The Guanine Nucleotide Exchanger Vav2 Interacts with c-ErbB-2 and

Induces Alveolar Morphogenesis of Mammary Epithelial Cells

DISSERTATION zur Erlangung des akademisches Grades

doctor rerum naturalium (Dr. rer. nat.)

im Fach Biologie

eingereicht an der

Mathematisch-Naturwissenschaftlichen Fakultät I

der Humboldt-Universität zu Berlin

von

Dipl. Biochem. Silvana Di Cesare

geb. am 23.09.63 in La Plata, Argentinien

Präsident der Humboldt-Universität zu Berlin

Prof. Dr. Jürgen Mlynek

Dekan der Mathematisch-Naturwissenschaftlichen Fakultät I

Prof. Dr. Bernhard Ronacher

Gutachter: 1. Prof. Dr. Harald Saumweber

2. Prof. Dr. Walter Birchmeier

3. Prof. Dr. Franz Theuring

Tag der mündlichen Prüfung: 9. November 2001

i

CONTENTS

1 INTRODUCTION 3 1.1 Development of the Mammary Gland 4

1.1.1 Regulation by Systemic Hormones 4 1.1.2 Local Effects of Multiple Growth Factors 6 1.1.3 The Role of Extracellular Matrix 9

1.2 The ErbB Family of Receptor Tyrosine Kinases 11 1.2.1 ErbB Ligands Contain an EGF-like Domain 12 1.2.2 Generation of Signal Diversity 13 1.2.3 Intracellular Effectors of ErbB Receptors 15 1.2.4 ErbB Signaling in Embryonic Development 16 1.2.5 ErbB Receptors in Mammary Gland Development 18

1.3 Vav Family of Guanine Nucleotide Exchange Factors 23

2 MATERIALS AND METHODS 25 2.1 Amplification of the Hollenberg cDNA Yeast Expression Library 25 2.2 Yeast Plasmids and Strains 25 2.3 Yeast Two-Hybrid Screen 27 2.4 Verification of Interacting Clones 28 2.5 Mutagenesis of the Yeast TprMet-ErbB2 Baits 29 2.6 Mammalian Expression Plasmids 30 2.7 Site-Directed Mutagenesis 30 2.8 Mammalian Cell Lines 31 2.9 Immunoprecipitation and Western Blotting 32 2.10 Matrigel Assays 33 2.11 Light and Electron Microscopy 34 2.12 In Situ Hybridization Analysis 34

3 RESULTS 35 3.1 Yeast Two-Hybrid Screen with ErbB-2 Bait Proteins 35 3.2 Distinct Phosphotyrosine Residues of ErbB-2 Bind to Various Interaction Partners 39 3.3 Vav2 Interacts with Receptor Tyrosine Kinases of the ErbB Subfamily 41 3.4 Vav2 Induces Alveolar Morphogenesis of EpH4 Mammary Epithelial Cells 43 3.5 Vav2 and ErbB-2 Can Both Directly and Indirectly Associate in Mammalian Cells 47 3.6 Vav2 and ErbB-2 Are Associated in Mammary Epithelium During Pregnancy 49 3.7 The Dbl-Homology Domain of Vav2 Is Required for Its Morphogenic Activity in EpH4 Cells 50 3.8 Catalytically Inactive Vav2 Blocks Neuregulin-Mediated Morphogenesis of EpH4 Cells 52

ii

4 DISCUSSION 54 4.1 Modified Yeast Two-Hybrid System: A Powerful Tool to Search for Phosphotyrosine-Interacting

Proteins 54 4.2 New Insights into the Intracellular Signaling Pathways of ErbB-2 55 4.3 Vav2 Couples to Receptor Tyrosine Kinases via Its SH2 Domain 56 4.4 Vav2 Mediates ErbB-2 Signals for Alveolar Morphogenesis of EpH4 Mammary Epithelial Cells 58 4.5 The Morphogenic Activity of Vav2 on Mammary Epithelial Cells May Involve Changes in Actin

Cytoskeleton 62 4.6 Vav2 Is a Specific Effector of Neuregulin Signals for Alveolar Morphogenesis 63 4.7 Possible Molecular Mechanisms Involving Vav2 as Critical Effector of Alveolar Morphogenesis 65 4.8 Conclusions 68

REFERENCES 70

ERKLÄRUNG 95

1

ABSTRACT

The ErbB receptor tyrosine kinases constitute a subfamily of four structurally related

members, the EGF receptor (ErbB-1), ErbB-2, ErbB-3 and ErbB-4. ErbB receptor tyrosine

kinases are critical for embryonic development of central and peripheral neural structures and

heart. In addition, ErbB receptors play an important role in the postnatal development of the

mammary gland. Previous studies showed that activated ErbB-2 receptor induces alveolar

morphogenesis of EpH4 mammary epithelial cells that are cultured on a three-dimensional

matrix (termed Matrigel). However, the downstream signaling proteins that mediate this

biological activity of ErbB-2 were unknown. In this work, Vav2 was identified as a direct

interaction partner of tyrosine-phosphorylated ErbB receptors using the yeast two-hybrid

system. Vav2 is a member of a family of guanine nucleotide exchange factors that induce

cytoskeletal rearrangements, transcriptional alterations, and have oncogenic potential when

activated. To test the ability of Vav2 to mediate morphogenic signals of ErbB-2, EpH4 cells

overexpressing Vav2 protein were cultured on Matrigel. Indeed, Vav2 induces alveolar

morphogenesis of EpH4 cells when activated either by oncogenic mutation or tyrosine

phosphorylation by ErbB-2. The morphogenic activity of Vav2 requires the Dbl homology

domain, which mediates GDP/GTP exchange. Dominant-negative Vav2 specifically blocks

the morphogenic signals of ErbB-2 in EpH4 cells without interfering with ErbB2-induced

mitogenesis. Importantly, Vav2 is co-expressed and interacts with ErbB-2 in the mammary

glands of pregnant mice. Taken together, these results point to Vav2 as a candidate to mediate

ErbB-2 signals for alveolar morphogenesis in vivo, which is a relevant step in the

development of the mammary gland during pregnancy.

2

ZUSAMMENFASSUNG

Die Familie der ErbB-Rezeptor-Tyrosinkinasen besteht aus vier Mitgliedern, dem EGF-

Rezeptor (ErbB-1), ErbB-2, ErbB-3 und ErbB-4. ErbB-Rezeptoren spielen eine wichtige

Rolle bei der Entwicklung des Nervensystems, des Herzens und der Brustdrüsen. Ein Teil

dieser Differenzierungsvorgänge läßt sich in vitro nachvollziehen: so ist zum Beispiel die

Aktivierung des ErbB-2 Rezeptors ausreichend für alveoläre Morphogenese der

Brustdrüsenepithelzellinie EpH4. Intrazelluläre Moleküle, die dieses ErbB2-Signal

übertragen, sind allerdings noch unbekannt. Mit Hilfe eines neuen, modifizierten Hefe-2-

Hybrid-Systems wurde in der vorliegenden Arbeit Vav2 als neuer Interaktionspartner von

ErbB-2 identifiziert. Vav2 assoziiert mit aktiviertem ErbB-2 über eine SH2-Domäne. Die

Interaktion ist direkt und ist von zwei Phosphotyrosinen in ErbB-2 abhängig. Vav2 kann den

GDP/GTP-Austausch bei GTPasen der Rho-Familie vermitteln. Dadurch kann der Umbau des

Zytoskeletts und Veränderungen der Transkription sowie Zelltransformation induziert werden.

In einem dreidimensionalen Zellkultursystem kann aktiviertes Vav2 in EpH4 Zellen die

Bildung von alveolären Zellaggregaten induzieren. In diesen Alveolen umgibt eine Schicht

polarisierter milchproduzierender Zellen ein zentrales Lumen. Diese Vav2-vermittelte

Morphogenese ist abhängig von der katalytischen GDP/GTP-Austausch Aktivität von Vav2.

Katalytisch-inaktives Vav2 kann die morphogenetische Aktivität von ErbB-2 in EpH4-Zellen

verhindern, ohne die mitogene Aktivität von ErbB-2 zu beeinflussen. Vav2 ist mit ErbB-2

coexprimiert und interagiert mit dem Rezeptor in Brustdrüsenzellen schwangerer Mäuse.

Diese Untersuchungen deuten darauf hin, dass Vav2 eine wichtige Funktion bei der durch

ErbB-2 induzierten alveolären Morphogenese der Brustdrüse spielt.

3

1 INTRODUCTION

Epithelium and mesenchyme are two distinct types of tissues that are present in virtually every

organ. Lung, kidney, vascular system and most glands consist of tubular epithelial networks

embedded in mesenchymal tissue. The formation of the first rudiments for these tree-like

structures is specified during embryogenesis; epithelial buds invade the underlying

mesenchyme and ramify to create interconnected tubules, a process known as branching

morphogenesis. Lungs, salivary glands and mammary glands exhibit further developmental

changes, namely alveolar morphogenesis, whereby round hollow alveoli arise from the ductal

tree and differentiate into the functional units of the organ. Mesenchymal-epithelial

interactions are strictly required for patterning morphogenic events (Sawer and Fallon, 1983);

mesenchymal soluble factors bind to their epithelial receptors thus activating several signaling

pathways which lead to local cellular responses like growth, motility, morphogenesis and

differentiation.

The mammary gland is one of the most interesting models to study mesenchymal-epithelial

interactions, as they play critical roles not only in embryonic mammary development but also

in postnatal growth and differentiation of the gland. The mammary gland is a dynamic organ

which has the unique property to undergo main developmental changes after birth. The

complex mechanisms supporting mammary ductal branching and alveolar morphogenesis

have been subject of extensive research, but are still far from being fully unravelled.

This work characterizes Vav2 as a novel intracellular effector of the receptor tyrosine kinase

ErbB-2 that mediates lobulo-alveolar morphogenesis of the mammary gland. The first part of

this Introduction reviews the developmental stages of the mammary gland and their

regulation. The second part concerns the ErbB family of receptor tyrosine kinases and their

role in mammary gland development. The third part describes features of the Vav family of

guanine nucleotide exchange factors that may be useful for interpreting the results.

4

1.1 Development of the Mammary Gland

The development of the murine mammary gland will be here outlined, since the mouse is the

most thoroughly studied mammalian model (reviewed in Sakakura, 1987; Silberstein et al.,

2001). During embryonic life, the mammary anlagen appear between days E10-E12 as an

invagination of epidermal cells into the underlying mesenchyme, the fat pad. The mammary

fat pad differentiates from deeply-placed mesenchymal cells. At day E16, primary ducts

emerge from the epithelial rudiments into the fat pad and undergo an initial round of

branching morphogenesis. Later, the nipples derive from epidermal invagination around the

primary duct. The infant mammary gland consists of a primitive ductal tree that emanates

from the nipple into the proximal fat pad. During puberty (5 to 8 weeks of age), the ducts

elongate and branch further into the fat pad. The growing points for ductal growth are

structures termed end buds, located at the terminal ends of the ducts. These end buds consist

of two distinguishable cell populations: the cap cells, which are the progenitors for

myoepithelium, and the body cells, which give rise to mammary epithelium. During the

estrous cycle, alveolar buds first emerge from the lateral walls of the ducts, then regress and

form again in the next cycle. Alveolar morphogenesis begins early in pregnancy with

extensive budding of alveoli from the ducts; later, alveoli cluster to form lobulo-alveolar

structures that are the secretory units of milk components throughout late pregnancy and

lactation. Following weaning, the glands undergo a remodelling process known as involution

(Lund et al., 1996; Li et al., 1997); during this phase, massive epithelial apoptosis results in

destruction of lobulo-alveolar structures and regression of the gland to the pre-pregnancy

state.

1.1.1 Regulation by Systemic Hormones

The development and biology of the mammary gland is controlled by a complex interplay of

systemic hormones and local growth factors. Hormones are critical regulators of mammary

5

development both in embryonic and postnatal life. Once the embryonic mammary buds are

formed, they stimulate expression of androgen receptors in the surrounding mesenchyme

(Kratochwil, 1986). Testicular androgens from male fetuses induce regression of the epithelial

mammary rudiment at E14, whereas estrogens are apparently not required for prenatal

development (Korach, 1994).

The structure and functionality of the postnatal mammary tissue is orchestrated by hormonal

changes occurring with age, estrous cycle and reproductive status. Pubertal growth and

secretory differentiation of mammary parenchyme is dependent on ovarian steroids (estrogen,

progesterone), prolactin and growth hormone. A role for estrogen and progesterone in ductal

growth has been demonstrated by genetic and tissue recombination studies. Estrogen induces

ductal dichotomous branching via paracrine stimulation of the stromal receptors, whereas the

epithelial receptors are dispensable (Bocchinfuso and Korach, 1997; Cunha et al., 1997).

Conversely, progesterone targets its epithelial receptors at puberty to promote ductal side-

branching (Lydon et al., 1995; Brisken et al., 1998). Genetic ablation of prolactin or its

epithelial receptor revealed that prolactin controls regression of terminal end buds and ductal

side-branching during puberty (Ormandy et al., 1997; Horseman et al., 1997); these effects of

prolactin are indirect and may involve regulation of ovarian production of progesterone

(Brisken et al., 1999). Recent tissue recombination experiments circumvented the sterility of

the abovementioned knockout mice and showed that both progesterone and prolactin act

directly on their epithelial receptors to stimulate lobulo-alveolar development (Brisken et al.,

1998; Brisken et al., 1999). Ectopic expression of growth hormone in transgenic mice leads to

precocious mammary development and epithelial differentiation (Bchini et al., 1991),

indicating that growth hormone promotes functional differentiation of the gland. This effect

may be mediated by insulin-like growth factor-1 (IGF-1), as growth hormone induces

synthesis of IGF-1 in stromal mammary cells (Kleinberg, 1997). Moreover, an essential role

of IGF-1 in end bud formation was shown by the targeted deletion of IGF-1, which resulted in

6

retardation of ductal morphogenesis that could be rescued by exogenous IGF-1 (Ruan and

Kleinberg, 1999).

1.1.2 Local Effects of Multiple Growth Factors

The complexity of signals that control postnatal mammary growth and differentiation is

intriguing. Systemic hormones may synergize with a variety of growth factors that are locally

produced either in the mammary mesenchyme (like HGF/SF, FGF-4, FGF-2, KGF, HRG1α,

TGF-β, insulin-like growth factors) or in the mammary epithelium (Wnts, EGF, TGF-α,

amphiregulin, FGF-1). This section concerns stimulatory and inhibitory growth factors that

are implicated in growth and differentiation of the mammary gland. The function of EGF-like

growth factors and their receptors in mammary development will be addressed separately.

The role of Wnt signals in mammary development begins in embryonic life. Lef-1 null mice

fail to form mammary anlagen (van Genderen et al., 1994). Synergism of Wnt and parathyroid

hormone-related peptide (PTHrP) signals has been shown to be essential for branching

morphogenesis, sexual dimorphism and nipple formation of the mammary gland during

embryogenesis (Wysolmerski et al., 1998; Dunbar and Wysolmerski, 1999; Foley et al.,

2001). In postnatal life, the Wnt pathway is essential for mammary growth and differentiation

during pregnancy. Wnt-4 and progesterone signals trigger interconnected cascades that control

ductal side-branching and alveolar morphogenesis; using genetic and tissue recombination

techniques, Brisken et al. (2000) showed that progesterone impacts nearby epithelial cells to

induce expression of Wnt-4, which in turn synergistically acts in a paracrine fashion to

promote ductal side-branching. Further support for a role of Wnt signaling in mammary

development at pregnancy comes from genetic experiments with β-catenin, a downstream

effector of the Wnt pathway. Mammary glands from virgin mice overexpressing an active β-

catenin mutant show pregnancy-like lobulo-alveolar development and differentiation (Imbert

et al., 2001); however, ductal side-branching is normal in these transgenic mice. These

findings suggest that the canonical Wnt signaling pathway contributes to alveolar

7

morphogenesis, while Wnt control of ductal side-branching during pregnancy is not mediated

by β-catenin but by other as yet unknown downstream effectors. Alternative Wnt-induced

effectors are reviewed elsewhere (Hülsken and Birchmeier, 2001).

Previous observations suggest a role for hepatocyte growth factor/scatter factor (HGF/SF) and

its receptor c-Met in ductal growth of the virgin mammary gland. HGF/SF and its receptor c-

Met are coordinately produced in mammary mesenchyme and epithelium, respectively, with

highest expression levels throughout puberty and in adult life until mid-pregnancy (Pepper et

al., 1995; Niranjan et al., 1995; Yang et al., 1995); HGF/SF is expressed at low levels during

late pregnancy and throughout lactation, and expression again increases during involution of

the glands. In support of a role in ductal growth, HGF/SF stimulates branching when human

mammary organoids are cultured on collagen, resembling the ductal elongation events that are

observed in the mammary gland during puberty (Niranjan et al., 1995). Similarly, exogenous

HGF induces extensive ductal branching in organ culture, whereas antisense HGF

oligonucleotides block ductal growth of explanted mouse mammary glands (Yang et al.,

1995). Branching morphogenesis is also observed in organotypic cell culture experiments

whereby primary mammary epithelial cells, or cells from the mammary epithelial cell lines

NMuMG and EpH4 are grown on three-dimensional matrices in the presence of HGF/SF

(Niranjan et al., 1995; Soriano et al., 1995; Niemann et al., 1998). However, direct proof of a

physiological role of HGF/SF signaling in the mammary gland in vivo is still awaited.

Factors that regulate differentiation of cells from the mononuclear phagocytic lineage also

appear to be involved in mammary development. The colony stimulating factor 1 gene (CSF-

1) is disrupted by an inactivating mutation in the recessive osteopetrosis (op) allele;

homozygous op/op mice show a lactational defect due to incomplete mammary ductal side-

branching and lactational failure, despite normal lobulo-alveolar morphogenesis and

expression of milk proteins (Pollard and Hennighausen., 1994). The TNF family member

osteoprotegerin-ligand or osteclast differentiation factor (ODF) synergizes with CSF-1 in

8

osteoclastogenesis (Lacey et al., 1998); absence of ODF or its epithelial receptor RANK

(receptor activator of NFκB) impairs formation of lobulo-alveolar structures during pregnancy

due to enhanced cell death; however, and in contrast to CSF-1 ablation, it does not affect side-

branching (Fata et al., 2000). These results suggest a model whereby CSF-1 regulates ductal

sprouting, and ODF subsequently promotes lobulo-alveolar development and terminal

differentiation.

The formation of the adult mammary gland depends not only on growth stimulation but also

on active inhibition, which prevents infilling the extraglandular mesenchyme. There is ample

evidence that various TGF-β factors reversibly inhibit growth of the mammary end buds

(reviewed in Silberstein, 2001). Overexpression of TGF-β1 in the mammary gland leads to

impaired ductal elongation (Pierce et al., 1993) and absence of alveolar outgrowth and milk

secretion (Jhappan et al., 1993), indicating that TGF-β1 negatively regulates both ductal and

alveolar morphogenesis. Conversely, inhibition of TGF-β1 signaling promotes excessive

ductal branching in mice that overexpress a kinase-deficient TGF-β type II receptor in the

mammary stroma (Gorska et al., 1998; Joseph et al., 1999); this effect may be driven by up-

regulation of HGF/SF expression, thus suggesting that the chronic inhibition of ductal growth

by TGF-β1 results from its down-regulatory effect on the periductal synthesis of HGF/SF.

Transgenic mice and transplantation experiments identified TGFβ-3 as a local factor that is

secreted by alveolar cells upon milk stasis, and initiates apoptosis during the first stage of

involution (Nguyen et al., 2000); the autocrine pro-apoptotic effect of TGFβ-3 involves

activation of Stat3 followed by up-regulation of IGF-binding protein-5 (IGFBP-5), which

sequesters and inactivates the mitogen IGF-1 (Li et al., 1997; Tonner et al., 1997; Chapman et

al., 1999; Nguyen et al., 2000).

The role of fibroblast growth factor (FGF) signaling in the mammary gland is still

controversial; whereas the different members of the FGF family show a temporally and

spatially regulated expression in mammary tissue, genetic experiments suggest that they may

9

have redundant roles in the development of the gland. Expression of endogenous FGF4 and its

receptor, FGFR1, is detected in virgin females, but not during pregnancy and lactation

(Coleman-Knarcik et al., 1994; Chodosh et al., 2000). However, transgenic mice for FGF4

exhibit hyperplastic lobulo-alveolar structures that persist longer after weaning due to

impaired apoptosis, and mice expressing an ectopic dominant-negative form of FGFR1 in

mammary epithelium surprisingly lack a discernible phenotype (Morini et al., 2000). It is

possible that FGF4, like TGFβ factors, plays a role in the control of apoptotic remodelling

during ductal development and involution. In contrast to the transgenics for inactive FGFR1,

mice overexpressing a dominant-negative FGFR2 transgene show an impairment in lobulo-

alveolar development by mid-pregnancy (Jackson et al., 1997); knockout mice for FGF-7, its

putative mammary ligand, show normal mammary development (Guo et al., 1996). Future

research employing combined FGF-factor knockout mice may help to understand the function

of this family in mammary tissue.

To conclude, the mammary development is regulated by multiple growth and differentiation

factors and their intracellular signaling cascades. Loss of a single factor is often not

compensated by the others, indicating that these factors trigger essential interacting or

intersecting signaling cascades. Therefore, integration of these signals and the identification of

new mammogenic factors still represent a major challenge.

1.1.3 The Role of Extracellular Matrix

The inducing effects of embryonic mesenchyme or its postnatal counterpart, termed stroma,

are partially mediated by components of the extracellular matrix (ECM). In the adult gland,

epithelial cells are in direct contact with basal myoepithelial cells and with the ECM structure

known as basement membrane. The basement membrane is a complex and organized three-

dimensional array of laminin, type IV collagen, heparan sulphate, proteoglycans and other

proteins (Timpl, 1996). It is known that cell-ECM interactions influence tissue architecture

through modulation of signaling pathways that affect cell growth, differentiation, survival and

10

morphogenesis (reviewed in Adams and Watt, 1993). The use of reconstituted basement

membranes provides an excellent system to study the essential role of ECM for lactogenic

differentiation in vitro. In organotypic cell culture, synthesis and secretion of milk

components by mammary epithelial cells results from the interrelated effects of hormones,

cell-cell and cell-ECM contacts (reviewed in Lin and Bissell, 1993). Primary mammary

epithelial cells fail to differentiate to a secretory phenotype when cultured on plastic or onto a

thin collagen type I layer (Emerman and Pitelka, 1977; Berdichevsky et al., 1992); however,

these cells undergo alveolar morphogenesis and secrete milk proteins vectorially when

cultured on a reconstituted, laminin-rich matrix from Engelbreth-Holm-Swarm (EHS)

tumours (termed Matrigel; Kleinman et al., 1986; Barcellos-Hoff et al., 1989). Indeed,

adhesion of mammary epithelial cells to laminin is critical for β-casein gene expression and

for activation of Stat5, an essential regulator of milk gene expression (Streuli et al., 1995a;

Streuli et al., 1995b; see also section 2.5 of this Introduction). However, the extent of

morphogenic events in vitro is limited, indicating that additional signals from living stromal

cells are required to support formation of fully-developed ducts or alveoli.

Integrins are cellular receptors for laminin, a major ECM component (Sonnenberg et al.,

1990). Integrins are expressed at the basal membrane of epithelial cells both in mammary

alveolar tissue and in EHS-cultured alveoli (Streuli et al., 1991). A role of integrins as

physiological receptors for ECM was suggested by cell culture studies in which integrin

function was blocked by pan-antibodies (Streuli et al., 1991); such blocking antibodies

prevented the expression of milk proteins by mammary epithelial cells embedded in EHS

matrix, indicating that the ECM induces lactogenic differentiation via integrin signaling.

Genetic studies confirmed that integrins are cellular laminin receptors that control mammary

functional differentiation; targeted expression of a transgene coding for an inactive β1-

integrin subunit impairs lobulo-alveolar development and secretory differentiation during

pregnancy (Faraldo et al., 1998). Moreover, laminin accumulates at the lateral surface of

11

luminal cells in the transgenic glands, indicating that integrin-ECM interactions determine

baso-apical polarity of alveolar cells.

Overall, it is evident that direct cell-ECM contacts contribute to the induction of morphogenic

and lactogenic events in mammary development. Future work will help to fully understand the

cooperative effects of the ECM and other mitogenic factors in growth, morphogenesis and

functional differentiation of the mammary epithelium.

