6. Genetic Transformation Studies using Theobroma cacao...

66.. GGeenneettiicc TTrraannssffoorrmmaattiioonn SSttuuddiieess uussiinngg TThheeoobbrroommaa ccaaccaaoo CChhiittiinnaassee GGeennee

6.1 INTRODUCTION

Castor is one of the most important non – edible oil seed crop which is

widely used in agriculture, textile chemicals, paper, plastics and rubber,

perfumeries, cosmetics, electronics and telecommunication industry,

pharmaceuticals, paint industry, lubricants, folk medicine, etc. (Atsmon 1989;

Vignolo and Naughton, 1991). Recently, its potential as a biofuel crop has been

realized (www.castoroil.in). The major drawback for the production of the crop

is due to the attack of biotic stresses and the presence of the protein ricin (Auld

et al., 2001). Various biotic stresses are there for the lack of production of castor

such as insect pests, bacterial diseases and fungal diseases. Among the biotic

stresses, fungal deisease - Fusarial wilt caused by Fusarium oxysporum was of a

serious concern. The average productivity of castor is affected due to a number

of biotic stresses (Sailaja et al., 2008). Agricultural practices such as fungicide

application and crop rotation are commonly used to fight this soil borne

diseases, but their effectiveness is limited. A realistic long-term solution to

manage the disease is by breeding fungus resistant cultivars. Nevertheless,

effective resistance genes are not always available in domestic cultivars, and

resistance is rapidly overcome by new races of the pathogen. In addition,

conventional breeding strategies are extremely time-consuming. The

application of biotechnological method for gene transfer provides a powerful

tool to improve the fungal disease resistance in castor.

Plant breeders and genetic engineers share the common goal of plant

improvement. While plant breeders traditionally use selective breeding for

varietals enhancement, genetic engineers continue to develop techniques for

the isolation and insertion of genes for desirable traits. Genes which are

unavailable to a particular plant species due to sexual incompatibility may be

Genetic Transformation Studies using Theobroma cacao Chitinase Gene

85

obtained from other organisms and transferred into plants (Perani et al., 1986).

Through gene transfer programmes herbicide tolerance, insect tolerance and

fungal pathogens tolerance in the higher plant were successfully achieved. By

using modern biotechnology, plants able to survive a continuous onslaught by

pathogens (bacteria, fungi, and viruses) and pests (insects, nematodes, etc.).

Plants deploy an assortment of defensive responses soon after infection or

exposure to abiotic stress. These responses involve activation of host defence

genes that were either inactive or expressed at basal levels previously. The

major defence response involves the biosynthesis and accumulation of

pathogenesis-related proteins (PR proteins). Both plants and pathogens possess

certain sets of resistance and avirulence genes that determine the outcome of

the plant–pathogen interaction in what is known as the gene for gene

hypothesis. The induction of PR proteins has been often interpreted as an

attempt by the plant to prevent or limit the spread of the pathogen (Karabi

et al., 1999).

Chitinases are ubiquitous enzymes of bacteria, fungi, animals, and

plants. They hydrolyze the β-1,4-linkage between N-acetylglucosamine

residues of chitin, a structural polysaccharide of the cell wall of many fungi and

of the exoskeleton of invertebrates and results in the production of fungal

elicitors that induce defence responses in plants (Schlumbaum et al., 1986; Leah

et al., 1991; Collinge et al., 1993; Neuhaus, 1999; Velazhahan et al., 2000; Dennis

et al., 2007). Several of these enzymes inhibit fungal growth in vitro, and

expression of their respective genes in transgenic plant can increase protection

against phytopathogenic fungi (Zhu et al., 1994; Lin et al., 1995; Masoud et al.,

1996; Kim et al., 2003). The studies on genetic engineering of plants with

chitinase gene become essential for fungal disease control mechanism. Several

review and research articles have also stressed the advantages of using

chitinase for plant protection because these enzymes are fungicidal, part of the

plant defence system and are not harmful to host or other plants (Collinge et

al., 1993; Moravcikova et al., 2004). Hence, in the last decade efforts have been


