the HCMV protein

kinase pUL97 that is C-terminally fused to the HA epitope; constructed by restriction enzyme

digestion of plasmid pcDNA-UL97-HA using XbaI and EcoRI followed by insertion of the

generated fragment containing ORF UL97 into the vector pBluescript II KS+

pBluescript-UL97(Mx4)-F (pHM3536): eukaryotic expression plasmid encoding the HCMV

protein kinase pUL97 carrying point mutations in the four in-frame ATG start codons at amino

acid positions 38, 74, 111, 157 and is C-terminally fused to the Flag epitope; constructed by

restriction enzyme digestion of plasmid pcDNA-UL97(Mx4)-F using XbaI and EcoRI followed by

insertion of the generated fragment containing ORF UL97 into the vector pBluescript II KS+

pBluescript-UL97-aphAI-HA (pHM3537): eukaryotic expression plasmid containing the entire

ORF UL97 with an internal 50 bp repeat and the kanamycin resistance cassette aphAI behind

the PstI restriction site as well as an HA epitope sequence; a PCR product was amplified by the

use of oligonucleotides 5-aphAI/UL97-PstI and 3-aphAI-PstI as well as the template pEPkan-S

and inserted into the vector pBluescript-UL97-HA using the PstI restriction site

pBluescript-UL97(Mx4)-aphAI-F (pHM3538): eukaryotic expression plasmid containing the

entire ORF UL97 with point mutations in the four in-frame ATG start codons at amino acid

positions 38, 74, 111 and 157, an internal 50 bp repeat and the kanamycin resistance cassette


aphAI behind the PstI restriction site as well as a Flag epitope sequence; a PCR product was

amplified by the use of oligonucleotides 5-aphAI/UL97-PstI and 3-aphAI-PstI as well as the

template pEPkan-S and inserted into the vector pBluescript-UL97(Mx4)-F using the PstI

restriction site

pcDNA-UL96-UL97-aphAI-HA-UL98 (pHM3712): eukaryotic expression plasmid containing the

entire ORF UL97 with an internal 50 bp repeat and the kanamycin resistance cassette aphAI

behind the PstI restriction site as well as 50 bp upstream and downstream sequences and an

HA epitope sequence; constructed by the use of oligonucleotides 5-UL97lang/UL96-EcoRI and

3-UL97-HA/UL98-XbaI as well as the template pBluescript-UL97-aphAI-HA and the vector

pcDNA3.1

pcDNA-UL96-UL97(M1L)-aphAI-HA-UL98 (pHM4040): eukaryotic expression plasmid

containing the entire ORF UL97 with a methionine to leucine exchange mutation at amino acid

position 1, an internal 50 bp repeat and the kanamycin resistance cassette aphAI behind the PstI

restriction site as well as 50 bp upstream and downstream sequences and an HA epitope

sequence; constructed by the use of oligonucleotides 5-UL97(M1L)lang/UL96-EcoRI and 3-

UL97-HA/UL98-XbaI as well as the template pBluescript-UL97-aphAI-HA and the vector

pcDNA3.1

pcDNA-UL96-UL97(Mx4)-aphAI-F-UL98 (pHM4041): eukaryotic expression plasmid containing

the entire ORF UL97 with point mutations in the four in-frame ATG start codons at amino acid

positions 38, 74, 111 and 157, an internal 50 bp repeat and the kanamycin resistance cassette

aphAI behind the PstI restriction site as well as 50 bp upstream and downstream sequences and

a Flag epitope sequence; constructed by the use of oligonucleotides 5-UL97lang/UL96-EcoRI

and 3-UL97-Flag/UL98-XbaI as well as the template pBluescript-UL97(Mx4)-aphAI-F and the

vector pcDNA3.1

D-2.2.4 BACmids generated in this thesis

HCMV UL97 (pHM4042): pHB15-based HCMV BACmid lacking the ORF UL97; constructed by

the use of pHB15 and a PCR product that was amplified with oligonucleotides 5- UL97 and 3-

UL97 as well as the template pEPkan-S

HCMV UL97( NLS1) (pHM4043): pHB15-based HCMV BACmid expressing the HCMV protein

kinase pUL97 containing a deletion of amino acid residues 6-35; constructed by the use of

pHB15 and a PCR product that was amplified with oligonucleotides 5-UL97( 6-35) and 3-

UL97( 6-35) as well as the template pEPkan-S


HCMV UL97( NLS2) (pHM4044): pHB15-based HCMV BACmid expressing the HCMV protein

kinase pUL97 containing a deletion of amino acid residues 190-213; constructed by the use of

pHB15 and a PCR product that was amplified with oligonucleotides 5-UL97( 190-213) and 3-

UL97( 190-213) as well as the template pEPkan-S

HCMV UL97( NLS1/ NLS2) (pHM4045): pHB15-based HCMV BACmid expressing the HCMV

protein kinase pUL97 containing deletions of amino acid residues 6-35 and 190-213; constructed

by the use of HCMV UL97( NLS1) and a PCR product that was amplified with oligonucleotides

5-UL97( 190-213) and 3-UL97( 190-213) as well as the template pEPkan-S

HCMV UL97-HA (pHM4046): pHB15-based HCMV BACmid expressing the HCMV protein

kinase pUL97 with a C-terminal HA epitope; constructed by the use of HCMV UL97 and

plasmid pcDNA-UL96-UL97-aphAI-HA-UL98

HCMV UL97(M1L)-HA (pHM4047): pHB15-based HCMV BACmid expressing the HCMV protein

kinase pUL97 with a methionine to leucine exchange mutation at amino acid position 1 and a C-

terminal HA epitope; constructed by the use of HCMV UL97 and plasmid pcDNA-UL96-

UL97(M1L)-aphAI-HA-UL98

HCMV UL97(Mx4)-F (pHM4048): pHB15-based HCMV BACmid expressing the HCMV protein

kinase pUL97 with point mutations in the four in-frame ATG start codons at amino acid positions

38, 74, 111, 157 and a C-terminal Flag epitope; constructed by the use of HCMV UL97 and

plasmid pcDNA-UL96-UL97(Mx4)-aphAI-F-UL98

D-2.3 Additional nucleic acids

GeneRuler™: DNA ladder for determination of size and approximate yield of double-stranded

DNA in agarose gels was obtained from Fermentas (St. Leon-Rot, Germany)

D-2.4 Synthetic peptides

All peptides were kindly provided by Jutta Eichler (Department Medicinal Chemistry, Erlangen,

Germany). They were synthesized as C-terminal amides by Fmoc/t-Bu-based solid-phase

synthesis (Franke et al., 2007). N-terminal amino groups were acetylated, cleaved peptides were

purified by preparative HPLC, and their identities were confirmed by electrospray

ionization/mass spectrometry.


Table 4. Synthetic peptides of pUL97

designation amino acid sequence molar mass M

[g/mol]

Pep97(1-20) MSSALRSRARSASLGTTTQG 2037.3

Pep97(16-35) TTTQGWDPPPLRRPSRARRR 2445.8

Pep97(31-50) RARRRQWMREAAQAAAQAAV 2338.7

Pep97(46-65) AQAAVQAAQAAAAQVAQAHV 1916.1

Pep97(61-80) AQAHVDENEVVDLMADEAGG 2111.3

Pep97(76-95) DEAGGGVTTLTTLSSVSTTT 1939.1

Pep97(91-110) VSTTTVLGHATFSACVRSDV 2091.4

Pep97(106-125) VRSDVMRDGEKEDAASDKEN 2294.4

Pep97(121-140) SDKENLRRPVVPSTSSRGSA 2184.4

Pep97(136-155) SRGSAASGDGYHGLRCRETS 2107.3

Pep97(151-170) CRETSAMWSFEYDRDGDVTS 2395.6

Pep97(166-185) GDVTSVRRALFTGGSDPSDS 2065.2

Pep97(27-35) RRPSRARRR 1251.5

Pep97(6-35) RSRARSASLGTTTQGWDPPPLRRPSRARRR 3487.9

Pep97(16-35_R31A) TTTQGWDPPPLRRPSAARRR 2360.7

Pep97(16-35_A32L) TTTQGWDPPPLRRPSRLRRR 2487.9

Pep97(16-35_R33A) TTTQGWDPPPLRRPSRAARR 2360.7

Pep97(16-35_R34A) TTTQGWDPPPLRRPSRARAR 2360.7

Pep97(16-35_R35A) TTTQGWDPPPLRRPSRARRA 2360.7

Pep97(16-35_R31/33A) TTTQGWDPPPLRRPSAAARR 2275.9

Pep97(16-35_R34/35A) TTTQGWDPPPLRRPSRARAA 2275.6

Pep97(190-198) RGGRKRPLR 1136.4

Pep97(190-213) RGGRKRPLRPPLVSLARTPLCRRR 2852.5

Pep97(195-213) RPLRPPLVSLARTPLCRRR 2297.5

Pep97(164-198) RDGDVTSVRRALFTGGSDPSDSVSGVRGGRKRPLR 3756.2

D-3 Enzymes, buffers and media

D-3.1 Enzymes

The applied restriction enzymes were purchased from New England Biolabs (Frankfurt,

Germany) and used with the provided buffers according to the manufacturer’s protocols. T4 DNA

ligase (Invitrogen, Karlsruhe, Germany), Shrimp alkaline phosphatase (Fermentas, St. Leon-Rot,

Germany), Proteinase K and Expand High Fidelity Polymerase (Roche, Mannheim, Germany)

were utilized with buffers recommended by the manufacturers and according to their instruction

protocols.


D-3.2 Standard buffers and solutions

PBSo (phosphate-buffered saline without CaCl2 and MgCl2): 138 mM NaCl, 2.7 mM KCl,

6.5 mM Na2HPO4, 1.5 mM KH2PO4

1x TAE buffer: 24.2 g Tris base, 1.7 g EDTA, 5.7 ml glacial acetic acid were dissolved in H2O

adjusting the volume to 5 liters

6x DNA loading buffer: 30 % glycerol, 0.25 % bromphenol blue, 0.25 % xylene cyanole

Coimmunoprecipitation (CoIP) buffer: 25 ml 1 M Tris/HCl pH 8.0, 15 ml 5 M NaCl, 5 ml 0.5 M

EDTA and 25 ml 10 % NP40 were dissolved in H2O adjusting volume to 500 ml followed by

sterile filtration; shortly before usage 100 µl 100 mM PMSF, 20 µl 1 mg/ml aprotinin, 20 µl

1 mg/ml leupeptin and 20 µl 1 mg/ml pepstatin were added per 10 ml CoIP stock solution

10x SDS-PAGE buffer: 286 g glycine, 60.6 g Tris base and 20 g SDS were dissolved in H2O

adjusting the volume to 2 liters

4x protein loading buffer: 125 mM Tris/HCl (pH 6.8), 2 mM EDTA, 20 % glycerol, 4 % SDS,

10 % -mercaptoethanol, 0.01 % bromphenol blue

Western blotting buffer: 15.1 g Tris base, 75 g glycine and 1 liter ethanol were dissolved in

H2O adjusting the volume to 5 liters

Skim milk powder solution: Skim milk powder (J. M. Gabler Saliter GmbH & Co. KG,

Obergünzburg, Germany) dissolved in PBSo/0.1 % Tween

ECL solution A: 50 mg luminol (Sigma-Aldrich, Deisenhofen, Germany) were dissolved in

200 ml 0.1 M Tris/HCl (pH 8.6)

ECL solution B: 11 mg p-hydroxycoumarin acid (Sigma-Aldrich, Deisenhofen, Germany) were

dissolved in 10 ml DMSO

4 % paraformaldehyde solution: 4 g paraformaldehyde was dissolved in 50 ml H2O including

some drops of a 1 M NaOH solution at 60°C and after cooling to room temperature (RT) the

solution was mixed with 50 ml 2x PBSo

0.2 % Triton X-100: 0.2 % Triton X-100 dissolved in PBSo

HBS solution (HEPES-buffered saline): 4.4 g NaCl and 2.4 g HEPES were dissolved in 500 ml

H2O and adjusted to a pH of 7.4 followed by sterile filtration

PEI2000 solution: 9 mg polyethyleneimine MW 2000 (Sigma-Aldrich, Deisenhofen, Germany)

was dissolved in 10 ml H2O and adjusted to a pH of 7.0 followed by sterile filtration


PEI25000 solution: 9 mg polyethyleneimine MW 25000 (Sigma-Aldrich, Deisenhofen,

Germany) was dissolved in 10 ml H2O and adjusted to a pH of 7.0 followed by sterile filtration

RIPA lysis buffer: 0.1 % SDS, 1 % Na-desoxycholate, 1 % Triton X-100, 0.5 % NP40, 1 mM

EDTA, 10 mM Tris/Cl pH 7.5, 150 mM NaCl were dissolved in sterile H2O followed by sterile

filtration; shortly before usage the buffer was occasionally completed by adding the protease

inhibitor cocktail Complete Mini (Roche, Mannheim, Germany; 1 tablet for 10 ml of RIPA lysis

buffer)

HNTG buffer: 50 mM HEPES pH 7.5, 150 mM NaCl, 1 mM EDTA, 10 % glycerine and 0.1 %

Triton X-100 were dissolved in sterile H2O followed by sterile filtration

Kinase assay buffer: 20 mM Tris/Cl pH 7.5 and 0.5 mM MnCl2 were dissolved in H2O followed

by sterile filtration

D-3.3 Media

D-3.3.1 Bacterial media

LB medium (Luria-Bertani medium): 10 g of bactotryptone, 5 g of bacto yeast, 8 g of NaCl and

1 g of glucose were dissolved in 1 liter of H2O and adjusted to a pH of 7.2 using NaOH followed

by autoclaving; ampicillin (100 µg/ml), kanamycin (30 µg/ml) or chloramphenicol (30 µg/ml) was

optionally added to the media

LB agar (Luria-Bertani agar): 15 g of agar were dissolved in 1 liter of LB medium followed by

autoclaving; the solution was cooled down to about 55°C and 1 ml of ampicillin (50 mg/ml),

kanamycin (15 mg/ml), chloramphenicol (15 mg/ml) or (+)-L-Arabinose (1 %) was added

according to the requirements

SOC medium: 20 g of bactotryptone, 5 g of bacto yeast, 2.5 mM NaCl, 10 mM MgCl2, 10 mM

MgSO4 and 20 mM glucose were dissolved in 1 liter of H2O followed by filter sterilization

D-3.3.2 Cell culture media

MEM (Eagle’s minimal essential medium): this medium was obtained from Gibco/BRL

(Eggenstein, Germany) as a ready-to-use substance, dissolved in sterile H2O and adjusted to a

pH of 7.0


DMEM (Dulbecco’s modified Eagle medium): this medium was obtained from Gibco/BRL

(Eggenstein, Germany) as a ready-to-use substance, dissolved in sterile H2O and adjusted to a

pH of 7.0

FCS (fetal calf serum): FCS was obtained from Sigma-Aldrich (Deisenhofen, Germany)

Trypsin/EDTA: 0.25 % trypsin, 140 mM NaCl, 5 mM KCl, 0.56 mM Na2HPO4, 5 mM D(+)

glucose, 25 mM Tris/HCl, 0.01 % EDTA, pH 7.0

D-4 Methods

D-4.1 Standard molecular biology techniques

Polymerase chain reaction (PCR) for amplification of DNA fragments (Sambrook et al., 1989);

to improve the efficiency of the PCR reaction DMSO, formamide or MgSO4 was optionally added

to the samples

Restriction enzyme digestion of DNA, dephosphorylation with shrimp alkaline

phosphatase (SAP), ligation with T4 DNA ligase and agarose gel electrophoresis

(Sambrook et al., 1989)

Elution and purification of DNA fragments from agarose gels using commercial kits from

either Qiagen (Hilden, Germany), Fermentas (St. Leon-Rot, Germany) or Invitrogen (Karlsruhe,

Germany)

Transformation of plasmid DNA into bacteria by electroporation (Sambrook et al., 1989)

Small-scale DNA preparation by standard alkaline lysis procedure (Zagursky et al., 1985)

Large-scale DNA preparation using a commercial kit from Invitrogen (Karlsruhe, Germany)

Photometric determination of DNA concentrations (Sambrook and Russel, 2001)

Automated nucleotide sequencing of DNA using fluorescence-based ABI-Prism 2000

sequencing detector (ABI, Weiterstadt, Germany)

Multiple sequence alignment of distinct amino acid sequences using Clustal Omega

(version1.1.1; http://www.clustal.org)

Sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE; Laemmli, U. K.,

1970)


Enhanced chemiluminescence (ECL) immunodetection of proteins (Amersham ECL

Western blotting detection reagents and analysis system; GE Healthcare Europe GmbH,

Freiburg, Germany)

D-4.2 Cell culture techniques

D-4.2.1 Maintenance of human cells

Eukaryotic cell cultures were maintained at 37°C, 5 % CO2 and 80 % humidity using the

corresponding culture media. After reaching confluence, the adherent growing cells were

detached from the surface by trypsin/EDTA treatment and reseeded into new flasks containing

fresh medium.

HEK293T: DMEM supplemented with 10 % (v/v) FCS, 350 µg/ml l-glutamine and 10 µg/ml

gentamicin

HeLa: DMEM supplemented with 10 % (v/v) FCS, 350 µg/ml l-glutamine and 10 µg/ml

gentamicin

HFF: MEM medium supplemented with 7.5 % (v/v) FCS, 350 µg/ml l-glutamine and 10 µg/ml

gentamicin

D-4.2.2 Transfection procedures

HEK293T cells were seeded either into the wells of a six-well plate (3 x 105 cells) or into 10 cm

dishes (5 x 106 cells) and incubated over night at 37°C. Plasmid transfection was accomplished

by the use of LipofectaminTM 2000 (Invitrogen, Karlsruhe, Germany) according to the

manufacturer’s instructions or using polyethyleneimine (PEI), respectively. For the latter

technique, 10 µl PEI2000 were mixed with 500 µl HBS and added dropwise to a solution of

12 µg plasmid DNA and 500 µl HBS. After incubation for 20 min at RT, a mixture of 18 µl

PEI25000 and 500 µl HBS was added dropwise to the PEI-DNA solution and incubated for

20 min at RT. Cells were washed twice with DMEM supplemented with l-glutamine, supplied with

1 ml medium and after addition of the PEI-DNA solution, incubated for 3-4 h at 37°C. Thereafter,

the transfection reagent was replaced by fresh DMEM including l-glutamine, FCS as well as

gentamicin and 48 h post-transfection, the cells were harvested for a combined CoIP/IVKA

analysis.

For immunofluorescence analysis, HeLa cells were seeded onto coverslips placed into the

wells of a six-well plate (3 x 105 cells) and incubated over night at 37°C. Transfection of plasmid


DNA was performed by the use of LipofectaminTM 2000 (Invitrogen, Karlsruhe, Germany)

according to the manufacturer’s instructions.

HFF cells were transfected by the use of X-treme GENE HP DNA Transfection Reagent

(Roche, Mannheim, Germany). One day prior transfection, the cells were seeded into the wells

of a six-well plate (3 x 105 cells), grown to confluent monolayers and subsequently transfected

according to the instructions of the manufacturer.

D-4.2.3 Infections

Infection experiments were performed using either the HCMV laboratory wild-type strain AD169,

the clinical isolates R3 and R4 or recombinant viruses. Preparation of high-titer virus stocks was

achieved by infection of HFF cells with infectious supernatants from existing virus stocks or

BACmid transfected cells, respectively. Cell cultures were weekly supplied with fresh medium

until a pronounced cytopathic effect (CPE) became apparent. Subsequently, supernatants were

collected, separated from cell debris by centrifugation for 10 min at 2000 rpm and stored in

aliquots at -80°C. For Western blot, immunofluorescence and quantitative real-time PCR

analysis, HFF cells were seeded into the wells of a six-well plate (3.5 x 105 cells), optionally onto

coverslips, and incubated over night at 37°C. CoIP and IVKA analysis were performed using one

flask of HFF cells per approach. Infection with the respective viruses was accomplished by

incubating the cells for 90 min with 1-5 ml of an infectious virus stock solution. After virus

adsorption, the cells were supplied with fresh medium, cultivated for the durations indicated, and

harvested or fixed on coverslips.

D-4.3 Coimmunoprecipitation (CoIP) analysis

To identify specific protein-protein interactions, CoIP analyses using material from HCMV-

infected HFF cells were performed. For this purpose, protein A sepharose beads (50 mg/ml)

were dissolved in CoIP buffer and incubated over night at 4°C with the appropriate

immunoprecipitation antibody. The next day, these sepharose beads were washed three times

with CoIP buffer in order to get rid of excess unbound antibody. The HCMV-infected HFF cells

were harvested by centrifugation for 5 min at 2000 rpm and 4°C, washed in PBSo and lysed for

20 min on ice in 500 µl CoIP buffer including protease inhibitors. After removing the cell debris

by centrifugation for 10 min at 14000 rpm and 4°C, 50 µl aliquots of each supernatant were

taken as expression controls and boiled for 10 min at 95°C with 50 µl 2x protein loading buffer.

To absorb unspecific protein binding, lysates were incubated for 1 h at 4°C with uncoated protein

A sepharose beads. After extraction of the pretreated lysates by centrifugation for 2 min at

1000 rpm and 4°C, antibody-coated sepharose beads were added and incubated for 2.5 h at


4°C. Thereafter, the precipitates were isolated by centrifugation for 2 min at 10000 rpm and 4°C,

washed five times in CoIP buffer and one time in H2O. Finally, the precipitates were mixed with

30 µl 4x protein loading buffer, boiled for 10 min at 95°C and subjected to Western blot analysis.

D-4.4 In vitro kinase assay (IVKA)

The determination of in vitro protein phosphorylation was investigated by IVKA analysis of

transiently transfected HEK293T cells or HCMV-infected HFF cells, respectively.

Coimmunoprecipitation of proteins for combined CoIP/IVKA analysis was performed as

described in D-4.3 by cell lysis and precipitation in CoIP buffer (preserving protein complexes),

with the final washing step modified compared to normal CoIP. The precipitates were washed

twice in 500 µl HNTG buffer and then in 500 µl kinase assay buffer, to prepare the CoIP samples

for the IVKA experiment. To analyze precipitated proteins in the absence of interaction partners,

cell lysis and precipitation conditions were altered. The cells were lysed for 30 min on ice in

500 µl RIPA buffer (dissolving protein complexes) including a protease inhibitor mix and

subsequently precipitated by antibody-coated protein A sepharose beads dissolved in RIPA

buffer. For IVKA reactions, the precipitates were then incubated for 30 min at 30°C in 40 µl

kinase assay buffer containing 1 µM ATP, 1 mM DTT and 2.5 µCi [ -33P]-ATP to start in vitro

protein phosphorylation. Optionally, 1 µl of a purified histone mix H1-4 (Roche, Mannheim,

Germany) was added as an exogenous substrate protein. In vitro phosphorylation was finally

stopped by incubating the IVKA samples for 10 min at 95°C with 15 µl 4x protein loading buffer.