1.2 The ErbB Family of Receptor Tyrosine Kinases

ErbB proteins belong to subclass I of the superfamily of receptor tyrosine kinases. This family

has evolved from a single ligand-receptor pair in Caenorhabditis elegans, lin-3/let-23 (Aroian

et al., 1990). Drosophila melanogaster also express one ErbB receptor, but three activating

ligands and one inhibitor (Freeman, 1998). In vertebrates, the ErbB family comprises four

membrane receptors: the epidermal growth factor receptor (EGF receptor; also termed ErbB-

1, HER1), ErbB-2 (c-Neu, HER2), ErbB-3 (HER3) and ErbB-4 (HER4) (reviewed in

Olayioye et al., 2000). These receptors share a glycosylated extracellular ligand-binding

region with two cysteine-rich domains, a transmembrane stretch, and an intracellular region

that encompasses a tyrosine kinase domain and a C-terminal tail containing the

autophosphorylation sites. ErbB-1, ErbB-2 and ErbB-4 encode ligand-activated tyrosine

kinases, whereas the corresponding ErbB-3 sequence is apparently devoid of kinase activity

(Guy et al., 1994). ErbB receptors show different patterns of expression: ErbB-1 is expressed

by liver parenchymal cells, fibroblasts, keratinocytes and several epithelial tissues, like the

basal layer of the skin (Adamson, 1990; Partanen, 1990); ErbB-2 is expressed in a variety of

tissues including nervous system, connective tissue and secretory epithelium (Kokai et al.,

1987); ErbB-3 is expressed primarily in epithelium of various organs, in peripheral nervous

system and in oligodendrocytes, while ErbB-4 is mostly restricted to central nervous system,

cardiac muscle and glial cells (Pinkas-Kramarski et al., 1997). These differential expression

12

patterns are consistent with specific biological activities during embryonic life (discussed in

Section 2.4 of this Introduction).

The ErbB receptors are activated upon ligand binding, a general mechanism that is shared by

various receptor tyrosine kinases. Ligand binding induces formation of receptor dimers; this

key step allows each receptor subunit to cross-phosphorylate tyrosine residues in the

activation loop of the kinase domain of its partner, thus enhancing the catalytic activity

(Hubbard et al., 1998). Following activation of the kinases, specific tyrosine residues on the

C-terminal tail of the receptors become autophosphorylated; these phosphotyrosine residues

are docking sites for intracellular signaling molecules that couple the receptors to signal

transduction cascades, thus ultimately resulting in specific cellular responses. The hallmark of

the ErbB family is the formation of both homo- and heterodimers following ligand binding.

Moreover, each ligand induces the formation of preferential dimers in tissues where more than

two ErbB receptors are expressed, leading to signal diversification (see below). The cellular

routing of each receptor after ligand binding also differs for each family member: ErbB-1

undergoes rapid internalization and targets EGF for lysosomal degradation, whereas the other

ErbBs are slowly internalized and are recycled back to the cell surface without significant

degradation of the endocytosed ligand (Baulida et al., 1996; Pinkas-Kramarski et al., 1996;

Lenferink et al., 1998).

1.2.1 ErbB Ligands Contain an EGF-like Domain

ErbB receptors are activated upon binding ligands that are known as EGF-related growth

factors. These factors are mostly produced as transmembrane precursors, which can be

proteolytically cleaved, thus releasing the extracellular, biologically active region. ErbB

ligands are characterized by the presence of a conserved EGF-like domain of 35-50 amino

acids that is essential for receptor binding. Six cystein residues form three disulfide bonds that

hold together the characteristic three-loop structure of this motif. EGF-like ligands can be

grouped according to their receptor-binding affinity: EGF, amphiregulin and transforming

13

growth factor-α (TGF-α) specifically bind to ErbB-1; betacellulin, heparin-binding EGF (HB-

EGF) and epiregulin bind both ErbB-1 and ErbB-4; neuregulins are a complex family of

proteins that include NRG-1 and NRG-2, which bind to ErbB-3 and ErbB-4, and the recently

described NRG-3 and NRG-4, which bind to ErbB-4. So far, no direct ligand for ErbB-2 has

been described (Peles et al., 1993; Tzahar et al., 1994).

NRG-1 (also termed Neu differentiation factor) was first isolated from medium of Ras-

transformed rat fibroblasts, and the human counterpart Heregulin was detected in medium of

breast cancer cells (reviewed in Peles and Yarden, 1993). Two neuronal factors, termed glial

growth factor (GGF) and acetylcholine receptor-inducing activity (ARIA) are alternatively

spliced variants of NRG-1. Four different nrg genes code for the neuregulin isoforms and their

related variants (Holmes et al., 1992; Wen et al., 1992; Falls et al., 1993; Marchionni et al.,

1993; Carraway et al., 1997; Chang et al., 1997; Harari et al., 1999). NRG-1 shows a wide

expression pattern during embryogenesis, being detectable in the central nervous system and

in ventricular endothelium (Meyer et al., 1995). NRG-2 is also expressed in embryonic neural

tissue and heart but otherwise is largely non-overlapping with NRG-1 expression (Carraway et

al., 1997; Chang et al., 1997). NRG-3 expression is restricted to developing and adult nervous

tissue (Zhang et al., 1997); NRG-4 is highly expressed in adult pancreatic tissue and weakly

in muscle, but no data exist about embryonic expression (Harari et al., 1999).

1.2.2 Generation of Signal Diversity

It has been proposed that EGF-like ligands are bivalent; in case of NRG-1, an N-terminally

located high affinity site with narrow specificity first binds a direct receptor (ErbB-3 or ErbB-

4), and then a second C-terminal site recruits a co-receptor with lower affinity but broader

specificity, ErbB-2 usually being the preferred one (Tzahar et al., 1997). Such a mechanism

may account for the diversity of receptor dimers that are observed with a single ligand, as well

as for the activation of the orphan receptor ErbB-2 in response to different EGF-like growth

factors (Karunagaran et al., 1996; Graus-Porta et al., 1997). Evidence for the existence of all

14

ten possible homo- and heterodimers of ErbB proteins has been reported, including the ErbB-

2 homodimer that is stabilized by oncogenic mutation or overexpression (Riese et al., 1995;

Tzahar et al., 1996). This network of inter-receptor interactions displays a strict hierarchy

rather than a random pattern (Tzahar et al., 1996). In fact, ErbB-2 is the preferred

heterodimerization partner for all other ErbB family members. A driving force for the

preferential binding to ErbB-2 could be that heterodimers containing ErbB-2 have a very low

rate of ligand dissociation compared to other receptor pairs; this property of ErbB-2 can

significantly prolong cell stimulation by every ErbB ligand (Graus-Porta et al., 1995;

Karunagaran et al., 1996). In the absence of ErbB-2, NRG-1 induces formation of other

heterodimers like ErbB-1/ErbB-3 and ErbB-1/ErbB-4 heterodimers, which explains the

inhibition in trans of EGF binding to ErbB-1 when NRG-1 is present (Karunagaran et al.,

1995). The existence of several ligands, together with their distinct ability to stabilize

preferential homo- and heterodimeric receptor pairs, points to the existence of a hierarchical

network of ligand-stimulated receptor dimerization events within the ErbB family (Pinkas-

Kramarski et al., 1996).

Autophosphorylation of tyrosine residues may also be influenced by the heterodimer

combination (Olayioye et al., 1998); in this way, each receptor has the ability to interact with

distinct sets of intracellular signaling proteins thus increasing the functional versatility of the

ErbB family. There are four potential mechanisms which may account for ligand-induced

differential phosphorylation of the receptors (reviewed in Sweeney and Carraway, 2000). One

ligand may induce receptor dimerization and phosphorylation of a particular subset of tyrosine

residues. Binding to a different ligand could influence site usage for phosphorylation by

promoting the association of the dimeric receptor complex with other cellular proteins like

kinases, phosphatases or even cell surface molecules, which may mediate phosphorylation or

dephosphorylation of specific sites. Alternatively, this second ligand could stimulate the

assembly of oligomeric receptor complexes, or induce a different conformation of the receptor

pair. Taken together, combinatorial dimerization and ligand-induced diversification of

15

signaling appear to confer ErbB receptors the potential to give rise to a broad range of cellular

responses; moreover, because each receptor is unique in terms of catalytic activity, cellular

routing and transmodulation, the resulting network allows fine tuning and stringent control of

cellular functions.

1.2.3 Intracellular Effectors of ErbB Receptors

As for other receptor tyrosine kinases, ligand-induced autophosphorylation of ErbB receptors

on specific tyrosine residues creates docking sites for cytoplasmic signaling proteins

containing Src-homology2 (SH2) or phosphotyrosine-binding (PTB) domains (reviewed in

Pawson, 1995). The binding specificity of these proteins is determined by the amino acid

sequences adjacent to the phosphorylated tyrosines; amino acids located N-terminally

determine the binding of specific PTB domains, and amino acids that are C-terminally located

select SH2 domains. All ErbB family members, including the C. elegans and D. melanogaster

homologs Let23 and DER, couple via Shc and/or Grb-2 to the mitogen-activated protein

kinase (MAPK) pathway (Pinkas-Kramarski et al., 1996). However, certain intracellular

proteins are preferential substrates of specific ErbB receptors. ErbB-3 is a preferred activator

of p85 subunit of phosphatidylinositol-3-kinase (PI-3-K) due to the multiple specific binding

motifs present in the ErbB-3 C-terminal tail, which are virtually absent in case of ErbB-2

(Fedi et al., 1994; Prigent et al., 1994). Similarly, the negative regulator c-Cbl and

phospholipase Cγ1 (PLCγ1) couple to both ErbB-1 and ErbB-2 but not to ErbB-3 or ErbB-4

(Fazioli et al., 1991; Fedi et al., 1994; Cohen et al., 1996; Levkowitz et al., 1998; Klapper et

al., 2000; Levkowitz et al., 2000). Olayioye et al. (2000) offers an excellent review of the

present knowledge about the intracellular mediators of ErbB signals. As this work aimed to

find novel substrates for the ErbB-2 receptor, its known downstream effectors will be

described in detail.

ErbB-2 contains 5 putative autophosphorylation sites in its C-terminal tail, termed here Y1

(the most N-terminal tyrosine residue) to Y5 (the most C-terminal one; Hazan et al., 1989;

16

Segatto et al., 1990; Akiyama et al., 1991). It has been described that Shc binds to Y4 through

its PTB domain (Segatto et al., 1993; Ricci et al., 1995; Dankort et al., 1997). Grb-2 directly

binds to Y2 via its SH2 domain, and indirectly via Shc (Ricci et al., 1995; Dankort et al.,

1997). Chk binds to Y5 (Zrihan-Licht et al., 1998). Grb-7, c-Src, Ras-GTPase activating

protein (Ras-GAP) and the abovementioned PLCγ1 also interact with ErbB-2, though the

binding sites are unclear (Fazioli et al., 1991; Jallal et al., 1992; Stein et al., 1994;

Muthuswamy and Muller, 1995b).

The functional role of the ErbB-2 autophosphorylation sites in receptor-mediated

transformation has been assessed by mutational analysis of the rodent constitutively active

ErbB-2, termed Neu (Dankort et al., 1997). Absence of all major autophosphorylation sites of

Neu dramatically decreases transforming activity upon overexpression in fibroblasts. The C-

terminal tyrosine residues Y2 to Y5 can independently mediate transformation, since they

fully restore transforming activity when individually added back to the inactive receptor. In

contrast, the first tyrosine residue Y1 may not be involved in receptor-mediated

transformation, as the resulting add-back mutant lacks transforming potential; moreover, Y1

may represent a negative regulatory site, since it supresses transforming activity when restored

in combination with any other single tyrosine residue. Recent studies show that the

functionally-redundant add-back mutants containing tyrosines Y2, Y4 and Y5 activate Ras to

induce transformation, whereas the add-back mutant containing tyrosine Y3 operates

independently of Ras to activate MAPK (Dankort et al., 2001).

1.2.4 ErbB Signaling in Embryonic Development

The importance of ErbB signaling in development was revealed by genetic studies in mice.

Null mutations of individual ErbB receptor loci are embryonic lethal. Loss of erbB-1 leads to

embryonic or perinatal lethality depending on the genetic background of the host (Miettinen et

al., 1995; Sibilia et al., 1995; Threadgill et al., 1995; Sibilia et al., 1998); the mice display

abnormalities in multiple organs including brain, skin, lung and gastrointestinal tract. Mice

17

that show spontaneous or targeted mutation of TGFα, one of the various ErbB-1 ligands,

show only part of the phenotype observed in erbB-1 null mice, like impaired development of

the eyes and hair follicles (Luetteke et al., 1993; Mann et al., 1993); this partial overlap

suggests that each ErbB-1 ligand may play a distinct developmental role. The information

gained by targeted mutation of erbB-2, erbB-3 and erbB-4 receptors and their ligand NRG-1

clearly demonstrates that distinct receptor heterodimers are essential for different

developmental events. ErbB-2 -/- mice die at midgestation (E10.5) due to malformation of

myocardial trabeculae in the heart ventricle (Lee et al., 1995), a phenotype that is shared by

the NRG-1 (Meyer et al., 1995) and the erbB-4 null mice (Gassmann et al., 1995). These

results are consistent with the view that NRG-1, which is expressed in endothelial cells of the

endocardium (Meyer and Birchmeier, 1994), is required for activation of myocardial ErbB-

2/ErbB-4 heterodimers to promote trabecular formation in the developing heart. In contrast to

ErbB-2 and ErbB-4, ErbB-3 is not expressed in myocardium but in mesenchyme of the pre-

valvular endocardial cushions. Accordingly, erbB-3 null mice die at day E13.5 displaying

normal heart trabeculation but defective valve formation (Erickson et al., 1997; Riethmacher

et al., 1997).

In addition to cardiac abnormalities, erbB-3 -/- mice show a generalized neural crest defect

that affects both central and peripheral nervous structures. ErbB-3 mutant mice fail to form

cranial sensory ganglia due to impaired migration of neurons from the hindbrain neural crest

(Erickson et al., 1997; Riethmacher et al., 1997). This phenotype is also observed in mice

lacking erbB-2 or NRG-1 (Lee et al., 95; Meyer et al., 1995); in contrast, erbB-4 deficient

mice do not exhibit deficient cellularity of cranial ganglia but rather the innervation of these

ganglia is disrupted, thus suggesting a unique role for ErbB-4 (Gassmann et al., 1995). In the

peripheral nervous system, erbB-3 -/- mice completely lack Schwann cell precursors and

Schwann cells that normally accompany nerves (Erickson et al., 1997; Riethmacher et al.,

1997). In addition, degenerative motor and sensory neurons are found in the dorsal root

ganglia (Erickson et al., 1997; Riethmacher et al., 1997), and migration of sympathogenic

18

neural crest cells is also impaired in erbB-3 mutants (Britsch et al., 1998); similar defects

have been observed in NRG-1 and erbB-2 deficient mice (Meyer et al., 1995; Kramer et al.,

1996; Britsch et al., 1998). It is evident from these studies that ErbB-2/ErbB-3 heterodimers

transmit NRG-1 signals for neural crest cells to migrate. Recently, the early mortality of erbB-

2 null mice has been rescued by myocardial expression of an erbB-2 transgene (Morris et al.,

1999; Woldeyesus et al., 1999); erbB-2 rescued mice show striking similarities with the erbB-

3 null mice, thus confirming the role of ErbB-2/ErbB-3 complexes in the development of the

peripheral nervous system. Data on genetic ablation of the other NRG genes are largely

missing. Mice carrying a targeted mutation of the NRG-3 gene, however, do not show an overt

phenotype, but may deserve a more detailed analysis (T. Müller and C. Birchmeier,

unpublished data). So far, the differential embryonic expression of the various neuregulin

proteins and their distinct biological properties in vitro suggest different physiological

functions (Carraway et al., 1997; Chang et al., 1997; Crovello et al., 1998). Together, these

observations show the critical function of ErbB receptors and their ligands during

embryogenesis. Moreover, the above genetic studies define distinct developmental roles for

certain receptor combinations and are therefore strong support for the occurrence of signal

diversification in vivo.

1.2.5 ErbB Receptors in Mammary Gland Development

There is considerable evidence that ErbB signaling has important roles in both normal and

neoplastic growth of the mammary gland. All four ErbB receptors are found in mammary

tissue (Schroeder et al., 1998). In prepubescent mammary gland, ErbB-1 and ErbB-2 are

widely expressed in epithelium, stroma and mesenchymal fat, with ErbB-1 levels being

particularly high in stromal cells. In the mature gland, ErbB-3 and ErbB-4 are also detected;

just at this stage, ErbB-1 and ErbB-2 are differentially located: ErbB-1 is present in stroma

and adipose compartments, while ErbB-2 is prominent in epithelium. During pregnancy, the

four ErbB receptors are coordinately expressed in mammary epithelium; ErbB-1 and ErbB-2

are found at high levels in the alveolar epithelium throughout pregnancy, whereas ErbB-3 and

19

ErbB-4 levels increase preferentially in the ductal epithelium later in pregnancy. During

lactation, receptor levels are low. ErbB-1 and ErbB-2 expression markedly increases during

involution, while ErbB-3 expression declines and ErbB-4 expression is not detectable.

Despite expression of all ErbB receptors during puberty, only ErbB-1 and ErbB-2 are

tyrosine-phosphorylated while ductal growth occurs (Sebastian et al., 1998). ErbB-3 and

ErbB-4 seem to be present in a non-phosphorylated, inactive state at this stage, suggesting that

none of them is relevant for ductal morphogenesis. Endogenous phosphorylation of all four

receptors is detected during late pregnancy and lactation, with increasing levels of tyrosine-

phosphorylated ErbB-1, ErbB-2 and ErbB-4 later at lactation. Information of the

phosphorylation state of the ErbB receptors during involution is missing.

Like the receptors, the six EGFR ligands and NRG-1 are differentially expressed in mammary

tissue (Schroeder et al., 1998). TGFα, betacellulin and heparin-binding EGF (HB-EGF)

transcripts are found in prepubescent mammary gland and through mid-pregnancy, drop

markedly during late pregnancy and lactation and again increase at involution. Amphiregulin

and epiregulin transcripts appear in mature virgin glands and early in pregnancy, respectively;

transcript levels of both factors decline later in pregnancy, remain low throughout lactation

and involution, and reappear as the gland again resembles the mature virgin state. EGF

transcripts are present at low levels in the virgin gland, and they dramatically increase during

late pregnancy and lactation and return to low levels during involution. The NRG-1α isoform

is found in mammary mesenchyme and shows a strongly regulated pattern of expression

(Yang et al., 1995). NRG-1 is present at low levels in the virgin gland. At mid-pregnancy,

NRG-1 exhibits a sudden concentration peak and then rapidly decreases to basal levels, which

are constant later in pregnancy, throughout lactation and involution.

Several lines of evidence support a role of ErbB signaling in the development of the

mammary gland. In early studies using mice, pellets containing EGF-like factors were

20

surgically implanted into the mammary glands to allow the slow local release of these factors.

Implants of EGF, TGFα and NRG-1α stimulate ductal side-branching and lobulo-alveolar

morphogenesis in virgin glands (Vonderhaar et al., 1987; Jones et al., 1996). EGF- or TGFα-

induced alveoli lack secretory activity; in contrast, alveoli that derive from NRG-1α treatment

are differentiated into secretory structures, which accumulate secreted milk proteins in their

luminal compartment. These observations indicate that all factors can promote formation of

alveoli but only NRG-1α stimulates their terminal differentiation. In other experiments, EGF-

like growth factors were directly injected into the mammary glands to study their ability to

induce tyrosine phosphorylation of ErbB receptors. Treatment of prepubescent glands with

EGF stimulates tyrosine phosphorylation of stromal ErbB-1 (the EGF receptor) and ErbB-2

(Schroeder et al., 1998; Sebastian et al., 1998); as above mentioned, endogenous

phosphorylation of ErbB-1 and ErbB-2 is observed in mammary tissue during puberty

(Sebastian et al., 1998). Therefore, it is likely that locally-produced EGF induces at puberty

the formation of active ErbB-1/ErbB-2 heterodimers, which may be essential for mammary

ductal growth. Exogenous EGF induces phosphorylation of ErbB-1 and ErbB-2 at pregnancy,

despite all ErbB receptors being present; in contrast, administration of NRG-1β results in

trans-phosphorylation of all ErbB receptors, clearly indicating that neuregulin can induce the

formation of combinatorial receptor complexes at pregnancy. Together with the pregnancy-

restricted expression of neuregulin in mammary mesenchyme (Yang et al., 1995), these

findings strongly suggest that NRG-1 may play a major role in the mammary gland during

pregnancy to promote alveolar morphogenesis via trans-activation of ErbB heterodimeric

receptors.

Convincing evidence of the physiological role of ErbB signals in mammary development has

been supplied by genetic studies in mice; moreover, the phenotypes of knockout or transgenic

mice support the differential roles of the ErbB receptors and their ligands that could be

expected from the abovementioned stimulation studies, and from expression and activation

patterns in vivo. Mammary glands from mice carrying a targeted mutation of the amphiregulin

21

gene show impaired ductal growth, whereas TGFα/EGF double null mice show normal

mammary development at this stage (Luetteke et al., 1999). Amphiregulin null mammary

glands are competent for lobuloalveolar differentiation; however, additional loss of TGFα

and/or EGF severely compromises lactogenesis. Coherent with these findings, expression of a

TGFα transgene in mammary tissue induces precocious alveolar development in virgin

females, alveolar hyperplasia during pregnancy and delayed involution (Matsui et al., 1990;

Sandgren et al., 1995). Together, these results suggest distinct functions of the various ErbB-1

ligands in the mammary gland: amphiregulin may be critical for ductal growth during puberty,

while TGFα or EGF may be involved in alveolar differentiation during pregnancy. ErbB-1 is

activated in virgin tissue; mammary expression of a transgene encoding a dominant-negative

ErbB-1 receptor (the EGF receptor) inhibits ductal branching in the glands of virgin mice thus

showing a role for ErbB-1 signaling in pubertal mammary development (Xie et al., 1997);

similarly, female waved-2 mice, which carry a spontaneous inactivating mutation of the erbB-

1 gene, display impaired glandular development (Fowler et al., 1995). Transplantation and

tissue recombination experiments further support a role for ErbB-1 in ductal morphogenesis.

Mammary gland grafts from neonatal erbB-1 -/- mice fail to undergo ductal growth (Sebastian

et al., 1998); however, they develop lobulo-alveolar structures when stimulated by prolactin,

indicating that the EGF receptor is essential for ductal branching but not for alveolar

morphogenesis (Wiesen et al., 1999). Moreover, tissue recombinants revealed that wild-type

fat pad supports outgrowth of erbB-1 -/- epithelium whereas the -/- fat pad does not, thus

clearly showing the relevant role of stromal ErbB-1 in mammary ductal growth.

A role for NRG-1 in mammary gland development during pregnancy is substantiated by its

restricted expression and pan-activating effect on ErbB receptors at this stage (see above).

Indeed, mammary glands from mice that lack NRG-1α fail to undergo lobulo-alveolar

morphogenesis at pregnancy (Li et al., submitted); NRG-1α is the isoform that is normally

expressed in the glands. In contrast, NRG-1β null mice die during embryogenesis; the NRG-

1β isoform accounts for the cardiac and neural crest phenotypes that were described in section

22

2.4 of this Introduction (C. Birchmeier, unpublished data). These results definitely

demonstrate that NRG-1α is the naturally occurring isoform in mammary tissue, where it

functions during pregnancy as a critical growth factor that promotes alveolar morphogenesis

and secretory differentiation. Further insights into the mechanisms of neuregulin-induced

morphogenesis have been gained from genetic studies with ErbB receptors. Expression of

dominant-negative forms of erbB-2 and erbB-4 in the mammary gland of transgenic mice

revealed a physiological role for both receptors in lobulo-alveolar development at late

pregnancy and lactation (Jones et al., 1999; Jones and Stern, 1999). Moreover, there is genetic

and biochemical evidence that Stat5a mediates morphogenic signals of ErbB-4 in the

mammary gland during lactation (Liu et al., 1997; Jones et al., 1999). According to this data,

it can be speculated that NRG-1α induces alveolar morphogenesis via signaling pathways that

involve trans-activation of ErbB-2 and ErbB-4 and transcriptional regulation by Stat5a.

As already mentioned in Section 1.3 of this Introduction, the physiological processes that

prepare the mammary gland for lactogenesis can be mimicked in vitro using organ culture and

organotypic assays. By these means, our group has extensively contributed to understand the

function of neuregulin in the mammary gland. The pioneering work of Yang et al. (1995) has

shown that NRG promotes lobulo-alveolar differentiation of mammary gland explants in

organ culture. The same morphogenic effect of neuregulin has been observed by Niemann et

al. (1998) in organotypic cell culture. Treatment with neuregulin induces EpH4 mammary

epithelial cells to form alveoli-like structures when cultured on a Matrigel reconstituted

matrix; moreover, alveolar cells functionally differentiate and secrete milk components into a

luminal compartment, thus reproducing in vitro the physiological responses of mammary

epithelium to neuregulin. In addition, these studies show that activation of exogenous ErbB-2

receptor tyrosine kinase is sufficient for EpH4 cells to undergo alveolar morphogenesis in the

Matrigel system. The present work contributes to understand the intracellular mechanisms

underlying the morphogenic events of neuregulin-stimulated EpH4 cells in organotypic

23

culture, for it identifies Vav2 as an essential mediator of ErbB-2 specific signals leading to

alveolar morphogenesis.