86

focused on the transgenic expression of chitinase in plants, and significant

importance in the resistance to fungal diseases have been recorded (Asao et al.,

1997; Lorito et al., 1998; Yamamoto et al., 2000; Kim et al., 2003; Kishimoto et al.,

2004; Dennis et al., 2007). Based on the reports, it is observed that the chitinase

gene plays a vital role to control the plant fungal pathogens. In particular, the

class I chitinases, which accumulate to high levels in vacuoles in response to

wounding and pathogen infection, have been reported to be important in these

regards (Maximova et al., 2003). Using transgenic approaches, chitinase genes

from plants and microorganisms have been introduced into different plant

species in order to enhance resistance against a broad range of fungal

pathogens (Kramer and Muthukrishnan, 1997, 2005; Kramer et al., 1993,

Kramer et al., 1997, Kramer and Koga, 1986).

Agrobacterium - mediated transformation via meristem based culture

has been the most common method for transgenic castor development.

Meristem based transformation was already done by Sujatha and Sailaja

(2005). Meristem explants have been successfully transformed in several crops

(Bilang et al., 1993; Saeed et al., 1997; Sticklen and Oraby, 2005). Hence, in this

present investigation we planned to produce the castor plantlets with Cacao

Class I Chitinase gene (Chi I) through Agrobacterium - mediated

transformation protocol by using cotyledonary node culture technique.

6.2 MATERIALS AND METHODS

6.2.1 Source of Chitinase gene

The Class I Chitinase gene was cloned into Amphicillin resistance vector

pGH00.0126. The lyophilized plasmid was gifted by Dr. Sharon Pishak and

Dr. Mark Guiltinan, Department of Horticulture, College of Agricultural

Sciences, The Pennsylvania State University, USA.


87

6.2.2 Confirmation of pGH00.0126 carrying T. cacao class I chitinase gene

For the confirmation of the Chitinase gene, the plasmid was

retransformed into E.coli (DH5α) competent cells and plated into Luria Broth

medium with 100 mg/l Amphicillin. The plate was kept in overnight at 37°C

incubator. The single colony was taken and patched into new plate containing

Amphicillin (100 mg/l). A loop of colony was taken from patched plate and

inoculated into 5 ml of LB medium with antibiotic and kept in 37°C at 220 rpm.

The plasmid was isolated from 10 - 12 hours grown culture using alkaline lysis

method and the plasmid was checked by using 0.8% 1X TAE Agarose gel

analysis. Based on the restriction map (Plate 10) the restriction digestion

analysis was done with SmaI, NotI and XbaI.

Restriction setup

Total reaction volume: 30.0µl

DDH20 - 23.0µl

Plasmid - 3.0µl (1.0ug)

10X Buffer - 3.0µl

(10U/µl ) Enzyme - 1.0µl

The restriction was kept at 37°C for NotI, XbaI and 30°C for SmaI in water

bath for 4 hrs and then, the restricted sample was checked with 0.8% 1X TAE

agarose gel.

6.2.3 Cloning of chitinase gene into Binary vector pBinAR

Restriction digestion for chitinase plasmid and pBinAR binary plasmid

with SmaI

Total reaction volume: 50µl

DDH20 – 31.0µl

Plasmid - 4.0µl (2.0ug)


88

10X Tango yellow Buffer – 4.0µl

(10U/ µl ) SmaI – 1.0µl

The restriction was kept at 30oC in water bath for 2 hrs. For the

confirmation of restriction, 5µl of restricted sample was loaded in 0.8% gel

which gives the linear fragment of approximately 4.2 kb of pGH00.0126

chitinase plasmid and 12.5 kb pBinAR binary plasmid. The sample was purified

and finally eluted from the column using with Qiaquick PCR purification kit

(Qiagen, catalog no. 28104). The eluted plasmid was checked by 0.8% 1X TAE

agarose gel and kept for further restriction with XbaI. (Plate 11)