The radioactive labeled proteins were subjected to SDS-PAGE and analyzed by

autoradiography, whereas protein expression and specific precipitation was controlled by

Western blot analysis.

D-4.5 Western blot analysis

For detection of specific viral and cellular proteins from transiently transfected HEK293T cells

and HCMV-infected HFF cells, Western blot analyses were performed. Protein samples were

either derived from CoIP or IVKA experiments or generated directly after cell lysis. In this case,

the adherent growing cells were detached from the surface by trypsin/EDTA treatment and

harvested by centrifugation for 5 min at 5000 rpm. After washing the cells with PBSo, they were

lysed for 10 min on ice using CoIP buffer and the cell debris was removed by centrifugation for

5 min at 14000 rpm and 4°C. Supernatants were resuspended in 50 µl 2x protein loading buffer,

boiled for 10 min at 95°C and subsequently stored at -20°C or directly subjected to Western blot

analysis. First, the individual protein samples were separated by SDS-PAGE and transferred to


a nitrocellulose membrane (Whatman GmbH, Dassel, Germany) by electroblotting. The

membrane was then saturated for 2 h in 5 % skim milk powder solution, before binding of the

primary antibody was achieved by incubation for at least 3 h. After washing the membrane three

times for approximately 10 min in PBSo/0.1 % Tween, the appropriate HRP-coupled secondary

antibody was bound for 1 h. Finally, the membrane was washed again, shortly incubated within a

freshly prepared ECL solution (10 ml ECL solution A, 100 µl ECL solution B and 3.1 µl H2O2) and

the respective proteins were detected by the use of the FUJIFILM Luminescent Image Analyzer

LAS-1000 (FUJIFILM Europe GmbH, Düsseldorf, Germany). A prestained molecular weight

marker (Precision Plus Protein Dual Color Standards; Bio-Rad Laboratories GmbH, München,

Germany) provided for the specification of visible protein bands. To perform further stainings of

relevant proteins, the bound antibody was removed from the membrane by incubation for 20 min

at 55°C with Roti®-Free stripping buffer (Roth, Karlsruhe, Germany), followed by several washing

steps and a second round of antibody binding.

D-4.6 Immunofluorescence analysis and confocal imaging

To determine the subcellular distribution of proteins in human cell cultures by high-resolution

confocal laser-scanning microscopy, transiently transfected HeLa cells or HCMV-infected HFF

cells, respectively, were fixed on coverslips and investigated by immunofluorescence analysis.

For this purpose, the cells were washed with PBSo and fixation was achieved by incubation with

a 4 % paraformaldehyde solution for 10 min at RT. Then, cells were washed twice,

permeabilized with 0.2 % Triton X-100 for 20 min at 4°C, washed three times and incubated for

30 min at 37°C with horse serum or human -globulin (2 mg/ml; Sigma Aldrich, Deisenhofen,

Germany), respectively. Subsequently, the cells were incubated for 90 min at 37°C with 150 µl of

the appropriate primary antibody diluted in PBSo, washed three times and incubated for 60 min

at 37°C with 150 µl of the corresponding secondary fluorescent-conjugated antibody diluted in

PBSo. For staining of the cell nuclei, DAPI-containing Vectashield mounting medium (Alexis,

Grünberg, Germany) was used. Confocal laser-scanning microscopy was performed with a TCS

SP5 microscope (Leica GmbH, Wetzlar, Germany) and images were processed using the

corresponding LAS AF software (version 1.8.2) and Adobe Photoshop (version 8.0.1).

D-4.7 Semi-automated interactive cell segmentation for the determination of

nucleocytoplasmic intensity ratios

To quantify the nucleocytoplasmic distribution of pUL97 and a series of mutants in transiently

transfected HeLa cells, immunofluorescence analysis was performed as described in D-4.6 and


the obtained images were investigated by an automated image segmentation method (Held et

al., 2014). The boundaries of individual nuclei and their corresponding cytoplasm were semi-

automatically marked and mean degrees of nuclear and cytoplasmic signals were measured.

Subsequently, the intensity ratios were calculated by the support vector machine classifier and

each single cell was subdivided into one of the three groups displaying either mainly nuclear,

nucleocytoplasmic or cytoplasmic localization pattern of the pUL97 mutants.

D-4.8 Surface plasmon resonance (SPR) analysis

To investigate the interaction between human importin and synthetic peptides of pUL97, SPR-

based Biacore analyses were performed using the T100, T200 or X100 instrument, respectively.

A commercially available human importin recombinant expressed in E. coli (Jena Bioscience

GmbH, Jena, Germany; accession no. NP_002257) was immobilized by standard covalent

amine coupling on a CM5 sensor chip (GE Healthcare Europe GmbH, Freiburg, Germany) to

either 1000 or 10 000 response units (RU). For this purpose, the surface of the measuring flow

cell was activated by a mixture of EDC and NHS, followed by covalent binding of importin and

saturation of the uncoupled primary amines by ethanolamine. The reference flow cell was

treated identically with the exception that no importin was applied for immobilization. Synthetic

pUL97 peptides were dissolved in HBS-EP+ running buffer (GE Healthcare Europe GmbH,

Freiburg, Germany) and injected over both flow cells at concentrations of 2-10 µM, a flow rate of

30 µl/min, an association time of 60 sec and a dissociation phase of 120 sec. Finally, the

sensorgrams were analyzed using the corresponding Biacore T100 evaluation software (version

2.0.1). Association and dissociation rate constants as well as the resulting kinetic constants were

calculated according to the global curve fit model.

D-4.9 Generation of recombinant viruses using the BACmid technology

D-4.9.1 Preparation of electrocompetent E. coli GS1783

To produce electrocompetent E. coli bacteria of the GS1783 strain, 10 ml LB medium

supplemented with chloramphenicol were inoculated and cultivated overnight at 32°C. The next

day, 500 ml of preheated medium were added and incubated at 32°C until the bacteria reached

the early logarithmic phase (OD of 0.4-0.5). At this stage, the culture was transferred into

preheated flasks and incubated for exactly 15 min in a 42°C warm water bath shaker. The cells

were cooled down for 30 min on ice, before they were harvested by centrifugation for 10 min at

4000 rpm and 4°C. After washing the cells three times with ice-cold H2O and once with 10 %


glycerol, the pellet volume was roughly estimated so that the bacteria could be resuspended in

an identical volume of 10 % glycerol. Aliquots of 50 µl were stored at -80°C or directly used for

transformation.

D-4.9.2 Homologous recombination

Recombinant HCMVs were generated using the two-step, traceless Red-mediated mutagenesis

of bacterial artificial chromosomes (BACs) containing the cytomegaloviral genome (Tischer et

al., 2006). To establish UL97 deletion mutants, PCR products consisting of the kanamycin

resistance cassette aphAI, a restriction site for the endonuclease I-SceI as well as specific

sequences upstream and downstream of the region of interest (contained within the PCR

primers) were amplified from the pEP-S/aphAI vector. For insertion of large DNA sequences

appropriate expression plasmids were constructed and the corresponding fragments were

amplified by PCR. First, a fragment encoding the kanamycin resistance cassette as well as the I-

SceI restriction site was amplified using the vector pEP-S/aphAI and the primers 5-aphAI/UL97-

PstI, that exhibits a 50 bp internal UL97 repeat, and 3-aphAI-PstI. Based on the unique PstI

restriction site within UL97, this PCR product was inserted into the expression plasmids UL97-

HA, UL97(Mx4)-F or UL97(M1L)-HA, respectively. For amplification of the final transfer products,

primers containing a 50 bp homologous region to either the upstream or downstream genomic

sequence of UL97 were applied. All PCR products for generation of the recombinant viruses

were digested with DpnI (to remove the methylated template construct) over night at 37°C and

purified from agarose gels, before approximately 100 ng were transformed into 50 µl of the

electrocompetent E. coli strain GS1783 encoding the endonuclease I-SceI under an arabinose-

inducible promoter and carrying an HCMV BACmid. The culture was incubated for 2 h at 32°C in

1 ml SOC medium, before plating on LB agar supplemented with kanamycin and

chloramphenicol for selection of positive transformants. The BACmids of selected clones were

then isolated and the first recombination step was controlled by restriction fragment length

polymorphism (RFLP). To eliminate the kanamycin resistance cassette, selected transformants

were grown over night at 32°C using LB medium supplemented with kanamycin and

chloramphenicol. Subsequently, 100 µl of this culture were used for inoculation of 2 ml fresh LB

medium containing only chloramphenicol and incubated at 32°C until bacteria reached the early

logarithmic phase (OD of 0.4-0.5). To induce expression of the I-SceI endonuclease, 2 ml of

preheated LB medium containing chloramphenicol and 1 % arabinose were added to the culture

and incubated for 1 h at 32°C. Afterwards, the culture was transferred to a 42°C warm water

bath shaker and incubated for 15 min in order to induce the expression of the Red recombination

system. After further incubation at 32°C for 3 h, positive transformants were identified by replica

plating using LB agar plates supplemented either with chloramphenicol and kanamycin as a


negative control or with chloramphenicol only. To confirm the second recombination, BACmids

were isolated and verified by RFLP, PCR amplification of the region of interest and nucleotide

sequencing.

D-4.9.3 Isolation and restriction enzyme digestion of BACmids

In order to verify each recombination step, BACmids were isolated by small scale DNA

preparation according to Zagursky et al. (1985). In case the purified BACmids were used for

reconstitution, an additional phenol-chloroform extraction was performed to increase the DNA

purity. Remarkably, the fragile BACmids were only carefully resuspended, directly used for

control digestion and stored at 4°C. For the analysis by RFLP, 25 µl of the purified BACmids

were added to 1.5 µl of the appropriate restriction enzyme, 4 µl of the corresponding 10x buffer

and 9.5 µl of sterile H2O and incubated overnight at 37°C. Subsequently, the digestion pattern

was analyzed by the use of 0.7 % agarose gels.

D-4.9.4 Reconstitution of infectious viral particles

For the generation of infectious viral particles, low-passaged HFF cells were transfected with the

respective recombinant BACmids. One day prior transfection, 3 x 105 cells were seeded into the

wells of a six-well plate, cultivated in 2 ml MEM medium and three wells per sample were

transfected using the X-treme GENE HP DNA Transfection Reagent (Roche, Mannheim,

Germany). For this purpose, 1 µl of the purified BACmids, 0.5 µg of the expression vector

encoding the Cre recombinase and 0.5 µg of the plasmid pCB6-pp71 were mixed with 300 µl of

plain MEM medium. Finally, 12 µl of the transfection reagent were added, the samples were

incubated for 15 min at RT and evenly distributed into the wells. The Cre recombinase enabled

removal of the chloramphenicol resistance cassette and the remaining bacterial gene elements,

which are located between two loxP sites. The HCMV tegument protein pp71 is known to

enhance the infectivity of viral DNA (Hobom et al., 2000; Baldick et al., 1997). After incubation

for 4-6 h at 37°C, the transfection medium was replaced by 2 ml of fresh MEM medium

supplemented with 7.5 % (v/v) FCS, 350 µg/ml l-glutamine and 10 µg/ml gentamicin. The next

day, cells were supplied with 2 ml of fresh medium and approximately one week later transferred

into a medium-sized flask. Henceforward, the medium was exchanged once a week until a

complete cytopathic effect (CPE) was visible. The supernatants of CPE-positive flasks were then

used to infect fresh HFF cells to generate high-titer virus stocks.


D-4.10 Virus titration

The determination of virus titers was based on the expression of the HCMV immediate early

protein IE1. For this purpose, 8 x 104 HFF cells were cultivated in the wells of a 24-well plate and

infected with 300 µl of a serial dilution (1:5 to 1:56) of the respective virus stock. Two days post-

infection, cells were washed with PBSo and fixed with 4 % paraformaldehyde for 10 min at RT.

After two washing steps, cells were permeabilized with 0.2 % Triton X-100 for 20 min at 4°C,

washed again three times and incubated for 1 h at 37°C with the primary antibody mAb-IE1. To

prepare the cells for immunofluorescence analysis, samples were washed twice and incubated

with the secondary antibody Alexa 488 for 30 min at 37°C. Finally, cells were washed, covered

with PBSo and the number of IE1-expressing cells, as referring to specific virus dilutions, was

counted using the Axiovert-200 fluorescence microscope (Zeiss, Jena, Germany). Calculation of

the virus titer was performed in duplicate.

D-4.11 Quantitative real-time PCR (TaqMan-PCR)

To quantify viral genome equivalents released within mature virions from HCMV-infected HFF

cells, real-time TaqMan-PCR was performed using the ABI Prism 7700 sequence detector

(Applied Biosystems, Foster City, USA). For this approach, cell culture supernatants were

collected at several time points post-infection and the viral DNA was extracted by digestion with

proteinase K. First, 20 µl of each sample were mixed with 80 µl proteinase K reaction buffer

containing 25 ng/ml of the enzyme. Then, the samples were incubated for 1 h at 56°C and

subsequently heated for 5 min at 95°C to stop the digestion. A specific gene region within exon 4

of the ORF UL123 encoding IE1 was specifically amplified. For this purpose, 5 µl of each sample

were mixed with 10 µl of 2x Taqman PCR Mastermix (Applied Biosystem, Foster City, USA),

1.5 µl of each primer CMV 5’ and CMV 3’ (5 µM stock solution), 0.4 µl of the fluorescence

labeled oligonucleotide CMV MIE FAM/TAMRA (10 µM stock solution) and 1.6 µl of sterile H2O.

After an initial denaturation step of 5 min at 95°C, 40 amplification cycles were conducted with a

15 sec denaturation step at 95°C, a 30 sec oligonucleotide hybridization step at 60°C and a

33 sec elongation step at 68°C. All samples were analyzed in triplicate. Serial dilutions of a

control plasmid containing the relevant IE1 gene region served as an internal amplification

standard and were monitored in parallel. Finally, the viral genome equivalents were calculated

by the corresponding software SDS (sequence detection system; version 1.9) using the internal

standard values.

Results - 37 -

E Results

E-1 Determination of three isoforms of pUL97 and the mechanism of

isoform formation

E-1.1 Expression of three pUL97-specific isoforms during HCMV infection

Previous publications depicted the occurrence of two prominent pUL97 products in transient

transfection experiments (Marschall et al., 2003; Schregel et al., 2007). To further characterize

the pUL97 expression pattern, Western blot analyses of material from HCMV-infected human

foreskin fibroblasts (HFF) were performed. To this end, cells were harvested several days post

infection, lysed and subjected to SDS-PAGE and immunoblotting. Detection of pUL97 using a

specific polyclonal antibody revealed the expression of three different isoforms during infection

with the laboratory-adapted HCMV strain AD169 (Fig. 2A). The largest isoform migrated at a

size of approximately 100 kDa (upper band; 1), the medium-sized isoform and the smallest

isoform at approximately 80 kDa (intermediate band; 2) and 70 kDa (lower band; 3),

respectively. All three pUL97-specific isoforms were expressed in similar amounts increasing

over the time course of viral infection. Furthermore, the accumulation of all three isoforms was

independent of the multiplicity of infection (MOI). At high MOIs, pUL97 was detectable by 2 days

post infection, whereas low MOIs resulted in delayed detection levels (Fig. 2A). To determine the

relevance of pUL97 isoform expression, cell lysates from clinical HCMV isolates R3 and R4 were

analyzed in parallel. Strikingly, all three isoforms were detectable at low and high MOIs with

expression pattern comparable to AD169 (Fig. 2B). However, further Western blot analyses

Results - 38 -

FIGURE 2. Translation of three pUL97 isoforms during HCMV replication. HFFs were infected with the laboratory

stain AD169 (A) or the clinical isolates R3 and R4 (B) at the MOIs indicated. Cell lysates were collected 1-7 days post infection and analyzed by SDS-PAGE and immunoblotting. Specific pUL97 isoform bands were detected at approximately 100 kDa (upper band; 1), 80 kDa (intermediate band; 2) and 70 kDa (lower band; 3) using the polyclonal antibody pAb-UL97 (Ulm). Cellular ß-actin levels served as a control for equal protein loading. (C) Comparison of isoform detection by different pUL97-specific antibodies using the same cell lysates (7 dpi, MOI 0.5).

suggested that relative detection of the isoforms varied among different pUL97-specific

antibodies (Fig. 2C). In summary, these results indicate that pUL97 physiologically occurs as

three different isoforms with typical early-late kinetics and that isoform formation may be relevant

for the fine-regulated cascade of HCMV replication.

Results - 39 -

E-1.2 Elucidation of the mechanism of isoform formation

E-1.2.1 Evidence for alternative sites of translational initiation

Due to the fact that ORF UL97 contains five in-frame ATG start codons, located at positions M1,

M38, M74, M111 and M157, the possibility of individual isoform formation resulting from

alternative sites of translational initiation was investigated. First, transient transfection

experiments using point and deletion mutants of pUL97 were performed with 293T cells.

Western blot analyses revealed that all three isoforms were detectable for wild-type pUL97 (Fig.

3 lane 1), whereas deletion of the extreme N-terminus of pUL97 abrogated formation of the

largest isoform, but allowed expression of smaller pUL97-specific products (Fig. 3, lane 2-5).

Similarly, directed mutation of the first ATG start codon (M1) to a leucine residue resulted in loss

of the largest isoform (Fig. 3, lane 6), indicating that M1 is used for translation of this isoform.

Strikingly, mutation of the downstream sites of translational initiation M38, M74, M111 and M157

inhibited expression of the smaller protein products, but allowed formation of the largest isoform

(Fig. 3, lane 7). An additional slightly visible product was detectable when using the pUL97-

specific polyclonal antibody, probably due to protein instability or degradation. The expression

pattern of pUL97 deletion mutant 74-707 showed a distinct protein band migrating with a

molecular mass identical to the medium-sized isoform (Fig. 3, lane 3), arguing for translational

initiation of this isoform at the third ATG start codon (M74). Deletion mutant 38-707

predominantly expressed this medium-sized isoform and additionally produced a faint protein

band consistent with a putative secondary translational initiation at M38 (Fig. 3, lane 2),

supporting M74 initiation responsible for production of the medium-sized isoform. Particularly for

pUL97 detection using the specific polyclonal antibody, a protein band representing the smallest

isoform was detectable for the mutants 38-707 and 74-707, obviously resulting from translational

initiation downstream of M74. Considering pUL97 products expressed by deletion mutants 111-

707 and 157-707 (Fig. 3, lanes 4 and 5), the formation of this smallest isoform is most likely

FIGURE 3. Alternative translational initiation is highly suggestive as the basis for pUL97 isoforms. 293T cells were transfected with

constructs coding for Flag-tagged pUL97 mutants starting or containing exchange mutations at the relevant initiation sites. Western blot analyses were performed and the expression of pUL97-specific products was monitored by a polyclonal antibody directed against pUL97 [pAb-UL97 (Ulm)] and the monoclonal antibody mAb-Flag. Cellular ß-actin levels served as a loading control.

Results - 40 -

initiated at the fifth ATG start codon (M157). These observations strongly suggest that the

mechanism of isoform formation is alternative initiation of translation based on the in-frame ATG

start codons M1, M74 and M157.

E-1.2.2 Confirmation of ATG start codons referring to pUL97 isoforms by the use

of recombinant HCMVs

Next, Western blot analysis was performed to confirm the ATG start codons M1, M74 and M157

for individual isoform expression in the viral context (Fig. 4). Cell lysates from recombinant

HCMVs containing a methionine to leucine exchange at position M1 or stop codon mutations (*)

at positions M74, M111 or M157, respectively, (kindly provided by S. Chou, Portland, USA) were

analyzed by immunoblotting. As expected, mutation of the start codon M1 abrogated expression

of the largest isoform, but resulted in formation of the medium-sized isoform and the smallest

isoform (Fig. 4, lane 2). Thus, M1 could be confirmed as the responsible start codon for

individual translation of the largest isoform during HCMV infection. The finding that a M74 stop

mutant virus was no longer able to express the medium-sized isoform, but showed a unique

protein band for the smallest isoform (Fig. 4, lane 3), confirmed the specificity of M74 for the

formation of the medium-sized isoform. Furthermore, M157 was verified for distinct expression of

the smallest isoform, due to the fact that a M111 stop mutant virus still showed a slight protein

band for this isoform (Fig. 4, lane 4), whereas a M157 stop mutant virus completely abrogated

any pUL97 isoform expression (Fig. 4, lane 5). These findings were supported by a comparative

Western blot analysis between pUL97 mutants expressed during HCMV infection or transient

transfection (data not shown). Taken together, the ATG start codons M1, M74 and M157 are

responsible for specific translation of pUL97 isoforms during HCMV infection.

FIGURE 4. Identification of the alternative translation initiation sites responsible for pUL97 isoform expression using recombinant viruses.

Cell lysates of HCMV-infected HFFs were separated by SDS-PAGE and the three pUL97 isoforms were detected by Western blot analyses using the polyclonal antibody pAb-UL97 (Ulm). Stop codon mutations are indicated by an asterisk (*).

Results - 41 -

E-1.3 Genetic conservation of isoform initiation sites and sequence motifs in the

ORF UL97

In order to investigate clinical HCMV isolates for their coding capacity of individual pUL97

isoforms, various patient samples were analyzed for amino acid substitutions within the N-

terminal region of pUL97, particularly at the translation initiation sites. The specimens (kindly

provided by the diagnostic repositories of the Virological Institutes at Erlangen and Sydney) were

isolated from primary or low passaged viruses, which were not adapted to laboratory cell lines.

Multiple sequence alignments of 42 clinical isolates and 5 reference HCMV strains revealed

complete conservation of all five in-frame ATG start codons of ORF UL97 and a high overall

conservation of the entire N-terminus of pUL97 (Fig. S1, Appendix). This observation is in

accordance with published data showing that the ORF UL97 is generally well conserved (Lurain

et al. 2001; Boutolleau et al. 2011). Additional sequence analysis showed significant differences

among human and simian cytomegaloviruses (Webel et al. 2011; data not shown). These results

indicated that the potential to express pUL97 isoforms is exclusively conserved among human

CMVs, but is missing in CMVs of monkeys.

E-2 Identification of two bipartite NLS sequences and their

relevance for nuclear translocation of pUL97 isoforms

E-2.1 Nuclear accumulation of pUL97 in HCMV-infected cells

Mainly nuclear functions of pUL97 are described that contribute to the efficient HCMV replication

in permissive cells (Prichard M. N., 2009; Lee and Chen, 2010; Marschall et al., 2011). For this

reason, an efficient translocation of pUL97 into the nucleus of the host cell is principally

expected. Consistent with published data (Michel et al., 1996; Gill et al., 2012),

immunofluorescence analysis revealed a predominant nuclear localization of pUL97 in HCMV-

infected HFFs (Fig. 5). In addition to the distribution throughout the entire nucleus, pUL97 was

found to accumulate specifically in viral replication compartments and to a marginal extent in

proximity to the nuclear envelope, denoted by lamina proteins A and C. Similar to the laboratory-

adapted HCMV strain AD169 (Fig. 5 panels 3-4), this nuclear phenotype was also detectable for

clinical isolates R3 and R4 (Fig. 5 panels 5-8).