1.3 Vav Family of Guanine Nucleotide Exchange Factors

Vav proteins constitute a family of structurally related guanine nucleotide exchange factors

that are involved in signaling pathways leading to cytoskeletal rearrangements and changes in

gene expression (reviewed in Bustelo, 2000). Vav, the first member of the family, was

identified as an oncogene encoding a constitutively active protein which lacks 67 amino acids

at the N-terminus and induces transformation of NIH 3T3 fibroblasts (Katzav et al., 1989;

Katzav et al., 1991). Vav expression and function is restricted to the hematopoietic system,

and T and B lymphocytes derived from vav -/- mice reveal defects in antigen-receptor induced

proliferation (Fischer et al., 1995; Tarakhovsky et al., 1995; Zhang et al., 1995; Fischer et al.,

1998). The recently discovered vav2 and vav3 are also expressed in tissues of non-

hematopoietic origin, among them epithelia (Schuebel et al., 1996; Movilla et al., 1999).

Transient expression of N-terminally truncated Vav2 and Vav3 proteins in fibroblasts results

in morphological changes such as membrane ruffling and formation of lamellipodia, and N-

terminally truncated Vav2 is transforming in fibroblasts (Schuebel et al., 1996; Schuebel et

al., 1998; Movilla et al., 1999). Vav2 has been implicated in cell-mediated killing by

cytotoxic lymphocytes and in cellular responses following activation of B cell receptor and

CD19 (Billadeau et al., 2000; Doody et al., 2000; Doody et al., 2001; Tedford et al., 2001).

Vav and Vav3 can enhance NFκB-dependent transcription after TCR engagement (Moores et

al., 2000). No biological function has as yet been assigned to Vav2 and Vav3 in epithelial

tissues. Vav proteins share many different structural domains, among them a Dbl-homology

domain that is responsible for their GDP/GTP exchange activity, and an SH2 domain that may

link them to receptor tyrosine kinases (Bustelo, 2000). Indeed, tyrosine phosphorylation is

required for the activation of full-size but not of N-terminally truncated forms of Vav proteins

(Bustelo, 2000). Recently, crystallographic analysis revealed that the N-terminus of Vav acts

24

as an autoinhibitory site, and that phosphorylation of one specific tyrosine residue within this

region relieves autoinhibition (Aghazadeh et al., 2000).

25

2 MATERIALS AND METHODS

Standard protocols for various techniques in molecular biology, like preparation and analysis

of DNA and RNA, enzymatic manipulation, transfection of DNA into mammalian cells,

protein analysis and setup of polymease chain reaction (PCR) were performed according to

Current Protocols in Molecular Biology (Ausubel et al., 1994).

2.1 Amplification of the Hollenberg cDNA Yeast Expression Library

The Hollenberg mouse embryo cDNA library (Behrens et al., 1996) was amplified to gain

enough plasmid for yeast transformation. E.coli library culture was thawed on ice, and 103 and

106 dilutions were made in LB-ampicillin selective medium. One µl of the 103 dilution, and

50-100 µl of the 106 dilution was mixed with LB-ampicillin medium, spread onto LB-

ampicillin plates and incubated at 37°C overnight. On the next day, colonies were counted to

calculate the library titer (number of colony forming units per ml of bacterial suspension). A

volume of this suspension containing twice as much cells as the number of independent

clones of the library (5x106) was diluted in LB-ampicillin, plated at 200,000 colonies per 15-

cm dish (nearly confluent) and incubated at 37°C overnight. Colonies were scraped into 1.5-

liter selective medium; this suspension was incubated at 37°C with shaking for a further 2 h,

bacteria were pelleted and large-scale plasmid isolation was performed using Megaplasmid

columns 2500 (Qiagen).

2.2 Yeast Plasmids and Strains

Bait proteins for the yeast two-hybrid system are encoded in the pBTM116 vector (Bartel and

Fields, 1995). This vector carries the TRP1 gene and has a polylinker downstream of LexA

coding sequences. The E. coli repressor LexA consists of two domains: a C-terminal domain,

which is responsible for dimerization prior to DNA binding, and an N-terminal domain

responsible for specific binding to a palindromic operator containing the CTGTNNNN

consensus half-site. The Hollenberg library is inserted in the VP16 vector, which carries the

26

LEU2 gene and contains a nuclear localization signal-VP16 activation domain sequence

upstream of the multiple cloning site. Both pBTM116 and VP16 yeast expression vectors bear

a bacterial origin of replication and an ampicillin resistance gene, which allow plasmid

amplification in bacteria.

To generate TprMet-ErbB2 yeast baits, a cDNA fragment encoding amino acids 1005-1260 of

rodent ErbB-2 harbouring a Y1253F mutation was inserted into the Not I/Sal I sites of pSK+

(Stratagene) This region stretches over Y1028 (Y1), Y1144 (Y2), 1201 (Y3) and 1226/7 (Y4)

of ErbB-2. A cDNA sequence coding for dimerization and kinase domains of TprMet (amino

acids 1-481; Park 86 cell) was generated by PCR; this fragment, flanked by 5´ Not I/EcoR I

and 3´ Not I sites, was inserted into the Not I site at 5´ end of ErbB-2 in pSK+, thus rendering

the hybrid cDNA for the TprMet-ErbB2(Y1-4) bait. The complete cDNA sequence was

finally subcloned downstream of LexA into EcoR I/Sal I sites of pBTM116 yeast expression

vector. A new TprMet hybrid protein was constructed to include Y1253 (Y5) of ErbB-2 in the

bait. An ErbB-2 sequence encoding amino acids 1197-1260 was fused to TprMet as above to

generate the TprMet-ErbB2(Y3-5) bait; thus, Y1201 (Y3), 1226/1227 (Y4) and 1253 (Y5) of

ErbB-2 were present in this bait. A BTM-TprMet-∆tail control plasmid lacking the Met C-

terminal multiple docking site was constructed by inserting a PCR fragment encoding amino

acids 1-479 of TprMet into the EcoR I site of pBTM116. To generate kinase-deficient bait

proteins, the wild type sequences of TprMet were excised by EcoR I/Not I and replaced by a

PCR fragment containing the inactivating mutation K243A (Rodrigues and Park, 1993).

Both TprMet-ErbB2(Y1-4) and TprMet-ErbB2(Y3-5) bait proteins were used to screen the

Hollenberg cDNA library from E10.5 mouse embryos. Saccharomyces cerevisiae strain L40

was used as host. This yeast strain carries two reporter genes, HIS3 and lacZ, whose

expression is driven by minimal GAL1 promoters fused to multimerized LexA binding sites;

therefore, yeast expressing LexA activators can be detected as histidine prototrophs or by

measurable β-galactosidase activity. A pBTM116-lamin plasmid was used as a further control

27

to eliminate false positive clones. Reagents and methods for yeast two-hybrid analyses were

adapted from MATCHMAKERTM Handbook (PT1265-1, Clontech).

2.3 Yeast Two-Hybrid Screen

Bait plasmids and library were sequentially introduced into host L40 yeast strain to improve

the efficiency of transformation. Briefly, yeast was initially transformed with bait plasmid in a

small-scale procedure, and then library screens were performed (Fields and Song, 1989). To

prepare competent yeast, a single colony of L40 yeast was inoculated into 20 ml of YPD (10

g/l yeast extract, Difco; 20 g/l peptone, Difco; 2% dextrose) medium and incubated at 30°C

overnight. On the next day, culture was diluted 10-fold and further incubated until OD600 was

0.5. Cells were pelleted, washed with water and resuspended in 1.5 ml of sterile 1X TE/LiAc

(10 mM Tris-HCl pH 7.5, 1 mM EDTA, 100 mM lithium acetate). Competent L40 yeast was

then transformed with bait plasmid; 0.5 µg of plasmid DNA was mixed with 50 µg of salmon

sperm carrier DNA, 50 µl of competent yeast and 300 µl PEG/TE/LiAc (40% polyethylene

glycol, 1X TE/LiAc), vortexed and incubated at 30°C for 30 min. DMSO was added to 10%,

and heat-shock transformation was performed at 42°C for 15 min. Mixture was chilled on ice,

cells were pelleted, resuspended in 250 µl water and spread onto selection agar plates lacking

tryptophan. Colonies appear after 2 or 3 days. For the library screen, one single colony of the

bait transformants was grown to obtain 200 ml of a saturated cell suspension (OD600 greater

than 1) in medium without tryptophan. This culture was added to 800 ml YPD medium to

prepare 20 ml of competent yeast as above. Yeast suspension was incubated at room

temperature for 10 min, and 10 mg carrier DNA, 250 µg library DNA and 140 ml

PEG/TE/LiAc was addded. Mixture was incubated at 30°C for 30 min, 17.6 ml of DMSO was

added, and heat-shock transformation was performed as above. Co-transformed yeast cells

were resuspended in 1 liter YPD and incubated at 30°C for 1 h. Cells were pelleted,

resuspended in selection medium lacking tryptophan and leucine and further incubated at

30°C for 8 h. Finally, cells were resuspended in 10 ml water and 200 µl of a dilution series

was plated onto 50 selection agar plates without tryptophan, leucine and histidine in the

28

presence of 20 mM 3-aminotriazole and incubated at 30°C. Double transformants that express

interacting proteins rendered colonies within 8-10 days, which were re-plated onto fresh

selection agar plates for further analysis.

2.4 Verification of Interacting Clones

Interaction between bait and preys was confirmed by β-galactosidase activity filter assay and

by re-transfection of bait and prey plasmids back into yeast. For filter assay, colonies from

selection plates (without tryptophan and leucine) were replica-transferred onto a Whatman

Nr.1 filter. The replica filter was submerged in liquid nitrogen to permeabilize cells, and then

allowed to thaw. The filter was placed (colonies facing up) onto another filter presoaked in Z

buffer/X-gal solution (60 mM Na2HPO4, 40 mM NaH2PO4, 10 mM KCl, 1 mM MgSO4, pH

7.0, 0.27% β-mercaptoethanol and 0.334 g/l X-gal) and incubated at 30°C. Colonies

expressing β-galactosidase appeared blue within 1-12 h.

For yeast re-transformation, library plasmids encoding interacting proteins were isolated from

individual positive colonies. To remove the bait plasmid from double transformant yeast,

colonies were inoculated into medium lacking leucine and cultured at 30°C for 1 day. Growth

in the absence of tryptophan selection allows survival of yeast segregants without bait

plasmid, which is randomly lost. To isolate the library plasmid from yeast segregants, cells

from 1 ml of the above culture were pelleted, lysed in 200 µl of lysis buffer (2% Triton X-100,

1% SDS, 100 mM NaCl, 1 mM EDTA, 10 mM Tris pH 8.0) and disrupted in the presence of

200 µl phenol/chloroform/isoamyl alcohol (25:24:1) and 0.3 g of acid-washed glass beads by

vortexing for 2 min; suspension was clarified by centrifugation and plasmid was recovered

from the supernatant by standard ethanol precipitation. Library plasmid was amplified in E.

coli HB101 strain, which is leucine auxotroph due to a leuB mutation. HB101 cells were

electroporated with the isolated library plasmid and plated onto selection agar plates without

leucine; therefore, transformants can be selected by complementation with the yeast LEU2

gene from the VP16 library plasmid. Bait and prey plasmids were re-transformed into yeast

29

according to the small-scale transformation protocol previously described. True positive

interacting clones grew again on selective agar plates without tryptophan, leucine and

histidine and were positive in β-galactosidase assays.

2.5 Mutagenesis of the Yeast TprMet-ErbB2 Baits

Mutational analysis of the bait proteins was performed to characterize the ErbB-2 binding

sites for each interacting protein found in the screen. Deletion mutants bearing single or

tandem tyrosine residues of the ErbB-2 multiple docking region were generated by standard

PCR. The PCR fragments were flanked by 5´ Not I and 3´ Sal I sites, and were used to replace

the ErbB-2 wild type sequence of the hybrid TprMet-ErbB2 baits. The ErbB-2 deletion

mutants fused to TprMet were: Y1 (amino acids 1014-1081) includes Y1028; Y1-2 (amino

acids 1014-1160) includes Y1028 and Y1144; Y2 (amino acids 1138-1160) includes Y1144;

Y2-3 (amino acids 1138-1221) includes Y1144 and Y1201; Y2F-3 is a variant of Y2-3 in

which Y2 was mutated to F using a commercial kit (Clontech); Y3 (amino acids 1194-1221)

includes Y1201; Y3-4 (amino acids 1194-1244) includes Y1201 and Y1226/1227; Y4 (amino

acids 1220-1244) includes Y1226/1227; Y4-5 (amino acids 1220-1260) includes Y1226/1227

and Y1253; Y5 (amino acids 1248-1260) includes Y1253.

Expression of the various TprMet-ErbB2 proteins in the yeast was checked by Western blot

analysis using anti-LexA antibodies (Clontech). L40 yeast transformants were grown in

selective medium without tryptophan at 30°C. During exponential growth phase, OD600 was

measured for 1 ml suspension; cells were pelleted from an aliquot corresponding to OD600=

0.5 and resuspended in 100 µl 2X denaturing buffer for SDS-PAGE (100 mM Tris base, pH

6.8, 20% glycerol, 4% SDS, 2% β-mercaptoethanol, 0.2% bromphenol blue). Twenty µl of

this suspension was loaded per slot onto an 8% polyacrylamide gel, proteins were resolved,

blotted in a PVDF membrane and Western Blotting was performed according to standard

protocols.

30

2.6 Mammalian Expression Plasmids

Full-length cDNA of Vav2 (∆29 isoform; Schuebel et al., 1996) was isolated from a λgt11

E17.5 mouse embryo cDNA library, using a cDNA fragment of Vav2 from a clone found in

the yeast two-hybrid screen. To generate Flag-tagged Vav2 proteins, the corresponding cDNA

sequences were inserted in frame in the Not I site downstream of a Flag epitope tag in pcDNA

3.1(+) (Invitrogen). The cDNAs of ∆N-Vav2 (encoding amino acids 189-839 of full-

sizeVav2) and ∆N-Vav2-∆C (encoding amino acids 189-595) were amplified by PCR using

full-size Vav2 as template. To generate ∆N-Vav2-dblmut and ∆N-Vav2-∆C∆PH, the

sequences encoding amino acids 336-342 and 383-507, respectively, were further deleted by

overlapping PCR. To generate the cDNA of TrkErbB2-∆tail, an Nco I/Not I fragment

encoding the ErbB-2 C-terminal tail (amino acids 1006-1260) was removed from a

pSK+/TrkErbB2 plasmid (Sachs et al., 1996) and replaced by a triple HA epitope tag flanked

by Nco I and compatible EagI sites; then, the sequence coding for HA-tagged TrkErbB2-∆tail

was excised EcoR I/Eag I and subcloned into pcDNA 3.1(+) using EcoR I/Not I sites. The

cDNA of HA-tagged TrkErbB2-Vav2 was constructed by inserting the full-size sequence of

Vav2 (encoding residues 2-839) into the Eag I site downstream from triple HA. To generate

the kinase-deficient mutant TrkErbB2-Kin-, a 951 bp-cDNA fragment containing the

inactivating K758A mutation was excised by Nco I/Mro I from the pLSV-K758A plasmid

(Ben-Levy et al., 1994) and inserted into pUC118-TrkErbB2 (Sachs et al., 1996) in place of

the wild-type sequence; the cDNA of TrkErbB2-Kin- was excised by Acc65 I/Spe I from

pUC118 and inserted into Acc65 I/Xba I sites of pcDNA 3.1(+). In TrkErbB2mut, Y1028 and

Y1201 of ErbB-2 C-terminal tail were mutated to phenylalanine using a commercial kit

(Clontech).

2.7 Site-Directed Mutagenesis

The TransformerTM Site-Directed Mutagenesis kit (Clontech) was used to generate Trk-ErbB2

variants in which single or pairs of tyrosine residues of the ErbB-2 C-terminal tail were

31

mutated to phenylalanine. Two oligonucleotide primers were used to introduce a base change

in double-stranded DNA. One primer (referred to as the mutagenic primer) introduced the

desired mutation. The second primer (referred to as the selection primer) disrupted a unique

restriction site to facilitate the ultimate selection of the mutated plasmid. A unique Sca I of

pUC118-Trk-ErbB2 was mutated to a Hpa I site with the selection primer 5'

CAGAATGACTTGGTTAACTACTCACCAGTC 3' (highlighted is the mutated base).

Mutagenic primers were Y2F (5' CCCCAGCCCGAGTTTGTGAACCAA 3'), Y3F (5' GGAG

AACCCTGAATTCTTAGTACCGAGAGAAGGC 3') and Y4F (5' GCCCAGCCTTTGACA

ACCTCTTTTTCTGGGACCAG 3'). The two primers were simultaneously annealed to one

DNA strand of the target plasmid. After standard elongation, ligation and a primary selection

by digestion with Sca I and Hpa I, the mixture of wild-type and mutated plasmid was

transformed into BMH 71-18 mutS E. coli strain, which contains a DNA mismatch repair

deficiency mutation. Plasmid DNA was prepared from the mixed bacterial population and

isolated DNA was again digested by Sca I and Hpa I. Mutated DNA was resistant to digestion

with Sca I but sensitive to Hpa I, whereas parental DNA was linearized by Sca I. A new

transformation of E. coli with the Sca I restriction mixture rendered high recovery of the

mutated plasmid. Protocols were carried out according to Clontech's user manual. Mutated

Trk-ErbB-2 DNAs were digested by Acc65 I/Spe I from pUC118 and inserted into the Kpn

I/Xba I sites of pcDNA3.1(+). A TrkErbB2 variant without both Vav2 binding sites (termed

TrkErbB2mut) was generated by Y1F mutation of pcDNA-TrkErbB2-Y3F, using a unique

Nde I site for the selection primer (5' TACATCAAGTGTATCCTCTGCCAAGTACGCCCC

CTA 3') and a Y1F mutagenic primer (5' CTGGTAGACGCTGAAGAGTTTCTGGTGCCCC

AGC 3').

2.8 Mammalian Cell Lines

Human embryo kidney 293T cells were used for transient transfections. For morphogenesis

assays on matrigel, EpH4 mouse mammary epithelial cells were used. EpH4 cells (Lopez-

Barahona et al., 1995) are a clonal epithelial derivative of IM-2 mouse mammary gland

32

epithelial cells, which were originally isolated from mammary tissue of a mid-pregnant

mouse (Reichmann et al., 1989). In our lab, the variant EpH4 K6 was subcloned (Niemann et

al., 1998), which exhibits a pronounced morphogenic potential on matrigel. The K6 subclone

was used in this work.

2.9 Immunoprecipitation and Western Blotting

3x106 293T cells were plated per 15-cm dish and co-transfected with 4 µg Flag-tagged Vav2

and 200 ng TrkErbB2, TrkErbB2-Kin- or TrkErbB2mut expression vectors by

calcium/phosphate precipitation. Twelve hours after transfection, cells were starved in serum-

free DMEM medium for 36 h. Prior to lysis, cells were stimulated with 50 ng/ml NGF

(Promega) in the presence of 1 µM phenylarsine oxide at 37°C for 10 min, and then washed

with ice-cold PBS (Sachs et al., 1996). Cells were harvested in 800 µl lysis buffer

supplemented with phosphatase and protease inhibitors (50 mM HEPES, 50 mM NaCl, 1.5

mM MgCl2, 1 mM EGTA, 10% glycerol, 1% Triton X-100, pH 7.5; inhibitors were added at

the following end concentrations: 10 mM NaF, 1 mM Na orthovanadate, 10 mM Na

pyrophosphate, 1 mM PMSF, 0.5 µg/ml aprotinin) and incubated on ice for 15 min. Lysates

were clarified by centrifugation at 14,000 rpm for 10 min at 4°C. For immunoprecipitations,

300 µl cell lysate was mixed with an equal volume of HNTG buffer (20 mM HEPES, 150

mM NaCl, 10% glycerol, 0.1% Triton X-100, pH 7.5; inhibitors were used as for lysis buffer)

and incubated with primary antibodies at 4°C overnight. Immunoprecipitates were

resuspended in 70 µl denaturing loading buffer and heated at 95°C for 3 min. Proteins were

resolved by SDS-PAGE, and transferred to PVDF membranes for 1 h at 100 mAmp per blot

using a Trans-Blot SD semi-dry electroblotter (BioRad). Membranes were blocked with 5%

low-fat milk powder in PBS at 25°C for 3 h, or with 0.5% Tween 20 and 10% FCS in PBS for

anti-phosphotyrosine primary antibodies. Membranes were incubated with primary antibodies

in blocking solution at 4°C overnight. Following 3 washes with PBS containing either 5%

milk or 0.05% Tween (for anti-phosphotyrosine Western blots), membranes were incubated

with peroxidase-conjugated secondary antibodies at 25°C for 45 min. After thorough washing,

33

proteins were detected by enhanced chemiluminescence (Amersham). For protein interaction

studies in mammary epithelial cells, EpH4 cells were serum-starved for 1 day, stimulated with

2 ng/ml neuregulin-β1 (R&D Systems) at 37°C for 10 min and lysed as for 293T cells.

Immunoprecipitation followed by SDS-PAGE and Western blotting was performed as above.

For detection of Vav2/ErbB-2 complexes in mammary tissue, mammary glands from 17.5-day

pregnant mice were solubilized in lysis buffer and incubated with anti-Vav2 antibodies at 4°C

for 7 h. Co-immunoprecipitated ErbB-2 was detected as described above.

Antibodies used for immunoprecipitation and Western blotting were: anti-Flag (affinity beads,

Sigma), anti-Flag Octapeptide (Zymed), anti-Vav2 (DPH, Calbiochem), anti-ErbB-2 (Ab-8,

NeoMarkers) and anti-PY antibodies (PY20, Transduction Laboratories). Peroxidase-

conjugated secondary antibodies were: goat anti-rabbit (Calbiochem), goat anti-mouse

(Jackson ImmunoResearch) and rabbit anti-sheep, Upstate Biotechnology). Protein G

Sepharose 4 FAST FLOW (Amersham Pharmacia Biotech) was used for immuno-

precipitation.

2.10 Matrigel Assays

EpH4 cells were transfected with Flag-tagged ∆N-Vav2, Flag-tagged ∆N-Vav2 mutants, HA-

tagged TrkErbB2-Vav2 or TrkErbB2-∆tail expression vectors by standard calcium/phosphate

method and selected for neomycin resistance in the presence of 800 µg/ml G418. Individual

clones stably expressing the exogenous proteins were expanded and tested for morphogenesis

on Matrigel (basement membrane from Engelbreth-Holm-Swarm murine tumor, Sigma;

Niemann et al., 1998). 24-well plates were cooled on ice, and each well was coated with 70

µl Matrigel solution. Plates were incubated at 37°C for 30-60 min until Matrigel solidified.

EpH4 cells were plated dropwise as a suspension containing approximately 300-500 cell

clusters/ml in DMEM supplemented with 10% FCS and the following hormones: bovine

prolactin (at 3 µg/ml; Sigma), hydrocortisone (at 1 µg/ml; Merck) and insulin (at 5 µg/ml;

Sigma). After one day of culture at 37°C, medium was replaced by serum-free DMEM

34

containing hormones. Neuregulin-β1 (at 1 ng/ml) or NGF (at 100 ng/ml) were added to

medium, which was changed daily. Assays were terminated after 5 days of culture. For

branching morphogenesis assays, 24-well plates were coated with a 5 mm-thick layer of

collagen; then, matrigel was added on top and cells were plated as above. Assays were

performed in the presence of DMEM medium supplemented with 10% FCS, hormones and

HGF/SF (at 10 units/ml).

2.11 Light and Electron Microscopy

For light and electron microscopy studies, matrigel specimens were fixed with 2.5 %

glutaraldehyde in 0.1 M phosphate buffer and 0.18 M sucrose at 4°C for 2 days, postfixed

with 1% OsO4 in 0.1 M phosphate buffer for 2 h, dehydrated in a graded ethanol series and

embedded in Poly/BedR 812 (Polysciences, Inc). For light microscopy, semithin section (1

µm) were stained with toluidine blue and analyzed in a Zeiss Axioplan II imaging microscope.

Ultrathin sections (70 nm) were contrasted with 2% uranyl acetate and lead citrate (Merck)

and analyzed in a Philips EM 400T electron microscope.

2.12 In Situ Hybridization Analysis

For in situ hybridization (Hülsken et al., 2001), sections of third thoracic glands of 16-day

pregnant mice were used. Digoxygenin-labelled RNA probes were synthesized with T3 or T7

RNA polymerase using DIG RNA kit (Boehringer Mannheim). Probes were: neuregulin,

nucleotides 391-1458 (Yang et al., 1995); ErbB-2, nucleotides 1746-3780; Vav2, nucleotides

1-2232 plus 504 nucleotides 5´ from start codon. Pyrogenin was used for red counterstaining.