Restriction with XbaI


Plasmid – 44.0µl

10X Tango yellow Buffer – 5.0µl

XbaI – 1.0µl

The restriction was kept at 37 oC water bath for 2 hrs. After restriction

sample was loaded into 0.8% 1xTAE agarose gel. The completely runned gel

was stain with Ethidium bromide and visualized with low intensity UV

transilluminator and eluted gel at 1.2 kb of chitinase fragment and 12.5 kb

linear fragment of pBinAR binary plasmid using autoclaved blade and the gel

pieces was transferred into 2.0 ml eppendorf tube for purification using with

Qiaquick gel extraction kit (Qiagen, catalog no: 28704)

Finally the sample was eluted with 20.0µl of DDH2O and the

concentration of eluted fragments were analysed by 0.8% 1X TAE agarose gel,

loaded with 1.0µl of each vector and insert.


89

Ligation

The ligation for insert and vector was done using following 3:1 molar

ratio.

50ng of vector × size of the insert ×3 = ng of insert?

Size of the vector × 1

Ligation setup


DDH2O – 2.0µl

Vector (pBinAR) – 4.0µl (50ng)

Insert (Chitinase) – 2.0µl (15ng)

10X ligation buffer – 1.0µl

T4 DNA ligase – 1.0µl

The ligation sample was kept in 4oC (fridge) for 16 hrs.

6.2.4 Transformation of ligation product

6.2.4.1 E.coli competent cell preparation: Host-DH5α

DH5 alpha E.coli strain was streaked in LA + Nal 10mg/l plate and the

plate was kept at 37oC incubator for overnight. Single colony was taken and

raised in 5 ml LB culture with antibiotic and kept the culture in 37oC shaker for

overnight with 220 rpm. Next day morning, 1.0 ml of overnight culture was

taken added into 100 ml of LB without any antibiotic and the flask was kept at

37oC with 220 rpm until the O.D was reached at 0.6 - 1.0. The flask was kept in

ice for 30 min, and the culture was poured in pre-cooled 50 ml centrifuge tube

in aseptic condition and centrifuged at 5000 rpm for 5 min at 4oC. The

supernatant was discarded and the pellet was resuspended with pre-cooled

100mM CaCl2, and centrifuge was repeated again as mentioned earlier. The

centrifuge was repeated for two more times and finally the supernatant was

discarded and the pellet was dissolved with 1.2 ml of pre-cooled 100mM CaCl2

and 0.8 ml of 100% glycerol. Aliquot (100µl) the in 1.5 ml eppendorf tube (The


90

tube was kept in ice condition) and the cell was stored into -70oC freezer for

future use.

6.2.5 Transformation: Heat-shock method

10µl of ligation sample was added into 100µl of comp. Cells (cells

thawed before adding sample). The content was gently mixed and kept in ice

for 45 min. The sample was transferred into 42oC Water bath for 90 - 120

seconds, and immediately kept in ice for 10 min after that 1.0 ml of LB was

added and kept in 370C shaker with 220 rpm for 1hr. The 50 - 200µl of culture

was taken and plated into LA+ Kanamycin 50mg/l medium and the plates

were kept in 37oC incubator for overnight. Single colony was observed and that

colony was patched into new plate. For confirmation of clone, the plasmid was

isolated using alkaline lysis method and the clone was confirmed by restriction

digestion analysis (Plate 13) using different restriction enzymes.

Restriction volume: 30.0µl volume

DDH2O – 23.0µl

Plasmid – 3.0µl

10X buffer - 3.0µl

Enzyme – 1.0µl

The restriction sample was kept at 37oC in the Water bath for 4 hrs and

the restriction sample was checked with 0.8% gel (Plate 11, 12 & 13).