Results - 42 -

Figure 5. Predominant nuclear accumulation of pUL97 at late stages of HCMV infection. HFFs were seeded on

coverslips, remained uninfected (mock) or were infected with the laboratory strain AD169 or the clinical isolates R3 and R4, respectively. At 96 hours post infection the cells were fixed and subjected to indirect immunofluorescence analysis. Nuclear lamina proteins A and C (depicted in red) were detected with the monoclonal antibody mAb-lamin A/C and pUL97 (depicted in green) was analyzed by the use of the polyclonal antibody pAb-UL97 (Boston). Cell nuclei were counterstained with DAPI.

E-2.2 Differences in subcellular localization between pUL97 isoforms

In order to examine the specific localization pattern of the pUL97 isoforms, plasmid constructs

allowing an individual expression of isoforms were generated and analyzed by confocal laser-

scanning microscopy. The possibility of passive nuclear diffusion was minimized by adding a

large part of the cytoplasmic protein ß-galactosidase (ß-gal) to the C-terminus of pUL97. The

observed phenotypes for the transiently expressed fusion proteins were clustered in three

categories, representing predominant nuclear, nucleocytoplasmic or cytoplasmic localization,

respectively. Percentage evaluation was performed by manual counting and additionally in

cooperation with Christian Held and Thomas Wittenberg (Fraunhofer Institute for Integrated

Circuits, Erlangen, Germany) by semi-automatic interactive cell segmentation measuring the

nucleocytoplasmic intensity ratios. Exclusive nuclear accumulation was observed for constructs

FIGURE 6. Quantification of the intracellular distribution of individually expressed pUL97 isoforms. HeLa cells

were transiently transfected with expression plasmids encoding pUL97-ß-gal fusion proteins, fixed on coverslips at 48 hours post transfection and analyzed by confocal laser-scanning microscopy using pAb-UL97 (Boston) and mAb-ß-gal. Cell nuclei were counterstained with DAPI and used to quantify the cells for predominant nuclear (blue), nucleocytoplasmic (green) or cytoplasmic (red) localization of the fusion protein. Isoform M1 expression is represented by pUL97(Mx4) and abrogated in the constructs pUL97(M1L) and pUL97(74-707).

Results - 43 -

expressing wild-type pUL97 and isoform M1, respectively (Fig. 6, left panel). Interestingly,

expression constructs with an abrogated isoform M1 formation showed reduced nuclear

translocation of the fusion proteins (Fig. 6, central and right panels). Only 67-75 % of the

analyzed cells displayed complete nuclear localization, whereas 15-20 % of cells exhibit a

homogenous nucleocytoplasmic distribution and even 5-18 % of cells showed strict cytoplasmic

accumulation. These results strongly suggested that isoforms M74 and M157 are less efficiently

transported into the nucleus than isoform M1.

E-2.3 In silico analysis of putative NLS sequences

Since the main localization of pUL97 was found to be nuclear, in silico analysis was performed

to predict putative NLS sequences. For this purpose, the commonly used prediction software

NLS mapper (Kosugi et al., 2009) was applied. Due to the fact that NLS sequences within

globular protein domains are in general difficult to access, they were excluded from further

analysis. In cooperation with Christophe Jardin and Heinrich Sticht (Institute of Biochemistry,

Erlangen, Germany) three candidate NLS sequences were identified in the mostly unstructured

N-terminal part of pUL97 (Table 5). They all belong to the bipartite NLS type containing two

clusters of basic residues separated by a short linker region. The first one comprised residues 6-

35 and was thereby exclusively located within the extreme N-terminus of isoform M1. The other

two putative NLS sequences, partially overlapping, consisted of amino acids 164-198 and 190-

213, respectively. The latter region was known to be present in all three pUL97 isoforms. A

comparative analysis between various human pUL97 sequences and simian homologs revealed

a high evolutionary conservation of the first candidate NLS (residues 6-35), while the putative

NLS sequences spanning residues 164-198 and 190-213 were mainly restricted to human

cytomegaloviruses (Webel et al. 2011; data not shown). Moreover, a secondary structure

prediction using the NPS@ consensus-prediction method (Combet et al., 2000) revealed the

embedding of the first candidate NLS into an alpha-helix located between amino acids 31-64

Table 5. Predicted bipartite NLS sequences within pUL97. Basic arginine and lysine residues are bold-printed and

overlapping amino acid sequences are underlined.

predicted NLS region amino acid sequence

6-35 RSRARSASLGTTTQGWDPPPLRRPSRARRR

164-198 RDGDVTSVRRALFTGGSDPSDSVSGVRGGRKRPLR

190-213 RGGRKRPLRPPLVSLARTPLCRRR

Results - 44 -

(Webel et al. 2011; data not shown). This observation was confirmed by nuclear magnetic

resonance (NMR) analysis of short synthetic pUL97 peptides covering the N-terminal region

(Webel et al. 2012; data not shown). Taken together, distinct and conserved bipartite NLS

sequences were predicted within the variable N-terminus of pUL97, supporting the idea of an

isoform-specific nuclear translocation.

E-2.4 The determinant activity of NLS1 and NLS2 for nuclear translocation of

pUL97

The potency of the postulated NLS candidates to confer nuclear protein translocation was

investigated using an established assay system (Sorg and Stamminger, 1999). For this purpose,

expression constructs containing the predicted NLS sequences within a GFP-ß-gal fusion

cassette were generated. HeLa cells were transiently transfected and the intracellular

distribution of the NLS fusion proteins was examined by immunofluorescence analyses. In this

system, a series of fragments of pUL97 was tested for NLS activity (Webel et al., 2011; data not

shown). Importantly, a construct containing pUL97 residues 6-35 showed a complete nuclear

accumulation of the fusion protein (Fig. 7 panels 1-3). Due to the fact that only highly effective

nuclear translocation elements are able to mediate a complete import of the GFP-ß-gal part into

the nucleus, it was concluded that residues 6-35 represent a fully functional, minimal NLS

sequence determinant (NLS1). Furthermore, the two overlapping NLS candidates spanning

FIGURE 7. Identification of two bipartite NLS sequences between amino acids 6-35 (NLS1) and 190-213 (NLS2). HeLa cells were seeded on coverslips, transiently transfected with GFP-ß-gal fusion constructs containing

candidate NLS regions, fixed at 48 hours post transfection and subjected to immunofluorescence analyses. Cell nuclei were counterstained with DAPI highlighting the intracellular localization of the fusion proteins.

Results - 45 -

residues 164-198 and 190-213 were analyzed in parallel. The entire region 164-213 was able to

confer a pronounced nuclear localization of the fusion protein (Fig. 7 panels 4-6), indicating a

second functional NLS within the N-terminus of pUL97. In an approach to narrow down this

second NLS sequence, a construct containing residues 164-198 showed a complete cytoplasmic

localization (Fig. 7 panels 7-9), whereas residues 190-213 were sufficient for nuclear import of

the fusion protein (Fig. 7 panels 10-12). Thus, a second NLS sequence (NLS2) of pUL97 was

identified between residues 190-213. Strikingly, the multiple sequence alignment described in E-

1.3 showed a high conservation of both, NLS1 and NLS2 within HCMV isolates. Only one coding

variation at amino acid position 19 (Q19E) was present in 6 out of 47 sequences (Fig. S1,

Appendix).

E-2.5 Impairment of nuclear import after deletion of NLS1/NLS2

To analyze the importance of the two identified NLS sequences for nuclear translocation of

pUL97, NLS deletion mutants containing a C-terminal fusion fragment of ß-gal were generated.

HeLa cells were transiently transfected with these constructs and the nucleocytoplasmic

distribution pattern of the pUL97 mutants was determined by immunofluorescence analysis as

described in E-2.2. Precise illustration of the main phenotypes of all analyzed NLS deletion

mutants are depicted in Figure 8A. Deletion of the NLS1 sequence resulted in a highly reduced

nuclear translocation of pUL97, with 58 % of cells showing nucleocytoplasmic and 42 % of cells

showing exclusive cytoplasmic distribution (Fig. 8A panels 1-8; 8B). In comparison, the

percentage evaluation of the NLS2 deletion mutant depicted only 49 % nucleocytoplasmic, 11 %

cytoplasmic and still 40 % nuclear localization of pUL97 (Fig. 8A panels 9-16; 8B). Thus, in this

system, NLS1 exhibited a stronger overall nuclear import efficiency than NLS2. As a next step,

the simultaneous deletion of both NLS sequences led to a more drastic impairment of nuclear

translocation of pUL97. Besides 82 % of cytoplasmic signals, only residual 16 %

nucleocytoplasmic and 2 % nuclear signals were detectable for the NLS1/NLS2 deletion mutant

(Fig. 8A panels 17-20; 8B). This indicated that the two identified NLS sequences are important

determinants for nuclear import of pUL97. However, it was still a remarkable point that some

residual nuclear localization could be detected. This might result from interaction of this pUL97

NLS mutant with cellular nuclear proteins (i.e. interaction-mediated nuclear import). Moreover,

the specific significance of NLS2 for nuclear translocation of the N-terminally truncated isoforms

M74 and M157 was demonstrated. A construct abrogating isoform M1 expression and thereby

lacking NLS1 showed an exclusive cytoplasmic staining after NLS2 deletion (Fig. 8A panels 21-

24; 8B). This indicated that the nuclear translocation of isoforms M74 and M157 is mostly

dependent on the presence and activity of NLS2. Thus, in summary, NLS1 and NLS2 are

differentially active and essential for the nuclear import regulation of the pUL97 isoforms.

Results - 46 -

FIGURE 8. Significance of NLS1 and NLS2 for nuclear translocation of pUL97. (A) NLS deletion mutants C-

terminally fused to ß-gal (inserted scheme) were plasmid-transfected into HeLa cells, which were fixed on coverslips at 48 hours post transfection and subjected to indirect immunofluorescence analyses using the indicated antibodies. Cell nuclei were counterstained with DAPI and used to determine the intracellular distribution of the fusion proteins. Representative microscopic images are depicted. (B) Quantitative evaluation of the analyzed cells showing predominant nuclear (blue), nucleocytoplasmic (green) or cytoplasmic (red) localization of the fusion proteins.

E-2.6 Properties of the NLS-mediated nuclear import pathway

E-2.6.1 Interaction between importin and NLS-peptides of pUL97

In general, bipartite NLS sequences act through the classical importin / pathway to provide

nuclear translocation of their cargo proteins. The two identified NLS sequences within pUL97

both belong to the bipartite-type of nuclear translocation elements. Thus, the ability of NLS1 and

Results - 47 -

NLS2 to directly interact with the adaptor molecule importin was investigated. In cooperation

with Andrea Groß, Jutta Eichler (Department Medicinal Chemistry, Erlangen, Germany), Sara

Solbak and Torgils Fossen (Centre of Pharmacy and Department of Chemistry, Bergen,

Norway), synthetic pUL97 peptides were constructed and surface plasmon resonance (SPR)

analyses were performed to study potential protein-peptide interactions. For this purpose,

recombinant expressed human importin was immobilized on CM5 sensor chips to 1000 or

10000 response units (RU) and specific peptide-binding was analyzed over a range of 2-10 µM.

Strikingly, peptides comprising relevant parts of NLS1 or NLS2 were able to interact with

importin , whereas peptides without the respective NLS regions did not show any binding

response (Fig. 9). The strongest interaction was detectable for a peptide spanning the entire

NLS1 sequence between pUL97 residues 6-35 [Pep97(6–35)] (Fig. 10A). N-terminal truncation

of 10 amino acids [Pep97(16–35)] or 21 amino acids [Pep97(27–35)] resulted in a highly

reduced importin binding (Fig. 10A). These results point to the fact that the bipartite structure

of NLS1 (6RSRAR10 and 27RRPSRARRR35) mediates a pronounced interaction with importin ,

whereas lack of one cluster of basic residues decreases the binding response drastically.

Concerning the bipartite-type NLS2 (190RGGRKR195 and 211RRR213), a peptide comprising the

FIGURE 9. Schematic overview of synthetic pUL97 peptides and their ability to interact with importin .

Positions and amino acid sequences of NLS1 and NLS2 as well as a summary of the obtained SPR data for importin

interaction with synthetic pUL97 peptides are indicated. -, no interaction; +, interaction; +/-, low interaction; n.s., not soluble; n.d., not determined.

Results - 48 -

FIGURE 10. SPR analyses demonstrating the ability of pUL97 NLS-peptides to interact with importin .

Synthetic pUL97 peptides containing NLS1 (A) or NLS2 (B) regions were injected at concentrations ranging from 2-

10 µM over a CM5 sensor chip immobilized to 10000 response units (RU) with human importin . The obtained sensorgrams were fitted to a 1:1 Langmuir ligand-binding model using the Biacore evaluation software.

Results - 49 -

entire NLS sequence [Pep97(190-213)] was able to interact in similar quantity as NLS1 (Fig.

10B). Moreover, deletion of 5 residues from the N-terminus of NLS2 [Pep97(195-213)]

diminished importin binding (Fig. 10B), indicating that likewise both clusters of basic residues

are important for the strong binding efficiency. For the C-terminally truncated peptides

[Pep97(190-198)] and [Pep97(164-198)] only marginal interaction with importin was detectable

(Fig. 10B), suggesting that both peptides contain an insufficient portion of the NLS2 sequence.

To quantify the interaction stoichiometry of the obtained SPR responses, a 1:1 Langmuir binding

model (Rich & Myszka, 2010) was applied and the kinetic constants were calculated (Table 6).

In summary, both NLS1 and NLS2 showed a strong interaction with importin , providing

evidence for a classical importin-mediated nuclear import of pUL97 through two bipartite NLS

sequences.

Table 6. Evaluation of the kinetic constants for a 1:1 Langmuir binding of pUL97 peptides to importin .

pUL97 peptides amino acid sequence

kinetic constants

KD (µM)

ka (x104/Ms)

kd (1/s)

NLS1

Pep97 (6-35)

RSRARSASLGTTTQG WDPPPLRRPSRARRR

0.68±0.02 6.06±0.11 0.041±0.001

Pep97 (16-35)

TTTQGWDPPPLRRPSRARRR 2.33±0.46

6.24±5.81 0.172±0.164

Pep97 (27-35)

RRPSRARRR 5.83±0.60 5.99±0.02 0.349±0.037

Pep97

(16-35_A32L)

TTTQGWDPPPLRRPSRLRRR 6.26±1.49 8.32±0.26 0.517±0.108

NLS2

Pep97

(190-213)

RGGRKRPLRPPLVSLARTPLCRRR n.d. n.d. n.d.

Pep97

(195-213)

RPLRPPLVSLARTPLCRRR n.d. n.d. n.d.

Pep97

(164-198)

RDGDVTSVRRALFTGGSD PSDSVSGVRGGRKRPLR

5.60±2.87 0.32±0.11 0.015±0.003

Pep97

(190-198)

RGGRKRPLR 10.84±2.82 18.06±13.72 1.570±0.977

Results - 50 -

E-2.6.2 Basic amino acids are critical residues for importin binding

A high density of arginine and lysine residues within bipartite-type NLS sequences generally

reflects the importance of basic amino acids. To proof these basic residues as the crucial

determinants for importin binding of pUL97 NLS sequences, further SPR analyses using

synthetic NLS-peptides were performed as described in E-2.6.1. Comparison between an

unmodified peptide and a mutated peptide containing an alanine to leucine exchange at position

32 [Pep97(16-35_A32L)] did not show significant alterations in the importin binding response

(Fig. 10A). In contrast, mutation of one single arginine residue at position 34 [Pep97(16-

35_R34A)] or 35 [Pep97(16-35_R35A)], respectively, resulted in a significant reduction in

importin binding compared to the peptide [Pep97(16-35_A32L)] (Fig. 11). Moreover, a peptide

containing both arginine mutations [Pep97(16-35_R34/35A)] showed an even stronger reduction

in binding (Fig. 11). Similar effects were obtained for peptides containing arginine to alanine

exchanges at positions 31 and 33 (Fig. 9). These results demonstrate that the interaction

between pUL97 NLS sequences and importin is determined by basic amino acids.

FIGURE 11. SPR analyses demonstrating an essential role of basic arginine residues for importin binding.

Synthetic pUL97 peptides containing amino acid substitutions were injected at concentrations ranging from 2-10 µM

over a CM5 sensor chip immobilized to 1000 response units (RU) with human importin .

Results - 51 -

E-2.7 Examination of the relevance of NLS1 and NLS2 in recombinant HCMVs

E-2.7.1 Generation of recombinant HCMVs carrying deletions of NLS1/NLS2

In order to analyze the relevance of NLS1 and NLS2 for nuclear import of pUL97 in the context

of viral replication, recombinant HCMVs carrying deletions in the respective NLS sequences

were generated using two-step traceless BAC mutagenesis (Tischer et al., 2006). For this

purpose, transfer constructs containing a kanamycin resistance cassette and homologous

sequences upstream and downstream of the particular NLS regions were amplified. The PCR

products were inserted into the HCMV BACmid pHB15 via homologous recombination and

positive clones were identified by the kanamycin resistance marker. In a second recombination

step, the coding sequence for the resistance cassette was removed. To verify the BAC

FIGURE 12. Generation of recombinant HCMVs carrying deletions of the NLS sequences of pUL97. (A) Control

agarose gel of the BAC mutagenesis. After each recombination step, BACmid DNA was isolated, digested with the restriction enzyme EcoRI and analyzed by restriction fragment length polymorphism. Successful recombination events were depicted by a mobility shift of one single DNA fragment.

§, first recombination step; *, second recombination step.

(B) Schematic presentation of the established recombinant HCMVs.

Results - 52 -

mutagenesis, restriction fragment length polymorphism of the recombinant HCMVs was

performed. Therefore, BACmid DNA was isolated, digested with the selected restriction enzyme

EcoRI and analyzed via agarose gel electrophoresis. Insertion of the transfer constructs during

the first recombination event resulted in an increased mobility shift of one single DNA fragment

(Fig. 12A highlighted by §). This effect was reversed by deletion of the kanamycin resistance

cassette after the second recombination step (Fig. 12A highlighted by *), indicating a successful

mutagenesis. In addition, the particular gene region of the newly generated recombinant HCMVs

was controlled by standard nucleotide sequencing using BACmid-derived PCR products.

Thereafter, verified BACmids were transfected into HFFs for the reconstitution of infectious

HCMVs and grown to viral stocks. Infectious virus titers were calculated by immunofluorescence

analysis (i.e. counting of IE1-positive cells). Using these methods, recombinant HCMVs with

single deletions of NLS1 or NLS2, respectively, were generated. Furthermore, based on the

NLS1 deletion mutant, a recombinant virus carrying a deletion of both NLS sequences was

established (Fig. 12B).

E-2.7.2 Effect of NLS deletions on the kinetics of viral protein expression

Mutations within the coding sequence of a gene can generally produce multifold effects on the

respective protein synthesis, especially on stability and functionality. Due to the fact that the N-

terminal region of pUL97 resides outside the globular domain, it was supposed that the NLS

deletion mutants should allow stable expression of catalytically active proteins. To analyze the

protein expression pattern of pUL97 versions after NLS1/NLS2 deletion, HFFs were infected

with recombinant HCMVs at a MOI of 0.1, harvested at serial times post infection and used for

Western blot analysis. For all viruses, stable pUL97 products were detectable as early as 4 days

post infection with an increasing protein level over the time course of infection (Fig. 13). The

NLS1 deletion mutant [HCMV UL97( NLS1)] expressed all three pUL97 isoforms and strikingly,

isoform M1 showed a slight deletion-conferred mobility shift (Fig. 13A; additional data not

shown). Deletion of residues 190-213 [HCMV UL97( NLS2)] affected the typical isoform

expression pattern in that it induced the production of several pUL97-specific protein bands,

which were not directly correlated to the three original isoforms (Fig. 13B). A similar effect was

demonstrated for the recombinant virus carrying deletions in both NLS sequences [HCMV

UL97( NLS1/ NLS2)], in particular an expected mobility shift was noted for the upper protein

band representing mutant isoform M1 (Fig. 13C). Furthermore, the influence of NLS-deleted

pUL97 on the expression of viral proteins representing markers for immediate early, early-late

and true late replication stages was investigated. The largely unaffected expression pattern of

IE1p72, pUL44 and pp28 suggested that the typical HCMV gene expression cascade was not

Results - 53 -

abrogated by these NLS mutations (Fig. 13). However, all viral proteins showed to some extent

a delayed expression, particularly prevalent for the phosphoprotein pp28. In conclusion, stable

forms of pUL97 and similar expression kinetics of viral marker proteins were verified for all

recombinant HCMVs carrying NLS1/NLS2 deletions.

FIGURE 13. Protein expression pattern of recombinant HCMVs carrying NLS1/NLS2 deletions.

HFFs were infected at a MOI of 0.1 with recombinant viruses containing NLS1 (A), NLS2 (B) or NLS1/NLS2 (C) deletion within pUL97. Cell lysates were collected 1-7 days post infection and analyzed by Western blot procedures for pUL97 expression in particular and immediate early, early-late and true late gene markers using the antibodies pAb-UL97 (Ulm), mAb-IE1, mAb-UL44 and mAb-pp28. Cellular ß-actin levels served as a control for equal protein loading.

Results - 54 -

E-2.7.3 Altered nucleocytoplasmic distribution of pUL97 lacking NLS sequences

In a next step, the impact of NLS sequences on the intracellular distribution of pUL97 was

determined by immunofluorescence analysis of cells infected with the generated recombinant

HCMVs. Since NLS1/NLS2 deletion showed a marked impact on the nuclear import efficiency of

pUL97 in transfection experiments (E-2.5), it was supposed to detect similar alterations in the

localization pattern of pUL97 in cells infected with recombinant HCMVs. Interestingly, deletion of

NLS1 [HCMV UL97( NLS1)] resulted in a predominant nuclear accumulation of pUL97 at early

and late time points of infection (Fig. 14 panels 1-9). This characteristic phenotype was similarly

detectable for the NLS2 deletion virus [HCMV UL97( NLS2)] (Fig. 14 panels 10-18). The

residual cytoplasmic signals, however, were more pronounced in the absence of NLS1 than

NLS2. This observation was in accordance with the results described for transiently transfected

cells (E-2.5), supporting the notion of a stronger influence of NLS1 on the nuclear translocation

FIGURE 14. Impact of the presence of NLS1 and NLS2 on nuclear translocation of pUL97 during the time course of HCMV replication.

HFFs were infected with recombinant viruses containing a single or double deletion of the pUL97 NLS regions, respectively. At 24, 48 and 72 hours post infection, the cells were fixed on coverslips, immunostained with the pAb-UL97 (Boston) antibody and analyzed by confocal laser-scanning microscopy. Cell nuclei were counterstained with DAPI.