35

3 RESULTS

3.1 Yeast Two-Hybrid Screen with ErbB-2 Bait Proteins

Previous studies implicate the receptor tyrosine kinase ErbB-2 in lobulo-alveolar development

of the mammary gland (Niemann et al., 1998; Jones and Stern, 1999). In search for new

substrates of ErbB-2 that mediate its function in mammary alveolar morphogenesis, yeast

two-hybrid screens were performed with ErbB-2 baits (Fields and Song, 1989). The classical

baits for receptor tyrosine kinases are hybrid proteins, which consist of an E.coli LexA DNA-

binding and dimerization domain followed by the intracellular region of the receptor tyrosine

kinase (O'Neill et al., 1994; Weidner et al., 1996). However, baits spanning the full-length

cytoplasmic region of the ErbB-2 receptor were highly unstable in the yeast (my own

observation; data not shown). Therefore, modified yeast baits were conceived on the basis of

previous studies with chimeric receptors; when C-terminal sequences of c-Met are fused to

the kinase of TrkA (the nerve growth factor receptor), the hybrid receptor elicits Met-specific

morphogenic responses upon activation with NGF (Sachs et al., 1996). Thus, the C-terminal

docking region of a receptor is sufficient to determine its signaling specificity; this region

contains tyrosine residues that, when phosphorylated, become docking sites for receptor-

specific downstream effectors. In view of these results, chimeric ErbB-2 bait proteins were

generated: the tyrosine kinase TprMet was fused to LexA, and the C-terminal tail of Met was

replaced by the C-terminal tail of ErbB-2 (Figure 1). TprMet was chosen as heterologous bait

kinase since it is strongly active when expressed in the yeast (my own observation; data not

shown). TprMet is the human oncogenic counterpart of c-Met (Park et al., 1986). Tpr

(translocated promoter region) codes for two putative dimerization domains, and is a movable

DNA element that has spontaneously translocated into a genomic region upstream of the Met

kinase; the resulting TprMet protein dimerizes in a ligand-independent fashion through its

newly-acquired Tpr sequences, and is therefore a cytoplasmic, constitutively active tyrosine

kinase protein with the biological activity of c-Met. It is therefore likely that the presence of a

C-terminal tail of ErbB-2 in the modified TprMet-ErbB2 baits bestows ErbB-2 signaling

36

properties on the chimeric proteins (see below). Two ErbB-2 baits, TprMet-ErbB2(Y1-4) and

TprMet-ErbB2(Y3-5), were generated to cover the five tyrosine residues that are putative

autophosphorylation sites of ErbB-2 (Fig. 1).

Figure 1. Structure of the chimeric ErbB-2 baits used in yeast two-hybrid screens.

The baits consist of a LexA DNA-binding and dimerization region, followed by the kinase domain of TprMet;

the C-terminal tail of TprMet is substituted for sequences of the ErbB-2 multiple docking region. The TprMet-

ErbB2(Y1-4) bait stretches over tyrosines Y1028 (for simplicity Y1 in the scheme), Y1144 (Y2), Y1201 (Y3)

and Y1226/7 (Y4) of ErbB-2, with Y1253 (Y5) being mutated to F; the TprMet-ErbB2(Y3-5) bait includes

tyrosines Y1201 (Y3), Y1226/7 (Y4) and Y1253 (Y5).

TprMet-ErbB2(Y1-4) contains the four N-terminal tyrosines of c-ErbB-2 (Y1 to Y4); TprMet-

ErbB2(Y3-5) includes the three most C-terminal tyrosines (Y3 to Y5). Both baits were

efficiently expressed in the yeast and were constitutively phosphorylated on tyrosine residues

(data not shown). In preliminary tests, these baits exhibited ErbB-2 selectivity for binding

downstream signaling molecules: TprMet-ErbB2(Y1-4) interacted with Grb-2 and Shc, while

TprMet-ErbB2(Y3-5) interacted with Shc (data not shown); it has already been described that

Grb-2 and Shc directly interact with phosphorylated Y2 and Y4 residues of ErbB-2,

respectively (Dankort et al., 1997).

Both chimeric ErbB-2 baits were used to screen the Hollenberg library (see Materials and

Methods). The library consists of mouse E10.5 embryonic cDNAs that are fused to the VP16

activation domain, and has extensively been used in our group to find novel interaction

37

partners of receptor tyrosine kinases (Weidner et al., 1996; Grimm et al., 2001). In several

independent screens, clones encoding the SH2 domains of known and novel interaction

partners of ErbB-2 were isolated. Table 1 summarizes the results of screens for each ErbB-2

bait protein. Fig. 2 indicates the amino acid region encoded in the interacting clones. Src and

PLCγ1 have previously been described as substrates of c-ErbB-2 (Fazioli et al., 1991;

Muthuswamy and Muller, 1995b); their isolation in the yeast screen corroborates ErbB-2

binding specificity of the chimeric baits. Vav2, Nck and Grb10 were here identified as novel

interaction partners of the ErbB-2 receptor.

Table 1. Interaction partners of ErbB-2 isolated in independent yeast two-hybrid

screens using different baits.

Clone TprMet-ErbB2(Y1-4) TprMet-ErbB2(Y3-5)

Vav2 2 1

PLCγ1 6 7

Nck - 1

Src - 2

Grb10 - 34

Numbers indicate frequency of each isolated interaction partner, including overlapping

clones.

Interaction of the prey proteins with the baits was confirmed by co-transfection into yeast

cells, followed by analysis of yeast growth and β-galactosidase activity assays (data not

shown). Sequence comparison analyses revealed that the interacting regions spanned the SH2

domain of each ErbB-2 partner (Fig. 2), strongly suggesting that interaction involved

phosphotyrosine residues of the baits. This hypothesis was confirmed by using kinase-

defective baits; a point mutation of lysine 243 to alanine (K243A) was introduced in the ATP-

38

binding site of the TprMet kinase, which completely disrupts the catalytic activity (Rodrigues

and Park, 1993). The inactivating mutation of the bait kinases abolished interaction,

confirming that the isolated SH2 domains bound to phosphotyrosine residues (Fig. 3, middle

panel; compare to interaction with wild-type bait, upper panel). Furthermore, deletion of the

ErbB-2 C-terminal tail also impaired binding (Fig. 3, lower panel), clearly indicating that the

clones interacted with phosphotyrosines that were located on the ErbB-2 tail and not within

the TprMet sequences of the baits.

Figure 2. Interaction partners of ErbB-2 in the yeast system are SH2 domains.

39

The overall structure of the interacting proteins is schematically shown, relevant domains are highlighted. The

amino acid stretch encoded in the isolated clones is indicated by the bars below the protein structures,

overlapping clones are shown. AD: acidic domain; CH: calponin-homology domain; DH: Dbl-homology domain;

PH: pleckstrin-homology domain; PR: proline-rich region; SH2: Src-homology-2 domain; SH3: Src-homology-3

domain; ZF: zinc finger.

Figure 3. The SH2 domains of substrates isolated in yeast two-hybrid screens interact with

phosphotyrosine residues of the ErbB-2 C-terminal tail.

Preys were co-transfected into yeast together with wild-type TprMet-ErbB2(Y3-5) (TprMet-ErbB2 for

simplicity), kinase-defective (TprMet-ErbB2-Kin-) or C-terminally deleted (TprMet-∆tail) baits (schematic

structures are on the right), and interaction was tested in a yeast colony-growth assay on selection plates. The

various preys interacted with the wild-type TprMet-ErbB2 bait, but not with the kinase-defective or the deletion

mutant without ErbB-2 C-terminal tail.

3.2 Distinct Phosphotyrosine Residues of ErbB-2 Bind to Various Interaction Partners

The phosphotyrosine residues of ErbB-2 that are direct binding sites for its interaction

partners were mapped by mutational analysis of the bait proteins. Sequences of the C-terminal

tail of ErbB-2 containing single tyrosines or pairs of consecutive tyrosine residues were fused

to TprMet to generate bait deletion mutants (see Materials and Methods); these new baits

were tested with the library clones for interaction in the yeast, which was evaluated by colony-

growth on selection plates and β-galactosidase activity. Grb-2 and Shc were included in these

40

experiments as controls. The results of yeast colony-growth and β-galactosidase assays are

summarized in Table 2. Nck interacted with baits containing Y3 (Y1201) and Grb10 with

baits containing Y4 (Y1226/7); Src required simultaneously both phosphorylated Y3 and Y4

(Y1201 and Y1226/7); PLCγ1 interacted with every tyrosine-phosphorylated bait mutant (data

not shown). Vav2 directly bound to phosphorylated Y1 (Y1028) and Y3 (Y1201) of ErbB-2

(see also Fig. 4). Interestingly, both tyrosines that bound Vav2 are located within a pYLVP

motif, which apparently constitutes the consensus binding sequence for the SH2 domain of

Vav2. These results again validate the reliability of this modified yeast two-hybrid approach

to identify phosphotyrosine binding proteins and to map their direct binding motifs.

Table 2. Characterization of specific binding sites of ErbB-2 for its

interaction partners.

Bait* Vav2 Nck Src Grb10 Grb2 Shc

Y1 + - - - - -

Y1-2 + - - - + -

Y2 - - - - + -

Y2-3 + + - - + -

Y3 + + - - - -

Y3-4 + + + + - +

Y3-5§ + + - + - +

Y4-5 - - - + - +

Y4 - - - + - +

Y5 - - - - - +

Plus (+) indicates interaction, minus (-) indicates no interaction.

41

*Baits are TprMet-ErbB2 deletion mutants; numbers indicate single or pairs

of tyrosine residues in the C-terminal tail of ErbB-2.

§TprMet-ErbB2(Y3-5) bait was included as internal control.

Figure 4. Vav2 directly interacts with phosphotyrosines Y1 and Y3 of c-ErbB-2.

The full-size cDNA of Vav2 was isolated from a phage library (see Materials and Methods) and inserted in VP16

yeast vector. To characterize the Vav2 binding sites on c-ErbB-2, the full-length Vav2 prey protein was tested

with various ErbB-2 bait mutants for interaction in the yeast. The results from colony-growth (left panel) and β-

galactosidase assays (right panel) are shown. ErbB-2 bait mutants are those from Table 2; additionally, Y2 and

Y3 are mutated to phenylalanine in the TprMet-ErbB2(Y2F-3) and TprMet-ErbB2(Y2-3F) baits, respectively.

TprMet-∆tail lacks an ErbB-2 C-terminal tail. Kin denotes kinase-deficient bait mutants. Hybrid TprMet bait

proteins for the other ErbB receptors (EGF receptor, ErbB-3 and ErbB-4) were simultaneously tested (see

below).

3.3 Vav2 Interacts with Receptor Tyrosine Kinases of the ErbB Subfamily

Next, the receptor specificity of each ErbB-2 interaction partner for other RTKs was tested in

the yeast system. Src, Nck, PLCγ1 and Grb10 interacted with various receptor tyrosine kinases

from unrelated subfamilies (Table 3). In contrast, Vav2 appears to preferentially bind

receptors of the ErbB subfamily; Vav2 bound to baits encoding TprMet fusion proteins with

42

the C-terminal tails of EGF receptor, ErbB-3 and ErbB-4 (Table 3 and Fig. 4); it additionally

interacted with a constitutively active PDGFβ receptor (Table 3).

Table 3. Interaction of the various ErbB-2 partners with different receptor tyrosine

kinases.

Receptor* PLCγγγγ1 Src Nck Grb10 Vav2

TprMet-ErbB2 + + + + +

TprMet-EGFR + + + + +

TprMet-ErbB3 - + + + +

TprMet-ErbB4 - - - + +

TprMet-∆tail - - - - -

Met + + + + -

Insulin Receptor + - + + -

Ret + + - + -

Kit - - - - -

KGF Receptor - - - - -

Ros + + - + -

Sea + - - - -

PDGFβ Receptor + + + + +

Plus (+) indicates interaction.

*Baits are LexA-receptor fusion proteins (Weidner et al., 1996). Baits containing TprMet

sequences are indicated. EGFR: epidermal growth factor receptor; KGF: keratinocyte growth

factor; PDGF: platelet-derived growth factor.

43

Together, these results point to Vav2 as a putative candidate to mediate ErbB signals in

mammary gland development. First, Vav2 specifically interacts with all the ErbB receptors;

second, all ErbB receptors are essential at different stages of mammary development (see

section 2.5 of the Introduction). Lastly, activated Vav2 induces cytoskeletal rearrangements,

which are a critical step for morphogenic events. Therefore, the potential of Vav2 to mediate

ErbB-2 signals in alveolar morphogenesis was next tested in organotypic cell culture

experiments.

3.4 Vav2 Induces Alveolar Morphogenesis of EpH4 Mammary Epithelial Cells

Activation of endogenous or ectopic ErbB-2 receptor instructs EpH4 mammary epithelial cells

to form functional alveoli-like structures when these cells are cultured on EHS matrix (termed

Matrigel; Niemann et al., 1998). To examine whether Vav2 mediates the morphogenic effect

of ErbB-2 in organotypic culture, EpH4 mammary epithelial cells were stably transfected with

a cDNA encoding N-terminally truncated Vav2, the oncogenic, constitutively active form of

Vav2 (termed ∆N-Vav2; structures are shown in Fig. 5; see Schuebel et al., 1996); afterwards,

transfectants were cultured on Matrigel to test their ability to undergo alveolar morphogenesis.

∆N-Vav2 was preferred to full-size Vav2 for the Matrigel assay in view of its functional

properties: ∆N-Vav2 is constitutively active as guanine nucleotide exchange factor and

induces cytoskeletal rearrangements when overexpressed in fibroblasts (Schuebel et al.,

1996); in contrast, full-size Vav2 requires tyrosine phosphorylation to elicit such responses

(Schuebel et al., 1998). Remarkably, overexpression of ∆N-Vav2 induced the arrangement of

the transfected EpH4 cells into large alveolar structures within two days of culture on Matrigel

(Fig. 5B, compare with control in A). The alveoli consisted of monolayers of tightly

associated cells facing a lumen (Fig. 5D). Ultrastructural studies revealed that the alveolar

cells were polarized; microvilli were scattered at the luminal side, and tight junctions were

observed at apical cell-cell borders (Fig. 6B, C). Polarization of alveolar cells in the mammary

gland during pregnancy and lactation has been described (Nemanic et al., 1971). Control

44

EpH4 cells formed small solid aggregates, and cells were non-polarized and were only loosely

connected (Fig. 6A).

Figure 5. Constitutively active Vav2 induces alveolar morphogenesis of EpH4 mammary epithelial cells.

(B) Cells expressing ∆N-Vav2 (see schematic structures below) form large alveoli-like structures on matrigel.

(D) Alveolar cells are facing a lumen (asterisk), as observed in semithin sections. (A, C) Mock-transfected

controls form small aggregates. Bar: 50 µm. CH: calponin-homology domain; AD: acidic domain; DH: Dbl-

homology domain; PH: pleckstrin-homology domain; ZF: zinc finger.

45

Figure 6. Constitutively active Vav2 induces polarization of alveolar EpH4 mammary epithelial cells.

(B, C) Microvilli (arrows) are present at the luminal side (asterisk) of alveolar EpH4 cells expressing ∆N-Vav2;

apical tight junctions (arrowheads) are revealed by electron-microscopy of ultrathin sections. (A) Mock-

transfected controls form small clumps of loosely associated cells. Bars: (A, B) 5 µm; (C) 0.5 µm. ECM:

extracellular matrix.

Full-size Vav2 is inactive as GDP/GTP exchanger in a non-phosphorylated state (Schuebel et

al., 1998). Not surprisingly, EpH4 cells overexpressing full-size Vav2 did not produce alveoli

(data not shown), suggesting that full-size Vav2 may also require tyrosine-phosphorylation to

become morphogenic. It has previously been shown that C-terminal fusion of a substrate to its

receptor results in efficient tyrosine phosphorylation of the substrate (Schaeper et al., 2000);

moreover, the insulin receptor substrate sequences are fused to the insulin receptor in D.

melanogaster (Yenush et al., 1996). Therefore, the fusion protein TrkErbB2-Vav2 was

generated by replacing the C-terminal tail of ErbB-2 with full-length Vav2 in a TrkErbB2

receptor (Sachs et al., 1996; structures are shown in Fig. 7). The resulting protein lacks the

docking sites of ErbB-2 and hence could only signal through the coupled substrate when

activated by nerve growth factor (NGF). Indeed, EpH4 cells expressing TrkErbB2-Vav2

formed large alveoli following stimulation with NGF (Fig. 7C, D). In the absence of NGF or

in transfectants lacking Vav2 in the fusion protein, respectively, none or only rudimentary

structures were seen (Fig. 7A, B and E, F). Taken together, these findings demonstrate that

46

Vav2 induces alveolar morphogenesis of EpH4 cells when activated either by N-terminal

truncation or upon tyrosine phosphorylation by ErbB-2.

Figure 7. Tyrosine phosphorylation of full-size Vav2 by ErbB-2 activates its morphogenic potential.

Left panel: overviews by light microscopy; right panel: semithin sections. (A, B) EpH4 transfectants expressing

the TrkErbB2-Vav2 hybrid (see structure below) form alveolar structures on matrigel upon NGF stimulation. (C,

47

D) Non-stimulated transfectants and (E, F) cells expressing a TrkErbB2 protein without the C-terminal tail of

ErbB-2 (TrkErbB2-∆tail) lack morphogenic activity. Bars: 50 µm.

3.5 Vav2 and ErbB-2 Can Both Directly and Indirectly Associate in Mammalian Cells

The interaction between Vav2 and ErbB-2 was also studied in cultured mammalian cells.

Human epithelial kidney 293T cells were transiently co-transfected with Vav2 and wild-type

or mutated TrkErbB2 receptors, and interaction after stimulation with NGF was examined by

Western blotting. Exogenous Vav2 co-immunoprecipitated with a TrkErbB2 hybrid receptor

in lysates of transfected 293T cells, but not with kinase-deficient receptor TrkErbB2-Kin-

(Fig. 8A, upper panel). These results indicate that association of Vav2 with ErbB-2 requires

tyrosine phosphorylation of the receptor, as previously observed in the yeast system.

Surprisingly, Vav2 still interacted with TrkErbB2mut, which lacks the Vav2 binding sites of

ErbB-2 (Y1028 and Y1201) identified in the yeast two-hybrid system. This suggests that

Vav2 may bind directly and indirectly to ErbB-2. However, interaction of Vav2 with

TrkErbB2 or TrkErbB2mut depends on activation of the hybrid receptors by NGF (Fig. 8A,

upper panel). Increased tyrosine phosphorylation of Vav2 was observed upon binding to

ErbB-2 proteins that contain an activated kinase (Fig. 8A, middle panel).

Interaction between Vav2 and ErbB-2 was also tested in EpH4 cells that are cultured under

standard conditions. Subconfluent EpH4 cells were treated shortly with neuregulin-1 (see

Materials and Methods) to activate the endogenous ErbB-2 receptor (Niemann et al., 1998)

and then lysed. Immunoprecipitation of endogenous Vav2 from cell lysates followed by

Western blotting revealed that Vav2 associated with ErbB-2 in lysates of neuregulin-treated

EpH4 cells (Fig. 8B, upper left panel). In addition, increased tyrosine phosphorylation of

ErbB-2 and Vav2 was observed in lysates of stimulated EpH4 cells (Fig. 8B, upper right

panel). These findings indicate that interaction between Vav2 and ErbB-2 occur in EpH4 cells

after activation of ErbB-2 by neuregulin. Moreover, activated ErbB-2 may further

48

phosphorylate Vav2 on tyrosine residues. The interaction between Vav2 and ErbB-2 in EpH4

cells may therefore be an essential step in neuregulin-induced morphogenesis of these cells.

Figure 8. Analysis of the interaction between Vav2 and ErbB-2 in mammalian cells

and in mammary tissue.

49

(A) Co-immunoprecipitation of Vav2 with various TrkErbB2 receptors in transfected 293T cells. (Top) Vav2 co-

immunoprecipitates with TrkErbB2 and TrkErbB2mut, when these hybrid receptors are activated by NGF. Vav2

does not associate with kinase-defective TrkErbB2-Kin-. (Middle) Binding of Vav2 to activated TrkErbB-2

receptors results in increased tyrosine phosphorylation of Vav2. (Bottom) Control immunoblots of total cell

lysates. Molecular weight markers on the left are in kDa. (B) Interaction between Vav2 and ErbB-2 in EpH4

mammary epithelial cells. (Top) Vav2 co-immunoprecipitates with ErbB-2 in lysates of neuregulin-treated cells

(left panel); association of Vav2 with activated ErbB-2 results in increased tyrosine phosphorylation of Vav2

(right panel). (Bottom) Control immunoblots of total cell lysates. (C) In vivo association between Vav2 and

ErbB-2 in mammary glands during pregnancy. Vav2 co-immunoprecipitates with ErbB-2 in mammary gland

lysates from pregnant mice. Anti-c-Myc antibody was used as non-specific control; Vav2 immuno-precipitation

is shown below.

3.6 Vav2 and ErbB-2 Are Associated in Mammary Epithelium During Pregnancy

Interaction between Vav2 and ErbB-2 was also studied in mammary glands from pregnant

mice. Lysis of all mammary glands from a female mouse at day 17.5 of pregnancy was

followed by immunoprecipitation of endogenous Vav2 and Western blotting as above. Indeed,

Vav2 co-immunoprecipitated with ErbB-2 from the mammary lysates (Fig. 8C), suggesting

the presence of endogenous complexes between Vav2 and ErbB-2 in mammary tissue during

pregnancy.

Cellular localization of Vav2 and ErbB-2 was studied in mammary tissue from pregnant mice

by in situ hybridization. Importantly, Vav2 and ErbB-2 are co-expressed in the epithelial cell

layer that lines alveoli and ducts of mammary glands during pregnancy (Fig. 9; Schroeder et

al., 1998). The co-localization of Vav2 and ErbB-2 in mammary epithelium supports the

presence of interaction in vivo during pregnancy, as above suggested by biochemical analysis

(see Fig. 8C); moreover, it rules out the possibility of association during the immuno-

precipitation of Vav2. Taken together, these observations indicate that ErbB-2 and Vav2 can

functionally associate in the mammary gland while lobulo-alveolar development takes place.

50

Figure 9. Vav2 and ErbB-2 are co-expressed in mammary alveolar epithelium during pregnancy.

(Top) Vav2 and ErbB-2 co-localize in alveolar (black arrowheads) and ductal (arrows) epithelia of the mammary

gland at late pregnancy. (Bottom) Neuregulin (NRG) is located in the mesenchyme surrounding alveoli and ducts

(white arrows); a control section (control) was hybridized with a Vav2 sense probe. Bar: 100 µm.

3.7 The Dbl-Homology Domain of Vav2 Is Required for Its Morphogenic Activity in

EpH4 Cells

The structural domains of Vav2 confer the protein two interesting features: first, Vav2 acts as

a GDP/GTP exchange factor for Rho/Rac GTPases via its catalytic Dbl-homology domain;

second, Vav2 has the capability to participate in signal transduction cascades by binding

further downstream proteins via its C-terminal SH2 and SH3 domains (Bustelo, 2000). To

define the functional role of the various domains of Vav2 in alveolar morphogenesis,

mutational analyses of constitutively active Vav2 were performed. ∆N-Vav2-∆C encodes an

active protein which lacks SH2 and both SH3 domains (structures are shown in Fig. 10). ∆N-

Vav2-dblmut lacks the GTP/GDP exchange activity due to a deletion of seven conserved

amino acids within the Dbl homology domain (336LLLKELL342), which has been reported

51

to inactivate Dbl, GRF1 and Sos1 (Hart et al., 1994; Freshney et al., 1997; Qian et al., 1998).

EpH4 cells were stably transfected with plasmids encoding Vav2 mutant proteins and

examined in Matrigel assays. Clearly, the Dbl homology domain is required for the biological

function of Vav2 whereas the SH2/SH3 domains are dispensable (Fig. 10B, C).

Overexpression of a minimal Vav2 protein which additionally lacks the pleckstrin homology

domain (∆N-Vav2-∆C∆PH) was also sufficient to elicit alveolar morphogenesis (Fig. 10D).

Figure 10. The Dbl homology domain of Vav2 is essential to promote alveolar morphogenesis of EpH4

mammary epithelial cells.

(C) C-terminally truncated Vav2 and (D) a minimal protein encompassing the DH and ZF domains, respectively,

are as efficient as constitutively active Vav2 (in A) to induce morphogenesis. (B) Catalytically inactive Vav2

carrying a mutation in the Dbl homology domain does not promote formation of alveoli. Bar: 50 µm. DH: Dbl-

homology domain; PH: pleckstrin-homology domain; ZF: zinc finger.

52

3.8 Catalytically Inactive Vav2 Blocks Neuregulin-Mediated Morphogenesis of EpH4

Cells

EpH4 cells that express catalytically inactive Vav2 (∆N-Vav2-dblmut) were tested for

alveolar morphogenesis following neuregulin treatment. Importantly, ∆N-Vav2-dblmut

interferred with the formation of alveoli when cells were treated with neuregulin: instead of

large hollow structures (Fig. 11B, C), cell aggregates without lumina were observed (Fig. 11E,

F), indicating that alveolar morphogenesis is prevented while cell growth still occurs. Only

small cell groups were formed in absence of neuregulin treatment (Fig. 11A, D).

Figure 11. Catalytically inactive Vav2 harbouring a mutation in the Dbl homology domain blocks the

morphogenic signals of neuregulin in EpH4 mammary epithelial cells.

(E, F) EpH4 cells expressing ∆N-Vav2-dblmut (see structure below) do not form hollow alveoli but rather large

cell aggregates upon stimulation with neuregulin. (B, C) Mock-transfected cells form alveoli-like structures in

53

response to neuregulin, as previously described (Niemann et al., 1998). (A, D) Non-stimulated controls. Bars: 50

µm. DH: Dbl-homology domain; PH: pleckstrin-homology domain; ZF: zinc finger.