6.2.6 Mobilization of Binary plasmid into Agrobacterium strain LBA4404

using freeze-thaw method

Agro comp. cell preparation and Freeze- -Thaw method for mobilization

A. tumefaciens strain LBA4404 was streaked out on a YEB media

containing 10 mg/l Rifampicin and grown at 28°C incubator for 2 - 3 days.

One loop of inoculums was inoculated into 5 ml LB medium containing

10mg/l Rifampicin and grown overnight at 28°C at 220 rpm. The 0.5 ml of

overnight grown culture was reinoculated into 50 ml of LB medium without


91

any antibiotic for grown in an incubator-shaker at 28°C at 220 rpm to obtain

cell densities of 0.5 to 1.0 at OD600. The cultures were chilled on ice for 15 min

and the cells were then harvested by centrifugation at 5000 rpm for 5 min at

4°C. In aseptic condition the supernatant was discarded and the pellet was

resuspended with 2.0 to 5.0 ml of precooled 20mM CaCl2 and centrifuged at

5000 rpm for minutes. The centrifuge was repeated one more time. Finally the

pellet was resuspended with 1.0ml precooled 20mM CaCl2 and 0.5 ml of

glycerol (100%) and aliquots the 50µl cells into eppendorf tube (eppendorf in

ice box) and stored it in -70°C freezer for future use.

Competent cells were kept in ice for thawing and then add 500 to 1000

ng of plasmid into comp. cells in laminar condition, then mixed gently and

kept it in ice for 5.0 min. The eppendorf was put into liquid nitrogen for 2.0 –

4.0 min, then immediately transferred into 37°C water bath. The eppendorf

was kept in ice for 5.0 min and then 1.0 ml of LB was added and kept in 28°C

shaker for 4.0 – 6.0 hrs. The eppendorf containing mobilized plasmid was

centrifuged and the pellet was resuspended in 200 ml LB and plated into LA

agar plate with 50mg/l of kanamycin and 10mg/l of Rifampicin antibiotic. The

plate was kept in 28°C incubators for 2 - 4 days; observed the single colony and

restreaked into new LA agar plate with same antibiotics. Finally the

Agrobacterium harbouring the binary plasmid was confirmed through colony

PCR with nptII and gene specific primer (chitinase) (Plate 14).

(For competent cell preparation and transformation was done in only laminar

condition and all things should properly autoclaved)

6.2.7 Binary plasmid and Agrobacterium strain

The 13.7 kb pBinAR binary plasmid is a pBin19 derivative containing

expression cassette for constitutive expression of chimeric genes in plants

(Hofgen & Willmitzer, 1990) The T-DNA portion of pBinAR having nos-npt II

cassette in RB and 770bp EcoR I/Hind III fragment containing the CaMV 35S


92

promoter, a partial pUC18 polylinker and the OCS terminator in LB. A 1.2 kb

SmaI - XbaI fragment of T. cacao class I chitinase was insert out from pGH00.0126

vector and cloned into corresponding sites of binary vector pBinAR. The total

size of the pBinAR binary vector carrying class I chitinase is 13.7 kb. For

Agrobacterium mediated transformation in plants the binary plasmid having

class I chitinase were mobilized into A. tumefaciens strain LBA4404. The

mobilized Agrobacterium strain was confirmed and taken for gene

transformation studies in plants. (Plate 11 & 12)

6.2.8 Plant materials, transformation, selection and regeneration

For standardization of gene transfer studies Agrobacterium strain

LBA4404 harbouring the binary plasmid pBAL2 (hptII and nptII as a plant

selection marker and GUS as a reporter gene) were used. Further

transformation was done with Agrobacterium strain LBA4404 harbouring binary

plasmid pBinAR - Chitinase. Agrobacterium mediated gene transfer sequential

process as discussed earlier (see Chapter 5).