Results - 55 -

of pUL97 than NLS2. However, the effect in HCMV-infected HFFs was less pronounced than

seen for NLS deletion in transfection experiments. Strikingly, deletion of both NLS sequences

[HCMV UL97( NLS1/ NLS2)] reduced the nuclear import of pUL97 drastically (Fig. 14 panels

19-27). The majority of signals appeared in the cytoplasm. Only residual nuclear signals were

detectable, especially late in infection, accumulating to higher amounts within viral replication

compartments (Fig. 14 panel 26). The marginal translocation of pUL97 into the nucleus was

likely due to NLS-carrying interaction partners, providing an indirect nuclear import mechanism

for pUL97. Taken together, confocal laser-scanning microscopy with samples from HCMV-

infected HFFs revealed that deletion of one single NLS was highly compensated by the second

NLS sequence. In contrast, deletion of both NLS1 and NLS2 drastically altered the intracellular

distribution of pUL97 towards a broader localization pattern comprising signals within the

cytoplasm and viral replication compartments.

E-2.7.4 Replication defect of the recombinant HCMV lacking NLS1 and NLS2

To determine the specific replication characteristics of the recombinant HCMVs carrying

NLS1/NLS2 deletions, multistep growth curve analyses were performed. Therefore, supernatant

samples were collected from HCMV-infected HFFs at serial time points post infection, the DNA

was isolated from viral particles and a specific IE1 gene region was amplified by quantitative

real-time PCR to measure viral genomic equivalents. The obtained growth curves were depicted

in a logarithmic scale. Comparison of the parental strain AD169 with the three NLS deletion

viruses revealed that neither NLS1 nor NLS2 deletion alone affected viral replication to a marked

extent. In contrast, simultaneous deletion of both NLS sequences impaired the production of

viral particles significantly (Fig. 15). Replication of the recombinant HCMV UL97( NLS1/ NLS2)

was 100-fold decreased towards the control and this reduction was MOI-independent, since the

FIGURE 15. Effects of pUL97 NLS1/NLS2 deletion on HCMV replication. HFFs were infected in parallel with

parental strain AD169 and recombinant HCMVs carrying NLS deletions (MOIs indicated). At serial time points post infection supernatants were collected, followed by viral DNA extraction and quantitative real-time PCR amplification of an IE1 gene region to monitor viral genomic equivalents. Mean values and standard deviations were derived from three independent experiments.

Results - 56 -

effect was similar for low (0.01) and high (0.1) MOIs. At late time points of higher MOI infections

(0.1), a maximum of 106 viral genomic equivalents was measured. In this case, the growth curve

of the NLS1/NLS2 deletion mutant finally reached this plateau of control values. The drastic

replication defect after deletion of both NLS sequences, compared to a mostly normal replication

characteristic of single NLS deletion viruses UL97( NLS1) and UL97( NLS2), were consistent

with data obtained for pUL97 intracellular distribution. Particularly, the reduced nuclear

translocation of pUL97, lacking both NLS1 and NLS2, was outstanding and supported the idea

that the regular nuclear import of pUL97 is crucial for HCMV replication.

E-3 Functional aspects of pUL97 isoforms

E-3.1 Generation of recombinant HCMVs expressing individual isoforms

As described above, three pUL97 isoforms are expressed during HCMV replication from

alternative translation initiation sites M1, M74 and M157 (E-1). In order to characterize functional

differences between these isoforms, recombinant HCMVs were generated to express individual

isoforms during viral replication. First, a recombinant pHB15-derived BACmid containing deletion

of the entire UL97 gene region was constructed using the two-step traceless BAC mutagenesis

procedure described in E-2.7.1. This intermediate step was required to avoid unspecific

recombination events between identical UL97 fragments of the transfer constructs and the viral

genome. Based on this BACmid, the sequences of C-terminally tagged versions of normal or

mutant pUL97 were inserted into the viral genomic backbone. To this end, transfer vectors

containing the relevant site-specific mutations, the epitope tag, a kanamycin resistance cassette

and homologous sequences for specific BAC mutagenesis were constructed. The respective

fragments were amplified and used for the two-step traceless mutagenesis of BACmids.

Successful recombination events were monitored by restriction fragment length polymorphism of

the single BACmids and standard nucleotide sequencing of the inserts (Fig. 16A). For virus

reconstitution, HFFs were transfected with the verified BACmid DNA, and viral stocks were

grown and titrated. Thus, three C-terminal epitope-tagged recombinant HCMVs were generated

(Fig. 16B): (i) one HA-tagged control virus, expected to express all isoforms, (ii) one mutant virus

containing a methionine to leucine exchange within the first ATG start codon M1, expected to

express isoforms M74 and M157, and (iii) one Flag-tagged recombinant HCMV containing

mutations within the ATG start codons M38, M74, M111 and M157, expected to show exclusive

expression of isoform M1. In addition, the untagged recombinant HCMVs UL97(M1L) and

UL97(157-707), the latter representing a pUL97 deletion virus starting at position M157 for

individual analysis of isoform M157, were kindly provided by our cooperation partner Sunwen

Chou.

Results - 57 -

FIGURE 16. Generation of recombinant HCMVs for the individual expression of pUL97 isoforms. (A) Control

agarose gel showing a DNA fragment analysis of the BACmid mutagenesis. After each recombination step, BACmid DNA was isolated, digested with the restriction enzyme EcoRI and analyzed by restriction fragment length polymorphism. Successful recombination events were depicted by a mobility shift of one single DNA fragment.

§, first

recombination step; *, second recombination step. (B) Schematic presentation of the established recombinant HCMVs.

E-3.2 Influence of pUL97 isoforms on HCMV protein expression kinetics

To proof the supposed pUL97 expression pattern of the generated recombinant HCMVs,

Western blot analyses using samples of HCMV-infected HFFs were performed. Strikingly, all

viruses showed the expected formation of pUL97 isoforms (Fig. 17). Concerning HCMV UL97-

HA, all three isoforms were detectable, indicating that the C-terminal epitope tag did not impair

isoform expression (Fig. 17 lane 2; Fig. 18A). Direct comparison with the AD169 control depicted

a slight mobility shift of all isoforms, representing an increased molecular weight of the HA-

tagged proteins (Fig. 17 lane 1 and 2; Fig. 18A). As expected, HCMV UL97(Mx4)-F, containing

methionine exchange mutations at positions 38, 74, 111 and 157, showed a pronounced

expression of isoform M1 (Fig. 17 lane 3; Fig. 18B). However, an additional smaller product was

slightly detectable on Western blots, likely as a result of protein degradation or even non-ATG

translational initiation. Strikingly, mutation of the first methionine [HCMV UL97(M1L)-HA]

abrogated formation of the full-length isoform M1, but allowed expression of the N-terminally

Results - 58 -

truncated isoforms M74 and M157 (Fig. 17 lane 4; Fig. 18C). The mutant virus UL97(157-707)

showed the exclusive expression of isoform M157 (Fig. 17 lane 5). Due to the fact that pUL97 is

a pluripotent regulator also involved in viral gene expression, further Western blot analyses were

performed to monitor the impact of the individual isoforms on the expression pattern of

immediate early (IE1p72), early-late (pUL44) and true late (pp28) proteins. Generally, the

recombinant viruses UL97-HA, UL97(Mx4)-F and UL97(M1L)-HA showed a wild-type-like protein

expression kinetics of the HCMV replication markers (Fig. 18A-C lanes 1-9). The immediate

early protein IE1p72 was already detectable 1 day post infection, whereas pUL44 showed the

characteristic early kinetic and pp28 true late kinetics. Moreover, the obtained protein levels of

the recombinant viruses and the control AD169 were absolutely comparable (Fig. 18A-C lanes

10-12). Accordingly, the performed Western blot analyses verified individual isoform expression

of established recombinant HCMVs and proofed the typical expression kinetics of significant

HCMV proteins.

FIGURE 17. Individual pUL97 isoforms expressed by recombinant HCMVs. At 5 days post infection cell lysates of

HCMV-infected HFFs (MIO of 0.1) were collected and subsequently subjected to Western blot analysis. Detection of pUL97 isoforms was achieved by the use of the polyclonal antibody pAb-UL97 (Ulm). Cellular ß-actin levels served as a loading control.

Results - 59 -

FIGURE 18. Effects of individual pUL97 isoforms on the protein expression pattern of HCMV. HFFs were

infected at a MOI of 0.1 with recombinant viruses expressing tagged pUL97 in its full-length form (A) or with mutations at the ATG start codons M38, M74, M111 and M157 (B) or M1 (C), respectively. Cell lysates were collected at the time points indicated and subsequently subjected to Western blot analyses. Expression of pUL97 and immediate early, early-late and true late marker proteins was monitored using the antibodies pAb-UL97 (Ulm), mAb-IE1, mAb-UL44 and mAb-pp28. Protein levels detected 7 days post infection were compared to that of AD169 and cellular ß-actin were detected to control equal protein loading.

E-3.3 Differential localization pattern of individual isoforms

To determine the intracellular localization of the individual isoforms, HFFs were infected with the

generated recombinant viruses, fixed on coverslips and analyzed by confocal laser-scanning

microscopy. As expected, HCMV UL97-HA depicted the characteristic predominant nuclear

Results - 60 -

distribution of wild-type pUL97 (Fig. 19 panels 1-9). At late times post infection a distinct

accumulation within the viral replication compartments and marginal cytoplasmic pUL97 signals

were clearly detectable (Fig. 19 panels 8b and c). Interestingly, HCMV UL97(Mx4)-F, expressing

predominantly isoform M1, showed a similar localization pattern (Fig. 19 panels 10-18),

indicating that the nuclear translocation of isoform M1 is not significantly altered in the absence

of isoforms M74 and M157. Moreover, a closer examination revealed a slight increase of pUL97

signals at the periphery of viral replication compartments (Fig. 19 panel 17b). In contrast, HCMV

UL97(M1L)-HA, abrogating isoform M1 expression, showed a reduced nuclear accumulation of

pUL97 signals (Fig. 19 panels 19-27). During early stages of HCMV replication pUL97 was

concentrated within viral replication compartments, but was not distributed throughout the

nucleus. At later times of infection an additional cytoplasmic localization was detectable (Fig. 19

panel 26c), illustrating that isoforms M74 and M157 are inefficiently transported into the nucleus.

This phenotype was confirmed by the recombinant HCMV UL97(M1L), expressing untagged

versions of isoforms M74 and M157 (Fig. 19 panels 28-30). Using the polyclonal antibody

against pUL97 no specific signals were detectable for the individually expressed isoform M157

[HCMV UL97(157-707)] (data not shown). Strikingly, the isoform-specific compartmentalization

of pUL97 in infected cells was in accordance with the differential localization pattern obtained in

transfection experiments (E-2.2). In conclusion, these results demonstrate that during HCMV

replication the nuclear translocation of the individual pUL97 isoforms is differentially regulated.

Results - 61 -

FIGURE 19. Intracellular localization of the pUL97 isoforms during the time course of HCMV replication. HFFs

were infected with recombinant viruses expressing individual pUL97 isoforms, fixed on coverslips at 24, 48 and 72 hours post infection and subjected to indirect immunofluorescence analyses. The polyclonal antibody pAb-UL97 (Boston) was used to detect pUL97-specific signals, followed by counterstaining of the cell nuclei with DAPI. Inset images represent enlargements of predominant nuclear (inset nuc) or cytoplasmic (inset cyt) areas, respectively.

E-3.4 Replication defect of a recombinant HCMV exclusively expressing

isoform M157

Next, the impact of each isoform on HCMV replication was addressed by multistep growth curve

analysis of the recombinant viruses as described in E-2.7.4. Similar replication efficiencies were

detected for HCMV UL97-HA and the positive control AD169, excluding a major disturbing effect

of the inserted epitope tag. Interestingly, a remarkable replication defect was detectable for

exclusive expression of isoform M157, whereas the expression of isoforms M1 and M74

correlated with wild-type kinetics (Fig. 20). In particular, replication of HCMV UL97(157-707) was

approximately 10-fold decreased compared to the positive control AD169 and this reduction

occurred in a MOI-independent manner. On the contrary, HCMV UL97(Mx4)-F and UL97(M1L)-

HA exerted no measurable impairment in viral replication, suggesting that the existence of full-

length isoform M1 is sufficient but not necessary for efficient HCMV replication. Moreover, this

finding pointed to the fact that expression of isoform M74 is able to compensate the lack of

isoform M1. Alternative growth curve analyses using an established SEAP reporter assay

confirmed the reduced replication efficiency when isoform M157 was exclusively expressed in

HFF and HEL cells. This reduction was less pronounced for HCMV UL97(157-707) than for a

Results - 62 -

catalytically inactive mutant virus (Webel et al., 2014; data not shown). Taken together, the

expression of either isoform M1 or M74 is required for normal HCMV replication, but isoform

M157 alone is not sufficient to provide wild-type-like viral replication.

FIGURE 20. Effects of individual isoform expression on HCMV replication. The replication characteristics of

recombinant HCMVs expressing individual pUL97 isoforms were analyzed in comparison to the wild-type strain AD169. After infection of HFFs with the respective viruses at a MOI of 0.01 or 0.1, respectively, supernatants were collected at the time points indicated, viral DNA was extracted and subsequently subjected to quantitative real-time PCR amplification of an IE1 gene region. The obtained viral genomic equivalents were depicted in a logarithmic diagram showing standard deviations from three independent experiments.

E-3.5 Differences between isoforms concerning properties of protein-protein

interactions

A crucial point for the functionality of pUL97 is the efficient interaction with various substrate

proteins. To determine potential isoform-specific properties of protein-protein interaction,

coimmunoprecipitation (CoIP) analyses using recombinant HCMVs were performed. To this end,

HFFs were infected at a MOI of 0.1, harvested 5 days post infection, and the individually

expressed isoforms were precipitated with a polyclonal antibody directed against pUL97. As

expected for the wild-type controls AD169 and HCMV UL97-HA, expression of all three isoforms

allowed a distinct coprecipitation of the known viral interaction partners pUL44 and pp65 (Fig. 21

lanes 2 and 3). A comparable interaction potential was detectable for HCMV UL97(Mx4)-F,

expressing almost exclusively isoform M1 (Fig. 21 lane 4), and for HCMV UL97(M1L)-HA

abrogating formation of isoform M1 (Fig. 21 lane 5). However, a slight variation in the binding

affinities of the individually expressed isoforms to their substrate proteins was observable. For

HCMV UL97(157-707), only a faint protein band for pUL44 and pp65 was detectable after an

elongated exposure time, depicting a highly reduced binding of isoform M157 to both viral

proteins (Fig. 21 lane 6). Since the interaction site for pUL44 was mapped to amino acids 366-

459 (Marschall et al., 2003; Krosky et al., 2003), such a decrease in the ability to bind pUL44

was not expected. The respective expression and precipitation controls identified equal levels of

protein, so that the detected alterations in protein-protein interaction were considered as

Results - 63 -

significant. Furthermore, the lack of background signals demonstrated a high specificity (Fig. 21

lanes 1 and 7). Thus, this CoIP analysis revealed that isoforms M1 and M74 were both able to

interact efficiently with the viral proteins pUL44 and pp65, whereas isoform M157 showed only a

weak interaction with both substrates.

FIGURE 21. Interaction of pUL97 isoforms with known interaction partners. HFFs were infected at a MOI of 0.1

with AD169 or recombinant HCMVs expressing individual pUL97 isoforms. Cell lysates were collected 5 days post infection and pUL97 was specifically precipitated using the polyclonal antibody pAb-UL97 (Boston). Expression control and CoIP samples were examined by Western blot analysis using pAb-UL97 (Ulm), mAb-UL44 or mAb-pp65, respectively. Precipitation without any antibody and mock-infected cells served as specificity controls.

E-3.6 Reduced in vitro kinase activity of isoform M157

The described differences in protein-protein interaction comparing pUL97 isoforms suggested an

isoform-specific phosphorylation of single substrates. To determine the phosphorylation of

coprecipitated interaction partners as well as the autophosphorylation of each pUL97 isoform,

combined CoIP-in vitro kinase assays (IVKA) were performed. For this purpose, HCMV-infected

HFFs (MOI of 0.1) were lysed 5 days post infection and individual isoforms were precipitated

using a polyclonal antibody against pUL97. All samples were incubated with the radioactive

isotope P33 and labeled proteins were subsequently detected by SDS-PAGE and

autoradiography. The positive controls AD169 and HCMV UL97-HA showed a strong

autophosphorylation of isoform M1 and a pronounced pp65 substrate phosphorylation. Isoforms

M74 and M157 were precipitated and phosphorylated to a smaller amount than isoform M1 (Fig.

22A lanes 1 and 2). Analysis of HCMV UL97(Mx4)-F demonstrated an almost exclusive

expression and precipitation of isoform M1 with a phosphorylation pattern comparable to that of

Results - 64 -

FIGURE 22. In vitro kinase activity of pUL97 isoforms. Auto- and substrate phosphorylation was detected using

material from infection experiments (A-C) and transfection experiments (D). HFFs were infected with the indicated viruses at a MOI of 0.1 or transfected with pUL97 mutants. Cell lysates were collected 5 days post infection or 2 days post transfection, respectively, followed by specific immunoprecipitation of pUL97 with the indicated antibody pAb-UL97 (Boston) or the peptide antiserum pAb-UL97-Pep(aa1-16). In vitro kinase assays were performed and the

radioactive labeled proteins were subsequently detected by SDS-PAGE and autoradiography. Combined CoIP/IVKA experiments were used to analyze coprecipitated substrate proteins, whereas exogenous addition of histone proteins were determined in single IVKA preparations. Protein expression and precipitation levels were controlled by Western blot analyses using pAb-UL97 (Ulm) and mAb-pp65. Cellular ß-actin was used as a control for protein input levels.

Results - 65 -

the positive controls (Fig. 22A lane 3). This observation was substantiated by an additional

CoIP-IVKA experiment using a peptide antibody directed against the first 16 amino acids of

pUL97 that specifically binds to the N-terminus of isoform M1 (Fig. 22C). HCMV UL97(M1L)-HA

expressed only marginal amounts of isoform M157, but showed a strong autophosphorylation of

isoform M74 and kinase activity towards pp65 (Fig. 22A lane 4). Interestingly, exclusive

expression of isoform M157 [HCMV UL97(157-707)] depicted a reduced auto- and pp65

substrate phosphorylation (Fig. 22A lane 5). Since the analyzed isoforms were expressed and

precipitated to similar amounts (Fig. 22A lanes 1-5) and no background signals were detected

for uninfected cells (Fig. 22A lane 6), the observed decrease in the autophosphorylation activity

of isoform M157 was considered as specific. The reduced substrate phosphorylation capacity of

isoform M157, however, may have resulted from a weaker coprecipitation of pp65. An

independent IVKA experiment using RIPA buffer for cell lysis and precipitation instead of CoIP

buffer confirmed these results (data not shown). Furthermore, this IVKA approach was utilized to

investigate the phosphorylation of an exogenous substrate protein. The addition of the histone

mix H1-4 prior to the in vitro kinase reaction demonstrated only a residual phosphorylation level

for isoform M157 (Fig. 22B lane 5) compared to the strong histone substrate phosphorylation

detected for isoforms M1 and M74 (Fig. 22B lanes 1-4). Thus, isoforms M1 and M74 exhibited

normal kinase activity in terms of auto- and substrate phosphorylation, whereas isoform M157

showed a highly reduced phosphorylation capacity. Additional IVKA analyses were performed

using material from transfected 293T cells. Again, a decreased auto- and histone substrate

phosphorylation was obtained for isoform M157, albeit the effect was less pronounced in

transfection than in infection experiments (Fig. 22D).

Discussion - 66 -

F Discussion

F-1 Regulation of the nuclear localization of HCMV protein

kinase pUL97

F-1.1 A pronounced nuclear accumulation of pUL97 is important for its

biological function

Previous publications showed that pUL97 is transported into the nucleus directly upon infection

and accumulates to high amounts during the course of viral replication (Michel et al., 1996; Gill

et al., 2012). However, the mechanism underlying this pronounced nuclear translocation has not

been elucidated so far. Experimental results from Michel et al. (1998) suggested an involvement

of the N-terminal part of pUL97, but the exact sequence motifs conferring nuclear import still

remained undetermined. Thus, an important aspect of the present study was to identify the

determining motifs essential for translocation of pUL97 into the nucleus and to clarify their mode

of action. Using an established NLS mapping system (Sorg and Stamminger, 1999), the

positions of two putative NLS sequences between amino acids 6-35 (NLS1) and 190-213 (NLS2)

were verified. Both, NLS1 and NLS2 were specified as bipartite sequence motifs consisting of

two clusters of basic residues separated by a short linker region. In accordance with previous

assumptions, the NLS sequences reside within the mainly unstructured N-terminal part of

pUL97. Interestingly, such a location directly within unstructured protein regions or in between

two globular domains is a common feature for short linear motifs (Fuxreiter et al., 2007; Neduva

and Russell, 2005). Additional results obtained from secondary structure predictions revealed

that NLS1 is embedded within an alpha-helix (Webel et al., 2011), and NMR experiments

suggested that the spacer region, connecting the two clusters of basic residues, adopted a

flexible random-coil structure (Webel et al., 2012). This organization might provide an optimal

recognition of NLS1 by the appropriate karyopherin. Since bipartite NLS sequences typically act

through the classical importin / pathway to mediate nuclear translocation of their cargo

proteins (Weis K., 1998), surface plasmon resonance (SPR) analyses were performed to

investigate the interaction between synthetic NLS-peptides and importin . The results indicated

that both NLS sequences were able to specifically interact with importin and that the basic

amino acids were essential for interaction. Thus, nuclear translocation of pUL97 was supposed

to occur via the classical importin / -mediated pathway. The specific interaction with

karyopherins might be fine-regulated by site-specific phosphorylation within or nearby the NLS

sequences. Remarkably, a recent publication from Alvisi et al. (2011) showed that nuclear import

of the viral DNA polymerase processivity factor pUL44, which represents a pUL97 substrate, is

regulated by complex phosphorylation events. Albeit several phosphorylation sites were

Discussion - 67 -

described for pUL97 adjacent to NLS1 and NLS2, no regulatory effects were detectable so far.

Even independent from such putative phosphorylation sites, the combined data indicate that the

pronounced nuclear accumulation of pUL97 is basically regulated by two distinct N-terminal NLS

sequences.

Since various functional roles of pUL97 have been shown to be mainly nuclear (Prichard M.

N., 2009; Lee and Chen, 2010; Marschall et al., 2011), an efficient nuclear import was

considered to be a prerequisite for its biological functionality. Thus, deletion of the NLS

sequences was supposed to impair nuclear translocation of pUL97 and thereby to exert a broad

influence on HCMV replication. Experiments performed in the present study revealed that

deletion of NLS1 affected the nuclear import efficiency of pUL97 more drastically than deletion of

NLS2. Moreover, while NLS1 was shown to be evolutionary conserved among pUL97 homologs

from human and simian CMVs, the conservation of NLS2 was restricted to HCMV strains (Webel

et al., 2011). Against this background, the development of a second NLS sequence reflects an

adaptation of human CMVs and might indicate a special role of NLS2 for the fine-regulation of

nuclear translocation of pUL97. Interestingly, growth curve analysis of recombinant HCMVs

demonstrated that deletion of either NLS1 or NLS2 maintained a wild-type-like viral replication,

pointing to the fact that both NLS sequences are functional and can substitute for each other.