Interestingly, ∆N-Vav2-dblmut did not interfere with tubular branching when EpH4 cells were

treated with hepatocyte growth factor/scatter factor (Fig. 12D, compare to control cells in B;

Niemann et al., 1998). Thus, catalytically inactive Vav2 blocks neuregulin-specific signals for

alveolar morphogenesis of EpH4 cells, while it does not affect cellular responses to other

morphogenic stimuli.

Figure 12. Catalytically inactive Vav2 does not interfere with branching morphogenesis

of EpH4 mammary epithelial cells.

(D) EpH4 cells expressing ∆N-Vav2-dblmut (see structure in Fig. 11) form tubular structures upon stimulation

with HGF/SF. (B) Mock-transfected cells exhibit branching morphogenesis in response to HGF/SF, as previously

described (Niemann et al., 1998). (A, C) Non-stimulated controls. Bars: 50 µm. DH: Dbl-homology domain; PH:

pleckstrin-homology domain; ZF: zinc finger.

54

4 DISCUSSION

Previous results from our and other groups suggest that neuregulin activates the receptor c-

ErbB-2 to promote lobulo-alveolar development of the mammary gland (Yang et al., 1995;

Jones et al., 1996; Niemann et al., 1998; Jones and Stern, 1999). However, little was known

about the intracellular effectors that mediate this morphogenic effect. Here, a modified yeast

two-hybrid screen was developed to search for new substrates of ErbB-2 that are involved in

alveolar morphogenesis of the mammary gland. The guanine nucleotide exchange factor Vav2

was identified among other proteins as a novel interaction partner of ErbB-2. A full

characterization of the ErbB-2 docking sites for these interacting proteins was performed in

the yeast system, thus adding complexity to the previous knowledge on intracellular effectors

of ErbB-2. Next, the potential function of Vav2 in ErbB2-induced morphogenesis was tested

in EpH4 mammary gland epithelial cells that were cultured on a reconstituted basement

membrane (Matrigel). These studies show two main points: first, Vav2 indeed promotes

alveoli-like growth and reorganization of EpH4 cells, either when constitutively active or

upon activation by ErbB-2; second, co-expression of Vav2 and ErbB-2 in mammary alveolar

epithelium is observed in pregnant mice. These findings suggest a functional association

between Vav2 and ErbB-2 during alveolar morphogenesis in vivo. Together, this work

supports a model for neuregulin-induced mammary alveolar morphogenesis in vivo, in which

Vav2 is a physiological target downstream of ErbB-2 that plays a crucial role in transduction

of signals for lobulo-alveolar morphogenesis.

4.1 Modified Yeast Two-Hybrid System: A Powerful Tool to Search for

Phosphotyrosine-Interacting Proteins

The commonly-used yeast two-hybrid baits to search for interaction partners of receptor

tyrosine kinases are hybrid proteins, which consist of a LexA DNA-binding and dimerization

sequence fused to the intracellular region of the receptors (O'Neill et al., 1994; Weidner et al.,

1996; Grimm et al., 2001). Bait molecules dimerize via LexA when expressed in yeast cells,

55

thus enabling the activation of receptor tyrosine kinases without requirement of a ligand. This

approach could not be used in case of the receptor ErbB-2, since the resulting hybrid proteins

were rapidly degraded in the yeast. Therefore, modified yeast baits were generated: C-terminal

sequences of ErbB-2 containing the autophosphorylation sites were fused to an oncogenic

TprMet kinase in order to obtain constitutively active TprMet-ErbB2 baits. TprMet encodes

the intracellular region of c-Met in frame with a leucin-zipper dimerization domain derived

from a different locus (Park et al., 1986). The heterologous TprMet kinase efficiently

phosphorylates tyrosine residues of ErbB-2, thus creating docking sites for signaling proteins

with SH2 and PTB domains. By this means, known and novel interacting proteins for ErbB-2

were identified in a cDNA library screen in yeast.

This modified yeast two-hybrid system has proven to be useful for standard search of proteins

that interact with peptides and proteins containing phosphorylated tyrosine residues; even

unrelated protein sequences become tyrosine-phosphorylated when fused to the TprMet kinase

and can be used as yeast baits. For example, coupling Gab1 to TprMet enabled the analysis of

the interaction between phosphorylated Gab1 and the SH2 domains of PI-3-K, PLCγ, Shp2

and CRKL (Schaeper et al., 2000). Thus, the new method presented here offers an easy

alternative for yeast screens as opposed to a tribrid approach, which includes an additional

kinase (Licitra and Liu, 1996). The main advantage of the here described modified two-hybrid

over a tribrid system is that only two selectable markers instead of three markers are

necessary; therefore, the efficiency of yeast transformation is improved, and protein

expression levels in the yeast are higher than those of the tribrid method.

4.2 New Insights into the Intracellular Signaling Pathways of ErbB-2

In independent cDNA library screens with tyrosine phosphorylated ErbB-2 baits, novel

ErbB2-interacting proteins like Nck, Grb-10 and Vav2 were identified, along with the known

partners Src and PLCγ1 (Muthuswamy and Muller, 1995b; Fazioli et al., 1991). These

proteins belong to the group of multiadaptor signaling molecules; the most conspicuous

56

feature of such proteins is the presence of several specialized regions that allow protein-

protein interactions (reviewed in Pawson and Scott, 1997). The ErbB-2 partners identified in

the present workt contain SH2 domains; indeed, these SH2 domains were always present in

the interacting clones and therefore mediate the association with phosphotyrosine residues of

ErbB-2. The direct binding sites of ErbB-2 for these proteins were mapped by mutational

analysis of the baits in the yeast system. So far, tyrosines Y2 and Y4 of the ErbB-2

multidocking site were known to directly bind Grb-2 and Shc, respectively (Ricci et al., 1995;

Dankort et al., 1997). Here, direct binding of Vav2 to Y1 and Y3, Grb-10 to Y4, Nck to Y3

and Src to complexed Y3-Y4 were characterized. The overlap of Vav2, Nck and Src for

binding to Y3 suggests that these proteins may represent alternative effectors of ErbB-2.

Alternatively, these proteins may assemble to form a hierarchy of different protein

multicomplexes; any of such supramolecular complexes may lead to a unique outcoming

signal, regardless of the protein-protein interaction pattern within the complexes. The

formation of functionally redundant protein alignments between Src, Nck and Vav2 (possibly

together with some other proteins) is indeed conceivable. Preliminary data indicate that Vav2

can directly bind Src or Nck; using the modified yeast two-hybrid method, a TprMet-Vav2

fusion bait was recently tested with several SH2 domains for interaction in the yeast. Indeed,

tyrosine-phosphorylated Vav2 interacted with the SH2 domains of Src and Nck but not with

that of Grb2 (data not shown). A mechanism whereby Vav2 is ultimately recruited and

activated via different protein-protein associations may account for the direct and indirect

binding of Vav2 to ErbB-2 (see also below).

4.3 Vav2 Couples to Receptor Tyrosine Kinases via Its SH2 Domain

Direct association of the SH2 domain of Vav2 with ErbB-2 involves recognition of the motif

pYLVP, present at Y1 (Y1028) and Y3 (Y1201). Using an entirely different selection

procedure, the sequence pYXEP (where X is L, M or E) has been identified to bind the SH2

domain of Vav (Songyang et al., 1994). The SH2 domains of Vav and Vav2 share 55%

identity (Schuebel et al., 1996), and it is therefore possible that they have distinct binding

57

preferences. From all the ErbB-2 partners that were found in the yeast screens, only Vav2

showed a particular affinity for binding to the various ErbB receptors. Vav2 also interacts

with the PDGFβ receptor the yeast system (Table 3). In fact, recent biochemical and mass

spectrometry analyses have shown that all three Vav proteins can form complexes with EGF

or PDGFβ receptors and become phosphorylated on tyrosine residues following stimulation

with EGF or PDGF (Bustelo et al., 1992; Margolis et al., 1992; Lopez-Lago et al., 2000;

Moores et al., 2000; Pandey et al., 2000). However, it was not clear from these studies

whether Vav proteins couple directly to the receptors or indirectly via binding to adaptor

proteins. The results from yeast two-hybrid analyses that are here presented do not rule out the

possibility of indirect interaction (see below); however, they provide the first line of evidence

that indeed Vav2 can directly bind to receptor tyrosine kinases via its SH2 domain, a

mechanism that may be shared by the other Vav proteins.

The above identified pYLVP consensus motif for binding to Vav2 is conserved in the C-

terminal region of ErB-4 (Y1022) but not in the EGF receptor, ErbB-3 or the

PDGFβ receptor; however, the rather similar sequences pYLIP in the EGF receptor (at

Y1012), pYLMP in ErbB-3 (at Y1159) and pYIIP in PDGFβ receptor (at Y1021) may be

predicted as Vav2 binding sites. This suggests that positions 1+ and 2+ of the consensus motif

for Vav2 are flexible but, in contrast to the pYXEP binding motif of Vav, they may selectively

be occupied by amino acids with a non-polar side chain.

The examination of ErbB-2/Vav2 interactions in mammalian cells rendered an unexpected

result: in 293T cells, a mutant ErbB-2 receptor that lacks both Y1 and Y3, the direct docking

sites for Vav2 identified in the yeast system, still binds Vav2. This indicates that, in addition

to direct binding, Vav2 may also interact indirectly with ErbB-2 via a further adaptor protein.

Similarly, direct and indirect binding has been reported for recruitment of the adaptor Gab1 to

the receptor tyrosine kinase c-Met (Fixman et al., 1995; Holgado-Madruga et al., 1996;

Weidner et al., 1996; Bardelli et al., 1997; Nguyen et al., 1997; Schaeper et al., 2000). ErbB-2

58

binds to Grb2, Shc, the Csk-homologous kinase, PLCγ1, Nck, Grb10 and Src (Fazioli et al.,

1991; Ricci et al., 1995; Muthuswamy and Muller, 1995; Dankort et al., 1997; Zrihan-Licht

et al., 1998; this work), which may indirectly recruit Vav2 to the receptor. Sequence analysis

of Vav2 reveals the presence of putative consensus motifs for binding the SH2 domains of

Src, Lck (a Src-related tyrosine kinase) and Shc (Songyang et al., 1994). Ongoing studies

suggest that Vav2 may directly interact with the SH2 domains of Src and Nck.

4.4 Vav2 Mediates ErbB-2 Signals for Alveolar Morphogenesis of EpH4 Mammary

Epithelial Cells

Recent work has shown that normal development of the mammary gland during pregnancy to

prepare lactogenesis can be mimicked in vitro. The reorganization of mammary epithelial

cells to form lobulo-alveolar structures is markedly influenced by the matrix on which these

cells are cultured. Barcellos-Hoff et al. (1989) demonstrated that primary mammary epithelial

cells form functional, albeit rudimentary, alveoli-like structures when cultured on a

reconstituted three-dimensional matrix, in the presence of lactogenic hormones and absence of

serum. Within the first days of culture, cells remodel the exogenous basement membrane and

form matrix-ensheated aggregates, which subsequently cavitate; by day 6 of culture, cells are

reorganized into hollow spheres composed of morphologically polarized cells facing a lumen.

These cells are functionally differentiated and secrete milk proteins vectorially into the

luminal compartment. A reconstituted basement membrane alone, however, does not account

for the complex epithelial-mesenchymal interactions that are linked to mammary

development. The spontaneously immortalized, non tumorigenic mouse mammary cell line

IM-2 consists of both epithelial and fibroblastic cell populations (Reichmann et al., 1989); it

has been shown that the fibroblastic cells render the epithelial cells competent to undergo

cytoskeletal rearrangements and to functionally differentiate on Matrigel. The physiological

signals from the mammary mesenchyme can alternatively be supplied by addition of growth

factors to mammary epithelial cells in organotypic culture. Previous studies pointed to

neuregulin as a mesenchymal growth factor that stimulates alveolar morphogenesis of

59

mammary glands in organ culture (Yang et al., 1995). In view of these results, Niemann et al.

(1998) used EpH4 mammary cells (an epithelial subclone derived from the abovementioned

IM-2 cell line) to test the effect of neuregulin in a Matrigel system; EpH4 cells indeed form

large alveoli-like structures when cultured on Matrigel in the presence of neuregulin.

Additionally, biochemical studies revealed tyrosine phosphorylation of endogenous ErbB-2 in

EpH4 cell lysates following neuregulin treatment (Fig. 8). Formation of similar alveolar

structures is observed when EpH4 transfectants that stably overexpress a TrkErbB2 chimeric

receptor are cultured on Matrigel in the presence of nerve growth factor (Niemann et al.,

1998). These results indicate that activation of the overexpressed ErbB-2 receptor is sufficient

to elicit alveolar morphogenesis in organotypic cultures of mammary epithelial cells. Together

with the mesenchymal localization of neuregulin transcripts and the epithelial expression of

ErbB-2 in mammary tissue at mid-pregnancy, these findings strongly suggest that stromal

neuregulin activates epithelial ErbB-2 to induce alveolar morphogenesis of the mammary

gland in vivo. Moreover, this model of neuregulin signaling supports the increasing evidence

of the role of epithelial–mesenchymal interactions in postnatal growth and differentiation of

the mammary gland (reviewed in Cunha and Hom, 1996; Robinson et al., 1999; Silberstein,

2001).

To understand the molecular mechanisms of neuregulin/ErbB signaling in mammary alveolar

morphogenesis, this work aimed at the identification of intracellular effectors of ErbB-2 that

mediate these morphogenic effects. In yeast two-hybrid screens with ErbB-2 baits, Vav2 was

identified as a novel partner of ErbB-2. Vav2 belongs to a family of guanine nucleotide

exchange factors for small GTPases of the Rho superfamily, like Rho, Rac and Cdc42

(reviewed in Bustelo, 2000). Vav proteins contain a common array of domains, which include

an N-terminal regulatory acidic region, a catalytic Dbl-homology domain and several C-

terminal SH2 and SH3 domains (see Fig. 2). Unlike Vav, Vav2 expression is not restricted to

the hematopoietic system, but is also found in several epithelia, for example in the mammary

gland epithelium (Fig. 9). Though recent reports involve Vav2 in immune responses of certain

60

hematopoietic lineages (Billadeau et al., 2000; Doody et al., 2000), a function of Vav2 in

epithelial tissues is also possible. Upon phosphorylation of a single regulatory tyrosine residue

in the N-terminus, Vav proteins gain catalytic activity towards Rho GTPases, thus leading to

changes in the actin cytoskeleton and gene transcription (reviewed in Bustelo, 2000). Vav2

associates not only with ErbB-2 in the yeast system, but also with all other ErbB receptors

(Fig. 4), which are known to be involved at different stages of mammary development (Xie et

al., 1997; Jones and Stern, 1999; Jones et al., 1999). The capability of Vav2 to induce

cytoskeletal reorganization, together with its high affinity for ErbB receptors, favored the

choice of Vav2 as candidate to mediate morphogenic signals of ErbB-2.

The morphogenic potential of Vav2 was here tested in a Matrigel assay. It was known that

truncation of the N-terminal region of Vav proteins eliminates an autoinhibitory loop and

exposes the catalytic site to small GTPases, thus enhancing GDP/GTP exchange (Aghazadeh

et al., 2000). Therefore, EpH4 mammary epithelial cells were stably transfected with a cDNA

encoding an N-truncated, constitutively active Vav2 protein (Schuebel et al., 1996), and

transfectants were cultured on Matrigel under serum-free conditions and in the absence of

growth factors. In this organotypic system, catalytically active Vav2 was sufficient to induce

formation of large alveolar structures that resembled those that are observed following

activation of ErbB-2 by neuregulin (see Niemann et al., 1998). Alveoli consisted of a

monolayer of polarized epithelial cells, which enclose a luminal compartment by means of

apical tight junctions. These results represent the first evidence of a biological response

elicited by overexpression of active Vav2 in epithelial cells. Constitutively active but not

wild-type Vav2 elicited these morphogenic events in EpH4 cells, indicating that GDP/GTP

exchanger activity, and therefore cytoskeletal reorganization, may be essential in these

processes. In line with these findings, it has been reported that truncated forms of all Vav

family members have a deregulated activity as guanine nucleotide exchange factors in vitro,

are highly transforming in focus formation assays, and elicit changes in cell morphology upon

transient transfection into NIH 3T3 fibroblasts (Bustelo, 2000 and references therein).

61

Activation of an overexpressed TrkErbB2-Vav2 fusion protein by nerve growth factor also

induced alveolar morphogenesis of EpH4 transfectants. This finding suggests that the

activated ErbB-2 kinase of the fusion protein efficiently phosphorylated wild-type Vav2.

Phosphorylation may occur on the putative regulatory tyrosine Y172 of Vav2; thus, the

autoinhibitory loop of wild-type Vav2 is disrupted and therefore, phosphorylated full-size

Vav2 can now behave as its oncogenic truncated counterpart to elicit morphogenesis.

Biochemical studies revealed association between Vav2 and ErbB-2 in lysates from EpH4

cells following neuregulin treatment (Fig. 8B, left panel). Activation of ErbB-2 was observed

after stimulation with neuregulin as an increase in phosphotyrosine content, despite high basal

phosphorylation levels (Fig. 8B, right panel). Importantly, endogenous complexes between

Vav2 and ErbB2 were found in lysates of mammary glands from pregnant mice (Fig. 8C). In

addition, in situ hybridization studies showed spatial co-localization of Vav2 and ErbB-2 in

mammary alveolar epithelium (Fig. 9), which allows the physical interaction between the

receptor and its putative effector in the mammary gland during pregnancy.

Taken together, Vav2 can induce alveolar morphogenesis of EpH4 cells, both in its

constitutively active state or when activated by ErbB-2. This places Vav2 as a downstream

effector of ErbB-2 for this biological response. In both cases, alveolar structures were similar

to those that are formed upon neuregulin treatment or activation of ectopic ErbB-2 (Niemann

et al., 1998); along with the functional link between neuregulin and ErbB-2, and with the

physical association of ErbB-2 and Vav2 in mammary tissue, these findings support a relevant

role of Vav2 as a downstream effector of neuregulin/ErbB-2 signals for alveolar

morphogenesis of the mammary gland in vivo. Furthermore, they provide clear evidence of the

as yet suggested function of Vav2 in signaling of receptor tyrosine kinases that lead to a

concrete biological response.

62

4.5 The Morphogenic Activity of Vav2 on Mammary Epithelial Cells May Involve

Changes in Actin Cytoskeleton

Mutational analysis revealed that a functional Dbl-homology domain is necessary and

sufficient for Vav2 to elicit alveolar morphogenesis. The Dbl-homology domain enables Vav2

to function as guanine nucleotide exchange factor towards small GTPases of the Rho family

with an as yet unclear specificity (Schuebel et al., 1998; Abe et al., 2000). Disruption of this

domain in a mutant Vav2 protein completely abolished its ability to promote alveolar

morphogenesis of EpH4 mammary epithelial cells. Moreover, the isolated Dbl-homology

domain of Vav2 still retained morphogenic properties, suggesting that the GDP/GTP

exchange activity is critical in this process, whereas the SH2/SH3 adaptor domains are

dispensable. Similarly, integrity of the Dbl-homology domain in the absence of SH2/SH3

modules is required by Vav3 to promote formation of lamellipodia and membrane ruffling in

transfected NIH3T3 fibroblasts (Movilla et al., 1999). In view of these results, it is evident

that the Dbl-homology domain of Vav proteins is sufficient to reorganize the actin

cytoskeleton, a process that may be required for Vav2-mediated alveolar morphogenesis.

Rho proteins constitute a subgroup of the Ras superfamily of small GTPases that are key

regulators of the actin cytoskeleton and of several cellular processes like gene transcription,

membrane trafficking, growth, movement and morphogenesis (reviewed in Van Aelst and

D’Souza-Chorey, 1997; Hall, 1998; Mackay and Hall, 1998). Rho small GTPases switch from

an inactive GDP-bound state to an active GTP-bound state; this process is accelerated by

guanine nucleotide exchange factors containing a Dbl-homology domain. Activated small

GTPases trigger actin polymerization to form stress fibers, focal adhesion complexes,

lamellipodia, membranes ruffles and filopodia. An increasing amount of genetic studies in

invertebrates provide ample evidence that GEFs and Rho proteins play a central role in several

morphogenic events during the development of a multicellular organism. It has been shown

that the putative GDP/GTP exchanger DRhoGEF2 and the small GTPase DRho1 are part of a

signaling pathway that determines cell shape changes during gastrulation of Drosophila

63

(Barrett et al., 1997; Häcker et al., 1998). The recently described Drosophila Trio GEF or its

C. elegans homolog UNC-73 have been shown to regulate axon guidance and cell migration

in the central nervous system (Steven et al., 1998; Awasaki et al., 2000; Liebl et al., 2000;

Newsome et al., 2000; Bateman et al., 2000). Still life, another Drosophila RhoGEF, has

been identified in a mutational screen for motor activity defects, and its absence determines

reduced locomotion as well as male infertility (Sone et al., 1997). Furthermore, Rho proteins

have also been shown to control dorsal closure at late stages of Drosophila embryogenesis

(Magie et al., 1999), directed cell movement in the Drosophila ovary (Murphy et al., 1999)

and planar polarity in eyes and wing hair (Eaton et al., 1995; Eaton et al., 1996; Strutt et al.,

1997). In mammals, the complexity of the small GTPase superfamily, and therefore the

potential redundancy of its members, has made the study of their role during embryogenesis

difficult. In humans, mutations of the FGD1 (faciogenital dysplasia) gene, which encodes the

Vav-related guanine nucleotide exchanger FGD1, cause an X-linked autosomal

developmental disorder (known as Aarskog-Scott syndrome or faciogenital dysplasia)

involving skeletal and genito-urinary anomalies (Pasteris et al., 1994; Olson et al., 1996;

Zheng et al., 1996). In view of the accumulating evidence of a role for GEFs and Rho proteins

in epithelial development, it is conceivable that Rho small GTPases are downstream effectors

of Vav2 in the mammary gland. Matrigel assays with EpH4 cells overexpressing

constitutively active or dominant negative forms of Rho, Rac and Cdc42 small GTPases may

elucidate their contribution to alveolar morphogenesis.

4.6 Vav2 Is a Specific Effector of Neuregulin Signals for Alveolar Morphogenesis

EpH4 mammary epithelial cells express endogenous c-Met and ErbB receptors and are

competent to elicit biological responses following stimulation by HGF/SF or neuregulin, the

ligands for such receptors (Niemann et al., 1998). EpH4 cells exhibit ductal growth when

cultured on Matrigel in the presence of HGF/SF, while they form alveoli-like structures upon

neuregulin treatment. Therefore, they provide a versatile system to study different

developmental events of the mammary gland in vitro. A Dbl-defective mutant of Vav2 did not

64

affect cell proliferation but completely blocked neuregulin-induced morphogenesis in a

dominant-negative manner (Fig. 11). In contrast, this catalytically-inactive Vav2 mutant did

not interfere with the morphogenic stimulus of HGF/SF for ductal growth (Fig. 12). These

results suggest that Vav2 is specifically involved in the morphogenic but not the mitogenic

signaling cascades of neuregulin/ErbB-2, whereas other intracellular effectors may mediate

the stimulatory effects of HGF/SF and c-Met. It is known that one such effector is the

multiadaptor protein Gab1 (Grb2-associated binder; Holgado-Madruga et al., 1996). Gab1

specifically couples to activated c-Met (Weidner et al., 96; Schaeper et al., 2000), thus

transmitting unique HGF/SF signals for essential developmental processes during embryonic

life; genetic analysis revealed that both Gab1- and c-Met-deficient mice exhibit similar

phenotypes (Bladt et al., 1996; Sachs et al., 2000). In the last years, several multiadaptor

proteins have been described as specific substrates of receptor tyrosine kinases and key

transducers of their biological function. DOS, a Gab1-related multiadaptor protein of

Drosophila, mediates retinal development downstream of the receptor tyrosine kinase

Sevenless (Herbst et al., 1996; Raabe et al., 1996). IRS-1 and IRS-2 are major substrates of

the insulin and insulin-like growth factor receptors (Sun et al., 1991; Sun et al., 1995). Mice

lacking IRS-1 are mildly insulin-resistant due to compensation by IRS-2, but show a dramatic

impairment of glucose uptake in skeletal muscle (Araki et al., 1994; Tamemoto et al., 1994;

Yamauchi et al., 1996; Bruning et al., 1997). Disruption of the IRS-2 gene results in diabetes

(Withers et al., 1998), thus clearly showing distinct and critical roles for IRS-1 and IRS-2 in

different tissues that are targeted by insulin. Recently, novel Dok proteins have been

characterized as interaction partners of c-Ret and, like the receptor, induce neurite outgrowth

in PC12 cells (Grimm et al., 2001). The present work supports a putative role of Vav2 in

mediating neuregulin signals for mammary alveolar morphogenesis. Moreover, all these

studies provide substantial evidence that specific biological responses may result from

specific signaling pathways involving particular adaptors and hence, they put forward an

alternative mechanism for the generation of the unique developmental responses of receptor

tyrosine kinases.