Cotyledonary node explants were excised from 10 days old in vivo

seedlings, surface sterilized and planted on the precultue medium for 4 days in

the culture room at 25 ± 2ºC, 16/ 8 h (light / dark) photoperiod. A total of one

fifty explants were inoculated. Agrobacterium strain LBA4404 harbouring

pBinAR - Chitinase culture were initiated by inoculating a loop of colony into 10

ml of YEB liquid medium containing 50mg/l Kanamycin and 10mg/l

Rifampicin at 28C for 24 h. The bacterial cultures (OD600 = 1.0) were pelleted at

5000 rpm, resuspended in 50 ml of mMS basal medium containing the

hormones for multiplication of shoots for co - cultivation. The explants were

co - cultivated on the Agrobacterium suspension along with acetosyringone 100

mg/l and incubated for two days in the culture room at 25 ± 2ºC, 16/ 8 h (light

/ dark) photoperiod. After 2 days of co - cultivation, the explants were

thoroughly washed with 250 mg/l of cefotaxime in sterile water for a period of

five minutes and incubated for ten days on the mMS medium containing


93

0.3 mg/l TDZ, 0.6 mg/l of PF – 68, 250 mg/l cefotaxime, and 50 mg/l

Kanamycin with 0.8% agar (selection I medium). After 10 days of culture, the

proliferated regions of the explants were excised and transferred to the MS

medium containing 0.3 mg/l TDZ, 0.6 mg/l PF – 68, 50 mg/l Kanamycin with

0.8% agar (Selection II medium), and were cultured for ten weeks. The

surviving green or creamy white regions were transferred to the regeneration

medium containing mMS + 0.3 mg/l TDZ, 0.6 mg/l PF – 68, 50 mg/l

Kanamycin with 0.8% agar (Selection III medium) for proliferation of shoots.

Regeneration of shoots was observed after 10 days; the regenerated shoots

were transferred to the mMS medium containing 0.6 mg/l PF 68 and 0.3 mg/l

Gibberellic acid (GA3) for shoot elongation. Elongated shoots were rooted on

the half - strength mMS medium containing 1.5 mg/l IBA, 0.6 mg/l AgNO3

and 0.8% agar. The rooted plants were initially transferred to sand, soil and

vermiculite mixture (1:1:1) in green house and were later established in field

(Plate 15).

6.2.9 Molecular confirmation of transformants

6.2.9.1 DNA isolation and quantification

The genomic DNA was isolated from transformed and untransformed

plant sample using CTAB method (Dolye and Dolye, 1990). The detailed

procedure is given in the materials and methods of chapter 5.

6.2.9.2 Polymerase chain reaction

Polymerase chain reaction (PCR) was performed to confirmation of

transgene in putative transgenic plants using npt II and gene specific primer chi

I. The primer sequences for npt II (F) 5’ – GCTTGGGTGGAGAGGGCTATT –

3’, (R) 5’ – AGAACTCGTCAAGAAGGCGA – 3’ to yield 750 bp PCR amplified

fragment, and for Chi I (F) 5’-GGAAAATGGTTGCCAGAGTCAGTGC–3’ (R)

5’– GCTACATTGAGTCCACCGAGGGTC – 3’ to yield a 1.0 kb PCR amplified

fragment. The final concentration of PCR components was prepared as 1X Taq

buffer with 1.5mM MgCl2, 200µM of each nucleotide, 0.4 µM of each primer,


94

1.0 units of Taq DNA polymerase and 100ng of template in 25.0 µl of total

reaction volume. The PCR sample was kept in Gene Amp thermal cycler

(Eppendorf, Germany). and set the cycling temperature as initial denaturation

at 94ºC for 5.0 min followed by 30 cycles of denaturation at 94ºC for 1.0 min;

annealing at 58ºC for 1.0 min; and extension at 72ºC for 1.0 min. The final

extension for 10 min at 72ºC and the reaction was hold at 4 ºC for short term

storage of the reaction (Plate 16).