Simultaneous deletion of NLS1 and NLS2 drastically reduced nuclear import of pUL97.

However, a residual accumulation within viral replication compartments was still detectable,

suggesting an NLS-independent nuclear transport mechanism that is most probably mediated by

an NLS-bearing interaction partner. A promising candidate might be the viral DNA polymerase

processivity factor pUL44 that is translocated into the nucleus through the classical importin /

pathway and accumulates together with pUL97 within viral replication compartments (Alvisi et

al., 2005; Marschall et al., 2003). Interestingly, deletion of both NLS sequences resulted in a

severe replication defect of HCMV about a factor of 100. Due to the fact that the expression

pattern of immediate early, early and true late marker proteins were not affected by deletion of

NLS1 and NLS2, the decreased efficiency of HCMV replication could be attributed to the

reduced nuclear import of pUL97. Consequently, it was assumed that the biological functionality

of pUL97 is strongly linked to its predominant nuclear localization. Moreover, it is noteworthy that

an even more drastic reduction of HCMV replication was described for deletion of the entire ORF

UL97 (100 to 1000-fold; Prichard et al., 1999). This finding strengthened the argumentation that,

although some cytoplasmic functions might have accessory importance, the main regulatory

functions of pUL97 are linked to the nucleus.

Discussion - 68 -

F-1.2 Isoform-specific aspects of nuclear localization of pUL97

A novel finding of the present study was that pUL97 is expressed in three individual isoforms.

Interestingly, NLS1 is only contained within the full-length isoform M1, but lacks in the N-

terminally truncated isoforms M74 and M157 (Fig. 23). Based on this fact, it was suggested that

their nuclear translocation is regulated in an isoform-specific manner. Indeed,

immunofluorescence analysis of plasmid-transfected cells as well as HCMV-infected cells

illustrated a reduced nuclear import of isoforms M74 and M157 compared to isoform M1.

Especially during late stages of HCMV replication, a pronounced cytoplasmic localization of the

two smaller isoforms was detectable, indicating that NLS2 was not sufficient to confer complete

nuclear translocation. One explanation for this observation is given by bioinformatics data,

providing evidence for an altered surface accessibility of the NLS sequences within the individual

isoforms. While NLS1 and NLS2 were well accessible for importin in the full-length isoform M1,

a reduced NLS2 accessibility was predicted for an N-terminally truncated construct (Webel et al.,

2012). Remarkably, deletion of NLS2 within isoforms M74 and M157 completely abolished their

nuclear import in transfection experiments. Against this background, the intracellular distribution

of the individual isoforms of pUL97 was assumed to be fine-regulated by the two NLS

sequences. Interestingly, it has been published that also the HSV-1 thymidine kinase is

expressed in three individual isoforms (Haarr et al., 1985; Marsden et al., 1983). Reminiscent to

the situation demonstrated for pUL97, the two N-terminally truncated versions of the HSV-1

thymidine kinase also lack an NLS sequence (Degrève et al., 1998, 1999). The particular

consequences for their intracellular distribution and functionality, however, have not been

described yet. A publication by Goldberg et al. (2011) recently showed that pUL97 is involved in

several steps of cytoplasmic secondary envelopment. Due to their additional cytoplasmic

accumulation, isoforms M74 and M157 might play so far undefined roles in these late maturation

steps.

FIGURE 23. Schematic overview of the individual pUL97 isoforms. The

translation initiation site of each isoform, the positions of NLS1, NLS2 as well as the kinase domain and several interaction sites are highlighted.

Discussion - 69 -

F-2 Relevance of different isoforms of pUL97 for HCMV replication

F-2.1 The expression of isoforms is a special feature of HCMV

Recently, it has been suggested by our working group that pUL97 is expressed in more than one

isoform (Schregel et al., 2007; Marschall et al., 2003). Here, it was demonstrated for the first

time that three distinct isoforms of pUL97 are generated during HCMV infection. Western blot

analyses of the laboratory strain AD169 revealed that each isoform is expressed with early-late

kinetics. The most abundant protein band was isoform M1 possessing a molecular weight of

approximately 100 kDa. Isoform M74 (approx. 80 kDa) and isoform M157 (approx. 70 kDa) were

expressed to lesser extents and differed in their detectability. Similar expression pattern showing

the existence of three individual isoforms of pUL97 were also demonstrated for clinical virus

isolates, suggesting that isoform formation is a common and important feature of HCMV. The

possibility that either mRNA splicing or a posttranslational modification, i.e. phosphorylation or

proteolytic cleavage, is responsible for the generation of pUL97 isoforms has been excluded by

several lines of experimental evidence (Webel et al., 2011). An outstanding characteristic of the

ORF UL97 is the presence of five in-frame ATG start codons at positions M1, M38, M74, M111

and M157. Based on this fact, isoform formation was assumed to result from alternative initiation

of translation. A series of transfection experiments provided evidence that isoform M1 was

expressed from the first ATG start codon and that the third in-frame ATG start codon was

responsible for the generation of isoform M74. Moreover, infection experiments with viral

mutants confirmed this point and suggested that isoform M157 initiates at the fifth in-frame ATG

start codon. Remarkably, the detection of isoform M157 in transfection experiments was often

limited, suggesting that an additional viral factor is necessary for efficient initiation at the M157

start codon. Attempts to verify the isoform-specific ATG start codons by Edman

microsequencing failed, probably because the N-terminal amino acids of the single isoforms

were not accessible to sequencing due to a posttranslational modification (Webel et al., 2011).

Interestingly, multiple sequence alignments revealed that all five in-frame ATG start codons were

highly conserved throughout clinical virus isolates as well as laboratory-adapted strains of

HCMV. However, the initiation sites M74 and M157 were evolutionary not conserved among

animal CMVs (Webel et al., 2011). Moreover, it has been shown that rodent homologs of pUL97,

i.e. rat pR97 and mouse pM97, only express isoform M1 (Romaker et al., 2006; unpublished

data). Against this background, it is highly suggestive that the formation of three isoforms is

restricted to human CMVs. Since isoform formation has neither been described for other

herpesviral homologs, pUL97 was the first conserved herpesviral protein kinase for which

expression of different isoforms was shown.

Discussion - 70 -

F-2.2 Specific replication characteristics of recombinant HCMVs expressing

individual isoforms

An important aspect of the present study was to determine the influence of the different pUL97

isoforms on HCMV replication. Previous publications demonstrated that pUL97 is a crucial

determinant for cytomegaloviral replication, but does not represent an essential protein for virus

propagation in cultured cells (Marschall et al., 2002; Prichard et al., 1999). Based on this

observation, recombinant HCMVs lacking individual isoforms of pUL97 were assumed to be

viable. For the generation of these pUL97 mutant viruses, an approved method to insert

mutations into a bacterial artificial chromosome (BAC) was applied (Tischer et al., 2006).

Western blot analyses using material from cells infected with these recombinant HCMVs were

carried out to investigate the isoform-specific expression pattern. The results confirmed that

mutation of the first methionine abrogated expression of isoform M1, but not expression of

isoforms M74 and M157, and strengthened the argumentation that the third and the fifth start

codons are utilized for the formation of isoforms M74 and M157, respectively. In addition, it was

demonstrated that the cascade-like expression of viral immediate early, early and true late

proteins was not affected by the lack of a single isoform. However, it has to be mentioned that

simultaneous mutation of M38, M74, M111 and M157 still resulted in the minor expression of a

protein possessing a molecular weight similar to isoform M74. This protein might either

represent a stable degradation product or might be generated by a non-ATG initiation. Notably,

previous publications have been shown that a favorable sequence context contributes to

translational initiation at non-ATG codons by compensating for the weakened anticodon binding

(Chen et al., 2008; Kozak, M., 1989). The recognition of non-ATG codons were supposed to be

strongly stimulated by the formation of a downstream secondary structure (Kozak, M., 1990).

Moreover, it has recently been published that single nucleotide exchanges are partially not

sufficient to abrogate initiation of translation at the appropriate ATG start codons (Chang et al.,

2010). Interestingly, the sequence context of start codon M74, and the fact that pUL97 M74

mutants used in this study were generated by a single alanine to cysteine exchange, pointed to

the possibility that a residual expression of isoform M74 might be initiated at the mutated CTG

site. Furthermore, various growth curve analyses of the recombinant HCMVs individually

expressing pUL97 isoforms indicated an isoform-specific contribution to cytomegaloviral

replication at low and high multiplicities of infection (MOI). The results revealed that isoforms M1

and M74 are sufficient to mediate a wild-type-like replication, whereas exclusive expression of

isoform M157 resulted in a 10-fold decrease in HCMV replication. Thus, it was suggested that

isoform M157 is impaired in its regulatory functionality.

Discussion - 71 -

F-2.3 Interaction profiles of pUL97 isoforms with viral and cellular proteins

The specific interaction between pUL97 and its various viral as well as cellular substrates has

been investigated for several years as described in the introduction. In the present study, CoIP

experiments provided first evidence for a differential interaction profile of the three pUL97

isoforms. While both isoforms M1 and M74 were able to specifically coprecipitate the viral DNA

polymerase processivity factor pUL44 as well as the major tegument protein pp65, isoform M157

showed only a marginal interaction potential to these two pUL97 substrates. Notably, the

interaction site for pUL44 has been mapped by our research group to amino acids 366-459

(Marschall et al., 2003; Fig. 23). Consequently, the entire region for pUL44 binding was still

contained within isoform M157, but apparently not sufficient to enable proper interactions.

Against this background, the CoIP results might indicate that isoform M157 forms a secondary

structure differing to some extent from that of isoforms M1 and M74. Moreover, this individual

structure might be relevant for interaction with other viral or cellular proteins and is possibly

linked to a different functionality of isoform M157. Until now, the exact interaction site for pp65 is

unknown. But strikingly, isoform M157 lacks the N-terminal binding motif for the cellular

retinoblastoma (Rb) protein, which is located between amino acids 149-153 (Fig. 23). Although

two more interaction sites have been postulated in the C-terminal part of pUL97, the potential of

isoform M157 to interact with Rb might be affected and this might also influence its specific

functionality. The determination of further cellular interaction partners of pUL97 was additionally

investigated by high-sensitive mass spectrometry analysis using material from transfected cells.

A series of coprecipitated proteins were suggested to bind pUL97 in an isoform-specific manner,

but a direct attribution of single proteins to an individual isoform was challenging. Promising

candidates were mainly involved in the regulation of replication, transcription and translation

events (unpublished data).

F-2.4 Aspects of fine-regulated kinase activity of pUL97

Autophosphorylation of pUL97 has been described in several publications (Schregel et al., 2007;

Baek et al., 2002; He et al., 1997). In the present study, first evidence is provided that the three

pUL97 isoforms are fine-regulated in their enzyme activity. In vitro kinase assays (IVKA)

performed by the use of material from either plasmid transfected cells or HCMV-infected cells,

confirmed a strong autophosphorylation of isoform M1. A similar extent of autophosphorylation

was detectable for isoform M74 when expressed to high amounts by pUL97 mutants. On the

contrary, the autophosphorylation activity of isoform M157 was strongly reduced. Whether this

difference in the phosphorylation potential of the individually expressed isoforms translates into

downstream functional effects of pUL97 has not been determined so far. Another important

Discussion - 72 -

feature of pUL97 is its ability to specifically phosphorylate various viral and cellular substrates

(Fig. 1). Further IVKA experiments suggested an isoform-specific substrate phosphorylation of

the coprecipitated viral tegument protein pp65 and an exogenously added preparation of purified

histone proteins. Interestingly, isoforms M1 and M74 were able to phosphorylate both pUL97

substrates to similar degrees, whereas isoform M157 showed only reduced phosphorylation

potency. Based on the fact that the histone proteins were added in equal amounts to each

sample prior the IVKA reaction, the obtained reduction in histone phosphorylation was

considered as strictly quantitative. On the other hand, the weak phosphorylation of pp65 by

isoform M157 might also be due to its marginal coprecipitation described in F-2.3. Furthermore,

it has previously been published that pUL97 might possess non-kinase functions, especially in

cytoplasmic secondary envelopment steps, i.e. viral tegumentation and release (Goldberg et al.,

2011). Interestingly, isoform M157 showed a reduced phosphorylation capacity together with a

pronounced cytoplasmic localization pattern at late stages of HCMV replication (F-1.2). Thus, it

seems possible that isoform M157 is involved in such non-kinase functions.

The distinct fine-regulation of the pUL97 kinase activity raised the question, whether the

susceptibility of HCMV to antiviral compounds is also linked to specific isoforms. Intense

research over the last years verified the potential of pUL97 to phosphorylate the nucleoside

analog ganciclovir (GCV) and its prodrug valganciclovir (VGCV). Moreover, the non-approved

drug candidate maribavir (MBV) has been shown to directly inhibit the enzyme activity of pUL97

by competing for the ATP-binding site. A series of publications demonstrated various mutations

within pUL97 that confer resistance to these antiviral compounds (Chou S., 2008; 2010).

Notably, all GCV and MBV resistance mutations identified so far reside to the C-terminal,

catalytic domain of pUL97 (Chou et al., 2012). An influence of the N-terminal part for the

development of antiviral drug resistance has not been described. However, experiments using

recombinant HCMVs individually expressing the full-length pUL97 isoform M1 or the N-terminally

truncated isoforms M74 and M157, respectively, suggested an isoform-specific drug

susceptibility to GCV and MBV (Webel et al., 2014). The expression of either isoform M1 or

isoform M74 was linked to a wild-type-like susceptibility to both antiviral compounds. Exclusive

expression of isoform M157, however, resulted in a low-level resistance of HCMV to MBV, while

the susceptibility to GCV was unaltered compared to the parental virus. Thus, the N-terminal

truncation of 156 amino acids correlates with MBV resistance of isoform M157. One explanation

for this result might be the development of a modified secondary structure, which was suggested

on the basis of CoIP analysis in F-2.3. On the other hand, Gill et al. (2009) have recently been

shown that disruption of the N-terminal retinoblastoma (Rb) binding motif (LRCRE; residues 149-

153), which is involved in the inactivation of Rb, modestly impacts the susceptibility to MBV. In

this regard, it is noteworthy that only isoform M157 lacks this N-terminal Rb binding motif (Fig.

23). Due to its ability to confer MBV resistance, and its exclusive expression in human CMV

Discussion - 73 -

strains, isoform M157 might theoretically have contributed to the failure of MBV in phase III

clinical trials. However, this is just a hypothesis and remains to be investigated in future studies.

Combined, the presented data strongly support the scenario that isoform expression broadens

the repertoire of fine-regulatory properties of pUL97 contributing to the replication efficiency of

HCMV.

Abbreviations - 74 -

G Abbreviations

Ad5 adenovirus type 5 AIDS acquired immunodeficiency syndrome BAC bacterial artificial chromosome ß-gal ß-galactosidase bp base pair(s) CK2 casein kinase 2 CDK cyclin-dependent kinase CDV cidofovir CHPK conserved herpesviral protein kinase CoIP coimmunoprecipitation CPE cytopathic effect CTD C-terminal domain cVAC cytoplasmic viral assembly compartment DAPI 4’,6-diamidino-2-phenylindole DMEM Dulbecco’s modified Eagle medium DMSO dimethyl sulfoxide DNA desoxyribonucleic acid dpi days post infection E early ECL enhanced chemiluminescence EDC 1-ethyl-3-(3-dimethylaminopropyl)-carbodiimide EDTA ethylenediaminetetraacetic acid ER endoplasmatic reticulum E. coli Escherichia coli FCS fetal calf serum GCV ganciclovir GDP guanosine diphosphate GFP green fluorescent protein GTP guanosine triphosphate h hour(s) HA hemagglutinin HBS HEPES-buffered saline HCMV human cytomegalovirus HDAC histone deacetylase HEK human embryonic kidney HEL primary human embryonic lung fibroblasts HEPES 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid HFF primary human foreskin fibroblasts hpi hours post infection HPLC high-performance liquid chromatography HPV-16 human papillomavirus type 16 HRP horseradish peroxidase HSV-1 herpes simplex virus type 1 IE immediate early IP immunoprecipitation IVKA in vitro kinase assay ka association constant kb kilobase(s) kd dissociation constant KD equilibrium dissociation constant kDa kilo Dalton L late LB Luria-Bertani

Abbreviations - 75 -

LBR lamin B receptor mAb monoclonal antibody MBV maribavir MCS multiple cloning site MEM Eagle’s minimal essential medium min minute(s) MOI multiplicity of infection mRNA messenger ribonucleic acid NEC nuclear egress complex NES nuclear export signal NHS N-hydroxysuccinimide NLS nuclear localization signal NMR nuclear magnetic resonance NPC nuclear pore complex ORF open reading frame pAb polyclonal antibody PBSo phosphate-buffered saline without CaCl2 and MgCl2 PCR polymerase chain reaction PEI polyethyleneimine

PKA RII protein kinase A regulatory subunit II PKC protein kinase C PMSF phenylmethanesulfonylfluoride PRV pseudorabies virus RanGAP Ran GTPase-activating protein RanGEF Ran guanine nucleotide exchange factor Rb retinoblastoma protein RFLP restriction fragment length polymorphism RIPA radioimmunoprecipitation assay rpm rotations per minute RT room temperature RU response unit(s) SAP shrimp alkaline phosphatase SD subdomain SDS-PAGE sodium dodecyl sulfate-polyacrylamide gel electrophoresis SEAP secreted embryonic alkaline phosphatase sec second(s) SOC super optimal broth with catabolite repression SPR surface plasmon resonance SV40 simian virus 40 TAE tris acetate-EDTA buffer Tris tris(hydroxymethyl)aminomethane Tween polyethylene glycol sorbitan monolaurate UL unique long US unique short VGCV valganciclovir

References - 76 -

H References

Alvisi, G., Jans, D. A., Guo, J., Pinna, L. A., and Ripalti, A. (2005). A protein kinase CK2 site flanking the nuclear targeting signal enhances nuclear transport of human cytomegalovirus ppUL44. Traffic 6, 1002-1013.

Alvisi, G., Rawlinson, S. M., Ghildyal, R., Ripalti, A., and Jans, D. A. (2008). Regulated nucleocytoplasmic trafficking of viral gene products: a therapeutic target? Biochim Biophys Acta 1784, 213-227.

Andreoni, M., Faircloth, M., Vugler, L., and Britt, W. J. (1989). A rapid microneutralization assay for the measurement of neutralizing antibody reactive with human cytomegalovirus. J Virol Meth 23, 157-167.

Azad, R. F., Driver, V. B., Tanaka, K., Crooke, R. M., and Anderson, K. P. (1993). Antiviral activity of a phosphorothioate oligonucleotide complementary to RNA of the human cytomegalovirus major immediate-early region. Antimicrob Agents Chemother 37, 1945-1954.

Baek, M. C., Krosky, P. M., and Coen, D. M. (2002). Relationship between autophosphorylation and phosphorylation of exogenous substrates by the human cytomegalovirus UL97 protein kinase. J Virol 76, 11943-11952.

Baek, M. C., Krosky, P. M., Pearson, A., and Coen, D. M. (2004). Phosphorylation of the RNA polymerase II carboxyl-terminal domain in human cytomegalovirus-infected cells and in vitro by the viral UL97 protein kinase. Virology 324, 184-193.

Becke, S., Fabre-Mersseman, V., Aue, S., Auerochs, S., Sedmak, T., Wolfrum, U., Strand, D., Marschall, M., Plachter, B., and Reyda, S. (2010). Modification of the major tegument protein pp65 of human cytomegalovirus inhibits viral growth and leads to the enhancement of a protein complex with pUL69 and pUL97 in infected cells. J Gen Virol 91, 2531-2541.

Benetti, L. and Roizman, B. (2004). Herpes simplex virus protein kinase US3 activates and functionally overlaps protein kinase A to block apoptosis. Proc Natl Acad Sci U S A 101, 9411-9416.

Bogner, E. (2002). Human cytomegalovirus terminase as a target for antiviral chemotherapy. Rev Med Virol 12, 115-127.

Boutolleau, D., Burrel, S., and Agut, H. (2011). Genotypic characterization of human cytomegalovirus UL97 phosphotransferase natural polymorphism in the era of ganciclovir and maribavir. Antiviral Res 91, 32-35.

Calton, C. M., Randall J. A., Adkins M. W., and Banfield B. W. (2004). The pseudorabies virus serine/threonine kinase US3 contains mitochondrial, nuclear and membrane localization signals. Virus Genes 29, 131-145.

Camozzi, D., Pignatelli, S., Valvo, C., Lattanzi, G., Capanni, C., Dal Monte, P., and Landini, M. P. (2008). Remodelling of the nuclear lamina during human cytomegalovirus infection: role of the viral proteins pUL50 and pUL53. J Gen Virol 89, 731-740.

Chang, C. P., Chen, S. J., Lin, C. H., Wang, T. L., and Wang, C. C. (2010). A single sequence context cannot satisfy all non-AUG initiator codons in yeast. BMC Microbiol 10:188.

Chen, S. J., Lin, G., Chang, K. J., Yeh, L. S., and Wang, C. C. (2008). Translational efficiency of a non-AUG initiation codon is significantly affected by its sequence context in yeast. J Biol Chem 283, 3173-3180.

References - 77 -

Chou, S. (2008). Cytomegalovirus UL97 mutations in the era of ganciclovir and maribavir. Rev Med Virol 18, 233-246.

Chou, S. (2010). Recombinant phenotyping of cytomegalovirus UL97 kinase sequence variants for ganciclovir resistance. Antimicrob Agents Chemother 54, 2371-2378.

Chou, S., Hakki, M., and Villano, S. (2012). Effects on maribavir susceptibility of cytomegalovirus UL97 kinase ATP binding region mutations detected after drug exposure in vitro and in vivo. Antiviral Res 95, 88-92.

Chrisp, P. and Clissold, S. P. (1991). Foscarnet. A review of its antiviral activity, pharmacokinetic properties and therapeutic use in immunocompromised patients with cytomegalovirus retinitis. Drugs 41, 104-129.

Collas, P., Thompson, L., Fields, A. P., Poccia, D. L., and Courvalin, J. C. (1997). Protein kinase C-mediated interphase lamin B phosphorylation and solubilization. J Biol Chem 272, 21274-21280.

Combet, C., Blanchet, C., Geourjon, C., and Deléage, G. (2000). NPS@: network protein sequence analysis. Trends Biochem Sci 25, 147-150.

Compton, T., Nowlin, D. M., and Cooper, N. R. (1993). Initiation of human cytomegalovirus infection requires initial interaction with cell surface heparan sulfate. Virology 193, 834-841.

Connolly, S. A., Jackson, J. O., Jardetzky, T. S., and Longnecker, R. (2011). Fusing structure and function: a structural view of the herpesvirus entry machinery. Nat Rev Microbiol 9, 369-381.