65

Recent studies show that activation of Vav2 and RhoA also inhibits HGF/SF-induced cell

scattering upon overexpression in Madin-Darby canine kidney cells (MDCK; Kodama et al.,

2000). This observation suggests a negative role of Vav2 in branching morphogenesis and

raises the possibility of a dual role in vivo. Vav2 may therefore mediate neuregulin-induced

alveolar morphogenesis while simultaneously repressing HGF/SF-induced ductal growth.

Other groups, in contrast, report that activation of RhoG is essential for differentiation and

neurite outgrowth in PC12 cells following NGF treatment (Katoh et al., 2000). In the present

work, catalytically active Vav2 as GDP/GTP exchanger is strictly required for neuregulin-

induced alveolar morphogenesis. Future experiments in more physiological systems are

required to clarify the regulatory role of GEF factors and their targets in different biological

responses.

4.7 Possible Molecular Mechanisms Involving Vav2 as Critical Effector of Alveolar

Morphogenesis

This work provides evidence that Vav2 and ErbB-2 may be functionally associated in vivo to

promote alveolar morphogenesis of mammary epithelium. However, it does not resolve the

issue whether Vav2 is a direct or indirect substrate of the ErbB-2 kinase. A TrkErbB2-Vav2

fusion protein becomes morphogenic upon NGF stimulation (Fig. 7); nevertheless, it is

possible that an additional kinase is recruited to this hybrid protein via Vav2. Indeed,

activation of all Vav proteins by phosphorylation through Src tyrosine kinases has been

reported (Crespo et al., 1997; Schuebel et al., 1998; Movilla et al., 1999). In addition, recent

studies show that the PDGF receptor stimulates Vav2 through tyrosine phosphorylation by Src

(Chiariello et al., 2001). Recently, in vitro kinase assays were here performed with

immunoprecipitated TrkErbB-2 receptor from lysates of stimulated cells, together with

recombinant Vav2 protein as substrate. In line with the aforementioned report, these data

suggests that Vav2 is not directly phosphorylated by ErbB-2 in vitro (data not shown). It is

thus possible that the recruitment and activation of Src by ErbB-2 represents an intermediate

step resulting in the engagement of Vav2 for morphogenesis. However, activation of Src has

66

largely been implicated in the etiology of ErbB2-overexpressing breast tumors but not in

normal mammary development (Muthuswamy and Muller, 1994; Muthuswamy and Muller,

1995a); in fact, targeted overexpression of activated c-Src in the mammary epithelium results

in epithelial hyperplasia and impaired lobulo-alveolar development followed by severe

lactational failure (Webster et al., 1995). Latest experiments show that phosphorylated Vav2

interacts with the SH2 domain of Src (data not shown). This interaction is indeed likely, since

Vav2 contains a Src-binding consensus motif involving the regulatory tyrosine Y172;

however, it requires previous phosphorylation of Vav2. It is therefore possible that ErbB-2

phosphorylates Vav2 first on some of its various, non-regulatory tyrosine residues, thus

creating docking sites for Src other than the predicted consensus motif, and then Src futher

phosphorylates and activates Vav2. In support of this hypothesis, none of the known

autophosphorylation sites of ErbB-2 corresponds to the optimal Src consensus binding motif

(Songyang et al., 1993), though direct interaction between Src and ErbB-2 was here observed

in the yeast system and has also been reported by others (Muthuswamy and Muller, 1995).

Similarly, the direct binding site for Src on the PDGFβ receptor (DGHEYpYIpYVDP; Mori

et al., 1993) does not match the predicted motif; instead, it resembles the amino acid sequence

of ErbB-2 encompassing tyrosine Y3 (pYLVP), which was mapped in the yeast system as part

of the Src binding site (Table 2). However, such sequence is not present in Vav2, thus raising

the possibility of a broader range of phosphotyrosine-containing sequences that may be

recognized by the SH2 domain of Src. Alternatively, it has been proposed that Src

phosphorylates its own binding sites on the EGF receptor (Olayioye et al., 1999); such a

model would account for simultaneous binding of Src and activation of Vav2. Taken together,

these latest experiments favor that the indirect recruitment of Vav2 to ErbB-2 is of

physiological relevance. Nevertheless, further research that addresses the role of direct and

indirect binding of Vav2 to ErbB-2 may contribute to understand the mechanisms of Vav2

recruitment and activation in neuregulin signaling.

67

Previous studies suggest that activation of the MAPK/ERK (mitogen-activated protein

kinase/extracellular signal regulated protein kinase) pathway is a necessary step in neuregulin-

induced alveolar morphogenesis (Niemann et al., 1998). Indeed, MAP kinases are stimulated

by all ligand-activated combinations of ErbB receptors (Ben-Levy et al., 1992; Graus-Porta et

al., 1995; Karunagaran et al., 1996; Pinkas-Kramarski et al., 1996; Dankort et al., 1997;

Pinkas-Kramarski et al., 1998). The MAPK pathway is triggered via recruitment of Grb2 or

Shc/Grb2 complexes by the activated receptors (reviewed in Schlessinger and Bar-Sagi, 1994

and references therein). It has been shown that Grb2 constitutively binds Sos (Son of

Sevenless) via its SH3 domains. Association of the SH2 domain of Grb2 with activated

receptor tyrosine kinases leads to recruitment of the GDP/GTP exhanger Sos to the

membrane, where it can switch the membrane-anchored Ras GTPase to the active GTP-bound

form. Activation of Ras triggers a signaling cascade of kinases involving Raf (also termed

MAP/ERK kinase kinase MEKK, or MAPKKK), MAPK/ERK kinase (MEK, also termed

MAPKK) and finally the MAPK, which ultimately regulates transcription (reviewed in

Schaeffer and Weber, 1999). Tyrosines Y2 and Y4 of the ErbB-2 multidocking site directly

bind Grb-2 and Shc, respectively (Ricci et al., 1995; Dankort et al., 1997), and

Grb2/Sos/ErbB-2 complexes have been detected in breast cancer cells (Janes et al., 1994).

Moreover, different patterns of MAPK activation by α- and β-isoforms of NRG-1 and NRG-2

were reported (Pinkas-Kramarski et al., 1998); it has been suggested that duration of coupling

to MAPK pathway contributes to the signaling specificity by several ErbB heterodimers, and

the presence of ErbB-2 in receptor combinations contributes to prolong MAPK activation

(Karunagaran et al., 1996). Overexpression of constitutively active Vav proteins does not

activate MAPK; instead, Vav proteins strongly activate the c-Jun N-terminal kinase/stress-

activated protein kinase (JNK/SAPK; Crespo et al., 1996; Abe et al., 2000; data not shown).

Activation of JNK/SAPK by Vav proteins depends on the integrity of the Dbl-homology

domain, as it requires activation of the small GTPase Rac1. Nevertheless, a connection

between Vav2 and Ras has been suggested by synergism for cellular transformation (Schuebel

et al., 1998). It has been shown that Vav indirectly enhances Ras signaling; Vav-mediated

68

activation of small GTPases leads to subsequent activation of p21-activated protein kinases

(PAKs), which in turn activate Raf and MEK (Bustelo, 2000 and references therein). It is still

unclear whether Vav2 engages similar phosphorylation cascades. The possible requirement of

JNK/SAPK activation in neuregulin-induced alveolar morphogenesis therefore requires

attention.

It is clear that activation of the transcription factor Stat5a (signal transducer and activator of

transcription 5a) is critical in lobulo-alveolar morphogenesis. High levels of activated Stat5a

are found in the mammary gland at late pregnancy and during lactation. Inactivation of the

stat5a gene is accompanied by failure in terminal mammary differentiation but normal

production of milk proteins during pregnancy (Liu et al., 1997). Moreover, activation and

function of Stat5a during alveolar morphogenesis seems to be located downstream of ErbB-4

and prolactin signaling (Jones et al., 1999; Ihle and Kerr, 1995). Phosphorylation and

activation of Stat5 following neuregulin treatment has been observed in NIH3T3 fibroblasts

overexpressing both ErbB-2 and ErbB-4 (Olayioye et al., 1999); this observation indicates

that either heterodimers of ErbB2/erbB4, homodimers of ErbB-4 or both are responsible for

Stat5 activation. Since transgenic mice overexpressing dominant-negative ErbB-2 and ErbB-4

receptors in the mammary gland also show lactational failure, it is likely that heterodimers of

ErbB-2 and ErbB-4 control the activity of Stat5a in vivo. The activity of Stat5a in EpH4 cells

that overexpress Vav2 proteins has not been evaluated.

4.8 Conclusions

The results presented in this work suggest that Vav2 is a specific interacting partner of the

ErbB subgroup of receptor tyrosine kinases. This particular affinity of Vav2 for ErbB

receptors has a functional outcome: Vav2 can mediate specific signals from these receptors to

elicit alveolar morphogenesis of mammary epithelial cells. The enzymatic activity of Vav

proteins as GDP/GTP exchangers may provide a direct link to cytoskeletal rearrangements, an

essential step in morphogenic events. In vivo, Vav2 and ErbB-2 co-localize and are associated

69

in mammary alveolar epithelium during pregnancy, while neuregulin is simultaneously

synthesized in the mammary stroma. Therefore, this work supports a model whereby

neuregulin activates ErbB-2 in mammary epithelium, which then recruits Vav2 to trigger

unique signaling cascades that lead to lobulo-alveolar morphogenesis of the gland during

pregnancy.

As discussed above, there are some mechanistic points of ErbB-2/Vav2 signaling that still

need to be clarified. In addition, data on the function of Vav2 in mammary development in

vivo are required. Genetic ablation of the vav2 gene in mice revealed defective immune

response to thymus-independent antigens, and the additional loss of vav led to a severe defect

in B cell maturation (Doody et al., 2001; Tedford et al., 2001); however, vav2-deficient mice

apparently lack an overt epithelial phenotype, and it is not clear whether the mammary glands

from vav2 null mice undergo normal alveolar morphogenesis during pregnancy. An

explanation for this lack of an evident phenotype in epithelia is that Vav3, the other epithelial

Vav protein, may compensate for Vav2 function in tissues where both Vav2 and Vav3 are co-

expressed, as is the case of the mammary epithelium. Thus, generation of vav2/vav3 double

knockout mice may shed light on the physiological function of these guanine nucleotide

exchange factors in mammalian epithelial morphogenesis.

70

REFERENCES

Abe, K., K. L. Rossman, B. Liu, K. D. Ritola, D. Chiang, S. L. Campbell, K. Burridge, C. J. Der (2000). Vav2 is

an activator of Cdc42, Rac1, and RhoA. J. Biol. Chem. 275, 10141-10149.

Adams, J. C. and F. M. Watt (1993). Regulation of development and differentiation by the extracellular matrix.

Development 117, 1183-1198.

Adamson, E. D. (1990). Developmental activities of the epidermal growth factor receptor. Curr. Top. Dev. Biol.

24,1-29.

Aghazadeh, B., W. E. Lowry, X. Y. Huang, M. K. Rosen (2000). Structural basis for relief of autoinhibition of

the Dbl homology domain of proto-oncogene Vav by tyrosine phosphorylation. Cell 102, 625-633.

Akiyama, T., S. Matsuda, Y. Namba, T. Saito, K. Toyoshima, T. Yamamoto (1991). The transforming potential

of the c-erbB-2 protein is regulated by its autophosphorylation at the carboxyl-terminal domain. Mol. Cell

Biol. 11, 833-842.

Araki, E., M. A. Lipes, M. E. Patti, J. C. Bruning, B. Haag, R. S. Johnson, C. R. Kahn (1994). Alternative

pathway of insulin signalling in mice with targeted disruption of the IRS-1 gene. Nature 372, 186-190.

Aroian, R. V., M. Koga, J. E. Mendel, Y. Ohshima, P. W. Sternberg (1990). The let-23 gene necessary for

Caenorhabditis elegans vulval induction encodes a tyrosine kinase of the EGF receptor subfamily. Nature

348, 693-699.

Ausubel, F., R. Brent, R. Kingston, D. Moore, J. Smith, K. Struhl (1994). Current Protocols in Molecular

Biology. John Wiley & Sons, Inc.

Awasaki, T., M. Saito, M. Sone, E. Suzuki, R. Sakai, K. Ito, C. Hama (2000). The Drosophila trio plays an

essential role in patterning of axons by regulating their directional extension. Neuron 26, 119-131.

Barcellos-Hoff, M. H., J. Aggeler, T. G. Ram, M. J. Bissell (1989). Functional differentiation and alveolar

morphogenesis of primary mammary cultures on reconstituted basement membrane. Development 105,

223-235.

71

Bardelli, A., P. Longati, D. Gramaglia, M. C. Stella, P. M. Comoglio (1997). Gab1 coupling to the HGF/Met

receptor multifunctional docking site requires binding of Grb2 and correlates with the transforming

potential. Oncogene 15, 3103-3111.

Barrett, K., M. Leptin, J. Settleman (1997). The Rho GTPase and a putative RhoGEF mediate a signaling

pathway for the cell shape changes in Drosophila gastrulation. Cell 91, 905-915.

Bartel, P. L. and S. Fields (1995). Analyzing protein-protein interactions using two-hybrid system. Methods

Enzymol. 254, 241-263.

Bateman, J., H. Shu, D. Van Vactor (2000). The guanine nucleotide exchange factor trio mediates axonal

development in the Drosophila embryo. Neuron 26, 93-106.

Baulida, J., M. H. Kraus, M. Alimandi, P. P. Di Fiore, G. Carpenter (1996). All ErbB receptors other than the

epidermal growth factor receptor are endocytosis impaired. J. Biol. Chem. 271, 5251-5257.

Bchini, O., A. C. Andres, B. Schubaur, M. Mehtali, M. LeMeur, R. Lathe, P. Gerlinger (1991). Precocious

mammary gland development and milk protein synthesis in transgenic mice ubiquitously expressing

human growth hormone. Endocrinology 128, 539-546.

Behrens, J., J. P. von Kries, M. Kuhl, L. Bruhn, D. Wedlich, R. Grosschedl, W. Birchmeier (1996). Functional

interaction of beta-catenin with the transcription factor LEF-1. Nature 382, 638-642.

Ben-Levy, R., H. F. Paterson, C. J. Marshall, Y. Yarden (1994). A single autophosphorylation site confers

oncogenicity to the Neu/ErbB-2 receptor and enables coupling to the MAP kinase pathway. EMBO J. 13,

3302-3311.

Berdichevsky, F., C. Gilbert, M. Shearer, J. Taylor-Papadimitriou (1992). Collagen-induced rapid

morphogenesis of human mammary epithelial cells: the role of the alpha 2 beta 1 integrin. J. Cell Sci. 102,

437-446.

Billadeau, D. D., S. M. Mackie, R. A. Schoon, P. J. Leibson (2000). The Rho family guanine nucleotide

exchange factor Vav-2 regulates the development of cell-mediated cytotoxicity. J. Exp. Med. 192, 381-

392.

72

Bladt, F., D. Riethmacher, S. Isenmann, A. Aguzzi, C. Birchmeier (1995). Essential role for the c-met receptor in

the migration of myogenic precursor cells into the limb bud. Nature 376, 768-771.

Bocchinfuso, W. P. and K. S. Korach (1997). Mammary gland development and tumorigenesis in estrogen

receptor knockout mice. J. Mammary. Gland. Biol. Neoplasia. 2, 323-334.

Brisken, C., S. Park, T. Vass, J. P. Lydon, B. W. O'Malley, R. A. Weinberg (1998). A paracrine role for the

epithelial progesterone receptor in mammary gland development. Proc. Natl. Acad. Sci. U. S. A 95, 5076-

5081.

Brisken, C., S. Kaur, T. E. Chavarria, N. Binart, R. L. Sutherland, R. A. Weinberg, P. A. Kelly, C. J. Ormandy

(1999). Prolactin controls mammary gland development via direct and indirect mechanisms. Dev. Biol.

210, 96-106.

Brisken, C., A. Heineman, T. Chavarria, B. Elenbaas, J. Tan, S. K. Dey, J. A. McMahon, A. P. McMahon, R. A.

Weinberg (2000). Essential function of Wnt-4 in mammary gland development downstream of

progesterone signaling. Genes Dev. 14, 650-654.

Britsch, S., L. Li, S. Kirchhoff, F. Theuring, V. Brinkmann, C. Birchmeier, D. Riethmacher (1998). The ErbB2

and ErbB3 receptors and their ligand, neuregulin-1, are essential for development of the sympathetic

nervous system. Genes Dev. 12, 1825-1836.

Bruning, J. C., J. Winnay, B. Cheatham, C. R. Kahn (1997). Differential signaling by insulin receptor substrate 1

(IRS-1) and IRS-2 in IRS-1-deficient cells. Mol. Cell Biol. 17, 1513-1521.

Bustelo, X. R., J. A. Ledbetter, M. Barbacid (1992). Product of vav proto-oncogene defines a new class of

tyrosine protein kinase substrates. Nature 356, 68-71.

Bustelo, X. R. (2000). Regulatory and signaling properties of the Vav family. Mol. Cell Biol. 20, 1461-1477.

Carraway, K. L., J. L. Weber, M. J. Unger, J. Ledesma, N. Yu, M. Gassmann, C. Lai (1997). Neuregulin-2, a

new ligand of ErbB3/ErbB4-receptor tyrosine kinases. Nature 387, 512-516.

Chang, H., D. J. Riese, W. Gilbert, D. F. Stern, U. J. McMahan (1997). Ligands for ErbB-family receptors

encoded by a neuregulin-like gene. Nature 387, 509-512.

73

Chapman, R. S., P. C. Lourenco, E. Tonner, D. J. Flint, S. Selbert, K. Takeda, S. Akira, A. R. Clarke, C. J.

Watson (1999). Suppression of epithelial apoptosis and delayed mammary gland involution in mice with a

conditional knockout of Stat3. Genes Dev. 13, 2604-2616.

Chiariello, M., M. J. Marinissen, J. S. Gutkind (2001). Regulation of c-myc expression by PDGF through Rho

GTPases. Nat. Cell Biol. 3, 580-586.

Chodosh, L. A., H. P. Gardner, J. V. Rajan, D. B. Stairs, S. T. Marquis, P. A. Leder (2000). Protein kinase

expression during murine mammary development. Dev. Biol. 219, 259-276.

Cohen, B. D., P. A. Kiener, J. M. Green, L. Foy, H. P. Fell, K. Zhang (1996). The relationship between human

epidermal growth-like factor receptor expression and cellular transformation in NIH3T3 cells. J. Biol.

Chem. 271, 30897-30903.

Coleman-Krnacik, S. and J. M. Rosen (1994). Differential temporal and spatial gene expression of fibroblast

growth factor family members during mouse mammary gland development. Mol. Endocrinol. 8, 218-229.

Crespo, P., X. R. Bustelo, D. S. Aaronson, O. A. Coso, M. Lopez-Barahona, M. Barbacid, J. S. Gutkind (1996).

Rac-1 dependent stimulation of the JNK/SAPK signaling pathway by Vav. Oncogene 13, 455-460.

Crespo, P., K. E. Schuebel, A. A. Ostrom, J. S. Gutkind, X. R. Bustelo (1997). Phosphotyrosine-dependent

activation of Rac-1 GDP/GTP exchange by the vav proto-oncogene product. Nature 385, 169-172.

Crovello, C. S., C. Lai, L. C. Cantley, K. L. Carraway (1998). Differential signaling by the epidermal growth

factor-like growth factors neuregulin-1 and neuregulin-2. J. Biol. Chem. 273, 26954-26961.

Cunha, G. R. and Y. K. Hom (1996). Role of mesenchymal-epithelial interactions in mammary gland

development. J. Mammary. Gland. Biol. Neoplasia. 1, 21-35.

Cunha, G. R., P. Young, Y. K. Hom, P. S. Cooke, J. A. Taylor, D. B. Lubahn (1997). Elucidation of a role for

stromal steroid hormone receptors in mammary gland growth and development using tissue recombinants.

J. Mammary. Gland. Biol. Neoplasia. 2, 393-402.

Dankort, D., B. Maslikowski, N. Warner, N. Kanno, H. Kim, Z. Wang, M. F. Moran, R. G. Oshima, R. D.

Cardiff, W. J. Muller (2001). Grb2 and Shc adapter proteins play distinct roles in Neu (ErbB-2)-induced

mammary tumorigenesis: implications for human breast cancer. Mol. Cell Biol. 21, 1540-1551.

74

Dankort, D. L., Z. Wang, V. Blackmore, M. F. Moran, W. J. Muller (1997). Distinct tyrosine

autophosphorylation sites negatively and positively modulate neu-mediated transformation. Mol. Cell

Biol. 17, 5410-5425.

Doody, G. M., D. D. Billadeau, E. Clayton, A. Hutchings, R. Berland, S. McAdam, P. J. Leibson, M. Turner

(2000). Vav-2 controls NFAT-dependent transcription in B- but not T-lymphocytes. EMBO J. 19, 6173-

6184.

Doody, G. M., S. E. Bell, E. Vigorito, E. Clayton, S. McAdam, R. Tooze, C. Fernandez, I. J. Lee, M. Turner

(2001). Signal transduction through Vav-2 participates in humoral immune responses and B cell

maturation. Nature Immunol. 2, 542-547.

Dunbar, M. E. and J. J. Wysolmerski (1999). Parathyroid hormone-related protein: a developmental regulatory

molecule necessary for mammary gland development. J. Mammary. Gland. Biol. Neoplasia. 4, 21-34.

Eaton, S., P. Auvinen, L. Luo, Y. N. Jan, K. Simons (1995). CDC42 and Rac1 control different actin-dependent

processes in the Drosophila wing disc epithelium. J. Cell Biol. 131, 151-164.

Eaton, S., R. Wepf, K. Simons (1996). Roles for Rac1 and Cdc42 in planar polarization and hair outgrowth in the

wing of Drosophila. J. Cell Biol. 135, 1277-1289.

Emerman, J. T. and D. R. Pitelka (1977). Maintenance and induction of morphological differentiation in

dissociated mammary epithelium on floating collagen membranes. In Vitro 13, 316-328.

Erickson, S. L., K. S. O'Shea, N. Ghaboosi, L. Loverro, G. Frantz, M. Bauer, L. H. Lu, M. W. Moore (1997).

ErbB3 is required for normal cerebellar and cardiac development: a comparison with ErbB2-and

heregulin-deficient mice. Development 124, 4999-5011.

Falls, D. L., K. M. Rosen, G. Corfas, W. S. Lane, G. D. Fischbach (1993). ARIA, a protein that stimulates

acetylcholine receptor synthesis, is a member of the neu ligand family. Cell 72, 801-815.

Faraldo, M. M., M. A. Deugnier, M. Lukashev, J. P. Thiery, M. A. Glukhova (1998). Perturbation of beta1-

integrin function alters the development of murine mammary gland. EMBO J. 17, 2139-2147.

75

Fata, J. E., Y. Y. Kong, J. Li, T. Sasaki, J. Irie-Sasaki, R. A. Moorehead, R. Elliott, S. Scully, E. B. Voura, D. L.

Lacey, W. J. Boyle, R. Khokha, J. M. Penninger (2000). The osteoclast differentiation factor

osteoprotegerin-ligand is essential for mammary gland development. Cell 103, 41-50.

Fazioli, F., U. H. Kim, S. G. Rhee, C. J. Molloy, O. Segatto, P. P. Di Fiore (1991). The erbB-2 mitogenic

signaling pathway: tyrosine phosphorylation of phospholipase C-gamma and GTPase-activating protein

does not correlate with erbB-2 mitogenic potency. Mol. Cell Biol. 11, 2040-2048.

Fedi, P., J. H. Pierce, P. P. Di Fiore, M. H. Kraus (1994). Efficient coupling with phosphatidylinositol 3-kinase,

but not phospholipase C gamma or GTPase-activating protein, distinguishes ErbB-3 signaling from that of

other ErbB/EGFR family members. Mol. Cell Biol. 14, 492-500.

Fields, S. and O. Song (1989). A novel genetic system to detect protein-protein interactions. Nature 340, 245-

246.

Fischer, K. D., A. Zmuldzinas, S. Gardner, M. Barbacid, A. Bernstein, C. Guidos (1995). Defective T-cell

receptor signalling and positive selection of Vav-deficient CD4+ CD8+ thymocytes. Nature 374, 474-

477.

Fischer, K. D., Y. Y. Kong, H. Nishina, K. Tedford, L. E. Marengere, I. Kozieradzki, T. Sasaki, M. Starr, G.

Chan, S. Gardener, M. P. Nghiem, D. Bouchard, M. Barbacid, A. Bernstein, J. M. Penninger (1998). Vav

is a regulator of cytoskeletal reorganization mediated by the T-cell receptor. Curr. Biol. 8, 554-562.

Fixman, E. D., M. A. Naujokas, G. A. Rodrigues, M. F. Moran, M. Park (1995). Efficient cell transformation by

the Tpr-Met oncoprotein is dependent upon tyrosine 489 in the carboxy-terminus. Oncogene 10, 237-249.

Foley, J., P. Dann, J. Hong, J. Cosgrove, B. Dreyer, D. Rimm, M. Dunbar, W. Philbrick, J. Wysolmerski (2001).