6.2.9.3 Southern Hybridization

For southern hybridization 10.0 µg of genomic DNA was extracted from

transformed and untransformed plant sample and digested with HindIII then

electrophoresed on a 0.8 % agarose gel. DNA fragments were transferred to

nylon membrane (Hybond-N+, Boehrigher, Laval, Quebec, Canada) and

hybridized with a digoxigenin-labeled chi I fragment probe described by

Tingay et al. (1997) to detect the integration of chi I gene (Plate 16).

6.2.10 In vivo evaluation of antifungal activity of transgenic castor plants

against Fusarium oxysporum

The pure culture of Fusarium oxysporum was obtained from the National

Chemical Laboratory, Pune. A suspension of spore (2 x 105 spores / ml sterile

water) was prepared from potato Dextrose agar medium. Four weeks old well

acclimatized PCR positive plants maintained in the green house were sprayed

with this suspension. The pots were covered with polyethylene bag for 2 days

to create proper conditions for infection and to prevent the spore dispersal. The

control (non-transgenic) plants were also treated in the same manner (Ganesan

et al., 2006). The resistance of the T0 generation was monitored for several

weeks from the date when the plants were sprayed with the fungal spores.

Plants that appeared resistant as well as those that developed disease

symptoms were grown intermixed after 15 days following infection and

sprayed with spores for a second time. The observation continued for a month.


95

6.3 RESULTS AND DISCUSSION

6.3.1 Sensitivity of selection antibiotics

Based on the standardize regeneration protocol, the antibiotic sensitivity

assay was performed in control explants using Kanamycin antibiotic to

investigate the sensitivity of cotyledonary node of R.communis. In addition,

influence of kanamycin concentration (50 mg/l) on shoot induction frequency

was recorded. Several workers used kanamycin as a plant selection agents for

successful selection of putative transgenic plantlets (Plate 15).

6.3.2 Plant materials, transformation, selection and regeneration

Four day pre-cultured mature cotyledon explants were used for

pBinAR - Chitinase gene transfer study. During transformation, pre-culture of

explants, shoot multiplication and regeneration medium prior to co-cultivation

was considered as one of the essential process. Pre - culture of explants was

done for improving the induction of the vir genes activity (Stachel et al., 1985;

Fillatti et al., 1987; Veluthambi et al., 1989). This work was already discussed in

detail in chapter 5. The first round of screening for putative transgenic castor

kept in a short incubation on mMS medium supplemented with TDZ

(0.3 mg/l), PF - 68 (0.6 mg/l), cefotaxime (250 mg/l) and kanamycin (50 mg/l).

In further selection, shoot buds regeneration was observed in the culture

medium from the explants after ten days of culture (Plate 15). Then the shoots

were transferred to elongation and rooting medium having Plant growth

regulators with 50 mg/l kanamycin (Plate 15; Table 6.1). The well rooted plants

were established in pots and carryout molecular confirmation. In each

experiment, nearly 150 explants were used and the experiment was repeated

10 times (Table 6.2) along with controls. Out of 1403 explants, 437 kanamycin

resistance putative transformed plantlets were recovered and the

transformation efficiency of 1.06% was recorded (Table 6.3).

The efficiency and density of Agrobacterium culture were studied using

OD600 = 1.0 when the infection and time period for cocultivation of the explants.


96

The OD600 = 1.0 was found to be a compromise between cell vitality and

Chitinase expression. The same concentration has been often used in

transformation experiments of castor (Sujatha and Sailaja, 2005) and Sunflower

(Laparra, et al., 1995; Lucas et al., 2000; Mul ler et al., 2001) and other plant

species (Bond and Roaser, 1998).