Conti, E., Uy, M., Leighton L., Blobel G., and Kuriyan J. (1998). Crystallographic analysis of the recognition of a nuclear localization signal by the nuclear import factor karyopherin alpha Cell 94, 193-204.

Conti, E. and Kuriyan, J. (2000). Crystallographic analysis of the specific yet versatile recognition of distinct nuclear localization signals by karyopherin alpha. Structure 8, 329-338.

Conti, E. (2002). Structures of importins. Results Probl Cell Differ 35, 93-113.

Das, S., Vasanji, A., and Pellett, P. E. (2007). Three-dimensional structure of the human cytomegalovirus cytoplasmic virion assembly complex includes a reoriented secretory apparatus. J Virol 81, 11861-11869.

Davison, A. J., Eberle, R., Ehlers, B., Hayward, G. S., McGeoch, D. J., Minson, A. C., Pellett, P. E., Roizman, B., Studdert, M. J., and Thiry, E. (2009). The order Herpesvirales. Arch Virol 154, 171-177.

Davison, A. J. (2010). Herpesvirus systematics. Vet Microbiol 143, 52-69.

De Clercq, E. (2003). Clinical potential of the acyclic nucleoside phosphonates cidofovir, adefovir, and tenofovir in treatment of DNA virus and retrovirus infections. Clin Microbiol Rev 16, 569-596.

Degrève, B., Johansson, M., De Clercq, E., Karlsson, A., and Balzarini, J. (1998). Differential intracellular compartmentalization of herpetic thymidine kinases (TKs) in TK gene-transfected tumor cells: molecular characterization of the nuclear localization signal of herpes simplex virus type 1 TK. J Virol 72, 9535-9543.

Degrève, B., Esnouf, R., De Clercq, E., and Balzarini, J. (1999). Characterization of multiple nuclear localization signals in herpes simplex virus type 1 thymidine kinase. Biochem Biophys Res Commun 264, 338-342.

References - 78 -

Efferth, T., Marschall, M., Huong, X. W. S., Hauber, I., Olbrich, A., Kronschnabl, M., Stamminger, T., and Huang, E. (2002). Antiviral activity of artesunate towards wild-type, recombinant, and ganciclovir-resistant human cytomegaloviruses. J Mol Med 80, 233-242.

Fahrenkrog, B. and Aebi, U. (2003). The nuclear pore complex: nucleocytoplasmic transport and beyond. Nat Rev Mol Cell Biol 4, 757-766.

Finnen, R. L. and Banfield, B. W. (2010). Subcellular localization of the alphaherpesvirus serine/threonine kinase Us3 as a determinant of Us3 function. Virulence 1, 291-294.

Fontes, M. R., Teh, T., and Kobe, B. (2000). Structural basis of recognition of monopartite and bipartite nuclear localization sequences by mammalian importin-alpha. J Mol Biol 297, 1183-1194.

Fuxreiter, M., Tompa, P., and Simon, I. (2007). Local structural disorder imparts plasticity on linear motifs. Bioinformatics 23, 950-956.

Geenen, K., Favoreel H. W., Olsen L., Enquist L. W., and Nauwynck H. J. (2005). The pseudorabies virus US3 protein kinase possesses anti-apoptotic activity that protects cells from apoptosis during infection and after treatment with sorbitol or staurosporine. Virology 331, 144-150.

Gershburg, E. and Pagano, J. S. (2007). Conserved herpesvirus protein kinases. Biochim Biophys Acta 1784, 203-212.

Gill, R. B., Frederick, S. L., Hartline, C. B., Chou, S., and Prichard, M. N. (2009). Conserved retinoblastoma protein-binding motif in human cytomegalovirus UL97 kinase minimally impacts viral replication but affects susceptibility to maribavir. Virol J 6:9.

Gill, R. B., James, S. H., and Prichard, M. N. (2012). Human cytomegalovirus UL97 kinase alters the accumulation of CDK1. J Gen Virol 93, 1743-1755.

Goldberg, M. D., Honigman, A., Weinstein, J., Chou, S., Taraboulos, A., Rouvinski, A., Shinder, V., and Wolf, D. G. (2011). Human cytomegalovirus UL97 kinase and nonkinase functions mediate viral cytoplasmic secondary envelopment. J Virol 85, 3375-3384.

Görlich, D. and Mattaj, I. W. (1996). Nucleocytoplasmic transport. Science 271, 1513-1518.

Graf, L., Webel, R., Wagner, S., Hamilton, S. T., Rawlinson, W. D., Sticht, H., and Marschall, M. (2013). The cyclin-dependent kinase ortholog pUL97 of human cytomegalovirus interacts with cyclins. Viruses 5, ISSN 1999-4915, www.mdpi.com/journal/viruses

Grant, S. G., Jessee, J., Bloom, F. R., and Hanahan, D. (1990). Differential plasmid rescue from transgenic mouse DNAs into Escherichia coli methylation-restriction mutants. Proc Natl Acad Sci U S A 87, 4645-4649.

Haarr, L., Marsden, H. S., Preston, C. M., Smiley, J. R., Summers, W. C., and Summers, W. P. (1985). Utilization of internal AUG codons for initiation of protein synthesis directed by mRNAs from normal and mutant genes encoding herpes simplex virus-specified thymidine kinase. J Virol 56, 512-519.

Hamirally, S., Kamil, J. P., Ndassa-Colday, Y. M., Lin, A. J., Jahng, W. J., Baek, M. C., Noton, S., Silva, L. A., Simpson-Holley, M., Knipe, D. M., Golan, D. E., Marto, J. A., and Coen, D. M. (2009). Viral mimicry of Cdc2/cyclin-dependent kinase 1 mediates disruption of nuclear lamina during human cytomegalovirus nuclear egress. PLoS Pathog 5, e1000275.

Hamprecht, K., Maschmann, J., Jahn, G., Poets, C. F., and Goelz, R. (2008). Cytomegalovirus transmission to preterm infants during lactation. J Clin Virol 41, 198-205.

References - 79 -

He, Z., He, Y. S., Kim, Y,. Chu, L., Ohmstede, C., Biron, K. K., and Coen, D. M. (1997). The human cytomegalovirus UL97 protein is a protein kinase that autophosphorylates on serines and threonines. J Virol 71, 405-411.

Held, C., Webel, R., Palmisano, R., Hutterer, C., Marschall, M., and Wittenberg, T. (2014). Using multi-channel level sets to measure the cytoplasmic localization of HCMV pUL97 in GFP-β-gal fusion constructs. J Virol Meth 199, 61-67.

Herget, T., Freitag, M., Morbitzer, M., Kupfer, R., Stamminger, T., and Marschall, M. (2004). Novel chemical class of pUL97 protein kinase-specific inhibitors with strong anticytomegaloviral activity. Antimicrob Agents Chemother 48, 4154-4162.

Hobom, U., Brune, W., Messerle, M., Hahn, G., and Koszinowski, U. H. (2000). Fast screening procedures for random transposon libraries of cloned herpesvirus genomes: mutational analysis of human cytomegalovirus envelope glycoprotein genes. J Virol 74, 7720-7729.

Hu, W. and Jans, D. A. (1999). Efficiency of importin alpha/beta-mediated nuclear localization sequence recognition and nuclear import. Differential role of NTF2. J Biol Chem 274, 15820-15827.

Hume, A. J., Finkel, J. S., Kamil, J. P., Coen, D. M., Culbertson, M. R., and Kalejta, R. F. (2008). Phosphorylation of retinoblastoma protein by viral protein with cyclin-dependent kinase function. Science 320, 797-799.

Jans, D. A., Xiao, C. Y., and Lam, M. H. (2000). Nuclear targeting signal recognition: a key control point in nuclear transport? Bioessays 22, 532-544.

Kalejta R. F. (2008). Tegument proteins of human cytomegalovirus. Microbiol Mol Biol Rev 72, 249-265.

Kawaguchi, Y., Matsumura, T., Roizman, B., and Hirai, K. (1999). Cellular elongation factor 1δ is modified in cells infected with representative alpha-, beta-, or gammaherpesviruses. J Virol 73, 4456-4460.

Kawaguchi, Y., Kato, K., Tanaka, M., Kanamori, M., Nishiyama, Y., and Yamanashi, Y. (2003). Conserved protein kinases encoded by herpesviruses and cellular protein kinase cdc2 target the same phosphorylation site in eukaryotic elongation factor 1delta. J Virol 77, 2359-2368.

Khaiboullina, S. F., Maciejewski, J. P., Crapnell, K., Spallone, P. A., Dean, S. A., Pari, G. S., Zanjani, E. D., and Jeor, S. S. (2004). Human cytomegalovirus persists in myeloid progenitors and is passed to the myeloid progeny in a latent form. Br J Haematol 126, 410-417.

Kosugi, S., Hasebe, M., Tomita, M., and Yanagawa, H. (2009). Systematic identification of cell cycle-dependent yeast nucleocytoplasmic shuttling proteins by prediction of composite motifs. Proc Natl Acad Sci U S A 106, 10171-10176.

Kozak, M. (1987). At least six nucleotides preceding the AUG initiator codon enhance translation in mammalian cells. J Mol Biol 196, 947-50.

Kozak, M. (1989). The scanning model for translation: an update. J Cell Biol 108, 229-41.

Kozak, M. (1990). Downstream secondary structure facilitates recognition of initiator codons by eukaryotic ribosomes. Proc Natl Acad Sci U S A 87, 8301-8305.

Krosky, P. M., Baek, M. C., and Coen, D. M. (2003). The human cytomegalovirus UL97 protein kinase, an antiviral drug target, is required at the stage of nuclear egress. J Virol 77, 905-914.

References - 80 -

Kuny, C. V., Chinchilla, K., Culbertson, M. R., and Kalejta, R. F. (2010). Cyclin-dependent kinase-like function is shared by the beta- and gamma- subset of the conserved herpesvirus protein kinases. PLoS Pathog 6, e1001092.

Laemmli, U. K. (1970). Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227, 680-685.

Lange, A., Mills, R. E., Lange, C. J., Stewart, M., Devine, S. E., and Corbett, A. H. (2007). Classical nuclear localization signals: definition, function, and interaction with importin alpha. J Biol Chem 282, 5101-5105.

Lee, C. P. and Chen, M. R. (2010). Escape of herpesviruses from the nucleus. Rev Med Virol 20, 214-230.

Leopardi, R., Van Sant, C., and Roizman, B. (1997). The herpes simplex virus 1 protein kinase US3 is required for protection from apoptosis induced by the virus. Proc Natl Acad Sci U S A 94, 7891-7896.

Lischka, P., Sorg, G., Kann, M., Winkler, M., and Stamminger, T. (2003). A nonconventional nuclear localization signal within the UL84 protein of human cytomegalovirus mediates nuclear import via the importin alpha/beta pathway. J Virol 77, 3734-3748.

Littler E., Stuart A. D., and Chee M. S. (1992). Human cytomegalovirus UL97 open reading frame encodes a protein that phosphorylates the antiviral nucleoside analogue ganciclovir. Nature 358, 160-162.

Lurain, N. S., Weinberg, A., Crumpacker, C. S., and Chou, S. (2001). Sequencing of cytomegalovirus UL97 gene for genotypic antiviral resistance testing. Antimicrob Agents Chemother 45, 2775-2780.

Lurain, N. S. and Chou, S. (2010). Antiviral drug resistance of human cytomegalovirus. Clin Microbiol Rev 23, 689-712.

Marfori, M., Mynott, A., Ellis, J. J., Mehdi, A. M., Saunders, N. F., Curmi, P. M., Forwood, J. K., Bodén, M., and Kobe, B. (2011). Molecular basis for specificity of nuclear import and prediction of nuclear localization. Biochim Biophys Acta 1813, 1562-1577.

Marschall, M., Stein-Gerlach, M., Freitag, M., Kupfer, R., van den Bogaard, M., and Stamminger, T. (2001). Inhibitors of human cytomegalovirus replication drastically reduce the activity of the viral protein kinase pUL97. J Gen Virol 82, 1439-1450.

Marschall, M., Stein-Gerlach, M., Freitag, M., Kupfer, R., van den Bogaard, M., and Stamminger, T. (2002). Direct targeting of human cytomegalovirus protein kinase pUL97 by kinase inhibitors is a novel principle for antiviral therapy. J Gen Virol 83, 1013-1023.

Marschall, M., Freitag, M., Suchy, P., Romaker, D., Kupfer, R., Hanke, M., and Stamminger, T. (2003). The protein kinase pUL97 of human cytomegalovirus interacts with and phosphorylates the DNA polymerase processivity factor pUL44. Virology 311, 60-71.

Marschall, M., Marzi, A., aus dem Siepen, P., Jochmann, R., Kalmer, M., Auerochs, S., Lischka, P., Leis, M., and Stamminger, T. (2005). Cellular p32 recruits cytomegalovirus kinase pUL97 to redistribute the nuclear lamina. J Biol Chem 280, 33357-33367.

Marschall, M., Feichtinger, S., and Milbradt, J. (2011). Regulatory roles of protein kinases in cytomegalovirus replication. Adv Virus Res 80, 69-101.

Marsden, H. S., Haarr, L., and Preston, C. M. (1983). Processing of herpes simplex virus proteins and evidence that translation of thymidine kinase mRNA is initiated at three separate AUG codons. J Virol 46, 434-445.

References - 81 -

McGeoch, D. J., Dolan, A., Donald, S., and Rixon, F.J. (1985). Sequence determination and genetic content of the short unique region in the genome of herpes simplex virus type 1. J Mol Biol 181, 1-13.

Meinhart, A., Kamenski, T., Hoeppner, S., Baumli, S., and Cramer, P. (2005). A structural perspective of CTD function. Genes Dev 19, 1401-1415.

Mettenleiter, T. C. (2004). Budding events in herpesvirus morphogenesis. Virus Res 106, 167-180.

Mettenleiter, T. C. (2013). The way out: what we know and do not know about herpesvirus nuclear egress. Cellular Microbiology 15, 170-178.

Michel, D., Papic, I., Zimmermann, A., Haupt, E., Wunderlich, K., Heuschmid, M., and Mertens, T. (1996). The UL97 gene product of human cytomegalovirus is an early-late protein with a nuclear localization but is not a nucleoside kinase. J Virol 70, 6340-6346.

Michel, D., Schaarschmidt, P., Wunderlich, K., Heuschmid, M., Simoncini, L., Mühlberger, D., Zimmermann, A., Papic, I., and Mertens, T. (1998). Functional regions of the human cytomegalovirus protein pUL97 involved in nuclear localization and phosphorylation of ganciclovir and pUL97 itself. J Gen Virol 79, 2105-2112.

Michel, D. and Mertens, T. (2004). The UL97 protein kinase of human cytomegalovirus and homologues in other herpesviruses: impact on virus and host. Biochim Biophys Acta 1697, 169-180.

Milbradt, J., Auerochs, S., Sticht, H., and Marschall, M. (2009). Cytomegaloviral proteins that associate with the nuclear lamina: components of a postulated nuclear egress complex. J Gen Virol 90, 579-590.

Milbradt, J., Webel, R., Auerochs, S., Sticht, H., and Marschall, M. (2010). Novel mode of phosphorylation-triggered reorganization of the nuclear lamina during nuclear egress of human cytomegalovirus. J Biol Chem 285, 13979-13989.

Mocarski, E. S., Shenk, T., and Pass, R. F. (2007). Cytomegaloviruses. In Fields Virology (eds. D. M. Knipe and P. M. Howle), pp. 2701-2772, Lippincott Williams & Wilkins.

Morris, M. I., Fischer, S. A., and Ison, M. G. (2010). Infections transmitted by transplantation. Infect Dis Clin North Am 24, 497-514.

Mou, F., Forest, T., and Baines, J. D. (2007). US3 of herpes simplex virus type 1 encodes a promiscuous protein kinase that phosphorylates and alters localization of lamin A/C in infected cells. J Virol 81, 6459-6470.

Munger, J. and Roizman, B. (2001). The US3 protein kinase of herpes simplex virus 1 mediates the posttranslational modification of BAD and prevents BAD-induced programmed cell death in the absence of other viral proteins. Proc Natl Acad Sci U S A 98, 10410-10415.

Neduva, V. and Russell, R. B. (2005). Linear motifs: evolutionary interaction switches. FEBS Lett 579, 3342-3345.

Nelson-Rees, W. A. and Flandermeyer, R. R. (1976). HeLa cultures defined. Science 191, 96-98.

Ogawa-Goto, K., Tanaka, K., Gibson, W., Moriishi, E., Miura, Y., Kurata, T., Irie, S., and Sata, T. (2003). Microtubule network facilitates nuclear targeting of human cytomegalovirus capsid. J Virol 77, 8541-8547.

References - 82 -

Ogg, P. D., McDonell, P. J., Ryckman, B. J., Knudson, C. M., and Roller, R. J. (2004). The HSV-1 Us3 protein kinase is sufficient to block apoptosis induced by overexpression of a variety of Bcl-2 family members. Virology 319, 212-224.

Pari, G. S. (2008). Nuts and bolts of human cytomegalovirus lytic DNA replication. Curr Top Microbiol Immunol 325, 153-166.

Pear, W. S., Nolan, G. P., Scott, M. L., and Baltimore, D. (1993). Production of high-titer helper-free retroviruses by transient transfection. Proc Natl Acad Sci U S A 90, 8392-8396.

Pellett, P. E. and Roizman, B. (2007). The family: Herpesviridae a brief introduction. In Fields Virology (eds. D. M. Knipe and P. M. Howle), pp. 2479-2500, Lippincott Williams & Wilkins.

Peter, M., Nakagawa, J., Dorée, M., Labbé, J. C., and Nigg, E. A. (1990). In vitro disassembly of the nuclear lamina and M phase-specific phosphorylation of lamins by cdc2 kinase. Cell 61, 591-602.

Poon, A. P. W., Benetti, L., and Roizman, B. (2006). US3 and US3.5 protein kinases of herpes simplex virus 1 differ with respect to their functions in blocking apoptosis and in virion maturation and egress. J Virol 80, 3752-3764.

Poon, A. P. W. and Roizman, B. (2005). Herpes simplex virus 1 ICP22 regulates the accumulation of a shorter mRNA and of a truncated US3 protein kinase that exhibits altered functions. J Virol 79, 8470-8479.

Prichard, M. N., Gao, N., Jairath, S., Mulamba, G., Krosky, P., Coen, D. M., Parker, B. O., and Pari, G. S. (1999). A recombinant human cytomegalovirus with a large deletion in UL97 has a severe replication deficiency. J Virol 73, 5663-5670.

Prichard, M. N., Sztul, E., Daily, S. L., Perry, A. L., Frederick, S. L., Gill, R. B., Hartline, C. B., Streblow, D. N., Varnum, S. M., Smith, R. D., and Kern, E. R. (2008). Human cytomegalovirus UL97 kinase activity is required for the hyperphosphorylation of retinoblastoma protein and inhibits the formation of nuclear aggresomes. J Virol 82, 5054-5067.

Prichard, M. N. (2009). Function of human cytomegalovirus UL97 kinase in viral infection and its inhibition by maribavir. Rev Med Virol 19, 215-229.

Purves, F. C., Longnecker, R. M., Leader, D. P., and Roizman B. (1987). Herpes simplex virus 1 protein kinase is encoded by open reading frame US3, which is not essential for virus growth in cell culture. J Virol 61, 2896-2901.

Rafailidis, P. I., Mourtzoukou, E. G., Varbobitis, I. C., and Falagas, M. E. (2008). Severe cytomegalovirus infection in apparently immunocompetent patients: a systematic review. Virol J 5:47.

Rechter, S., Scott, G. M., Eickhoff, J., Zielke, K., Auerochs, S., Müller, R., Stamminger, T., Rawlinson, W. D., and Marschall, M. (2009). Cyclin-dependent kinases phosphorylate the cytomegalovirus RNA export protein pUL69 and modulate its nuclear localization and activity. J Biol Chem 284, 8605-8613.

Reeves, M. and Sinclair, J. (2013). Regulation of human cytomegalovirus transcription in

latency: beyond the major immediate-early promoter. Viruses 5, 1395-1413.

Reynolds, A. E., Wills, E. G., Roller, R. J., Ryckman, B. J., and Baines, J. D. (2002). Ultrastructural localization of the herpes simplex virus type 1 UL31, UL34, and US3 proteins suggests specific roles in primary envelopment and egress of nucleocapsids. J Virol 76, 8939-8952.

References - 83 -

Rich, R. L. and Myszka, D. G. (2010). Grading the commercial optical biosensor literature-Class of 2008: 'The Mighty Binders'. J Mol Recognit 23, 1-64.

Roizman, B., Carmichael, L. E., Deinhardt, F., de-The, G., Nahmias, A. J., Plowright, W., Rapp, F., Sheldrick, P., Takahashi, M., and Wolf, K. (1981). Herpesviridae. Definition, provisional nomenclature, and taxonomy. The Herpesvirus Study Group, the International Committee on Taxonomy of Viruses. Intervirology 16, 201-217.

Roizman, B., Desrosiers, R. C., Fleckenstein, B., Lopez, C., Minson, A. C., and Studdert, M. J. (1992). The family Herpesviridae: an update. The Herpesvirus Study Group of the International Committee on Taxonomy of Viruses. Arch Virol 123, 425-449.

Roizman, B. and Knipe, D. M. (2001). Herpesviruses and their replication. In D M Knipe and P M Howley (eds), Lippincott Williams and Wilkins, Philadelphia, 2399-2460.

Romaker, D., Schregel, V., Maurer, K., Auerochs, S., Marzi, A., Sticht, H., and Marschall, M. (2006). Analysis of the structure-activity relationship of four herpesviral UL97 subfamily protein kinases reveals partial but not full functional conservation. J Med Chem 49, 7044-7053.

Rowe, W. P., Hartley, J. W., Waterman, S., Turner, H. C., and Huebner, R. J. (1956). Cytopathogenic agent resembling human salivary gland virus recovered from tissue cultures of human adenoids. Proc Soc Exp Biol Med 92, 418-424.

Sambrook, J., Fritsch, E. F., and Maniatis, T. (1989). Molecular cloning - a laboratory manual. Cold Spring Harbor: Cold Spring Harbor Laboratory Press.

Sambrook, J. and Russel, D. W. (2001). Molecular cloning - a laboratory manual. Cold Spring Harbor: Cold Spring Harbor Laboratory Press.

Sanchez, V., Greis, K. D., Sztul, E., and Britt, W. J. (2000a). Accumulation of virion tegument and envelope proteins in a stable cytoplasmic compartment during human cytomegalovirus replication: characterization of a potential site of virus assembly. J Virol 74, 975-986.

Sanchez, V., Sztul, E., and Britt, W. J. (2000b). Human cytomegalovirus pp28 (UL99) localizes to a cytoplasmic compartment which overlaps the endoplasmic reticulum-golgi-intermediate compartment. J Virol 74, 3842-3851.