Parathyroid hormone-related protein maintains mammary epithelial fate and triggers nipple skin

differentiation during embryonic breast development. Development 128, 513-525.

Fowler, K. J., F. Walker, W. Alexander, M. L. Hibbs, E. C. Nice, R. M. Bohmer, G. B. Mann, C. Thumwood, R.

Maglitto, J. A. Danks, a. et (1995). A mutation in the epidermal growth factor receptor in waved-2 mice

has a profound effect on receptor biochemistry that results in impaired lactation. Proc. Natl. Acad. Sci. U.

S. A 92, 1465-1469.

76

Freeman, M. (1998). Complexity of EGF receptor signalling revealed in Drosophila. Curr. Opin. Genet. Dev. 8,

407-411.

Freshney, N. W., S. D. Goonesekera, L. A. Feig (1997). Activation of the exchange factor Ras-GRF by calcium

requires an intact Dbl homology domain. FEBS Lett. 407, 111-115.

Gassmann, M., F. Casagranda, D. Orioli, H. Simon, C. Lai, R. Klein, G. Lemke (1995). Aberrant neural and

cardiac development in mice lacking the ErbB4 neuregulin receptor. Nature 378, 390-394.

Gorska, A. E., H. Joseph, R. Derynck, H. L. Moses, R. Serra (1998). Dominant-negative interference of the

transforming growth factor beta type II receptor in mammary gland epithelium results in alveolar

hyperplasia and differentiation in virgin mice. Cell Growth Differ. 9, 229-238.

Graus-Porta, D., R. R. Beerli, N. E. Hynes (1995). Single-chain antibody-mediated intracellular retention of

ErbB-2 impairs Neu differentiation factor and epidermal growth factor signaling. Mol. Cell Biol. 15,

1182-1191.

Graus-Porta, D., R. R. Beerli, J. M. Daly, N. E. Hynes (1997). ErbB-2, the preferred heterodimerization partner

of all ErbB receptors, is a mediator of lateral signaling. EMBO J. 16, 1647-1655.

Grimm, J., M. Sachs, S. Britsch, S. Di Cesare, T. Schwarz-Romond, K. Alitalo, W. Birchmeier (2001). Novel

p62dok family members, dok-4 and dok-5, are substrates of the c-Ret receptor tyrosine kinase and

mediate neuronal differentiation. J. Cell Biol. (in press).

Guo, L., L. Degenstein, E. Fuchs (1996). Keratinocyte growth factor is required for hair development but not for

wound healing. Genes Dev. 10, 165-175.

Guy, P. M., J. V. Platko, L. C. Cantley, R. A. Cerione, K. L. Carraway (1994). Insect cell-expressed p180erbB3

possesses an impaired tyrosine kinase activity. Proc. Natl. Acad. Sci. U. S. A 91, 8132-8136.

Hacker, U. and N. Perrimon (1998). DRhoGEF2 encodes a member of the Dbl family of oncogenes and controls

cell shape changes during gastrulation in Drosophila. Genes Dev. 12, 274-284.

Hall, A. (1998). Rho GTPases and the actin cytoskeleton. Science 279, 509-514.

Harari, D., E. Tzahar, J. Romano, M. Shelly, J. H. Pierce, G. C. Andrews, Y. Yarden (1999). Neuregulin-4: a

novel growth factor that acts through the ErbB-4 receptor tyrosine kinase. Oncogene 18, 2681-2689.

77

Hart, M. J., A. Eva, D. Zangrilli, S. A. Aaronson, T. Evans, R. A. Cerione, Y. Zheng (1994). Cellular

transformation and guanine nucleotide exchange activity are catalyzed by a common domain on the dbl

oncogene product. J. Biol. Chem. 269, 62-65.

Hazan, R., B. Margolis, M. Dombalagian, A. Ullrich, A. Zilberstein, J. Schlessinger (1990). Identification of

autophosphorylation sites of HER2/neu. Cell Growth Differ. 1, 3-7.

Herbst, R., P. M. Carroll, J. D. Allard, J. Schilling, T. Raabe, M. A. Simon (1996). Daughter of sevenless is a

substrate of the phosphotyrosine phosphatase Corkscrew and functions during sevenless signaling. Cell

85, 899-909.

Holgado-Madruga, M., D. R. Emlet, D. K. Moscatello, A. K. Godwin, A. J. Wong (1996). A Grb2-associated

docking protein in EGF- and insulin-receptor signalling. Nature 379, 560-564.

Holmes, W. E., M. X. Sliwkowski, R. W. Akita, W. J. Henzel, J. Lee, J. W. Park, D. Yansura, N. Abadi, H.

Raab, G. D. Lewis, a. et (1992). Identification of heregulin, a specific activator of p185erbB2. Science

256, 1205-1210.

Horseman, N. D., W. Zhao, E. Montecino-Rodriguez, M. Tanaka, K. Nakashima, S. J. Engle, F. Smith, E.

Markoff, K. Dorshkind (1997). Defective mammopoiesis, but normal hematopoiesis, in mice with a

targeted disruption of the prolactin gene. EMBO J. 16, 6926-6935.

Hubbard, S. R., M. Mohammadi, J. Schlessinger (1998). Autoregulatory mechanisms in protein-tyrosine kinases.

J. Biol. Chem. 273, 11987-11990.

Huelsken, J. and W. Birchmeier (2001). New aspects of Wnt signaling pathways in higher vertebrates. Curr. Op.

Genet. Dev. (in press).

Huelsken, J., R. Vogel, B. Erdmann, G. Cotsarelis, W. Birchmeier (2001). beta-Catenin controls hair follicle

morphogenesis and stem cell differentiation in the skin. Cell 105, 533-545.

Ihle, J. N. and I. M. Kerr (1995). Jaks and Stats in signaling by the cytokine receptor superfamily. Trends Genet.

11, 69-74.

Imbert, A., R. Eelkema, S. Jordan, H. Feiner, P. Cowin (2001). Delta N89 beta-catenin induces precocious

development, differentiation, and neoplasia in mammary gland. J. Cell Biol. 153, 555-568.

78

Jackson, D., J. Bresnick, C. Dickson (1997). A role for fibroblast growth factor signaling in the lobuloalveolar

development of the mammary gland. J. Mammary. Gland. Biol. Neoplasia. 2, 385-392.

Jallal, B., J. Schlessinger, A. Ullrich (1992). Tyrosine phosphatase inhibition permits analysis of signal

transduction complexes in p185HER2/neu-overexpressing human tumor cells. J. Biol. Chem. 267, 4357-

4363.

Janes, P. W., R. J. Daly, A. deFazio, R. L. Sutherland (1994). Activation of the Ras signalling pathway in human

breast cancer cells overexpressing erbB-2. Oncogene 9, 3601-3608.

Jhappan, C., A. G. Geiser, E. C. Kordon, D. Bagheri, L. Hennighausen, A. B. Roberts, G. H. Smith, G. Merlino

(1993). Targeting expression of a transforming growth factor beta 1 transgene to the pregnant mammary

gland inhibits alveolar development and lactation. EMBO J. 12, 1835-1845.

Jones, F. E., D. J. Jerry, B. C. Guarino, G. C. Andrews, D. F. Stern (1996). Heregulin induces in vivo

proliferation and differentiation of mammary epithelium into secretory lobuloalveoli. Cell Growth Differ.

7, 1031-1038.

Jones, F. E. and D. F. Stern (1999). Expression of dominant-negative ErbB2 in the mammary gland of transgenic

mice reveals a role in lobuloalveolar development and lactation. Oncogene 18, 3481-3490.

Jones, F. E., T. Welte, X. Y. Fu, D. F. Stern (1999). ErbB4 signaling in the mammary gland is required for

lobuloalveolar development and Stat5 activation during lactation. J. Cell Biol. 147, 77-88.

Joseph, H., A. E. Gorska, P. Sohn, H. L. Moses, R. Serra (1999). Overexpression of a kinase-deficient

transforming growth factor-beta type II receptor in mouse mammary stroma results in increased epithelial

branching. Mol. Biol. Cell 10, 1221-1234.

Karunagaran, D., E. Tzahar, N. Liu, D. Wen, Y. Yarden (1995). Neu differentiation factor inhibits EGF binding.

A model for trans-regulation within the ErbB family of receptor tyrosine kinases. J. Biol. Chem. 270,

9982-9990.

Karunagaran, D., E. Tzahar, R. R. Beerli, X. Chen, D. Graus-Porta, B. J. Ratzkin, R. Seger, N. E. Hynes, Y.

Yarden (1996). ErbB-2 is a common auxiliary subunit of NDF and EGF receptors: implications for breast

cancer. EMBO J. 15, 254-264.

79

Katoh, H., H. Yasui, Y. Yamaguchi, J. Aoki, H. Fujita, K. Mori, M. Negishi (2000). Small GTPase RhoG is a

key regulator for neurite outgrowth in PC12 cells. Mol. Cell Biol. 20, 7378-7387.

Katzav, S., D. Martin-Zanca, M. Barbacid (1989). vav, a novel human oncogene derived from a locus

ubiquitously expressed in hematopoietic cells. EMBO J. 8, 2283-2290.

Katzav, S., J. L. Cleveland, H. E. Heslop, D. Pulido (1991). Loss of the amino-terminal helix-loop-helix domain

of the vav proto-oncogene activates its transforming potential. Mol. Cell Biol. 11, 1912-1920.

Klapper, L. N., H. Waterman, M. Sela, Y. Yarden (2000). Tumor-inhibitory antibodies to HER-2/ErbB-2 may

act by recruiting c-Cbl and enhancing ubiquitination of HER-2. Cancer Res. 60, 3384-3388.

Kleinberg, D. L. (1997). Early mammary development: growth hormone and IGF-1. J. Mammary. Gland. Biol.

Neoplasia. 2, 49-57.

Kleinman, H. K., M. L. McGarvey, J. R. Hassell, V. L. Star, F. B. Cannon, G. W. Laurie, G. R. Martin (1986).

Basement membrane complexes with biological activity. Biochemistry 25, 312-318.

Kodama, A., T. Matozaki, A. Fukuhara, M. Kikyo, M. Ichihashi, Y. Takai (2000). Involvement of an SHP-2-Rho

small G protein pathway in hepatocyte growth factor/scatter factor-induced cell scattering. Mol. Biol. Cell

11, 2565-2575.

Kokai, Y., J. A. Cohen, J. A. Drebin, M. I. Greene (1987). Stage- and tissue-specific expression of the neu

oncogene in rat development. Proc. Natl. Acad. Sci. U. S. A 84, 8498-8501.

Korach, K. S. (1994). Insights from the study of animals lacking functional estrogen receptor. Science 266, 1524-

1527.

Kramer, R., N. Bucay, D. J. Kane, L. E. Martin, J. E. Tarpley, L. E. Theill (1996). Neuregulins with an Ig-like

domain are essential for mouse myocardial and neuronal development. Proc. Natl. Acad. Sci. U. S. A 93,

4833-4838.

Kratochwil, K. (1986). Tissue combination and organ culture studies in the development of the embryonic

mammary gland. Dev. Biol. (N. Y. 1985. ) 43,15-33.

Lacey, D. L., E. Timms, H. L. Tan, M. J. Kelley, C. R. Dunstan, T. Burgess, R. Elliott, A. Colombero, G. Elliott,

S. Scully, H. Hsu, J. Sullivan, N. Hawkins, E. Davy, C. Capparelli, A. Eli, Y. X. Qian, S. Kaufman, I.

80

Sarosi, V. Shalhoub, G. Senaldi, J. Guo, J. Delaney, W. J. Boyle (1998). Osteoprotegerin ligand is a

cytokine that regulates osteoclast differentiation and activation. Cell 93, 165-176.

Lee, K. F., H. Simon, H. Chen, B. Bates, M. C. Hung, C. Hauser (1995). Requirement for neuregulin receptor

erbB2 in neural and cardiac development. Nature 378, 394-398.

Lenferink, A. E., R. Pinkas-Kramarski, M. L. van de Poll, M. J. van Vugt, L. N. Klapper, E. Tzahar, H.

Waterman, M. Sela, E. J. van Zoelen, Y. Yarden (1998). Differential endocytic routing of homo- and

hetero-dimeric ErbB tyrosine kinases confers signaling superiority to receptor heterodimers. EMBO J. 17,

3385-3397.

Levkowitz, G., H. Waterman, E. Zamir, Z. Kam, S. Oved, W. Y. Langdon, L. Beguinot, B. Geiger, Y. Yarden

(1998). c-Cbl/Sli-1 regulates endocytic sorting and ubiquitination of the epidermal growth factor receptor.

Genes Dev. 12, 3663-3674.

Levkowitz, G., S. Oved, L. N. Klapper, D. Harari, S. Lavi, M. Sela, Y. Yarden (2000). c-Cbl is a suppressor of

the neu oncogene. J. Biol. Chem. 275, 35532-35539.

Li, M., X. Liu, G. Robinson, U. Bar-Peled, K. U. Wagner, W. S. Young, L. Hennighausen, P. A. Furth (1997).

Mammary-derived signals activate programmed cell death during the first stage of mammary gland

involution. Proc. Natl. Acad. Sci. U. S. A 94, 3425-3430.

Li, L., (2001). (submitted)

Licitra, E. J. and J. O. Liu (1996). A three-hybrid system for detecting small ligand-protein receptor interactions.

Proc. Natl. Acad. Sci. U. S. A 93, 12817-12821.

Liebl, E. C., D. J. Forsthoefel, L. S. Franco, S. H. Sample, J. E. Hess, J. A. Cowger, M. P. Chandler, A. M.

Shupert, M. A. Seeger (2000). Dosage-sensitive, reciprocal genetic interactions between the Abl tyrosine

kinase and the putative GEF trio reveal trio's role in axon pathfinding. Neuron 26, 107-118.

Lin, C. Q. and M. J. Bissell (1993). Multi-faceted regulation of cell differentiation by extracellular matrix.

FASEB J. 7, 737-743.

Liu, X., G. W. Robinson, K. U. Wagner, L. Garrett, A. Wynshaw-Boris, L. Hennighausen (1997). Stat5a is

mandatory for adult mammary gland development and lactogenesis. Genes Dev. 11, 179-186.

81

Lopez-Barahona, M., I. Fialka, J. M. Gonzalez-Sancho, M. Asuncion, M. Gonzalez, T. Iglesias, J. Bernal, H.

Beug, A. Munoz (1995). Thyroid hormone regulates stromelysin expression, protease secretion and the

morphogenetic potential of normal polarized mammary epithelial cells. EMBO J. 14, 1145-1155.

Lopez-Lago, M., H. Lee, C. Cruz, N. Movilla, X. R. Bustelo (2000). Tyrosine phosphorylation mediates both

activation and downmodulation of the biological activity of Vav. Mol. Cell Biol. 20, 1678-1691.

Luetteke, N. C., T. H. Qiu, R. L. Peiffer, P. Oliver, O. Smithies, D. C. Lee (1993). TGF alpha deficiency results

in hair follicle and eye abnormalities in targeted and waved-1 mice. Cell 73, 263-278.

Luetteke, N. C., T. H. Qiu, S. E. Fenton, K. L. Troyer, R. F. Riedel, A. Chang, D. C. Lee (1999). Targeted

inactivation of the EGF and amphiregulin genes reveals distinct roles for EGF receptor ligands in mouse

mammary gland development. Development 126, 2739-2750.

Lund, L. R., J. Romer, N. Thomasset, H. Solberg, C. Pyke, M. J. Bissell, K. Dano, Z. Werb (1996). Two distinct

phases of apoptosis in mammary gland involution: proteinase-independent and -dependent pathways.

Development 122, 181-193.

Lydon, J. P., F. J. DeMayo, C. R. Funk, S. K. Mani, A. R. Hughes, C. A. Montgomery, G. Shyamala, O. M.

Conneely, B. W. O'Malley (1995). Mice lacking progesterone receptor exhibit pleiotropic reproductive

abnormalities. Genes Dev. 9, 2266-2278.

Mackay, D. J. and A. Hall (1998). Rho GTPases. J. Biol. Chem. 273, 20685-20688.

Magie, C. R., M. R. Meyer, M. S. Gorsuch, S. M. Parkhurst (1999). Mutations in the Rho1 small GTPase disrupt

morphogenesis and segmentation during early Drosophila development. Development 126, 5353-5364.

Mann, G. B., K. J. Fowler, A. Gabriel, E. C. Nice, R. L. Williams, A. R. Dunn (1993). Mice with a null mutation

of the TGF alpha gene have abnormal skin architecture, wavy hair, and curly whiskers and often develop

corneal inflammation. Cell 73, 249-261.

Marchionni, M. A., A. D. Goodearl, M. S. Chen, O. Bermingham-McDonogh, C. Kirk, M. Hendricks, F. Danehy,

D. Misumi, J. Sudhalter, K. Kobayashi, a. et (1993). Glial growth factors are alternatively spliced erbB2

ligands expressed in the nervous system. Nature 362, 312-318.

82

Margolis, B., P. Hu, S. Katzav, W. Li, J. M. Oliver, A. Ullrich, A. Weiss, J. Schlessinger (1992). Tyrosine

phosphorylation of vav proto-oncogene product containing SH2 domain and transcription factor motifs.

Nature 356, 71-74.

Matsui, Y., S. A. Halter, J. T. Holt, B. L. Hogan, R. J. Coffey (1990). Development of mammary hyperplasia and

neoplasia in MMTV-TGF alpha transgenic mice. Cell 61, 1147-1155.

Meyer, D. and C. Birchmeier (1994). Distinct isoforms of neuregulin are expressed in mesenchymal and neuronal

cells during mouse development. Proc. Natl. Acad. Sci. U. S. A 91, 1064-1068.

Meyer, D. and C. Birchmeier (1995). Multiple essential functions of neuregulin in development. Nature 378,

386-390.

Miettinen, P. J., J. E. Berger, J. Meneses, Y. Phung, R. A. Pedersen, Z. Werb, R. Derynck (1995). Epithelial

immaturity and multiorgan failure in mice lacking epidermal growth factor receptor. Nature 376, 337-341.

Moores, S. L., L. M. Selfors, J. Fredericks, T. Breit, K. Fujikawa, F. W. Alt, J. S. Brugge, W. Swat (2000). Vav

family proteins couple to diverse cell surface receptors. Mol. Cell Biol. 20, 6364-6373.

Mori, S., L. Ronnstrand, K. Yokote, A. Engstrom, S. A. Courtneidge, L. Claesson-Welsh, C. H. Heldin (1993).

Identification of two juxtamembrane autophosphorylation sites in the PDGF beta-receptor; involvement in

the interaction with Src family tyrosine kinases. EMBO J. 12, 2257-2264.

Morini, M., S. Astigiano, M. Mora, C. Ricotta, N. Ferrari, S. Mantero, G. Levi, M. Rossini, O. Barbieri (2000).

Hyperplasia and impaired involution in the mammary gland of transgenic mice expressing human FGF4.

Oncogene 19, 6007-6014.

Morris, J. K., W. Lin, C. Hauser, Y. Marchuk, D. Getman, K. F. Lee (1999). Rescue of the cardiac defect in

ErbB2 mutant mice reveals essential roles of ErbB2 in peripheral nervous system development. Neuron

23, 273-283.

Movilla, N. and X. R. Bustelo (1999). Biological and regulatory properties of Vav-3, a new member of the Vav

family of oncoproteins. Mol. Cell Biol. 19, 7870-7885.

Murphy, A. M. and D.J.Montell (1996). Cell type specific roles for Cdc42, Rac and RhoL in drosophila

oogenesis. J. Cell Biol. 133, 617-630.

83

Muthuswamy, S. K. and W. J. Muller (1994). Activation of the Src family of tyrosine kinases in mammary

tumorigenesis. Adv. Cancer Res. 64, 111-123.

Muthuswamy, S. K. and W. J. Muller (1995a). Activation of Src family kinases in Neu-induced mammary tumors

correlates with their association with distinct sets of tyrosine phosphorylated proteins in vivo. Oncogene

11, 1801-1810.

Muthuswamy, S. K. and W. J. Muller (1995b). Direct and specific interaction of c-Src with Neu is involved in

signaling by the epidermal growth factor receptor. Oncogene 11, 271-279.

Nemanic, M. K. and D. R. Pitelka (1971). A scanning electron microscope study of the lactating mammary gland.

J. Cell Biol. 48, 410-415.

Newsome, T. P., S. Schmidt, G. Dietzl, K. Keleman, B. Asling, A. Debant, B. J. Dickson (2000). Trio combines

with dock to regulate Pak activity during photoreceptor axon pathfinding in Drosophila. Cell 101, 283-

294.

Nguyen, A. V. and J. W. Pollard (2000). Transforming growth factor beta3 induces cell death during the first

stage of mammary gland involution. Development 127, 3107-3118.

Nguyen, L., M. Holgado-Madruga, C. Maroun, E. D. Fixman, D. Kamikura, T. Fournier, A. Charest, M. L.

Tremblay, A. J. Wong, M. Park (1997). Association of the multisubstrate docking protein Gab1 with the

hepatocyte growth factor receptor requires a functional Grb2 binding site involving tyrosine 1356. J. Biol.

Chem. 272, 20811-20819.

Niemann, C., V. Brinkmann, E. Spitzer, G. Hartmann, M. Sachs, H. Naundorf, W. Birchmeier (1998).

Reconstitution of mammary gland development in vitro: requirement of c-met and c-erbB2 signaling for

branching and alveolar morphogenesis. J. Cell Biol. 143, 533-545.

Niranjan, B., L. Buluwela, J. Yant, N. Perusinghe, A. Atherton, D. Phippard, T. Dale, B. Gusterson, T. Kamalati

(1995). HGF/SF: a potent cytokine for mammary growth, morphogenesis and development. Development

121, 2897-2908.

O'Neill, T. J., A. Craparo, T. A. Gustafson (1994). Characterization of an interaction between insulin receptor

substrate 1 and the insulin receptor by using the two-hybrid system. Mol. Cell Biol. 14, 6433-6442.

84

Olayioye, M. A., D. Graus-Porta, R. R. Beerli, J. Rohrer, B. Gay, N. E. Hynes (1998). ErbB-1 and ErbB-2

acquire distinct signaling properties dependent upon their dimerization partner. Mol. Cell Biol. 18, 5042-

5051.

Olayioye, M. A., I. Beuvink, K. Horsch, J. M. Daly, N. E. Hynes (1999). ErbB receptor-induced activation of

stat transcription factors is mediated by Src tyrosine kinases. J. Biol. Chem. 274, 17209-17218.

Olayioye, M. A., R. M. Neve, H. A. Lane, N. E. Hynes (2000). The ErbB signaling network: receptor

heterodimerization in development and cancer. EMBO J. 19, 3159-3167.

Olson, M. F., N. G. Pasteris, J. L. Gorski, A. Hall (1996). Faciogenital dysplasia protein (FGD1) and Vav, two

related proteins required for normal embryonic development, are upstream regulators of Rho GTPases.

Curr. Biol. 6, 1628-1633.

Ormandy, C. J., A. Camus, J. Barra, D. Damotte, B. Lucas, H. Buteau, M. Edery, N. Brousse, C. Babinet, N.

Binart, P. A. Kelly (1997). Null mutation of the prolactin receptor gene produces multiple reproductive

defects in the mouse. Genes Dev. 11, 167-178.

Pandey, A., A. V. Podtelejnikov, B. Blagoev, X. R. Bustelo, M. Mann, H. F. Lodish (2000). Analysis of receptor

signaling pathways by mass spectrometry: identification of vav-2 as a substrate of the epidermal and

platelet-derived growth factor receptors. Proc. Natl. Acad. Sci. U. S. A 97, 179-184.

Park, M., M. Dean, C. S. Cooper, M. Schmidt, S. J. O'Brien, D. G. Blair, G. F. Vande-Woude (1986).

Mechanism of met oncogene activation. Cell 45, 895-904.

Partanen, A. M. (1990). Epidermal growth factor and transforming growth factor-alpha in the development of

epithelial-mesenchymal organs of the mouse. Curr. Top. Dev. Biol. 24, 31-55.

Pasteris, N. G., A. Cadle, L. J. Logie, M. E. Porteous, C. E. Schwartz, R. E. Stevenson, T. W. Glover, R. S.

Wilroy, J. L. Gorski (1994). Isolation and characterization of the faciogenital dysplasia (Aarskog-Scott

syndrome) gene: a putative Rho/Rac guanine nucleotide exchange factor. Cell 79, 669-678.

Pawson, T. (1995). Protein modules and signalling networks. Nature 373, 573-580.

Pawson, T. and J. D. Scott (1997). Signaling through scaffold, anchoring, and adaptor proteins. Science 278,

2075-2080.

85

Peles, E. and Y. Yarden (1993). Neu and its ligands: from an oncogene to neural factors. Bioessays 15, 815-824.

Peles, E., R. Ben Levy, E. Tzahar, N. Liu, D. Wen, Y. Yarden (1993). Cell-type specific interaction of Neu

differentiation factor (NDF/heregulin) with Neu/HER-2 suggests complex ligand-receptor relationships.

EMBO J. 12, 961-971.