6.3.3 Molecular confirmation of transformants

6.3.3.1 Polymerase chain reaction analysis

Polymerase chain reaction (PCR) analysis was performed to the presence

of npt II and chi I gene in the kanamycin resistance plants. The expected 750bp

and 1.0 kb amplified fragments corresponding to npt II and chi I gene was

observed (Plate 16), no amplification was detected in the DNA sample from

non-transformed plants. The amplified product of 750bp and 1.0kb was

confirmed the presence of the npt II and chitinase gene in the putative

transgenic plants compare to untransformed plant. No abnormal phenotypes

were observed during the growth of transgenic plants (Plate 16). In each

experiment 2 – 3 plants were obtained when analysing PCR with npt II and

chitinase primers. The transformation efficiency was 1.06% (Table 6.3). The

efficiency was calculated on the basis of PCR positive plants. The observation

indicated the presence of chi I gene in the transgenic plants (Plate 16). The PCR

confirmation was based on previous report on gene transformation in castor

(Sujatha and Sailaja 2005; Malathi et al., 2006) and the Cacao chitinase gene

transformation protocol done by Maximova et al. (2003) and (2006).

6.3.3.2 Southern blot analysis

The integration of transgene copy number and junction fragment

analysis were determined by genomic southern blots. Southern blots analysis

was done using 10µg of transformed and untransformed plant DNA sample

which was digested with HindIII along with E.coli binary plasmid as a positive

control and eletrophoresed on a 0.8% agarose gel then gel was transferred to a

nylon membrane (Hybond-N+, Boehringer, Lavel, Quebec, Canada). The 1.2 kb


97

chitinase gene was used as a probe labelled with digoxignin and hybridization

was performed as described by Maximova et al. (2006). Out of 15 plants

analysed, 4 plants carried the chi I gene, here chi I probe provide the evidence

for the presence of integrated T-DNA (Plate 16).

6.3.4 Bio-assay for disease resistance in transformed plantlets

Analysis for Fusarium wilt resistance

Plants evoke a series of general defence reaction, including the

production of phytoalexins and anitimicrobial proteins, upon sensing

invading microbes and microbial substances (Lawrence et al., 1996). The wilt

fungus colonizes the root surface and then hyphae penetrate the root cortex,

the endodermis and the xylem. Systemic invasion of the plant results when

successive generations of conidia are produced and then transported by the

xylem’s transpiration stream to the aerial parts of the plant (Garas et al.,

1986; Hill et al., 1999; Daayf, 1997). Binding et al. (1970) was the pioneer to

demonstrate the possibility of in vitro selection of callus cultures for

desirable traits. Many attempts have been made since then to apply such

selection schemes for crop improvement, including resistance to Fusarium

wilt (Arai and Takeuchi, 1993; Scala et al., 1998; Mosquera et al., 1999).

Plant chitinases have been shown to inhibit fungal growth in vitro by

degrading chitin polymers in fungal cell walls (Hüttermann and Cwielong,

1982; Nielsen et al., 1994; Susi, 1997; Susi et al., 1995; Toyoda et al., 1991;

Schlumbaum et al., 1986; Mauch et al., 1988; Sela-Buurlage et al., 1993;

Collinge et al., 1993; Schickler and Chet, 1997; Lorito et al., 1998). Hence, in the

last decade efforts have been focused on the transgenic expression of plant

fungal chitinases in plants, and significant improvements in the resistance to

fungal diseases have been recorded (Asao et al., 1997; Broglie et al., 1991; Lorito

et al., 1998; Tabei et al., 1998).


98

In the present investigation, 15 plantlets were selected for Fusarium

wilt testing. During disease resistance analysis, the survival percentage of

non-transformed plantlets was significantly affected by the inoculation of

Fusarium macrospores (2 x 105 spores/ml) during hardening (Table 6.4; Plate

15). Among the 15 transformed plants tested, 10 plants showed healthy

regeneration in fungal spore inoculated soil. These plants were finally

selected as Fusarium wilt tolerant plants (Table 6.4). In support of the above

results the vascular browning was completely absent in the transformed

plants compared to control plant (Plate 15). All the selected disease tolerant

plants showed equal regeneration potential when compared with controls.

In accordance with our results the transgenic Theobroma cacao plants over

expressed with Cacao Chitinase was reproducibly showed enhanced resistance

against the fungus Colletrotrichum gloeosporioides was reported by Maximova

et al. (2006).