Schregel, V., Auerochs, S., Jochmann, R., Maurer, K., Stamminger, T., and Marschall, M. (2007). Mapping of a self-interaction domain of the cytomegalovirus protein kinase pUL97. J Gen Virol 88, 395-404.

Schreiber, A., Härter, G., Schubert, A., Bunjes, D., Mertens, T., and Michel, D. (2009). Antiviral treatment of cytomegalovirus infection and resistant strains. Expert Opin Pharmacother 10, 191-209.

Sinclair, J. (2008). Human cytomegalovirus: Latency and reactivation in the myeloid lineage. J Clin Virol 41, 180-185.

Sinzger, C., Digel, M., and Jahn, G. (2008). Cytomegalovirus cell tropism. Curr Top Microbiol Immunol 325, 63-83.

Sissons, J. G. and Carmichael, A. J. (2002). Clinical aspects and management of cytomegalovirus infection. J Infect 44, 78-83.

Sorg, G. and Stamminger, T. (1999). Mapping of nuclear localization signals by simultaneous fusion to green fluorescent protein and to beta-galactosidase. Biotechniques 26, 858-862.

Steininger, C. (2007). Clinical relevance of cytomegalovirus infection in patients with disorders of the immune system. Clin Microbiol Infect 13, 953-963.

References - 84 -

Sullivan, V., Talarico C. L., Stanat S. C., Davis M., Coen D. M., and Biron K. K. (1992). A protein kinase homologue controls phosphorylation of ganciclovir in human cytomegalovirus-infected cells. Nature 358, 162-164.

Tandon, R. and Mocarski, E. S. (2012). Viral and host control of cytomegalovirus maturation. Trends Microbiol 20, 392-401.

Theiler, R. N. and Compton, T. (2001). Characterization of the signal peptide processing and membrane association of human cytomegalovirus glycoprotein O. J Biol Chem 276, 39226-39231.

Thomas, M., Rechter, S., Milbradt, J., Auerochs, S., Müller, R., Stamminger, T., and Marschall, M. (2009). Cytomegaloviral protein kinase pUL97 interacts with the nuclear mRNA export factor pUL69 to modulate its intranuclear localization and activity. J Gen Virol 90, 567-578.

Tischer, B. K., von Einem, J., Kaufer, B., and Osterrieder, N. (2006). Two-step red-mediated recombination for versatile high-efficiency markerless DNA manipulation in Escherichia coli. Biotechniques 40, 191-197.

Tischer, B. K., Smith, G. A., and Osterrieder, N. (2010). En passant mutagenesis: a two step markerless red recombination system. Methods Mol Biol 634, 421-430.

Tsutsui, Y. (2009). Effects of cytomegalovirus infection on embryogenesis and brain development. Congenit Anom (Kyoto) 49, 47-55.

Turcotte, S., Letellier, J., and Lippé, R. (2005). Herpes simplex virus type 1 capsids transit by the trans-Golgi network, where viral glycoproteins accumulate independently of capsid egress. J Virol 79, 8847-8860.

Vancikova, Z. and Dvorak, P. (2001). Cytomegalovirus infection in immunocompetent and immunocompromised individuals - a review. Curr Drug Targets Immune Endocr Metab Disord 1, 179-187.

van Zeijl, M., Fairhurst, J., Baum, E. Z., Sun, L., and Jones, T. R. (1997) The human cytomegalovirus UL97 protein is phosphorylated and a component of virions. Virology 231, 72-80.

van Zijl, M., van der Gulden, H., de Wind, N., Gielkens, A., and Berns, T. G. (1990). Identification of two genes in the unique short region of pseudorabies virus: comparison with herpes simplex virus and varicella-zoster virus. J Gen Virol 71, 1747-1755.

Webel, R., Milbradt, J., Auerochs, S., Schregel, V., Held, C., Nöbauer, K., Razzazi-Fazeli, E., Jardin, C., Wittenberg, T., Sticht, H., and Marschall, M. (2011). Two isoforms of the protein kinase pUL97 of human cytomegalovirus are differentially regulated in their nuclear translocation. J Gen Virol 92, 638-649.

Webel, R., Solbak, S. M., Held, C., Milbradt, J., Groß, A., Eichler, J., Wittenberg, T., Jardin, C., Sticht, H., Fossen, T., and Marschall, M. (2012). Nuclear import of isoforms of the cytomegalovirus kinase pUL97 is mediated by differential activity of NLS1 and NLS2 both acting through classical importin-α binding. J Gen Virol 93, 1756-1768.

Webel, R., Hakki, M., Prichard, M., Rawlinson, W. D., Marschall, M., and Chou, S. (2014). Differential properties of cytomegalovirus pUL97 kinase isoforms affect viral replication and maribavir susceptibility. J Virol 88, 4776-4785.

Weis, K. (1998). Importins and exportins: how to get in and out of the nucleus. Trends Biochem Sci 23,185-189.

References - 85 -

Wing, B. A. and Huang, E. (1995). Analysis and mapping of a family of 39-coterminal transcripts containing coding sequences for human cytomegalovirus open reading frames UL93 through UL99. J Virol 69, 1521-1531.

Wisner, T. W., Wright, C. C., Kato, A., Kawaguchi, Y., Mou, F., Baines, J. D., Roller, R. J., and Johnson, D. C. (2009). Herpesvirus gB-induced fusion between the virion envelope and outer nuclear membrane during virus egress is regulated by the viral US3 kinase. J Virol 83, 3115-3126.

Wolf, D. G., Courcelle, C. T., Prichard, M. N., and Mocarski, E. S. (2001). Distinct and separate roles for herpesvirus-conserved UL97 kinase in cytomegalovirus DNA synthesis and encapsidation. Proc Natl Acad Sci U S A 98, 1895-1900.

Yang, S. N., Takeda, A. A., Fontes, M. R., Harris, J. M., Jans, D. A., and Kobe, B. (2010). Probing the specificity of binding to the major nuclear localization sequence-binding site of importin-alpha using oriented peptide library screening. J Biol Chem 285, 19935-19946.

Zagursky, R. J., Baumeister, K., Lomax, N., and Berman, M. L. (1985). Rapid and easy sequencing of large linear double-stranded and supercoiled plasmid DNA. Gene Anal Tech 2, 89-94.

Appendix - 86 -

I Appendix

FIGURE S1. Multiple sequence alignment of the UL97 gene region from different HCMV strains. Multiple sequence alignment of reference HCMV strains (underlined) and clinical isolates from

Europe (in italics) or from Australia (standard characters) using Clustal Omega (version1.1.1). *, conserved bases; blank, varying bases shaded in light gray; ATG start codons M1, M38, M74, M111 and M157 highlighted in black; NLS1/NLS2 sequences highlighted in dark gray.