Pepper, M. S., J. V. Soriano, P. A. Menoud, A. P. Sappino, L. Orci, R. Montesano (1995). Modulation of

hepatocyte growth factor and c-met in the rat mammary gland during pregnancy, lactation, and involution.

Exp. Cell Res. 219, 204-210.

Pierce, D. F., M. D. Johnson, Y. Matsui, S. D. Robinson, L. I. Gold, A. F. Purchio, C. W. Daniel, B. L. Hogan,

H. L. Moses (1993). Inhibition of mammary duct development but not alveolar outgrowth during

pregnancy in transgenic mice expressing active TGF-beta 1. Genes Dev. 7, 2308-2317.

Pinkas-Kramarski, R., L. Soussan, H. Waterman, G. Levkowitz, I. Alroy, L. Klapper, S. Lavi, R. Seger, B. J.

Ratzkin, M. Sela, Y. Yarden (1996). Diversification of Neu differentiation factor and epidermal growth

factor signaling by combinatorial receptor interactions. EMBO J. 15, 2452-2467.

Pinkas-Kramarski, R., R. Eilam, I. Alroy, G. Levkowitz, P. Lonai, Y. Yarden (1997). Differential expression of

NDF/neuregulin receptors ErbB-3 and ErbB-4 and involvement in inhibition of neuronal differentiation.

Oncogene 15, 2803-2815.

Pinkas-Kramarski, R., M. Shelly, B. C. Guarino, L. M. Wang, L. Lyass, I. Alroy, M. Alimandi, A. Kuo, J. D.

Moyer, S. Lavi, M. Eisenstein, B. J. Ratzkin, R. Seger, S. S. Bacus, J. H. Pierce, G. C. Andrews, Y.

Yarden, M. Alamandi (1998). ErbB tyrosine kinases and the two neuregulin families constitute a ligand-

receptor network. Mol. Cell Biol. 18, 6090-6101.

Pollard, J. W. and L. Hennighausen (1994). Colony stimulating factor 1 is required for mammary gland

development during pregnancy. Proc. Natl. Acad. Sci. U. S. A 91, 9312-9316.

Prigent, S. A. and W. J. Gullick (1994). Identification of c-erbB-3 binding sites for phosphatidylinositol 3'-kinase

and SHC using an EGF receptor/c-erbB-3 chimera. EMBO J. 13, 2831-2841.

Qian, X., W. C. Vass, A. G. Papageorge, P. H. Anborgh, D. R. Lowy (1998). N terminus of Sos1 Ras exchange

factor: critical roles for the Dbl and pleckstrin homology domains. Mol. Cell Biol. 18, 771-778.

86

Raabe, T., J. Riesgo-Escovar, X. Liu, B. S. Bausenwein, P. Deak, P. Maroy, E. Hafen (1996). DOS, a novel

pleckstrin homology domain-containing protein required for signal transduction between sevenless and

Ras1 in Drosophila. Cell 85, 911-920.

Reichmann, E., R. Ball, B. Groner, R. R. Friis (1989). New mammary epithelial and fibroblastic cell clones in

coculture form structures competent to differentiate functionally. J. Cell Biol. 108, 1127-1138.

Ricci, A., L. Lanfrancone, R. Chiari, G. Belardo, C. Pertica, P. G. Natali, P. G. Pelicci, O. Segatto (1995).

Analysis of protein-protein interactions involved in the activation of the Shc/Grb-2 pathway by the ErbB-2

kinase. Oncogene 11, 1519-1529.

Riese, D. J., T. M. van Raaij, G. D. Plowman, G. C. Andrews, D. F. Stern (1995). The cellular response to

neuregulins is governed by complex interactions of the erbB receptor family. Mol. Cell Biol. 15, 5770-

5776.

Riese, D. J. and D. F. Stern (1998). Specificity within the EGF family/ErbB receptor family signaling network.

Bioessays 20, 41-48.

Riethmacher, D., E. Sonnenberg-Riethmacher, V. Brinkmann, T. Yamaai, G. R. Lewin, C. Birchmeier (1997).

Severe neuropathies in mice with targeted mutations in the ErbB3 receptor. Nature 389, 725-730.

Robinson, G. W., A. B. Karpf, K. Kratochwil (1999). Regulation of mammary gland development by tissue

interaction. J. Mammary. Gland. Biol. Neoplasia. 4, 9-19.

Rodrigues, G. A. and M. Park (1993). Dimerization mediated through a leucine zipper activates the oncogenic

potential of the met receptor tyrosine kinase. Mol. Cell Biol. 13, 6711-6722.

Ruan, W. and D. L. Kleinberg (1999). Insulin-like growth factor I is essential for terminal end bud formation and

ductal morphogenesis during mammary development. Endocrinology 140, 5075-5081.

Sachs, M., K. M. Weidner, V. Brinkmann, I. Walther, A. Obermeier, A. Ullrich, W. Birchmeier (1996).

Motogenic and morphogenic activity of epithelial receptor tyrosine kinases. J. Cell Biol. 133, 1095-1107.

Sachs, M., H. Brohmann, D. Zechner, T. Muller, J. Hulsken, I. Walther, U. Schaeper, C. Birchmeier, W.

Birchmeier (2000). Essential role of Gab1 for signaling by the c-Met receptor in vivo. J. Cell Biol. 150,

1375-1384.

87

Sakakura, T. (1987). Mammary embryogenesis. In The mammary gland: Development, regulation and function.

(eds. M. C. Neville and C. W. Daniel), pp. 37-66. Plenum Press, New York.

Sandgren, E. P., J. A. Schroeder, T. H. Qui, R. D. Palmiter, R. L. Brinster, D. C. Lee (1995). Inhibition of

mammary gland involution is associated with transforming growth factor alpha but not c-myc-induced

tumorigenesis in transgenic mice. Cancer Res. 55, 3915-3927.

Sawer, R. J. and J. F. Fallon (1983). Epithelial-mesenchymal interactions in development. Praeger Publishers,

New York.

Schaeffer, H. J. and M. J. Weber (1999). Mitogen-activated protein kinases: specific messages from ubiquitous

messengers. Mol. Cell Biol. 19, 2435-2444.

Schaeper, U., N. H. Gehring, K. P. Fuchs, M. Sachs, B. Kempkes, W. Birchmeier (2000). Coupling of Gab1 to c-

Met, Grb2, and Shp2 mediates biological responses. J. Cell Biol. 149, 1419-1432.

Schlessinger, J. and D. Bar-Sagi (1994). Activation of Ras and other signaling pathways by receptor tyrosine

kinases. Cold Spring Harb. Symp. Quant. Biol. 59, 173-179.

Schroeder, J. A. and D. C. Lee (1998). Dynamic expression and activation of ErbB receptors in the developing

mouse mammary gland. Cell Growth Differ. 9, 451-464.

Schuebel, K. E., X. R. Bustelo, D. A. Nielsen, B. J. Song, M. Barbacid, D. Goldman, I. J. Lee (1996). Isolation

and characterization of murine vav2, a member of the vav family of proto-oncogenes. Oncogene 13, 363-

371.

Schuebel, K. E., N. Movilla, J. L. Rosa, X. R. Bustelo (1998). Phosphorylation-dependent and constitutive

activation of Rho proteins by wild-type and oncogenic Vav-2. EMBO J. 17, 6608-6621.

Sebastian, J., R. G. Richards, M. P. Walker, J. F. Wiesen, Z. Werb, R. Derynck, Y. K. Hom, G. R. Cunha, R. P.

DiAugustine (1998). Activation and function of the epidermal growth factor receptor and erbB-2 during

mammary gland morphogenesis. Cell Growth Differ. 9, 777-785.

Segatto, O., F. Lonardo, J. H. Pierce, D. P. Bottaro, P. P. Di Fiore (1990). The role of autophosphorylation in

modulation of erbB-2 transforming function. New Biol. 2, 187-195.

88

Segatto, O., G. Pelicci, S. Giuli, G. Digiesi, P. P. Di Fiore, J. McGlade, T. Pawson, P. G. Pelicci (1993). Shc

products are substrates of erbB-2 kinase. Oncogene 8, 2105-2112.

Sibilia, M. and E. F. Wagner (1995). Strain-dependent epithelial defects in mice lacking the EGF receptor.

Science 269, 234-238.

Sibilia, M., J. P. Steinbach, L. Stingl, A. Aguzzi, E. F. Wagner (1998). A strain-independent postnatal

neurodegeneration in mice lacking the EGF receptor. EMBO J. 17, 719-731.

Silberstein, G. B. (2001). Postnatal mammary gland morphogenesis. Microsc. Res. Tech. 52, 155-162.

Sone, M., M. Hoshino, E. Suzuki, S. Kuroda, K. Kaibuchi, H. Nakagoshi, K. Saigo, Y. Nabeshima, C. Hama

(1997). Still life, a protein in synaptic terminals of Drosophila homologous to GDP-GTP exchangers.

Science 275, 543-547.

Songyang, Z., S. E. Shoelson, M. Chaudhuri, G. Gish, T. Pawson, W. G. Haser, F. King, T. Roberts, S.

Ratnofsky, R. J. Lechleider, a. et (1993). SH2 domains recognize specific phosphopeptide sequences. Cell

72, 767-778.

Songyang, Z., S. E. Shoelson, J. McGlade, P. Olivier, T. Pawson, X. R. Bustelo, M. Barbacid, H. Sabe, H.

Hanafusa, T. Yi, a. et (1994). Specific motifs recognized by the SH2 domains of Csk, 3BP2, fps/fes,

GRB-2, HCP, SHC, Syk, and Vav. Mol. Cell Biol. 14, 2777-2785.

Sonnenberg, A., C. J. Linders, P. W. Modderman, C. H. Damsky, M. Aumailley, R. Timpl (1990). Integrin

recognition of different cell-binding fragments of laminin (P1, E3, E8) and evidence that alpha 6 beta 1

but not alpha 6 beta 4 functions as a major receptor for fragment E8. J. Cell Biol. 110, 2145-2155.

Soriano, J. V., M. S. Pepper, T. Nakamura, L. Orci, R. Montesano (1995). Hepatocyte growth factor stimulates

extensive development of branching duct-like structures by cloned mammary gland epithelial cells. J. Cell

Sci. 108, 413-430.

Stein, D., J. Wu, S. A. Fuqua, C. Roonprapunt, V. Yajnik, P. D'Eustachio, J. J. Moskow, A. M. Buchberg, C. K.

Osborne, B. Margolis (1994). The SH2 domain protein GRB-7 is co-amplified, overexpressed and in a

tight complex with HER2 in breast cancer. EMBO J. 13, 1331-1340.

89

Steven, R., T. J. Kubiseski, H. Zheng, S. Kulkarni, J. Mancillas, A. Ruiz-Morales, C. W. Hogue, T. Pawson, J.

Culotti (1998). UNC-73 activates the Rac GTPase and is required for cell and growth cone migrations in

C. elegans. Cell 92, 785-795.

Streuli, C. H., N. Bailey, M. J. Bissell (1991). Control of mammary epithelial differentiation: basement

membrane induces tissue-specific gene expression in the absence of cell-cell interaction and

morphological polarity. J. Cell Biol. 115, 1383-1395.

Streuli, C. H., C. Schmidhauser, N. Bailey, P. Yurchenco, A. P. Skubitz, C. Roskelley, M. J. Bissell (1995a).

Laminin mediates tissue-specific gene expression in mammary epithelia. J. Cell Biol. 129, 591-603.

Streuli, C. H., G. M. Edwards, M. Delcommenne, C. B. Whitelaw, T. G. Burdon, C. Schindler, C. J. Watson

(1995b). Stat5 as a target for regulation by extracellular matrix. J. Biol. Chem. 270, 21639-21644.

Strutt, D. I., U. Weber, M. Mlodzik (1997). The role of RhoA in tissue polarity and Frizzled signalling. Nature

387, 292-295.

Sun, X. J., P. Rothenberg, C. R. Kahn, J. M. Backer, E. Araki, P. A. Wilden, D. A. Cahill, B. J. Goldstein, M. F.

White (1991). Structure of the insulin receptor substrate IRS-1 defines a unique signal transduction

protein. Nature 352, 73-77.

Sun, X. J., L. M. Wang, Y. Zhang, L. Yenush, M. G. Myers, E. Glasheen, W. S. Lane, J. H. Pierce, M. F. White

(1995). Role of IRS-2 in insulin and cytokine signalling. Nature 377, 173-177.

Sweeney, C. and K. L. Carraway (2000). Ligand discrimination by ErbB receptors: differential signaling through

differential phosphorylation site usage. Oncogene 19, 5568-5573.

Tamemoto, H., T. Kadowaki, K. Tobe, T. Yagi, H. Sakura, T. Hayakawa, Y. Terauchi, K. Ueki, Y. Kaburagi, S.

Satoh, a. et (1994). Insulin resistance and growth retardation in mice lacking insulin receptor substrate-1.

Nature 372, 182-186.

Tarakhovsky, A., M. Turner, S. Schaal, P. J. Mee, L. P. Duddy, K. Rajewsky, V. L. Tybulewicz (1995).

Defective antigen receptor-mediated proliferation of B and T cells in the absence of Vav. Nature 374,

467-470.

90

Tedford, K., L. Nitschke, I. Girkontaite, A. Charlesworth, G. Chan, V. Sakk, M. Barbacid, K. D. Fischer (2001).

Compensation between Vav-1 and Vav-2 in B cell development and antigen receptor signaling. Nature

Immunol. 2, 548-555.

Threadgill, D. W., A. A. Dlugosz, L. A. Hansen, T. Tennenbaum, U. Lichti, D. Yee, C. LaMantia, T. Mourton,

K. Herrup, R. C. Harris, a. et (1995). Targeted disruption of mouse EGF receptor: effect of genetic

background on mutant phenotype. Science 269, 230-234.

Timpl, R. (1996). Macromolecular organization of basement membranes. Curr. Opin. Cell Biol. 8, 618-624.

Tonner, E., M. C. Barber, M. T. Travers, A. Logan, D. J. Flint (1997). Hormonal control of insulin-like growth

factor-binding protein-5 production in the involuting mammary gland of the rat. Endocrinology 138,

5101-5107.

Tzahar, E., G. Levkowitz, D. Karunagaran, L. Yi, E. Peles, S. Lavi, D. Chang, N. Liu, A. Yayon, D. Wen, a. et

(1994). ErbB-3 and ErbB-4 function as the respective low and high affinity receptors of all Neu

differentiation factor/heregulin isoforms. J. Biol. Chem. 269, 25226-25233.

Tzahar, E., H. Waterman, X. Chen, G. Levkowitz, D. Karunagaran, S. Lavi, B. J. Ratzkin, Y. Yarden (1996). A

hierarchical network of interreceptor interactions determines signal transduction by Neu differentiation

factor/neuregulin and epidermal growth factor. Mol. Cell Biol. 16, 5276-5287.

Tzahar, E., R. Pinkas-Kramarski, J. D. Moyer, L. N. Klapper, I. Alroy, G. Levkowitz, M. Shelly, S. Henis, M.

Eisenstein, B. J. Ratzkin, M. Sela, G. C. Andrews, Y. Yarden (1997). Bivalence of EGF-like ligands

drives the ErbB signaling network. EMBO J. 16, 4938-4950.

Van Aelst, L. and C. D'Souza-Schorey (1997). Rho GTPases and signaling networks. Genes Dev. 11, 2295-2322.

van Genderen, C., R. M. Okamura, I. Farinas, R. G. Quo, T. G. Parslow, L. Bruhn, R. Grosschedl (1994).

Development of several organs that require inductive epithelial-mesenchymal interactions is impaired in

LEF-1-deficient mice. Genes Dev. 8, 2691-2703.

Vonderhaar, B. K. (1987). Local effects of EGF, alpha-TGF, and EGF-like growth factors on lobuloalveolar

development of the mouse mammary gland in vivo. J. Cell Physiol 132, 581-584.

91

Webster, M. A., R. D. Cardiff, W. J. Muller (1995). Induction of mammary epithelial hyperplasias and mammary

tumors in transgenic mice expressing a murine mammary tumor virus/activated c-src fusion gene. Proc.

Natl. Acad. Sci. U. S. A 92, 7849-7853.

Weidner, K. M., S. Di Cesare, M. Sachs, V. Brinkmann, J. Behrens, W. Birchmeier (1996). Interaction between

Gab1 and the c-Met receptor tyrosine kinase is responsible for epithelial morphogenesis. Nature 384, 173-

176.

Wen, D., E. Peles, R. Cupples, S. V. Suggs, S. S. Bacus, Y. Luo, G. Trail, S. Hu, S. M. Silbiger, R. Ben-Levi, R.

A. Koski, H. S. Lu, Y. Yarden (1992). Neu differentiation factor: a transmembrane protein containing an

EGF domain and an immunoglobulin homology unit. Cell 69, 559-572.

Wiesen, J. F., P. Young, Z. Werb, G. R. Cunha (1999). Signaling through the stromal epidermal growth factor

receptor is necessary for mammary ductal development. Development 126, 335-344.

Withers, D. J., J. S. Gutierrez, H. Towery, D. J. Burks, J. M. Ren, S. Previs, Y. Zhang, D. Bernal, S. Pons, G. I.

Shulman, S. Bonner-Weir, M. F. White (1998). Disruption of IRS-2 causes type 2 diabetes in mice.

Nature 391, 900-904.

Woldeyesus, M. T., S. Britsch, D. Riethmacher, L. Xu, E. Sonnenberg-Riethmacher, F. Abou-Rebyeh, R.

Harvey, P. Caroni, C. Birchmeier (1999). Peripheral nervous system defects in erbB2 mutants following

genetic rescue of heart development. Genes Dev. 13, 2538-2548.

Wysolmerski, J. J., W. M. Philbrick, M. E. Dunbar, B. Lanske, H. Kronenberg, A. E. Broadus (1998). Rescue of

the parathyroid hormone-related protein knockout mouse demonstrates that parathyroid hormone-related

protein is essential for mammary gland development. Development 125, 1285-1294.

Xie, W., A. J. Paterson, E. Chin, L. M. Nabell, J. E. Kudlow (1997). Targeted expression of a dominant negative

epidermal growth factor receptor in the mammary gland of transgenic mice inhibits pubertal mammary

duct development. Mol. Endocrinol. 11, 1766-1781.

Yamauchi, T., K. Tobe, H. Tamemoto, K. Ueki, Y. Kaburagi, R. Yamamoto-Honda, Y. Takahashi, F.

Yoshizawa, S. Aizawa, Y. Akanuma, N. Sonenberg, Y. Yazaki, T. Kadowaki (1996). Insulin signalling

and insulin actions in the muscles and livers of insulin-resistant, insulin receptor substrate 1-deficient

mice. Mol. Cell Biol. 16, 3074-3084.

92

Yang, Y., E. Spitzer, D. Meyer, M. Sachs, C. Niemann, G. Hartmann, K. M. Weidner, C. Birchmeier, W.

Birchmeier (1995). Sequential requirement of hepatocyte growth factor and neuregulin in the

morphogenesis and differentiation of the mammary gland. J. Cell Biol. 131, 215-226.

Yenush, L., R. Fernandez, M. G. Myers, T. C. Grammer, X. J. Sun, J. Blenis, J. H. Pierce, J. Schlessinger, M. F.

White (1996). The Drosophila insulin receptor activates multiple signaling pathways but requires insulin

receptor substrate proteins for DNA synthesis. Mol. Cell Biol. 16, 2509-2517.

Zhang, D., M. X. Sliwkowski, M. Mark, G. Frantz, R. Akita, Y. Sun, K. Hillan, C. Crowley, J. Brush, P. J.

Godowski (1997). Neuregulin-3 (NRG3): a novel neural tissue-enriched protein that binds and activates

ErbB4. Proc. Natl. Acad. Sci. U. S. A 94, 9562-9567.

Zhang, R., F. W. Alt, L. Davidson, S. H. Orkin, W. Swat (1995). Defective signalling through the T- and B-cell

antigen receptors in lymphoid cells lacking the vav proto-oncogene. Nature 374, 470-473.

Zheng, Y., D. J. Fischer, M. F. Santos, G. Tigyi, N. G. Pasteris, J. L. Gorski, Y. Xu (1996). The faciogenital

dysplasia gene product FGD1 functions as a Cdc42Hs-specific guanine-nucleotide exchange factor. J.

Biol. Chem. 271, 33169-33172.

Zrihan-Licht, S., B. Deng, Y. Yarden, G. McShan, I. Keydar, H. Avraham (1998). Csk homologous kinase, a

novel signaling molecule, directly associates with the activated ErbB-2 receptor in breast cancer cells and

inhibits their proliferation. J. Biol. Chem. 273, 4065-4072.

93

ABBREVIATIONS

ATP adenosine 5' triphosphate

cDNA complementary DNA

C-terminus carboxyl terminus

DMEM Dulbecco's modified Eagle medium

DMSO dimethyl sulfoxide

DNA deoxyribonucleic acid

E day of embryonic development

ECM extracellular matrix

EDTA ethylendiaminotetraacetic acid

EGF epidermal growth factor

EHS Engelbreth-Holm-Swarm murine tumor

FCS fetal calf serum

FGF fibroblast growth factor

GDP guanosine 5' diphosphate

GTP guanosine 5' triphosphate

HA hemagglutinin epitope

HEPES N-(2-hydroxyethyl)piperazine-N'-(2-ethanesulfonic acid)

HGF/SF hepatocyte growth factor/scatter factor

IgG Immunoglobulin Class G

JNK/SAPK c-Jun N-terminal kinase/stress-activated protein kinase

kDa kiloDalton

LB Luria-Bertani medium

M mol/l

MAPK mitogen-activated protein kinase

Matrigel reconstituted basement membrane from EHS

mRNA messenger RNA

94

NGF nerve growth factor

NP-40 Nonidet P-40

NRG neuregulin

OD optical density

PAGE polyacrylamide gel electrophoresis

PBS phosphate buffered saline

PCR polymerase chain reaction

PDGF platelet-derived growth factor

PEG polyethylene glycol

PLCγ1 phospholipase C gamma1

PMSF phenylmethylsulfonylfluoride

Y tyrosine residue

RNA ribonucleic acid

SDS sodium dodecylsulphate

TE tris-EDTA solution

TGF transforming growth factor

Tpr Translocated promoter region

Tris tris(hydroxymethyl)-aminomethane hydrochloride

x-Gal 5-chlor-4-brom-3-indolyl-β-galactoside

YPD yeast extract/peptone/dextrose

95

ERKLÄRUNG

Hiermit erkläre ich, dass ich die vorliegende Dissertation selbständig und nur unter

Verwendung der angegebenen Hilfsmittel erarbeitet und verfasst habe. Diese Arbeit wurde

keiner anderen Prüfungsbehörde vorgelegt.

Berlin, 5. Juli 2001.

Silvana Di cesare

96

CURRICULUM VITAE

Name Di Cesare, Silvana Patricia

Date of birth 23. September 1963

Place of birth La Plata, Argentina

Education

1968-1975 Primary school

Colegio Corazon Eucaristico de Jesus, La Plata

1976-1980 Secondary school

Colegio Corazon Eucaristico de Jesus, La Plata

1981-1989 Studies and Graduation in Biochemistry

Facultad de Ciencias Exactas, Universidad Nacional de La Plata

1992-1995 Dissertation in Human Biology: Studies of the immunoneuroendocrine

interactions in an animal model of systemic lupus erythemathosus.

Supervisor: Prof. Dr. Hugo Besedovsky

Philipps-Universität, Marburg

since 1996 Graduate student. Supervisor: Prof. Dr. Walter Birchmeier

Max-Delbrück-Centrum für Molekulare Medizin, Berlin

97

PUBLICATIONS

Weidner, K. M., S. Di Cesare, M. Sachs, V. Brinkmann, J. Behrens, W. Birchmeier (1996).

Interaction between Gab1 and the c-Met receptor tyrosine kinase is responsible for epithelial

morphogenesis. Nature 384, 173-176.

Birchmeier, W., V. Brinkmann, C. Niemann, S. Meiners, S. Di Cesare, H. Naundorf, M.

Sachs (1997). Role of HGF/SF and c-Met in morphogenesis and metastasis of epithelial cells.

In Plasminogen-related growth factors (eds. G. R. Bock and J. A. Goode). John Wiley and

Sons Ltd, West Sussex, England.

Di Cesare S., K. M. Weidner, M. Sachs, V. Brinkmann, W. Birchmeier (1996). Gab1

functionally interacts with c-Met to mediate branching morphogenesis. In Mol. Biol. Cell

(ASCB Abstracts, Supplement to Vol. 7).

Grimm, J., M. Sachs, S. Britsch, S. Di Cesare, T. Schwarz-Romond, K. Alitalo, W.

Birchmeier (2001). Novel p62dok family members, dok-4 and dok-5, are substrates of the c-

Ret receptor tyrosine kinase and mediate neuronal differentiation. J. Cell Biol. 154(2), 345-

354.

Di Cesare S., J. Huelsken, B. Erdmann, M. Sachs, J. Grimm, W. Birchmeier (2001). The

guanine nucleotide exchange factor Vav2 induces alveolar morphogenesis of mammary gland

epithelial cells. (Manuscript in preparation).