6.4 CONCLUSION

This study is the first successful attempt to develop a stable

transformation system for castor via A. tumefaciens LBA4404 strain harbouring

pBinAR Cacao Chitinase mediated transfer using CN from 10th day in vivo

seedlings. Advances in regeneration and transformation protocols have led

to the successful development of transgenic castor with improved

agronomic characters. In our studies, we obtained the significant

improvement in the plant regeneration percentage of transformed plants

and recovery of transgenic plants resistant to Fusarium oxysporum.

Limitations associated with tissue culture protocol make the present protocol

more suitable for rapid development of transgenics in recalcitrant system-like

castor and the method will be useful for genetic engineering of castor for

various agronomical traits including fungal resistance.

Table 6.1

Effect of selection marker sensitivity on growth and multiple shoot induction with growth regulator of cotyledonary node explants

Kanamycin (mg/l)

Percentage of response

Mean number of shoot / explant

00 25 50 75

100 125 150

34.3 21.2 9.4 3.6 - - -

11.3 6.5 4.1 1.2 - - -

Table 6.2

Character gene transfer with Agrobacterium strain pBinAR Chi I and Kanamycin (Selection Marker) on their response on cotyledonary node explants

Experiments No. of explants

Infected (A)

No. of KanR

shoots (B)

Percentage of response (%)

(B/A)

No. of shoots PCR positive

(C)

Transformation efficeiency (%)

(C/A)

1 2 3 4 5 6 7 8 9

10

122 132 150 145 142 150 150 141 138 133

39 42 46 48 47 53 45 49 36 32

31.9 31.8 30.6 33.1 33.0 35.3 30.0 34.7 26.0 24.0

2 0 2 2 1 3 2 2 1 0

1.6 0.0 1.3 1.3 0.7 2.0 1.3 1.4 0.7 0.0

Table 6.3

Summary of character Agrobacterium strain with pBin AR Chi I and Kanamycin (Selection Marker) on their response on cotyledonary node explants

No. of explants Infected

(A)

No. of KanR

shoots (B)

Percentage of response

(B/A)

No. of shoots PCR positive

(C)

Transformationefficeiency

(C/A)

1403 437 31.1 15

1.06

Table 6.4

Survival rate of PCR positive plantlets and control plants on earthen pots inoculated with 2 × 105 spores/ml of Fusarium oxysporum.

Survival rate of regenerants No. of days after inoculation of

spores C C (i) PCR Positive

Plantlets

4 8

12 16 20 24 30

15 15 15 15 14 14 13

11 9 5 2 0 0 0

15 10 10 10 10 10 10

Plate 15 Genetic transformation of Ricinus communis L. using Chi I gene harboured in

pBinAR vector and bioassay with Fusarium oxysporum

a. Preculture of explants (1.0 x) b & c. Shoot bud initiation from cotyledonary node explants in selection media

(1.0 x) d. Shoot bud proliferation (1.0 x) e. Rooting of elongated shoots (1.0 x) f. Hardened plants g & h. Control plants affected by Fusarium (C) i & j. Transverse cut of Fusarium infected control stem and transformed stem k & l. Transformed healthy plants in earthern pots.

Plate 16

a. PCR analysis of putatively transformed plants using npt II

L – Ladder W - Water Control N – Untransformed plant DNA (negative control) L1 to L3 – Transformed plant DNA L4 – Empty well P – Plasmid DNA (positive control)

b. PCR analysis of putatively transformed plants using Chi I L – Ladder W - Water Control N – Untransformed plant DNA (negative control) L1 to L3 – Transformed plant DNA P – Plasmid DNA (positive control)

c. Southern hybridization of putatively transformed plants P – Plasmid DNA (positive control) L1 to L4 – Transformed plant DNA N – Untransformed plant DNA (negative control)

6. Genetic Transformation Studies using Theobroma cacao...

Documents

Transcript of 6. Genetic Transformation Studies using Theobroma cacao...