73A CACAACATAACGACAGTGTCGGTGTGGTAGCTAGTGCAGCCTTAGGAACAGGGAAGACTG

1817 CACAACATAACGACAGTGTCGGTGTGGTAGCTAGTGCAGCCTTAGGAACAGGGAAGACTG

AD169 CACAACATAACGACAGTGTCGGTGTGGTAGCTAGTGCAGCCTTAGGAACAGGGAAGACTG


81B CACAACATAACGACAGTGTCGGTGTGGTAGCTAGTGCAGCCTTAGGAACAGGGAAGACTG


3E CACAACATAACGACAGTGTCGGTGTGGTAGCTAGTGCAGCCCTAGGAACAGGGAAGACTG

FIX CACAACATAACGACAGTGTCGGTGTGGTAGCTAGTGCAGCCCTAGGAACAGGGAAGACTG

47A CACAACATAACGACAGTGTCGGTGTGGTAGCTAGTGCAGCTCTAGGAACAGGGAAGACTG

37E CACACCATAACGACAGTGTCGGTGTGGTAGCTAGTGCAGCCCTAGGAACAGGGAAGACTG

70A CACACCATAACGACAGTGTCGGTGTGGTAGCTAGTGCAGCCCTAGGAACAGGGAAGACTG


TB40E CACACCATAACGACAGTGTCGGTGTGGTAGCTAGTGCAGCCCTAGGAACAGGGAAGACTG



Merlin CACACCATAACGACAGTGTCGGTGTGGTAGCTAGTGCAGCCCTAGGAACAGGGAAGACTG


7577 CACACCATAACGACAGTGTCGGTGTGGTAGCTGGTGCAGCCCTAGGAACAGGGAAGACTG

23B CACACCATAACGACAGTGTCGGTGTGGTAGCTGGTGCAGCCCTAGGAACAGGGAAGACTG

4804 CACACCATAACGACAGTGTCGGTGTGGTAGCTAGTGCAGCCCTAGGAACAGGGAAGACTG

7498 CACACCATAACGACAGTGTCGGTGTGGTAGCTAGTGCAGCCCTAGGAACAGGGAAGACTG

5B CACACCATAACGACAGTGTCGGTGTGGTAGCTAGTGCAGCCCTAGGAACAGGGAAGACTG




6939 CATACCATAACGACAGTGTCGGTGTGGTAGCTAGTGCAGCCCTAGGAACAGGGAAGACTG

9318 CATACCATAACGACAGTGTCGGTGTGGTAGCTAGTGCAGCCCTAGGAACAGGGAAGACTG

1B CATACCATAACGACAGTGTCGGTGTGGTAGCTAGTGCAGCCCTAGGAACAGGGAAGACTG

3A CATACCATAACGACAGTGTCGGTGTGGTAGCTAGTGCAGCCCTAGGAACAGGGAAGACTG

541 CACAACATAACGACAGTGTCGGCGTGGTAGCTAGTGCAGCCCTAGGAACAGGGAAGACTG

7800 CACAACATAACGACAGTGTCGGTGTGGTAGCTAGTGCAGCCCTAGGAACAGGGAAGACTG


16B CACAACATAACGACAGTGTCGGTGTGGTAGCTAGTGCAGCCCTAGGAACAGGGAAGACTG

1D CACAACATAACGACAGTGTCGGTGTGGTAGCTAGTGCAGCCCTAGGAACAGGGAAGACTG



7567 CACAACATAACGACAGTGTCGGTGTGGTAGCTAGTGCAGCTCTAGGAACAGGGAAGACTG



Towne CACAACATAACGACAGTGTCGGTGTGGTAGCTAGTGCAGCTCTAGGAACAGGGAAGACTG

44A CACAACATAACGACAGTGTCGGTGTGGTAGCTAGTGCAGCCCTAGGAACAGGGAAGACTG







** * ***************** ********* ******* ******************

73A TCGCCACTATGTCCTCCGCACTTCGGTCTCGGGCTCGCTCGGCCTCGCTCGGAACGACGA

1817 TCGCCACTATGTCCTCCGCACTTCGGTCTCGGGCTCGCTCGGCCTCGCTCGGAACGACGA

AD169 TCGCCACTATGTCCTCCGCACTTCGGTCTCGGGCTCGCTCGGCCTCGCTCGGAACGACGA

Appendix - 87 -


81B TCGCCACTATGTCCTCCGCACTTCGGTCTCGGGCTCGCTCGGCCTCGCTCGGAACGACGA


3E TCGCCACTATGTCCTCCGCACTTCGGTCTCGGGCTCGCTCGGCCTCGCTCGGAACGACGA

FIX TCGCCACTATGTCCTCCGCACTTCGGTCTCGGGCTCGCTCGGCCTCGCTCGGAACGACGA


37E TTGCCACTATGTCCTCCGCACTTCGGTCTCGGGCTCGCTCGGCCTCGCTCGGAACGACGA



TB40E TCGCCACTATGTCCTCCGCACTTCGGTCTCGGGCTCGCTCGGCCTCGCTCGGAACGACGA



Merlin TCGCCACTATGTCCTCCGCACTTCGGTCTCGGGCTCGCTCGGCCTCGCTCGGAACGACGA














541 TCGCCACTATGTCCTCCGCGCTTCGGTCTCGGGCTCGCTCGGCCTCGCTCGGAACGACGA




1D TCGCCACTATGTCCTCCGCACTTCGGTCTCGGGCTCGCTCGGCCTCGCTCGGAACGACGA

26A TCGCCACTATGTCCTCCGCACTTCGGTCTCGGGCTCGCTCGGCCTCACTCGGAACGACGA





Towne TCGCCACTATGTCCTCCGCACTTCGGTCTCGGGCTCGCTCGGCCTCGCTCGGAACGACGA







36A TCGCCACTATGTCCTCCGCATTTCGGTCTCGGGCTCGCTCGGCCTCGCTCGGAACGACGA

* ***************** ************************* *************

73A CTCAGGGCTGGGATCCGCCGCCATTGCGTCGTCCCAGCAGGGCGCGCCGGCGCCAGTGGA

1817 CTCAGGGCTGGGATCCGCCGCCATTGCGTCGTCCCAGCAGGGCGCGCCGGCGCCAGTGGA

AD169 CTCAGGGCTGGGATCCGCCGCCATTGCGTCGTCCCAGCAGGGCGCGCCGGCGCCAGTGGA


81B CTCAGGGCTGGGATCCGCCGCCATTGCGTCGTCCCAGCAGGGCGCGCCGGCGCCAGTGGA


3E CTCAGGGCTGGGATCCGCCGCCATTGCGTCGTCCCAGCAGGGCGCGCCGGCGCCAGTGGA

FIX CTCAGGGCTGGGATCCGCCGCCATTGCGTCGTCCCAGCAGGGCGCGCCGGCGCCAGTGGA





TB40E CTCAGGGCTGGGATCCGCCGCCATTGCGTCGTCCCAGCAGGGCGCGCCGGCGCCAGTGGA



Merlin CTCAGGGCTGGGATCCGCCGCCATTGCGTCGTCCCAGCAGGGCGCGCCGGCGCCAGTGGA

Appendix - 88 -


















1D CTCAGGGCTGGGATCCGCCGCCATTGCGTCGTCCCAGCAGGGCGCGCCGGCGCCAGTGGA

26A CTGAGGGCTGGGATCCGCCGCCATTGCGTCGTCCCAGCAGGGCGCGCCGGCGCCAGTGGA


7567 CTGAGGGCTGGGATCCGCCGCCATTGCGTCGTCCCAGCAGGGCGCGCCGGCGCCAGTGGA



Towne CTGAGGGCTGGGATCCGCCGCCATTGCGTCGTCCCAGCAGGGCGCGCCGGCGCCAGTGGA








** *********************************************************

73A TGCGCGAAGCTGCGCAGGCCGCCGCTCAAGCCGCGGTGCAGGCCGCGCAGGCCGCCGCCG

1817 TGCGCGAAGCTGCGCAGGCCGCCGCTCAAGCCGCGGTGCAGGCCGCGCAGGCCGCCGCCG

AD169 TGCGCGAAGCTGCGCAGGCCGCCGCTCAAGCCGCGGTGCAGGCCGCGCAGGCCGCCGCCG


81B TGCGCGAAGCTGCGCAGGCCGCCGCTCAAGCCGCGGTGCAGGCCGCGCAGGCCGCCGCCG


3E TGCGCGAAGCTGCGCAGGCCGCCGCTCAAGCCGCGGTACAGGCCGCGCAGGCCGCCGCCG

FIX TGCGCGAAGCTGCGCAGGCCGCCGCTCAAGCCGCGGTGCAGGCCGCGCAGGCCGCCGCCG

47A TGCGCGAAGCTGCGCAGGCCGCCGCTCAAGCCGCGGTACAGGCCGCGCAGGCCGCCGCCG




TB40E TGCGCGAAGCTGCGCAGGCCGCCGCTCAAGCCGCGGTACAGGCCGCGCAGGCCGCCGCCG



Merlin TGCGCGAAGCTGCGCAGGCCGCCGCTCAAGCCGCGGTACAGGCCGCGCAGGCCGCCGCCG


7577 TGCGCGAAGCTGCGCAGGCCGCCGCTCAAGCCGCGGTACAGGCCGCGCAGGCCGCCGCCG

23B TGCGCGAAGCTGCGCAGGCCGCCGCTCAAGCCGCGGTACAGGCCGCGCAGGCCGCCGCCG











Appendix - 89 -





1D TGCGCGAAGCTGCGCAGGCCGCCGCTCAAGCCGCGGTGCAGGCCGCGCAGGCCGCCGCCG






Towne TGCGCGAAGCTGCGCAGGCCGCCGCTCAAGCCGCGGTGCAGGCCGCGCAGGCCGCCGCCG








************************************* **********************

73A CTCAGGTCGCCCAGGCTCACGTTGATGAAAACGAGGTCGTGGATCTGATGGCCGACGAGG

1817 CTCAGGTCGCCCAGGCTCACGTTGATGAAAACGAGGTCGTGGATCTGATGGCCGACGAGG

AD169 CTCAGGTCGCCCAGGCTCACGTTGATGAAAACGAGGTCGTGGATCTGATGGCCGACGAGG


81B CTCAGGTCGCCCAGGCTCACGTTGATGAAAACGAGGTCGTGGATCTGATGGCCGACGAGG


3E CTCAAGTTGCCCAGGCTCACGTCGATGAAGACGAGGTCGTGGATTTAATGGCCGACGAGG

FIX CTCAGGTTGCCCAGGCTCACGTCGATGAAGACGAGGTCGTGGATCTGATGGCCGACGAGG

47A CTCAAGTTGCCCAGGCTCACGTCGATGAAGACGAGGTCGTGGATCTGATGGCCGACGAGG

37E CTCAAGTTGCCCAGGCTCACGTCGATGAAGACGAGGTCGTGGATCTGATGGCCGACGAGG

70A CTCAAGTTGCCCAGGCTCACGTCGATGAAGACGAGGTCGTGGATTTGATGGCCGACGAGG


TB40E CTCAAGTTGCCCAGGCTCACGTCGATGAAGACGAGGTCGTGGATCTGATGGCCGACGAGG



Merlin CTCAAGTTGCCCAGGCTCACGTCGATGAAGACGAGGTCGTGGATCTGATGACCGACGAGG

91A CTCAAGTTGCCCAGGCTCACGTCGATGAAGACGAGGTCGTGGATCTGATGACCGACGAGG

7577 CTCAAGTTGCCCAGGCTCACGTCGATGAAGACGAGGTCGTGGATCTGATGGCCGACGAGG

23B CTCAAGTTGCCCAGGCTCACGTCGATGAAGACGAGGTCGTGGATCTGATGGCCGACGAGG













6281 CTCAGGTTGCCCAGGCTCACGTCGATGAAGATGAGGTCGTGGATCTGATGGCCGACGAGG

16B CTCAGGTTGCCCAGGCTCACGTCGATGAAGATGAGGTCGTGGATCTGATGGCCGACGAGG

1D CTCAGGTTGCCCAGGCTCACGTCGATGAAGATGAGGTCGTGGATCTGATGGCCGACGAGG

26A CTCAGGTTGCCCAGGCTCACGTCGATGAAGACGAGGTCGTGGATCTGATGGCCGACGAGG

29A CTCAGGTCGCCCAGGCTCACGTCGATGAAGACGAGGTCGTGGATCTGATGGCCGACGAGG

7567 CTCAGGTTGCCCAGGCTCACGTCGATGAAGACGAGGTCGTGGATCTGATGGCCGACGAGG



Towne CTCAGGTCGCCCAGGCTCACGTCGATGAAGACGAGGTCGTGGATCTGATGGCCGACGAGG

44A CTCAGGTTGCCCAGGCTCACGTCGATGAAGACGAGGTCGTGGATCTGATGGCCGACAAGG

9025 CTCAGGTTGCCCAGGCTCACGTCGATGAAGACGAGGTCGTGGATCTGATGGCCGACGAGG

Appendix - 90 -


4B CTCAGGTTGCCCAGGCTCACGTCGATGAAGACGAGGTCGTGGATCTGATGGCCGACGAGG

45B CTCAGGTTGCCCAGGCTCACGTCGATGAAGACGAGGTCGTGGATCTGATGGCCGACGAGG


36A CTCAGGTTGCCCAGGCTCACGTCGATGAAGACGAGGTCGTGGATCTGATGGCTGACGAGG

**** ** ************** ****** * ************ * *** * *** ***

73A CCGGCGGCGGCGTCACCACTTTGACCACCCTGAGTTCCGTCAGCACAACCACCGTGCTTG

1817 CCGGCGGCGGCGTCACCACTTTGACCACCCTGAGTTCCGTCAGCACAACCACCGTGCTTG

AD169 CCGGCGGCGGCGTCACCACTTTGACCACCCTGAGTTCCGTCAGCACAACCACCGTGCTTG


81B CCGGCGGCGGCGTCACCACTTTGACCACCCTGAGTTCCGTCAGCACAACCACCGTGCTTG


3E CCGGCGGCGGCGTCACCACTTTGACCACCCTGAGTTCCGTCAGCACAACCACCGTGCTTG

FIX CCGGCGACGGCGTCACCACTTTGACCACCCTGAGTTCCGTCAGCACAACCACCGTGCTTG





TB40E CCGGCGGCGGCGTCACCACTTTGACCACCCTGAGTTCCGTCAGCACAACCACCGTGCTTG



Merlin CCGGCGGCGGCGTCACCACTTTGACCACCCTGAGTTCCGTCAGCACAACCACCGTGCTTG
















6281 CCGGCGGTGGCGTCACCACTTTGACCACCCTGAGTTCCGTCAGCACAACCACCGTGCTTG

16B CCGGCGGTGGCGTCACCACTTTGACCACCCTGAGTTCCGTCAGCACAACCACCGTGCTTG

1D CCGGCGGTGGCGTCACCACTTTGACCACCCTGAGTTCCGTCAGCACAACCACCGTGCTTG






Towne CCGGCGGCGGCGTCACCACTTTGACCACCCTGAGTTCCGTCAGCACAACCACCGTGCTTG








****** ****************************************************

73A GACACGCGACTTTTTCCGCATGCGTTCGAAGTGACGTGATGCGTGACGGAGAAAAAGAGG

1817 GACACGCGACTTTTTCCGCATGCGTTCGAAGTGACGTGATGCGTGACGGAGAAAAAGAGG

AD169 GACACGCGACTTTTTCCGCATGCGTTCGAAGTGACGTGATGCGTGACGGAGAAAAAGAGG


81B GACACGCGACTTTTTCCGCATGCGTTCGAAGTGACGTGATGCGTGACGGAGAAAAAGAGG


Appendix - 91 -

3E GACACGCGACTTTTTCCGCATGCGTTCGAAGTGACGTGATGCGTGACGGAGAAAAAGAGG

FIX GACACGCGACTTTTTCCGCATGCGTTCGAAGTGACGTGATGCGTGACGGAGAAAAAGAGG





TB40E GACACGCGACTTTTTCCGCATGCGTTCGAAGTGACGTGATGCGTGACGGAGAAAAAGAGG



Merlin GACACGCGACTTTTTCCGCATGCGTTCGAAGTGACGTGATGCGTGACGGAGAAAAAGAGG


















1D GACACGCGACTTTTTCCGCATGCGTTCGAAGTGACGTGATGCGTGACGGAGAAAAAGAGG

26A GACACGCGACTTTTTCCGCATGCGTTCGAAATGACGTGATGCGTGACGGAGAAAAAGAGG


7567 GACACGCGACTTTTTCCGCATGCGTTCGAAATGACGTGATGCGTGACGGAGAAAAAGAGG



Towne GACACGCGACTTTTTCCGCATGCGTTCGAAATGACGTGATGCGTGACGGAGAAAAAGAGG








****************************** *****************************

73A ACGCGGCTTCGGACAAGGAGAACCTGCGTCGGCCCGTGGTGCCGTCCACGTCGTCTCGCG

1817 ACGCGGCTTCGGACAAGGAGAACCTGCGTCGGCCCGTAGTGCCGTCCACGTCGTCTCGCG

AD169 ACGCGGCTTCGGACAAGGAGAACCTGCGTCGGCCCGTAGTGCCGTCCACGTCGTCTCGCG

59A ACGCGGCTTCGGACAAGGAGAACCTGCGTCGGCCCGTAGTGCCGTCCACGTCGTCTCGCG

81B ACGCGGCTTCGGACAAGGAGAACCTGCGTCGGCCCGTAGTGCCGTCCACGTCGTCTCGCG

84A ACGCGGCTTCGGACAAAGAGAACCTGCGTCGGCCCGTAGTGCCGTCCACGTCGTCTCGCG

3E ACGCGGCTTCGGACAAGGAGAACCTGCGTCGGCCCGTGGTGCCGTCCACGTCGTCTCGCG

FIX ACGCGGTTTCGGACAAGGAGAACCAACGTCGGGCCGTGGTGCCGTCCACGTCGTCTCGCG

47A ACGCGGCTTCGGACAAGGAGAACCAGCGTCGGCCCGTGGTGCCGTCCACGTCGTCTCGCG

37E ACGCGGCTTCGGACAAGGAGAACCAGCGTCGGCCCGTGGTGCCGTCCACGTCGTCTCGCG



TB40E ACGCGGCTTCGGACAAGGAGAACCAGCGTCGGCCCGTGGTGCCGTCCACGTCGTCTCGCG



Merlin ACGCGGCTTCGGACAAGGAGAACCAGCGTCGGCCCGTGGTGCCGTCCACGTCGTCTCGCG


7577 ACGCGGCTTCGGACAAGGAGAACCAGCGTCGGCCCGTGGTGCCGTCCACGTCGTCTCGCG

23B ACGCGGCTTCGGACAAGGAGAACCAGCGTCGGCCCGTGGTGCCGTCCACGTCGTCTCGCG

Appendix - 92 -











541 ACGCAGCTTCGGACAAGGAGAACCTGCGTCGGCCCGTGGTGCCGTCCACGTCGTCTCGCG

7800 ACGCGGCTTCGGACAAGGAGAACCTGCGTCGGCCCGTGGTGCCGTCCACGTCGTCTCGCG

6281 ACGCGGCTTCGGACAAGGAGAACCTGCGTCGGCCCGTGGTGCTGTCCACGTCGTCTCGCG

16B ACGCGGCTTCGGACAAGGAGAACCTGCGTCGGCCCGTGGTGCTGTCCACGTCGTCTCGCG

1D ACGCGGCTTCGGACAAGGAGAACCTGCGTCGGCCCGTGGTGCTGTCCACGTCGTCTCGCG






Towne ACGCGGCTTCGGACAAGGAGAACCTGCGTCGGCCCGTGGTGCCGTCCACGTCGTCTCGCG




4B ACGCGGCTTCGGACAAGGAGAACCTGCGTCGGCCCGTGGTGCCGTCCACGTCGTCTCGCG

45B ACGCGGCTTCGGACAAGGAGAACCTGCGTCGGCCCGTGGTGCCGTCCACGTCGTCTCGCG



**** * ********* ******* ****** **** **** *****************

73A GCAGCGCCGCCAGCGGCGACGGTTACCACGGCTTGCGCTGCCGCGAAACTTCGGCCATGT

1817 GCAGCGCCGCCAGCGGCGACGGTTACCACGGCTTGCGCTGCCGCGAAACTTCGGCCATGT

AD169 GCAGCGCCGCCAGCGGCGACGGTTACCACGGCTTGCGCTGCCGCGAAACTTCGGCCATGT


81B GCAGCGCCGCCAGCGGCGACGGTTACCACGGCTTGCGCTGCCGCGAAACTTCGGCCATGT


3E GCAGCGCCGCCAGCGGCGACGGTTACCACGGCTTACGCTGCCGCGAAACCTCGGCCATGT

FIX GCAGCGCCGCCAGCGGCGACGGTTACCACGGCTTGCGCTGCCGCGAAACCTCGGCCATGT

47A GCAGCGCCGCCAGCGGCGACGGTTACCACGGCTTGCGCTGCCGCGAAACCTCGGCCATGT

37E GCAGCGCCGCCAGCGGCGACGGTTACCACGGCTTGCGCTGCCGCGAAACCTCGGCCATGT



TB40E GCAGCGCCGCCAGCGGCGACGGTTACCACGGCTTGCGCTGCCGCGAAACCTCGGCCATGT



Merlin GCAGCGCCGCCAGCGGCGACGGTTACCACGGCTTGCGCTGCCGCGAAACCTCGGCCATGT


7577 GCAGCGCCGCCAGCGGCGACGGTTACCACGGCTTGCGCTGCCGCGAAACCTCGGCCATGT

23B GCAGCGCCGCCAGCGGCGACGGTTACCACGGCTTGCGCTGCCGCGAAACCTCGGCCATGT












7800 GCAGCGCCGCCAGCGGCGACGGTTACCACGGCTTACGCTGCCGCGAAACCTCGGCCATGT


Appendix - 93 -


1D GCAGCGCCGCCAGCGGCGACGGTTACCACGGCTTGCGCTGCCGCGAAACCTCGGCCATGT






Towne GCAGCGCCGCCAGCGGCGACGGTTACCACGGCTTGCGCTGCCGCGAAACCTCGGCCATGT

44A GCAGCGCCGTCAGCGGCGACGGTTACCACGGCTTGCGCTGCCGCGAAACCTCGGCCATGT







********* ************************ ************** **********

73A GGTCGTTCGAGTACGATCGCGACGGCGACGTGACCAGCGTACGCCGCGCTCTCTTCACCG

1817 GGTCGTTCGAGTACGATCGCGACGGCGACGTGACCAGCGTACGCCGCGCTCTCTTCACCG

AD169 GGTCGTTCGAGTACGATCGCGACGGCGACGTGACCAGCGTACGCCGCGCTCTCTTCACCG


81B GGTCGTTCGAGTACGATCGCGACGGCGACGTGACCAGCGTACGCCGCGCTCTCTTCACCG


3E GGTCGTTCGAGTATGATCGCGACGGCGACGTGACCAGCGTACGCCGTGCTCTCTTCACCG

FIX GGTCGTTCGAGTACGATCGCGACGGCGACGTGACCAGCGTACGCCGCGCTCTCTTCACCG


37E GGTCGTTCGAGTACGATCGCGACGGCGACGTGACCAGCGTACGCCGCGCTCTCTTCACCG


33E GGTCGTTCGAGTACGATCGTGACGGCGACGTGACCAGCGTACGCCGCGCTCTCTTCACCG

TB40E GGTCGTTCGAGTACGATCGCGACGGCGACGTGACCAGCGTACGCCGCGCTCTCTTCACCG



Merlin GGTCGTTCGAGTACGATCGCGACGGCGACGTGACCAGCGTACGCCGCGCTCTCTTCACCG








17E GGTCGTTCGAGTACGATCGCGACGGCGACGTGACCAGCGTACGCCGCGCTCTCTTCACCG







7800 GGTCGTTCGAGTATGATCGCGACGGCGACGTGACCAGCGTACGCCGCGCTCTCTTCACCG



1D GGTCGTTCGAGTACGATCGCGACGGCGACGTGACCAGCGTACGCCGCGCTCTCTTCACCG


29A GGTCGTTCGAGTACGATCGCGACGGCGACGTGACCAGCGTACGTCGCGCTCTCTTCACCG




Towne GGTCGTTCGAGTACGATCGCGACGGCGACGTGACCAGCGTACGCCGCGCTCTCTTCACCG






Appendix - 94 -



************* ***** *********************** ** *************

73A GCGGCAGCGACCCCTCGGACAGCGTGAGCGGCGTCCGCGGTGGACGCAAACGCCCGTTGC

1817 GCGGCAGCGACCCCTCGGACAGCGTGAGCGGCGTCCGCGGTGGACGCAAACGCCCGTTGC

AD169 GCGGCAGCGACCCCTCGGACAGCGTGAGCGGCGTCCGCGGTGGACGCAAACGCCCGTTGC


81B GCGGCAGCGACCCCTCGGACAGCGTGAGCGGCGTCCGCGGTGGACGCAAACGCCCGTTGC


3E GCGGCAGCGACCCCTCGGACAGCGTGAGCGGCGTCCGCGGTGGACGCAAACGCCCGTTGC

FIX GCGGCAGCGACCCCTCGGACAGCGTGAGCGGCGTCCGCGGTGGACGCAAACGCCCGTTGC


37E GCGGCAGCGACCCCTCGGACAGCGTGAGCGGCGTTCGCGGTGGACGCAAACGCCCGTTGC



TB40E GCGGCAGCGACCCCTCGGACAGCGTGAGCGGCGTCCGCGGTGGACGCAAACGCCCGTTGC



Merlin GCGGCAGCGACCCCTCGGACAGCGTGAGCGGCGTCCGCGGTGGACGCAAACGCCCGTTGC
















6281 GCGGCAGCGACCCCTCAGACAGCGTGAGCGGCGTCCGCGGTGGACGCAAACGCCCGTTGC

16B GCGGCAGCGACCCCTCAGACAGCGTGAGCGGCGTCCGCGGTGGACGCAAACGCCCGTTGC

1D GCGGCAGCGACCCCTCAGACAGCGTGAGCGGCGTCCGCGGTGGACGCAAACGCCCGTTGC






Towne GCGGCAGCGACCCCTCGGACAGCGTGAGCGGCGTCCGCGGTGGACGCAAACGCCCGTTGC








**************** ***************** *************************

73A GTCCGCCGTTGGTGTCGCTGGCCCGCACCCCGCTGTGCCGACGTCGTGTGGGCGGTGTGG

1817 GTCCGCCGTTGGTGTCGCTGGCCCGCACCCCGCTGTGCCGACGTCGTGTGGGCGGTGTGG

AD169 GTCCGCCGTTGGTGTCGCTGGCCCGCACCCCGCTGTGCCGACGTCGTGTGGGCGGTGTGG


81B GTCCGCCGTTGGTGTCGCTGGCCCGCACCCCGCTGTGCCGACGTCGTGTGGGCGGTGTGG


3E GTCCGCCGTTGGTGTCGCTGGCCCGCACCCCGCTGTGCCGACGTCGTGTGGGCGGCGTGG

FIX GTCCGCCGTTGGTGTCGCTGGCCCGCACCCCGCTGTGCCGACGTCGTGTGGGCGGCGTGC

47A GTCCGCCGTTGGTGTCGCTGGCCCGCACCCCGCTGTGCCGACGTCGTGTGGGCGGCGTGG

Appendix - 95 -




TB40E GTCCGCCGTTAGTGTCGCTGGCCCGCACCCCGCTGTGCCGACGTCGTGTGGGCGGCGTGG

95A GTCCGCCGTTAGTGTCGCTGGCCCGCACCCCGCTGTGCCGACGTCGTGTGGGCGGCGTGG

96A GTCCGCCGTTAGTGTCGCTGGCCCGCACCCCGCTGTGCCGACGTCGTGTGGGCGGCGTGG

Merlin GTCCGCCGTTGGTGTCGCTGGCCCGCACCCCGCTGTGCCGACGTCGTGTGGGCGGCGTGG


7577 GTCCGCCGTTGGTGTCGCTGGCCCGCACCCCGCTGTGCCGACGTCGTGTGGGCGGCGTGG

23B GTCCGCCGTTGGTGTCGCTGGCCCGCACCCCGCTGTGCCGACGTCGTGTGGGCGGCGTGG















1D GTCCGCCGTTGGTGTCGCTGGCCCGCACCCCGCTGTGCCGACGTCGTGTGGGCGGCGTGG






Towne GTCCGCCGTTGGTGTCGCTGGCCCGCACCCCGCTGTGCCGACGTCGTGTGGGCGGCGTGG

44A GTCCGCCGTTGGTATCGCTGGCCCGCACCCCGCTGTGCCGACGTCGTGTGGGCGGCGTGG







********** ** ***************************************** ***

73A ACGCGGTGCTCGAAGAAAACGACGTGGAGCTGCGCGCGGAAAGTCAGGACAGCGCCGTGG

1817 ACGCGGTGCTCGAAGAAAACGACGTGGAGCTGCGCGCGGAAAGTCAGGACAGCGCCGTGG

AD169 ACGCGGTGCTCGAAGAAAACGACGTGGAGCTGCGCGCGGAAAGTCAGGACAGCGCCGTGG


81B ACGCGGTGCTCGAAGAAAACGACGTGGAGCTGCGCGCGGAAAGTCAGGACAGCGCCGTGG


3E ACGCGGTGCTCGAAGAAAACGACGTGGAGCTGCGCGCGGAAAGTCAGGACAGCGCCGTGG

FIX ACGCGGTGCTCGAAGAAAACGACGTGGAGCTGCGCGCGGAAAGTCAGGACAGCGCCGTGG





TB40E ACGCGGTGCTCGAAGAAAACGACGTGGAGCTGCGCGCGGAAAGTCAGGACAGCGCCGTGG



Merlin ACGCGGTGCTCGAAGAAAACGACGTGGAGCTGCGCGCGGAAAGTCAGGACAGCGCCGTGG







Appendix - 96 -












1D ACGCGGTGCTCGAAGAAAACGACGTGGAGCTGCGCGCGGAAAGTCAGGACAGCGCCGTGG






Towne ACGCGGTGCTCGAAGAAAACGACGTGGAGCTGCGCGCGGAAAGTCAGGACAGCGCCGTGG








************************************************************

73A CATCGGGCCCGGGCCGCATTCCGCAGCCGCTCAGCGGTAGTTCCGGGGAGGAATCC

1817 CATCGGGCCCGGGCCGCATTCCGCAGCCGCTCAGCGGTAGTTCCGGGGAGGAATCC

AD169 CATCGGGCCCGGGCCGCATTCCGCAGCCGCTCAGCGGTAGTTCCGGGGAGGAATCC


81B CATCGGGCCCGGGCCGCATTCCGCAGCCGCTCAGCGGTAGTTCCGGGGAGGAATCC


3E CATCGGGCCCGGGCCGCGTTCCGCAGCCGCTTAGCGGTAGTTCCGGGGAGGAATCC

FIX CATCGGGCCCGGGCCGCGTTCCGCAGCCGCTCAGCGGTAGTTCCGGGGAGGAATCC

47A CATCGGGCCCGGGCCGCGTTCCGCAGCCGCTCAGCGGTAGTTCCGGGGAGGAATCC

37E CATCGGGCCCGGGCCGCGTTCCGCAGCCGCTCAGCGGTAGTTCCGGGGAGGAATCC



TB40E CATCGGGCCCGGGCCGCGTTCCGCAGCCGCTCAGCGGTAGTTCCGGGGAGGAATCC



Merlin CATCGGGCCCGGGCCGCGTTCCGCAGCCGCTCAGCGGTAGTTCCGGGGAGGAATCC


7577 CATCGGGCCCGGGCCGCGTTCCGCAGCCGCTCAGCGGTAGTTCCGGGGAGGAATCC

23B CATCGGGCCCGGGCCGCGTTCCGCAGCCGCTCAGCGGTAGTTCCGGGGAGGAATCC












7800 CATCGGGCCCGGGCCGCGTTCCGCAACCGCTCAGCGGTAGTTCCGGGGAGGAATCC

6281 CATCGGGCCCGGGCCGTGTTCCGCAGCCGCTCAGCGGTAGTTCCGGGGAGGAATCC

16B CATCGGGCCCGGGCCGTGTTCCGCAGCCGCTCAGCGGTAGTTCCGGGGAGGAATCC

1D CATCGGGCCCGGGCCGCGTTCCGCAGCCGCTCAGCGGTAGTTCCGGGGAGGAATCC


Appendix - 97 -





Towne CATCGGGCCCGGGCCGCGTTCCGCAGCCGCTCAGCGGTAGTTCCGGGGAGGAATCC








**************** ******* ***** ************************

Own publications

Webel, R., Hakki, M., Prichard, M., Rawlinson, W. D., Marschall, M., and Chou, S. (2014). Differential properties of cytomegalovirus pUL97 kinase isoforms affect viral replication and maribavir susceptibility. J Virol 88, 4776-4785.

Held, C., Webel, R., Palmisano, R., Hutterer, C., Marschall, M., and Wittenberg, T. (2014). Using multi-channel level sets to measure the cytoplasmic localization of HCMV pUL97 in GFP-β-gal fusion constructs. J Virol Meth 199, 61-67.

Graf, L., Webel, R., Wagner, S., Hamilton, S. T., Rawlinson, W. D., Sticht, H., and Marschall, M. (2013). The cyclin-dependent kinase ortholog pUL97 of human cytomegalovirus interacts with cyclins. Viruses 5, ISSN 1999-4915, www.mdpi.com/journal/viruses

Webel, R., Solbak, S. M., Held, C., Milbradt, J., Groß, A., Eichler, J., Wittenberg, T., Jardin, C., Sticht, H., Fossen, T., and Marschall, M. (2012). Nuclear import of isoforms of the cytomegalovirus kinase pUL97 is mediated by differential activity of NLS1 and NLS2 both acting through classical importin-α binding. J Gen Virol 93, 1756-1768.

Webel, R., Milbradt, J., Auerochs, S., Schregel, V., Held, C., Nöbauer, K., Razzazi-Fazeli, E., Jardin, C., Wittenberg, T., Sticht, H., and Marschall, M. (2011). Two isoforms of the protein kinase pUL97 of human cytomegalovirus are differentially regulated in their nuclear translocation. J Gen Virol 92, 638-649.

Held, C., Wenzel, J., Webel, R., Marschall, M., Lang, R., Palmisano, R. and Wittenberg, T. (2011). Using multimodal information for the segmentation of fluorescent micrographs with application to virology and microbiology. Conf Proc IEEE Eng Med Biol Soc, 6487-6490.

Milbradt, J., Webel, R., Auerochs, S., Sticht, H., and Marschall, M. (2010). Novel mode of phosphorylation-triggered reorganization of the nuclear lamina during nuclear egress of human cytomegalovirus. J Biol Chem 285, 13979-13989.

Contributions to national and international conferences

23nd Annual Meeting of the Society for Virology (GfV), Kiel, Germany (March 2013). Identification of three HCMV pUL97 isoforms expressed from alternative ATG start sites revealing insight into their importance for viral replication (poster presentation).

37th International Herpesvirus Workshop (IHW 2012), Calgary, Canada (August 2012). Specification of the HCMV pUL97 isoforms: differences in subcellular localization and functionality (poster presentation).

Appendix - 98 -

International Symposium: Forty Years of Virology at the University of Erlangen-Nuremberg, Erlangen, Germany (June 2012). Specification of the HCMV pUL97 isoforms and their differences in nuclear import (poster presentation).

22nd Annual Meeting of the Society for Virology (GfV), Essen, Germany (March 2012). Two NLS sequences within the cytomegaloviral protein kinase pUL97 regulate the nuclear import of both isoforms through the classical importin alpha/beta pathway (oral presentation).

1st International SFB 796 Conference: Mechanisms of viral host cell manipulations: from plants to humans, Bamberg, Germany (October 2011). Characterization of the nuclear import mechanism of two isoforms of the HCMV protein kinase pUL97 (poster presentation).

13th International CMV/Betaherpesvirus Workshop, Nuremberg, Germany (May 2011). Identification of two NLS sequences within the HCMV protein kinase pUL97 differentially regulating the nuclear translocation of two isoforms (poster presentation).

21st Annual Meeting of the Society for Virology, Freiburg, Germany (March 2011). The HCMV protein kinase pUL97 contains two NLS sequences responsible for regulation of nuclear translocation of two isoforms (poster presentation).

35th International Herpesvirus Workshop (IHW 2010), Salt Lake City, USA (July 2010). The UL97 gene of human cytomegalovirus encodes two isoforms showing regulatory similarities and differences (poster presentation).

Contributions to graduate school retreats

5th Retreat of Integrated Research Training Group (SFB 796), Bad Staffelstein, Germany (Juli 2013). Cytomegalovirus protein kinase pUL97: formation of three isoforms and their relevance for efficient viral replication (oral presentation).

4th Retreat of Integrated Research Training Group (SFB 796), Bad Staffelstein, Germany (Juli 2012). Characterization of the HCMV protein kinase pUL97 highlighting differences in the isoform-specific nuclear import (oral and poster presentation).

3rd Retreat of Integrated Research Training Group (SFB 796), Bad Staffelstein, Germany (Juli 2011). Nuclear transport regulation of two isoforms of the cytomegalovirus protein kinase pUL97 (oral and poster presentation).

Appendix - 99 -

Acknowledgements

I would like to acknowledge Prof. Dr. Bernhard Fleckenstein for the opportunity to perform my

PhD thesis at the Institute for Clinical and Molecular Virology.

I wish to thank Prof. Dr. Andreas Burkovski, who kindly agreed to supervise and review my

PhD thesis for the School of Sciences, Friedrich-Alexander-University of Erlangen-Nuremberg.

I would like to express my sincere thanks to my advisor Prof. Dr. Manfred Marschall for giving

me the great possibility to work on this project. Thank you for continuous advice throughout my

PhD thesis, for your encouragement and for the opportunity to gain experience in other

laboratories (from Norway to Down Under).

Furthermore, I would like to thank Prof. Dr. Heinrich Sticht for scientific support and mentoring

(SFB 796) and Prof. Dr. Thomas Stamminger for helpful discussions and advice.

I would like to extend my thanks to the Integrated Research Training Group of SFB 796 for

providing an excellent education program and interdisciplinary skills.

Many thanks go to all present and former members of the Marschall and Stamminger labs for

the friendly atmosphere, their scientific help and all the fun we had in and out of the lab. In

particular, I want to thank my direct lab neighbors Ina and Myri for their valuable advice and a lot

of rememberable moments and Jens for helping me whenever I had questions not concerning

pUL97. Special thanks go to Sabrina, who became a really good friend of mine. Thank you for

all the talks, discussions and laughter that made the last years such a great time.

My sincere gratitude goes to my family for their support throughout my entire education.

I always feel loved and I know that you believe in me.

Very special thanks go to my love Andi for supporting me in every step of my life and for the

patience during some hard times. I love you!

Protein kinase pUL97 of human cytomegalovirus - functional ... · Rike Nadine Silke Webel aus...

Documents

Transcript of Protein kinase pUL97 of human cytomegalovirus - functional ... · Rike Nadine Silke Webel aus...